KR101937180B1 - Microbe Prototyping Genetic Circuit based Novel Microbe Screening System - Google Patents

Abstract

The present invention relates to a gene circuit comprising a gene encoding a transcriptional regulatory factor which is expressed by sensing phenol and a sub-reporter gene activated by the transcriptional regulatory factor, a sensor cell containing the gene circuit, And a method for detecting and searching for a new microorganism strain or a genetic resource that possesses the activity of a target enzyme directly in a natural sample using a tag substrate. Since the gene circuit of the present invention and the sensor cell containing the same together with the fluorescent protein as a reporter gene together with the enzyme involved in nutritional requirement for controlling the survival of the sensor cell, The microorganism strain of the present invention can be easily cultured to measure the fluorescence and thus a novel microorganism strain or gene source having the activity of the target enzyme can be easily identified. In addition, by introducing such a double reporter system, Can be visually confirmed more clearly. In addition, when exploring useful resources directly in nature, it is possible to maximize the expression possibility and experiment easiness of the target enzyme gene by restricting the use of antibiotics without going through the process of DNA separation and library construction, and by directly using natural highly active microorganisms, Can minimize GMO / LMO problems.

Description

Technical Field [0001] The present invention relates to a novel microbial resource search system based on a microbial prototyping gene circuit,

The present invention relates to a method for detecting a phenolic compound, which comprises using a substrate containing a " phenolic compound " which can be used for detecting intracellular enzyme activity, a gene encoding a transcriptional regulatory factor expressed by detecting a phenolic compound, A sensor cell including the gene circuit, and a new microorganism strain having the activity of the target enzyme using the sensor cell are co-cultured with the sensor cell to directly detect and search for the activity of the sensor cell .

Recently, research to apply directional molecular evolution to develop a new genetic resource from a microorganism or metagenome, or to develop a biocatalyst with a high usefulness by improving the activity of existing genes, It has become important strategy, and it is becoming necessary to develop a new high sensitivity detection technology that detects a very small amount of enzyme activity at a high speed.

In order to acquire a new enzyme gene from various genetic resources such as microbial genome and environmental DNA (metagenome), sequence-based search technique for acquiring an amplified gene by first performing PCR reaction by grasping a DNA sequence, screening. This method has an advantage of being able to utilize only the desired gene, but it can be used only when the exact information of the nucleotide sequence of the target gene is known, There is a disadvantage that the applicable target is limited to a part of the genetic circle.

In contrast, function-based screening, which selects genes based on enzyme activity, is also widely used. In order to detect enzyme activity by this method, a method of directly isolating microorganisms from environmental samples of soil, river, factory wastewater, seawater, forest and so on has been mainly used. However, microorganism species that can be cultivated in a laboratory are microorganisms Less than 1%, only a very small amount. Recently, strategies for constructing genetic resources in the form of a meta genome library have been actively attempted by isolating DNA directly from environmental samples without culturing microorganisms. There is thus a growing interest in the development of search techniques to directly detect industrially useful enzyme activities in the meta genome library.

High-speed analysis techniques for enzyme activity include (1) automated multi-analysis techniques using well-plates, (2) methods of observing color or halo in a solid medium, (3) And the selective separation method to be used are mainly used. These methods are based on the actual activity of the enzyme, and thus have the advantage of clearly screening the genes of the objective function, but they require a single detection technique in accordance with the activity of the individual enzymes, thus limiting the versatility of the technology. Furthermore, the effect is further reduced when there is a problem such as transcription, detoxification, and expression of a foreign gene in the host cell, protein folding, secretion, and the like. In fact, in the case of a novel enzyme derived from a genetic source having a high genetic diversity such as a new microorganism genome, a metagenome, or the like, the level of expression in the recombinant microorganism is very low and it is very difficult to apply this high-speed analysis method. Accordingly, there is a continuing need to develop a new high-speed search technology capable of detecting even a very small amount of enzyme activity with high sensitivity.

On the other hand, research on a technique for detecting a phenol compound is known (Korean Patent Registration No. 10-0464068), and studies for applying various phenol compounds to a search for various enzyme activities have been conducted Publication No. 10-2010-0131955), antibiotic use, DNA isolation, library construction, and the like, so that it is easy to detect a new microorganism strain having the activity of the target enzyme And how to navigate was not known.

Accordingly, the present inventors have developed a gene circuit comprising a transcription regulator whose expression is induced by phenol and a sub-reporter gene which is driven by the transcription regulator, and a sensor cell containing the gene circuit. Instead of isolating the DNA of the target microorganism in order to search for the target enzyme, the sensor cell and the environmental sample of the microorganism or the natural environment itself are simply cultured together with antibiotics to easily identify and isolate the microorganism resource having the enzyme The present invention has been completed.

Korean Patent Publication No. 10-0464068 Korean Patent Publication No. 10-2010-0131955

The present invention relates to a method for detecting a phenolic compound, which comprises using a substrate containing a " phenolic compound " which can be used for detecting intracellular enzyme activity, a gene encoding a transcriptional regulatory factor expressed by detecting a phenolic compound, A method for detecting and searching activity of a novel microorganism strain having an activity of a target enzyme using a sensor cell including the gene circuit and a substrate containing the sensor cell and the phenol compound And to provide the above objects.

In order to achieve the above object, the present invention provides a method for regulating gene expression, comprising the steps of: (i) regulating gene expression, a first promoter whose activity is regulated by the gene expression regulatory region and an activator of the first promoter, And a reporter gene comprising a gene encoding an enzyme involved in nutritional requirement (auxotrophic); And (ii) a gene encoding a transcription regulatory factor that is regulated by the second promoter and the second promoter and binds to the gene expression regulatory region only in the presence of the phenolic compound to activate the second promoter A gene construct for detecting the presence of a phenolic compound.

Further, the present invention provides a sensor cell comprising the gene circuit.

Further, the present invention provides a method for detecting and searching for a novel microorganism strain having the activity of a target enzyme by using a substrate containing the " phenol compound " do.

Hereinafter, the present invention will be described in detail.

The present invention

(I) a gene expression regulatory region, a first promoter whose activity is regulated by the gene expression regulatory region, and a gene whose expression is regulated by activation of the first promoter and which encodes a fluorescent protein and an enzyme involved in nutritional requirement A first gene construct comprising a reporter gene comprising a gene that encodes a first gene construct; And

(Ii) a gene encoding a transcription regulator whose expression is regulated by the second promoter and which binds to the gene expression regulatory region only in the presence of a phenolic compound to activate the second promoter A second genetic construct;

A gene circuit for detecting the presence of a phenolic compound is provided.

In this specification, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs, unless otherwise defined. In general, the nomenclature used herein and the experimental methods described below are well known and commonly used in the art.

The present invention relates to a microbe prototyping based genetic enzyme screening system (MP-GESS) for easily identifying and isolating new microorganism resources having a desired enzyme activity using a gene circuit.

In the present invention, " phenolic compound " is a substrate which can be used for the detection of intracellular enzyme activity, and includes phenol, 2-chlorophenol, 2-iodophenol, 2-fluorophenol, o- m-cresol, 2-nitrophenol, catechol, 2-methoxyphenol, 2-aminophenol, 2,3-dichlorophenol, 3- chlorophenol, 2,3-dimethylphenol, Phenol, p-cresol, 2,5-dichlorophenol, 2,5-dimethylphenol, and the like. A substrate containing such a " phenolic compound " is also referred to as a " phenol-tag substrate ".

In the present invention, the reporter gene and the first promoter controlling the expression of the reporter gene are operatively linked to each other.

In the present invention, the site where the transcriptional regulatory factor binds and induces the expression of the downstream reporter gene activates the first promoter of the reporter gene so that the transcriptional regulatory factor binds and the downstream reporter gene can be expressed .

In the present invention, a gene encoding a transcription regulatory factor that recognizes the phenolic compound and induces expression of a downstream reporter protein and a second promoter that regulates the expression of the transcription regulatory factor are operatively linked to each other .

In the present invention, the "transcriptional regulatory factor" is preferably a protein that regulates the expression of a degrading enzyme comprising a phenolic compound. By activating a promoter that regulates the expression of the phenolic cleavage enzyme by detecting phenol , And a protein that induces the expression of a reporter linked to such a promoter. Regarding the above-mentioned "transcriptional regulatory factors", genes showing decomposing activity of aromatic organic compounds such as phenol, xylene, toluene, and benzene are mainly found in the genus Pseudomonas and Acinetobacter. These genes are multifunctional Operon and is expressed by sigma ^54- dependent transcriptional regulation. DMPR, DmpR, XmlR, MopR, PhhR, PhlR and TbuT are known to be typical transcription regulators. Among them, DmpR involved in phenol degradation metabolism and XylR involved in toluene and xylene degradation metabolism in Pseudomonas putida It is well known. In particular, studies using DmpR or XylR to detect toluene, xylene, or phenol contaminated with natural environments have been studied extensively as microbial biosensors. This NtrC family expression regulator is a combination of a domain (A domain) that recognizes an activating factor such as phenol and xylene, a domain that has ATPase activity (C domain), and a domain that functions to bind DNA (D domain) . Thus, when the phenol molecule is absent, the A domain inhibits the transcription. However, when the phenol molecule binds and inhibits the A domain, transcription activation by the C and D domains appears. Recently, it has been known that the specificity of the A domain is improved through research and genetic engineering methods used for the detection of new substances using the specificity.

Therefore, the transcriptional regulator preferably used in the present invention may be dmpR, a control protein of the P. putida-derived phenol digesting operon, or a mutant thereof. dmpR is the σ ⁵⁴ -dependent transcriptional activity regulatory region of the dmp operon gene, which shows degradative activity of aromatic organic compounds such as phenol, xylene, toluene, and benzene. The dmp operon derived from P. putida consists of 15 genes, of which dmpKLMNOP codes for the enzymes necessary for phenol hydroxylation and dmpQBCDEFGHI codes for the enzymes of the meta-degradation pathway that break down the catechol intermediate. Expression of the dmpKLMNOP operon is activated by binding a sigma54-dependent transcriptional regulator, dmpR, to the dmp operator upstream of dmpK, and the transcription factor for dmpR itself is known as the sigma ⁷⁰ dependency. The variant of dmpR may be E135K in which the 135th E of the dmpR amino acid sequence is mutated to K, E172K, D135N, D135N and E172K, F65L, L184I, F42Y, R109C, L113V, D116N, F122L, K6E And at least one of F42S, Q10R and K117M, Q10R, D116G and K117R, D116V may be a mutant in which the amino acid residue is mutated, but the mutant is highly affinity to the phenol compound, Various variants including single or multiple mutations at the periphery, as well as variants of various dmpR can be included within the scope of the present invention.

In the present invention, " gene expression regulatory region " is a region regulating the entire gene circuit. When the phenol molecule binds and inhibits the A domain, transcriptional activation by the C and D domains appears. Thus, the transcriptional regulatory factor binds to OpR (Operator for Reporter) , Whose activity is regulated by a sigma ⁵⁴ dependence.

In the present invention, the term " promoter " means a promoter that regulates expression of a transcription regulatory factor or a promoter that regulates the expression of a reporter protein. For example, a promoter of dmpR or dmp operon of Pseudomonas or a promoter for expression of a general protein High expression promoters including trc, T7, lac and ara promoters can be used for high expression of foreign proteins, and Phce, which is a high expression vector that does not require an inducer, can be used. For example, as the promoter for regulating the expression of the reporter protein, a sigma ⁵⁴ -dependent promoter (PECO) of E. coli and the like can be used. In addition to this, it will be obvious to those skilled in the art to apply Pseudomonas putida (PPPU) and yeast (PYST) according to the host of MP-GESS.

In the present invention, the gene circuit may include not only the promoter but also RBS (Ribosome Binding Site) and / or transcription termination factor which facilitates the expression of the reporter protein. That is, as a site for regulating the expression of the regulatory protein, RBS and / or a transcription termination factor may be included in addition to the promoter.

In general, protein expression begins in AUG (methionine) or GUG (valine), which is the initiation codon in mRNA. The distinction between AUG and GUG, which are located in residues of ribosomes in proteins, and AUG and GUG, as protein initiation codons, (Or Shine-Dalgarno (SD) sequence) rich in RBS (or Shine-Dalgarno (SD) sequence). According to a preferred embodiment, a gene circuit built in the present invention and were using transcription factors in Pseudomonas, but different from many living form and a host E. coli of the gene circuit as σ ⁵⁴ for dependent gene expression, the Because the σ ⁵⁴ binding site or σ ⁵⁴ factor itself is very different from that of E. coli, RBS (RBSPPU) of Pseudomonas or RBS (RBSε) for E. coli, or all strains can be used to facilitate reporter protein expression in the host E. coli Possible RBS (RBSx) is available.

In the present invention, the transcription termination factor may preferably be rrnBT1T2 or tL3, and in addition, any transcription termination conventionally used in the art may be used to constitute the present invention.

In the present invention, the reporter protein is composed of a fluorescent protein and an enzyme involved in nutritional requirement. GFP, GFP _UV , or RFP can be preferably used as the fluorescent protein, but the fluorescent protein that can be used in the present invention is not limited to such examples as long as the object of the present invention can be achieved. In addition, the enzymes involved in the nutritional requirement are not able to grow in the medium due to the loss of the ability of the microorganism to synthesize any particular amino acid, nucleic acid base, vitamins and the like due to the mutation, The required auxotrophs represent enzymes that enable the depleted substances to be synthesized. Such mutations of nutritional requirement include, but are not limited to, a number of species including arginine urine, methionine urine, thymine urine, and the like. In addition, even if the same arginine urine composition is formed, arginine is produced only by arginine, arginine is replaced by citrulline instead of arginine, and arginine, citrulline and ornithine are produced in accordance with the inhibition step of the arginine biosynthesis pathway. . According to a preferred embodiment of the present invention, the enzymes involved in the nutritional requirement include DAAT (D-amino acid aminotransferase) enzymes that enable glutamic acid auxotrophic microorganisms to survive even in an environment deficient in glutamate, It is not.

According to a preferred embodiment of the present invention, the reporter may be a dual reporter consisting of both a fluorescent protein and enzymes involved in nutritional requirement, or a multiple reporter consisting of two or more reporters. According to the present invention, any of the methods known in the art can be used for sequential transformation of the metagenome library and the phenol sensing redesign gene circuit into a suitable microbial host. In order to increase the efficiency of transformation, electroporation can be preferably used.

Further, the present invention provides a sensor cell comprising the gene circuit.

In the present invention, the gene circuit may be provided in the form of a vector or a microorganism containing the vector.

In the present invention, the cell may preferably be any bacterium such as E. coli, fungi such as yeast, plant cell, animal cell, and the like, but is not limited thereto.

The E. coli may be an auxotrophic host cell, preferably a glutamate auxotrophic host cell, but is not limited thereto.

The present invention also provides a method for detecting and searching for a novel microorganism strain having the activity of a target enzyme using the sensor cell.

The method

(1) designing a phenol-tag substrate capable of generating a phenolic compound by the activity of an enzyme;

(2) a step of treating the natural microorganism strain or an environmental sample containing the enzyme with the phenol-tag substrate, which is expected to have an enzyme, with the sensor cell under an environment lacking a specific nutrient;

(3) identifying and sorting the reporter protein in the cultured sensor cells; And

(4) separating the microorganism strains adjacent to the selected sensor cells.

In step (2), a natural microorganism strain expected to have the target enzyme or an environmental sample containing the natural microorganism strain may be mixed with the phenol-tag substrate and the sensor cell and co-cultured together.

Or step (2) comprises culturing a natural microorganism or an environmental sample containing the target enzyme, which is expected to have the target enzyme, in an environment treated with the phenol-tag substrate to form a colony; And co-culturing the formed colonies and the sensor cells together. The sensor cell may be co-cultured by spraying a sensor cell culture liquid onto a colony formed from a natural microorganism or an environmental sample containing the same.

The sensor cells may be stored at low temperature and then thawed without any culturing process and used immediately.

In one embodiment of the present invention, when a sheet-like bacterial cell or TPL-producing Escherichia coli is cultured together with the substrate tyrosine and the sensor cell, the activity of the enzymes present in the sheet-by-sheet expression vector or TPL-expressing Escherichia coli It was confirmed that fluorescence appears in the sensor cells around the sheetrobacteria or the TPL-expressing Escherichia coli by the phenolic compound produced from tyrosine (Fig. 6C).

Likewise, in another embodiment of the present invention, when colonies are formed by culturing a sheet bacteriophage or TPL-producing E. coli on a medium containing tyrosine as a substrate, sensor cells are sprayed on the colonies and cultured, Fluorescence expressed by sensor cells was observed around Robulfrandie or TPL-producing E. coli (Fig. 6d).

In the present invention, the nutrient may be glutamic acid, but is not limited thereto.

According to one embodiment of the present invention, the phenol-tagged substrate is designed according to the activity of the target enzyme in the step (1). For example, a phenol-tagged substrate includes a binding site that can be cleaved by the activity of the target enzyme and a phenol attached through the binding site. As described above, by designing the phenol-tag substrate so as to be suitable for the activity of the target enzyme, that is, by designing the binding site or the type of the functional group according to the activity of the enzyme to be searched, In addition, it is possible to search for a microorganism having a target enzyme having various activities.

Further, in the step (2), the phenol-tag substrate is treated with a natural microorganism strain or an environmental sample containing the target enzyme, which is expected to have the target enzyme, And cultured with the cells. Since the DAAT gene is contained in the gene circuit introduced into the sensor cell, even if the sensor cell is placed in an environment where it is an auxotrophic strain and a nutritional deficiency, the DAAT gene is expressed in the introduced gene circuit If only a few can survive.

In step (3), the sensor cell in which the expression of the reporter protein is induced by the phenol compound produced by the activity of the target enzyme is identified and screened. If the target enzyme is present in the natural microorganism strain or the environmental sample containing the same, the phenol-based compound will be produced by the activity of the target enzyme when the phenol-tagged substrate designed as described above is treated, The compound will induce the expression of the reporter protein in the sensor cell in the vicinity of the natural microorganism strain or the environmental sample containing the same, so that the novel strain having the target enzyme can be searched by confirming the expression of the reporter protein as described above .

In addition, in step (4), the microorganism strains adjacent to the sensor cell in which the expression of the selected reporter protein is induced are isolated. The microorganism strain isolated as described above has a target enzyme. In addition, the isolated microorganism strain can be verified again for the activity of the target enzyme, and 16s rRNA analysis can be performed to confirm which microorganism strain corresponds to which microorganism strain.

In addition, to optimize the enzyme reaction, the timing of addition of the substrate may be adjusted so that the activation step of the cell growth-redesign gene circuit is separated. Compounds that can generate phenolic compounds by an enzymatic reaction, that is, phenol-tagged substrates, include esters (ester, -OOC-), ether (-OC-) in which a phenol hydroxyl group (hydroxy, , glycoside (glycoside, -O-Glc), phosphate esters (phospho-ester, -O-PO3 ), ortho-, meta-, para-position on the alkyl (-CH _3), hydroxyl (-OH), carboxylic acid (-COOH), amino (-NH _2), thiol (-SH), amides (amide, -NH-CO- or -CO-NH-), a sulfide (sulfide, -S-SH), halogen group (- Cl, -Br, -F), or a benzene ring compound, but the present invention is not limited thereto.

For example, as the phenol-tag substrate according to the present invention, various phenol derivatives linked by a covalent bond with a phenol group can be used. For example, an ester bond (ester, -OOC-), an ether bond (-OC-), a glycoside bond (glycoside, -O -Glucose and phospho-ester (-O-PO ₃ ) are used as a substrate, esterase, lipase, glycosidase, phosphatase, Can be used for the purpose of detecting phytase activity.

In addition, the phenol-tag substrate has a new methyl group (-CH ₃ ), a hydroxyl group (-OH), a carboxy group (-COOH), an amino group (-NH ₂ ), hydrogen sulfide (-SH). ≪ / RTI > When a substance having an amide bond (-NH-CO- or -CO-NH-) or a sulfide bond (-S-SH) at this position is used as a substrate, the phenol compound connected through the amide group is amidase, Can be used for the purpose of detecting peptidase activity and can be used for detecting the intracellular redox level by using a phenol compound linked through a sulfide group. It is also possible to detect phenol-lyase activity, which decomposes carbon bonds to generate phenol, when a phenolic compound, i.e., Ph-C- (R), in which a new carbon bond is linked to the phenol- . As the phenol-tag substrate, a benzene ring material may be used. In this case, oxidative enzyme activities such as monooxygenase and dioxygenase, which are involved in the oxidation of aromatic compounds, can be detected. Halogen-linked phenol compounds such as chlorine (Cl), bromine (Br), and fluorine (F) can also be used as substrates. In this case, the enzymatic activity which acts on the halogenated phenol compound to dehalogenate or change the position of the halogen can be detected according to the present invention.

The activity of the transferase that transfers covalent bonds to other organic molecules in the various phenolic compounds mentioned above or the activity of a new covalent linkage-forming ligase can also be detected by the present invention by the same principle. Thus, the various phenol-tagged substrates provided in the present invention can be used to identify specific hydrolases, oxido-reductases, isomerases, lyases, Transferase and the like can be detected. In the present invention, the substrate used for the detection of the intracellular enzyme activity is a phenol-tag substrate, and it shows various synthetic substrates including phenol, o / p-nitrophenol, o / p-chlorophenol and the like. When an enzyme suitable for such a phenol-tag substrate is present, the phenol material is produced from the original phenol-tag substrate. For example, when β-galactosidase (lacZ) of E. coli acts on phenyl-β-glucoside, a phenol component is produced according to enzyme activity.

According to one embodiment of the present invention, when an enzyme gene is introduced into a sensor cell containing a gene circuit for sensing a phenolic compound and a phenol-tag substrate is treated with a microorganism strain having the activity of the target enzyme, The concentration of the phenolic compound changes depending on the function and activity of the intracellular enzyme gene. Therefore, it is possible to identify a microorganism strain having an activity of a desired target enzyme easily through the degree of reactivity to fluorescence and nutritional requirement by the function of inducing expression of a phenol compound.

In addition, in the present invention, a fluorescent protein used as a reporter and an enzyme involved in nutritional requirement can not only be subjected to a high sensitivity measurement method but also are limited within specific cells without passing through the cell membrane, Thereby exerting the characteristics of foreign genes individually. Therefore, since individual single cells act as independent reaction vessels and analyzers, it is possible to measure the activity of the expression-induced reporters by detecting the phenolic compounds produced by the enzyme reaction, Samples can also be measured using fluorescence flow cytometry (FACS), microcolony fluorescence image analysis, fluorescence spectroscopy analysis, and mass screening using nutrient-selective media.

Since the gene circuit of the present invention and the sensor cell containing the same contain the enzyme involved in the nutritional requirement to control the survival of the sensor cell together with the fluorescent protein as the reporter gene, It is possible to easily identify a new microorganism strain having the activity of the target enzyme by a simple method of measuring the fluorescence of the colonies formed by culturing the microorganism resource or the environmental samples of the natural environment together and introducing such a double reporter system The presence or absence of the target enzyme can be visually confirmed more clearly. In addition, when searching useful resources directly in nature, searching for co-culturing with sensor cells without process such as DNA isolation, library construction and antibiotic use maximizes the expression potential of the target enzyme, facilitates experimentation, It is a useful technique to avoid GMO / LMO problems caused by recombinant microorganisms by directly using highly active microorganisms.

BRIEF DESCRIPTION OF THE DRAWINGS Fig. 1 is a schematic diagram showing the main constitution of the microorganism prototyping-based enzyme gene screening system (MP-GESS) of the present invention.
2 is a schematic diagram showing the operational aspects of the MP-GESS construct of the present invention.
FIG. 3 is a graph showing the growth and fluorescence of phenol from an auxotrophic host comprising the MP-GESS construct of the present invention.
4A shows a system in which a phenol compound inducing dmpR activation activates a GFP-encoding gene or an antibiotic resistance gene. Fig. 4A (B) shows that a target enzyme in a cell produces phenol from a substrate molecule, Indicates that DmpR is activated by phenol and expresses downstream GFP-encoding gene. 4B is a schematic representation of the introduction of the D-AAT coding gene at the N-terminus of EGFP and the transformation of this system with the D-glutamate auxotrophic host WM335. Figure 4B (B) Cell-cell communication-based screening system. Phenol molecules are used not only as enzyme activity markers but also as signal transmitters, and phenol activates transcription factors (dmpR) to induce the expression of D-AAT and GFP-encoding genes.
5 is a graph showing the degree of proliferation of a transformant when an antibiotic resistance gene or an auxotrophic gene is introduced into a phenotype reporter.
6A is a chemical reaction diagram showing the production of phenol, pyruvate and ammonia by the decomposition of L-tyrosine by TPL (tyrosine-phenol lyase) enzyme.
FIG. 6B shows two methods of detecting a microorganism having a target enzyme activity using the sensor cell of the present invention.
FIG. 6C shows the result of the activity verification of the sensor cell based on the one-step protocol.
FIG. 6D shows the result of the activity verification of the sensor cell based on the two-step protocol.
7a shows a chemical reaction formula showing the production of p-nitrophenol and cellobiose by decomposition of pNPG2 by a fibrinolytic enzyme, and Fig. 7b shows a process of searching for a microorganism having a fibrinolytic enzyme activity in a soil sample .
Figure 8 is a photograph showing fluorescence images of four colonies isolated from the soil from the metagenome sample.
FIG. 9 is a graph showing the fibrinolytic activity on various substrates of the seven candidate microorganisms selected.
10 shows the distribution of the ORF (open reading frame) function based on the new strain sequence through RAST site analysis.
Fig. 11 shows the results of sequence similarity analysis with other strains through comparison of the ORF sequences of whole new strains.
FIG. 12 is a graph comparing the function of Pseudomonas fluorescence Pf0-1 with the strain Pseudomonas fluorescence which was found to be the most similar strain through comparison with the new strain. (Left) function of the Pseudomonas fluorescens Pf0-1 strain only (right), and the top ten functions of the Pseudomonas fluorescens Pf0-1 strain only (right).
13 (A) and 13 (B) are photographs showing images of Pseudomonas sp. # 46-2 using a scanning electron microscope and a transmission electron microscope, respectively.
FIG. 14A shows the reaction of phenylphosphate to phenol and phosphate by phosphatase, FIG. 14B shows seven candidate microorganisms selected as the sensor cell, and FIG. Lt; RTI ID = 0.0 > dLB < / RTI > FIG. 14D shows the result of confirming the presence or absence of a sensor cell by PCR of the selected 10 colonies shown in FIGS. 14B and 14C.
FIG. 15A shows green fluorescence and bright field images of 36 colonies selected using a GFP filter-equipped microscope analysis after soil sample and sensor cells were cultured using the two-step protocol of Example 8, and 15b represents 36 And the specific enzyme activities of the candidate colonies were measured using their crude extracts.

Hereinafter, the present invention will be described in detail with reference to Examples and Experimental Examples.

However, the following examples and experimental examples are provided only for illustrating the present invention, and the content of the present invention is not limited by the following examples and experimental examples.

Microbial prototyping based enzyme gene screening system (MP-GESS)

In order to develop an antibiotic-independent new bio-part search technique, a DESS-DMPR transcription regulator of Pseudomonas putida- derived phenol-degrading operon, or a DESS-DMPR variant, was added to the GESS gene construct with a D-amino acid aminotransferase (D- amino acid-aminotransferase (DAAT) gene. The DAAT gene is expressed in the presence of phenol. In addition, glutamate auxotrophic Escherichia coli (WM335) was used as a host cell of the MP-GESS construct. A schematic diagram of the MP-GESS is shown in FIG. 1, and the components and components of the MP-GESS are shown in Table 1 below.

Component designation characteristic Transcription regulator dmpR or dmpR variant Derived from Pseudomonas / phenol compounds detection Reporter protein DAAT, EGFP Host cell survival including MP-GESS, fluorescence expression Control region Electron-regulating factor binding site Transcription factor binding / reporter expression activation Promoter 1 Transcription factor for expression promoter (P _X) Expression of transcription factors Promoter 2 The reporter protein expression promoter (P _R ) Reporter protein expression Ribosome binding site RBS Promoting reporter protein expression Transcription termination factor rrnBT1T2, tL3 (t) End of warrior Decomposition tag ssrA DAAT half-life adjustment

The operation of the MP-GESS construct is shown in FIG. Specifically, the MP-GESS construct was introduced into the glutamate auxotrophic Escherichia coli to prepare sensor cells. When the sensor cell is cultured in a glutamic acid-free medium, it is killed. If a phenol-decomposable substrate is added while culturing with a strain capable of producing phenol, the phenol produced by the phenol-producing strain causes MP- Since the DAAT gene of the tumor is expressed and the sensor cell is alive and the EGFP is expressed and the fluorescence is displayed, it becomes possible to search for a strain producing phenol according to the existence of the sensor cell.

<1-1> Production of MP-GESS Construct

The MP-GESS construct contains the N-terminal top of pGESSv4 (ACS Synthetic Biology (2014) 3 (3): 163-167) or pGESS (E135K) (ACS Synthetic Biology (2014) The DAAT gene can be inserted into the cell. In the present invention, a fragment of 6,185 bp was amplified by PCR using pGESSv4 as a template and the sequences of SEQ ID NO: 1 and SEQ ID NO: 2 shown below.

The DAAT gene was obtained by the following procedure. A PCR product of about 800 bp was amplified using the DNA of Bacillus subtilis 168 (microorganism resource center, Korean Collection for Type Cultures) as a template and the sequence of SEQ ID NO: 3 and SEQ ID NO: 4 PCR was carried out once more using the 800 bp PCR product as a template and the sequence of SEQ ID NO: 5 and SEQ ID NO: 6 having the homology with the vector pGESSv4 to obtain a final PCR product of 852 bp in length. In particular, the sequence of SEQ ID NO: 6 contains the ssrA tag (underlined) which controls the lifetime of the DAAT. The ssrA tag is a type of destruction tag that can control the half-life of the protein when inserted at the C-terminus of the protein, and can control the half-life of the fluorescent protein in E. coli or Pseudomonas. In the present invention, the non-specific response of MP-GESS was reduced by controlling the half-life of DAAT by using the AANDENYALAA amino acid sequence (SEQ ID NO: 7) (ssrA tag; amino acid sequence corresponding to the underlined sequence of SEQ ID NO: 6).

SEQ ID NO: 1: 5'-atgtatatctccttctccaggttggcggat

SEQ ID NO: 2: 5'-aaggagatatacatatggtgagcaagggcg

SEQ ID NO: 3: 5'-atgttggaacaaccaataggagtcattgattc

SEQ ID NO: 4: 5'-tcttttaatcggttcttgcagtgagatacatt

SEQ ID NO: 5: 5'-atccgccaacctggagaaggagatatacatatgttggaacaaccaataggag

SEQ ID NO: 6: 5'-cgcccttgctcaccatatgtatatctccttcta agctgctaaagcgtagttttcg tcgtttgctgctcttttaatcggtt

The pGESSv4 vector and the DAAT gene, amplified and secured in the above, were cloned into the Gibson assembly method (Gibson Assembly Master Mix, NEB, UK) to complete the MP-GESS construct.

<1-2> Validation of MP-GESS activity

The MP-GESS plasmid was transformed into Escherichia coli WM335 to verify the activity of the MP-GESS construct constructed in Example <1-1> above. Escherichia coli WM335 strain is a glutamate auxotrophic strain and does not grow unless additional growth medium is added with glutamic acid (Biosci Biotechnol Biochem. 1998 Jan; 62 (1): 193-5). A single colony of Escherichia coli WM335 strain containing the MP-GESS construct was added to LB liquid medium at a concentration of 0.1 mg / ml of D-glutamic acid and incubated at 37 DEG C for 24 hours with shaking. The seeds were washed once with M9 liquid medium and then re-suspended in M9 liquid medium ((6.78 g of Na ₂ HPO ₄ .7H ₂ O, ₃ g of KH ₂ PO ₄ , 0.5 g of NaCl, 1 g of NH ₄ Cl, 2 mM MgSO ₄ , 0.1 mM CaCl ₂ , 0.4% (w / v) Glucose, and 0.01% (w / v) thiamine were added).

As a result, the glutamate auxotrophic host cell into which the MP-GESS construct was introduced did not grow in the absence of glutamic acid, but fluorescence was expressed while growing only when the DAAT gene was expressed by phenol (FIG. 3). From the above results, it can be seen that the glutamate auxotrophic host cell, that is, the sensor cell, in which the MP-GESS construct of the present invention is introduced is viable by phenol.

<1-3> Construction of pGESS-Cm / Tc / Km Construct and Confirmation

In order to promote the practicality of GESS, additional biocompatibility was investigated and antibiotic resistance genes and auxotrophic genes were used as phenotypic reporters. For the antibiotic resistance gene, the reporter region of the DmpR-based GESS plasmid (ACS Synthetic Biology (2014) 3 (3): 163-167) was cloned as chloramphenicol (pGESS-Cm) -, tetracycline (pGESS- (pGESS-Km) -resistant gene (Fig. 4 (A)). For the auxotrophic genes, the MP-GESS construct of Example 1-2 was used (Fig. 4 (D)).

Cm- (chloramphenicol) resistance gene and Tc- (tetracycline) resistance gene were amplified by PCR from pACYC184 (New England Biolabs, Ipswitch, MA, USA) and Km- (kanamycin) resistance gene was amplified by pET27b (EMD Millipore, Darmstadt, Germany ). (Vector-F1: aaggagatatacatatggtgagcaagggcg) and SEQ ID NO: 11 (Vector-R1: atgtatatctccttctccaggttggcggat), which is a DMPR-based GESS plasmid (ACS Synthetic Biology (2014) 3 Primers were used to amplify the 6,185 bp fragment. PGESS-Cm, pGESS-Tc, and pGESS-Km were introduced into the N-terminus of EGFP in the pGESSv4 vector in which the antibiotic resistance gene was amplified using the same cloning method as in pGESS- Construct was made. Next, DH5? E. coli cells containing each plasmid were cultured overnight at 37 占 폚, the preculture was diluted to 10 ⁶ times, and different combinations of phenol (1-1000 μM) and antibiotics (0, 10, 20 , And 30 [mu] g / mL). pGESS-Tc was investigated for the detection of tyrosine phenolytic enzyme. DH5a E. coli cells containing pGESS-Tc transformed with pHCEIIB-TPL were placed on LB solid medium containing 1 mM Tyrosine, 10 [mu] M PLP, 30 [mu] g / ml tetracycline and cultured at 30 [deg.] C for 48 hours.

As a result, the survival rate of each cell having pGESS-Cm and pGESS-Tc was increased in proportion to the concentration of phenol in the culture medium, and little survival was observed in the absence of phenol (Fig. 5 (A) . Cells with pGESS-Cm showed profiles similar to cells with pGESS-Tc, while cells transformed with pGESS-Km showed the lowest viability among the three tested strains (Figure 5). In the case of pGESS-Tc, the fluorescence intensity of the colonies was higher at an increased phenol concentration. Cells with pGESS-DAAT increased in number of colonies with increasing phenol concentration.

Thus, although an antibiotic resistance gene can be used to select a microorganism having a specific enzyme activity, by adding an antibiotic resistance gene as an additional reporter together with a green fluorescent protein, any metagenomic gene having an antibiotic resistance activity can be used as a sensor cell colony Formation, which can lead to a false positive rate. Unlike E. coli host-based metagenomic screening, it is not possible to grow natural microorganisms on plates containing antibiotics. Therefore, in order to select a microorganism having a specific enzyme activity in the metagenomic microorganisms, it is effective to introduce an auxotrophic gene as in the above Example <1-2> rather than the use of an antibiotic resistance gene. Therefore, Additional experiments were performed using MP-GESS with a gene encoding AAT and a fluorescent reporter.

Verification of heterologous enzyme activity of MP-GESS

<2-1> Enzyme activity verification based on one-step protocol

A TPL (tyrosin-phenol lase) enzyme was used to verify whether the enzyme activity could be detected among other microorganisms using the MP-GESS construct prepared in Example <1-1>. TPL is an enzyme which produces pyruvate, ammonia and phenol by decomposing tyrosine, and it is confirmed that a phenol produced by TPL activates MP-GESS of the present invention to express a fluorescent protein (FIG. 6A). Specifically, a sheet-like bacterial cell or TPL-producing Escherichia coli producing TPL was plated on an LB solid medium containing tyrosine as a substrate and cultured. Then, as in Example 1-2, MP-GESS vector The glutamate auxotrophic Escherichia coli cells (ie, sensor cells) were cultured and cultured. The cells were mixed with 0.75% (w / v) agar solution and placed in a solid medium growing TPL producing cells. After 12 hours incubation, the survival and fluorescence expression of the sensor cells into which the MP-GESS construct was introduced by fluorescence microscopy was observed (one-step protocol of FIG. 6B).

As a result, although no sensor cell was present around the E. coli cells without TPL as the negative control group, it was observed that there were sensor cell colonies that fluoresce around the Escherichia coli expressing the sheet- (Fig. 6C). From the above results, it was found that the glutamate auxotrophic E. coli introduced with the MP-GESS construct can survive not only by the TPL expressed in Escherichia coli, which is homologous to E. coli, but also by the TPL activity of the S. cerevisiae.

<2-2> Enzyme activity verification based on two-step protocol

The sensor cell treatment was performed in the same manner as in Example <2-1> except that the cells were cultured for 12 hours and then cultured for 12 hours, after culturing the TPL-producing Salmonella flexibilis or TPL-producing Escherichia coli 6b &lt; / RTI &gt; two-step protocol).

As a result, E. coli having TPL activity was clearly visible as fluorescence around the periphery of TPL cell, and the sensor cell was widely distributed on the plate due to the rapid growth of cell and strong TPL activity. However, Sensor cells did not grow and fluorescence did not appear at the edge of the plate without the Bacteria plastidis (Fig. 6D).

One-step protocol-based microbial search: Microbial search with a fibrinolytic enzyme activity in a soil sample (co-culture of the sensor cell and the microorganism to be searched in Example <1-2>),

The fibrinolytic enzyme decomposes para-nitrophenyl cellobioside (pNPG2) into nitrophenol and cellobiose (Fig. 7A). Since Escherichia coli introduced with the MP-GESS construct produced in Example < 1-2 > shows fluorescence when it is present in the presence of phenol, the Escherichia coli with the MP-GESS introduced therein and the microorganisms derived from the soil are co-cultured, It was confirmed whether microbes present in the soil could be detected by the fluorescence expression level of Escherichia coli with MP-GESS. Specifically, 1 g of a soil sample of a nearby wild field in Daejeon Research Complex was placed in a solution of 0.1% carboxyl methyl cellulose (CMC) in 100 ml of 1X PBS buffer, followed by shaking culture at 25 ° C for 2 hours to remove soil (Hereinafter referred to as &quot; enhanced soil sample &quot;). In the 1/10 diluted LB solid medium containing 100 μM of the substrate pNPG2, 1 ml of the enriched soil sample was plated together with 5 × 10 ⁴ cells of the E. coli WM335 containing MP-GESS prepared in Example <1-2>. After culturing at 30 ° C for about 12 hours, the cells were observed with a fluorescence microscope (Nikon), and the colonies around the E. coli bacteria producing the fluorescence activated by the MP-GESS construct were judged to be candidate microorganisms producing fibrinolytic enzymes. In order to isolate the candidate microorganisms producing the cellulolytic enzyme, the colonies are cut out with a flame sterilized knife, suspended in a LB liquid medium diluted 1/10, plated on a solid medium not containing the substrate, or in a solid medium The selective colonies were streaked. Escherichia coli containing the MP-GESS construct was unable to grow because it could not express the DAAT gene because it could not produce phenol in a substrate-free medium, so that it could isolate the candidate microorganism producing the cellulolytic enzyme (Fig. 7B).

Four colonies of # 25, # 34, # 43, and # 46, where fluorescence was observed around the colonies, were obtained from about 2,500 colonies isolated from soil samples (FIG. 8) Three additional species of phenotypes were found during the further isolation of the species microorganisms, and the strains of # 25-1, # 25-2, # 34-1, # 34-2, # 43, # 46-1 and # 46-2 A total of seven microbial strains were produced for the production of seven types of enzymes.

Identification of the fibrinolytic activity of the candidate microorganisms selected in Example 3

Whether the seven candidate microorganisms selected in Example 3 had a fibrinolytic activity was confirmed by using various substrates. The selected candidate microorganisms were cultured at 30 ° C, treated with celLyticB, lysozyme, and DNase, respectively, and lysates were used as crude enzyme solutions. pNPG2 and pNPG3 (para-nitrophenyl cellotrioside) as substrates for 2 hours at 45 ° C. Then, the optical density (Victor) of the degraded pNP (para-nitrophenol) was measured at 405 nm. As a negative control, buffers were added to the buffer without the enzyme solution, each of the candidate microorganism samples was used with no substrate, and none (NC) was used. As the positive control, 0.02% c-tech (Changhua Ethanol, PC) and celEdx16 (KC Ko, et al. (2011) Appl. Microbiol. Biotechnol. 89, 1453-1462) were used. In addition, filter paper (1 x 3 cm), 1% (w / v) Avicel and 2% (w / v) CMC were also used as substrates. Each reaction was carried out at 45 ° C. After the enzymatic reaction, the activity was measured by DNS reducing sugar assay. Among the various substrates, pNPG2, avicel, and filter paper are substrates of exo-type fibrinolytic enzyme, and pNPG3 is substrates of endo-type fibrinolytic enzyme.

As a result of the reaction, # 25-1 and # 46-2 strains reacted with Avicel, and the activity against pNPG2 and pNPG3 was confirmed in the samples except strains # 34-1 and # 46-1. In particular, strain # 46-2 has high activity against filter paper, and because of this property, it can be usefully used for decomposing crystalline fibrils (FIG. 9). From the above results, it was confirmed that the strains of E. coli WM335 containing the MP-GESS, which is the sensor cell of the present invention, can be used for the search for strains having a fibrinolytic enzyme activity.

Identification of candidate microorganisms selected in Example 3

16s rRNA analysis was performed to identify the microbial species of the selected colonies in Example 4. In order to analyze the nucleotide sequence of 16s rRNA of bacteria containing 9 variable regions, 9F (SEQ ID NO: 8) and 1512R (SEQ ID NO: 9) primers capable of PCR amplification of the 16s rRNA sequence of E. coli were used Respectively. Of the seven isolated microbial resources, 16s rRNA sequencing was performed on six microbial resources except # 34-1, which were not incubated.

SEQ ID NO: 8: 5'-agagtttgatcatggctcag

SEQ ID NO 9: 5'-tacggttaccttgttacgactt

Table 2 shows the similarity results between each candidate microorganism and the previously identified microorganisms.

Candidate microorganism Close match Similarity (%) # 25-1 Bacillus cereus ATCC 14579 (T) 97.34 # 25-2 Pseudomonas koreensis Ps 9-14 (T) 99.13 # 34-2 Bacillus cereus ATCC 14579 (T) 99.92 # 43 Pseudomonas koreensis Ps 9-14 (T) 98.87 # 46-1 Bacillus cereus ATCC 14579 (T) 99.92 # 46-2 Pseudomonas koreensis Ps 9-14 (T) 92.77

As a result, # 25-1 showed 97% or more similarity with Bacillus cereus ATCC 14579 (T), and # 34-2 and # 46-1 showed 99% or more similarity with Pseudomonas thringiensis ATCC 10792 Respectively. In the case of # 46-2, which is relatively active on the filter paper, it was analyzed to be 93% similar to Pseudomonas koreensis Ps 9-14 (T). As a result, # 46-2 strain was confirmed to be a new microorganism, Deposited at the Microbial Resource Center with accession number KCTC32541. Microorganisms # 25-2 and # 43 were also found to be more than 98% similar to Pseudomonas koreensis Ps 9-14.

From the above results, it is possible to search for a strain having a protease activity with E. coli WM335 containing MP-GESS, which is a sensor cell of the present invention, and the strain found is similar to Bacillus cereus, Pseudomonas trigiensis, and Pseudomonas corynsis, It was found that novel microorganisms having decomposition activity could be searched.

NGS analysis of the new microorganism selected in Example 3, total genome analysis and functional difference analysis with existing microorganisms

<6-1> NGS analysis of new microorganisms, whole genome analysis

DNA of # 46-2 strain was extracted for Pseudomonas spp. Analysis, and two next generation DNA sequencers (NGS) (Roche454) were performed. The total number of readings was 1,192,651, and the total number of contigs found by the GS FLX assembler was 625. The average contig size was 10,059 bp, indicating that the microorganism had a total length of about 6M. Based on the identified congestion, one of the online tools, RAST (http://rast.nmpdr.org/rast.cgi), was used for the annotation analysis of the # 46-2 genome. RAST is a tool that estimates an ORF by taking a congig as an input value and classifies / analyzes the function of the ORF estimated by a method called 'subsystem technique'. As confirmed in May 2015, it has 1,151 proven subsystems, divided into three levels, including 27 categories. The function of the putative ORF can belong to more than one subsystem. In the case of strain # 46-2, the subsystem classification was defined in 2,941 ORFs, 52% of the total 5,692 ORFs, and the remaining 48% It was an ORF. This ratio and 2,941 subsystem distributions are shown in FIG. The most common category was amino acids and their derivatives, followed by carbohydrates, cofactors, vitamins, prosthetic groups and pigments.

Through the above process, Blast analysis of NCBI was performed using predicted ORF sequence information for comparison with other strains of # 46-2 strain. Using Blastn software, a total of 5,754 ORFs were aligned to the NCBI nt database and evalua- tions of less than 10 hits were found, resulting in an average of about 45 hits per orf. As a result of analyzing the strains derived from the identified heat sequences, the most frequently found strains were Pseudomonas fluorescens Pf0-1, and 4,829 genes out of total 5,754 ORF fragments were similar to those present in P. fluorescence Pf0-1 Respectively. FIG. 11 shows the genomic Coverage value obtained by dividing the number of identified genes by the total number of genes of each of the compared strains. It was confirmed that about 84% of the genes of P. fluorescence Pf0-1 were similar to the # 46 strains. Therefore, it was found that the selected strain # 46-2 was a novel microorganism different from the existing Pseudomonas species while having the activity of cellulase.

<6-2> Functional difference analysis with existing microorganisms

For the analysis of the gene structure and function of strain # 46-2, gene function and sequence-based comparative analysis with P. fluorescence Pf0-1 species analyzed as the most similar strains were conducted. Using function-based comparison tool, a function provided by RAST, the function and existence of constitutive genes of # 46-2 and P. fluorescence Pf0-1 were compared with each other, and the results were downloaded and analyzed by a second comparison.

As a result, 3,142 genes shared function of two strains among the total 3480 genes analyzed by subsystem, 168 genes functioning only in # 46-2 strain, 170 genes functioning only in P. fluorescence Pf0-1 . The functional difference between the two microorganisms is shown in Fig. From the above results, it was confirmed that the P. fluorescence Pf0-1 strain found to be the closest in sequence to the strain # 46-2 could show not only the difference in ORF sequence but also the function thereof.

Evaluation of morphology by electron microscopic image analysis of new microorganisms selected in Example 3

The novel strain # 46-2 selected as the sensor cell of the present invention, MP-GESS-containing Escherichia coli WM335, is the most similar genus of P. koreensis sp. Were observed with an electron microscope.

As a result, strain # 46-2 was identified as the most similar genus in the 16srRNA analysis by P. koreensis sp. (Fig. 13). &Lt; tb &gt;&lt; TABLE &gt; This was similar to P. monocytogenes Ps9-14 (T) with many flagella. In addition, this microbial resource was a rod-shaped and swollen surface, which is thought to produce macromolecular material because of the mucous colony shape.

Microbial search based on two-step protocol: search for microorganisms having phosphatase activity in soil samples (microorganisms to be searched for enzyme activity were cultured to form colonies, A method of spraying the sensor cell of the present invention)

Phosphorylase has an activity of decomposing phenyl phosphate into phenol and phosphate (Fig. 14 (a)). Therefore, a microorganism having a phosphatase activity using a sensor cell was searched.

1g of soil was collected from rivers in Shindangjin-dong, Daejeon, and 50ml of 1x PBS was added to the collected soil. After 24 hours, centrifugation was performed at 1000 rpm for 5 minutes to obtain 10 mL of supernatant. 1 mL of the soil sample obtained was spread on a 1/10 diluted LB medium containing 100 μM phenylphosphate and cultured at 20 ° C for 12 hours. The sensor cells, WM335 cells with pGESS-DAAT prepared in Example 1-2, were separately cultured in 10 mL dLB broth containing 10 μM phenol for 24 hours at 37 ° C. The cultured sensor cells were centrifuged at 3000 rpm for 15 minutes and washed with 5 mL of dLB. After the washing step was performed once more, OD ₆₀₀ of the sensor cell was set to about 1 before spraying. Then, the sensor cells were sprayed on a solid plate on which colonies of soil microorganisms were formed, using an atomizer. After incubation at 37 ° C for 12 hours in an incubator, the samples were subjected to an AZ100M fluorescence multi-zoom microscope (Nikon) equipped with a GFP filter, . As expected from the TPL results, circular colonies were formed that emitted green fluorescence around the edges of candidate colonies with phosphatase activity (Fig. 14B). 14b), and three arbitrary fluorescent colonies (when only soil microorganisms were cultured without sensor cells), 7 candidate microorganism colonies producing phosphatase were cultured 14C) was selected and PCR was performed using primers of SEQ ID NO: 12 (MP-F1: tgaaacctgcagcaacagcatgcgttgttc) and SEQ ID NO: 13 (MP-R1: ggtgaacagctcctcgcccttgctcaccat). As a result, it was confirmed that all the colonies except for C7 were mixed with sensor cells (cells having MP-GESS) (FIG. 14D). The results of PCR showed that any soil microorganisms, C8, C9 and C10, did not amplify the gene for the vector contained in the sensor cell, so it is presumed that it emits autofluorescence rather than containing the sensor cell. Compared with the one-step protocol of Example 3 above, the two-step protocol allows for the colony size formed by the sensor cell and the metagenomic microorganism, and between the sensor cell and the metagenomic microbe , It is possible to provide a more effective guideline in selecting a candidate microorganism having a target enzyme activity.

The 7 selected colonies were further examined by 16s rRNA analysis to identify them. Seven colonies were plated on a sterile toothpick and streaked onto dLB medium without substrate, phenol or D-glutamic acid. At this stage, the sensor cells spontaneously disappeared, and single colonies were isolated for further 16s rRNA analysis. Table 3 shows the result of 16s rRNA analysis of each colony.

No. Reference Strain Length Score Identification (%) C1 NR_036911.2 Aeromonas media strain RM 16S ribosomal RNA gene, partial sequence 1503 2894 1469/1472 (99%) C2 NR_024927.1 Pseudomonas migulae strain CIP 105470 16S ribosomal RNA gene, partial 1516 2866 1467/1474 (99%) C3 NR_113578.1 Pseudomonas fragi strain NBRC 3458 16S ribosomal RNA gene, partial 1462 2876 1458/1461 (99%) C4 NR_044863.1 Shewanella putrefaciens strain Hammer 95 16S ribosomal RNA gene 1504 2831 1461/1472 (99%) C5 NR_044863.1 Shewanella putrefaciens strain Hammer 95 16S ribosomal RNA gene, 1504 2734 1406/1415 (99%) C6 NR_074891.1 Escherichia coli O157: H7 str. Sakai strain Sakai 16S ribosomal RNA, 1542 2208  1318/1386 (95%) C7 NR_108852.1 Shewanella seohaensis strain S7-3 16S ribosomal RNA gene, partial 1465 2036 1307/1399 (93%)

As a result, four types of genus, namely Aeromonas, Pseudomonas, Shewanella, and Escherichia, were identified from seven selected microorganisms. Especially, the genus Shewanella and Aeromonas were identified in the aquatic environment.

Identification of phosphorylase activity of candidate microorganisms

Since the phosphatase has an activity of decomposing phenylphosphate into phenol and phosphate, the cells selected by the sensor cell were recovered to confirm whether the selected cells had phosphatase activity.

The selected cells were collected and suspended in 50 mM HEPES buffer (pH 7.5), and 0.1 mM phenylmethylsulfonyl fluoride (PMSF) was added as a protease inhibitor. The suspended cells were disrupted by sonication in ice (Fisher Scientific, Pittsburgh, Pa.). Cell debris was removed by centrifugation at 15,000 x g for 20 min at 4 ° C, and the supernatant was filtered through a 0.45-μm filter. Protein concentrations were quantified according to the method described in Bradford, Analytical biochemistry 72, 248-254. The catalytic activity of the crude extract was confirmed on the basis of the amount of pNP released from a 0.2 mL HEPES buffer (pH 7.5) containing 1 mM pNP-phosphate in a 1.5-ml tube in round bottom form. The crude extract enzyme reaction was carried out for 10 min at 25 ° C and terminated by the addition of 1 M Na ₂ CO ₃ . The reaction solution was clarified by centrifugation at 16,300 x g for 15 minutes and the absorbance change was measured at 420 nm using a Victor V Multilabel Plate Reader (PerkinElmer Life Sciences, Waltham, Massachusetts, USA). One unit of enzyme was defined as the activity required to produce 1 nmol of pNP as the product per minute under the specific assay conditions.

36 colonies were selected from 4000 colonies in order to confirm whether the phospholipase-positive colonies actually have phospholipase activity (Fig. 15A). Phosphorylase activities of crude extracts of 36 selected colonies were confirmed. The results of the 16s rRNA analysis of the colonies selected in FIG. 15 (b) show the activity (U / mg) of the phos- pholytic enzymes of the colonies selected. The major five strains ( Shigella sonnei, Shigella flexneri, Rheinheimera tangshanensis, Rheinheimera soli, Escherichia fergusonii ) were found to exhibit an apparent phosphatase activity ranging from 10 to 30 U / mg. Shigella flexneri is one of the well-known bacterial nonspecific acid phosphatase sources, which are used in the production of various phosphorylation products. Rheinheimera soli is known to have weak enzymatic activity against acidic phosphatase, and Escherichia fergusonii has also been reported to have acidic phosphatase activity. However, no information on the activity of the phosphatases of Shigella sonnei and Rheinheimera tangshanensis has been published, and thus further investigation of the above Shigella sonnei and Rheinheimera tangshanensis reveals that a new phosphatase can be found Could know.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the scope of the invention is not limited to the disclosed exemplary embodiments. It will be possible to change it appropriately.

<110> Korea Research Institute of Bioscience and Biotechnology <120> Microbe Prototyping Genetic Circuit based Novel Microbe Screening System <130> 2016-dpa-1453 <150> KR 10-2015-0099372 <151> 2015-07-13 <160> 13 <170> Kopatentin 2.0 <210> 1 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> forward primer for pGESSv4 <400> 1 atgtatatct ccttctccag gttggcggat 30 <210> 2 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for pGESSv4 <400> 2 aaggagatat acatatggtg agcaagggcg 30 <210> 3 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> forward primer for DAAT gene <400> 3 atgttggaac aaccaatagg agtcattgat tc 32 <210> 4 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for DAAT gene <400> 4 tcttttaatc ggttcttgca gtgagataca tt 32 <210> 5 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> forward primer for DAAT gene (2) <400> 5 atccgccaac ctggagaagg agatatacat atgttggaac aaccaatagg ag 52 <210> 6 <211> 80 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for DAAT gene (2) <400> 6 cgcccttgct caccatatgt atatctcctt ctaagctgct aaagcgtagt tttcgtcgtt 60 tgctgctctt ttaatcggtt 80 <210> 7 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> peptide for ssrA tag <400> 7 Ala Ala Asn Asp Glu Asn Tyr Ala Leu Ala Ala   1 5 10 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer for 16s rRNA of E. coli <400> 8 agagtttgat catggctcag 20 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for 16s rRNA of E. coli <400> 9 tacggttacc ttgttacgac tt 22 <210> 10 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Vector-F1 <400> 10 aaggagatat acatatggtg agcaagggcg 30 <210> 11 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Vector-R1 <400> 11 atgtatatct ccttctccag gttggcggat 30 <210> 12 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> MP-F1 <400> 12 tgaaacctgc agcaacagca tgcgttgttc 30 <210> 13 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> MP-R1 <400> 13 ggtgaacagc tcctcgccct tgctcaccat 30

Claims (18)

(1) designing a phenol-tag substrate capable of generating a phenolic compound by the activity of an enzyme;
(2) Purpose To treat the natural microorganism strain expected to have an enzyme or a naturally-occurring environmental sample containing the enzyme, the phenol-tagged substrate is treated to culture with the sensor cell in an environment in which a specific nutrient is deficient and an antibiotic is not present ;
(3) identifying and selecting those in which the fluorescent protein is expressed among the surviving sensor cells as a result of the culture; And
(4) separating the microorganism strains adjacent to the selected sensor cells to detect and search for a new microorganism strain derived from a natural organism having a target enzyme,
The method does not include the process of constructing the meta genome library,
The sensor cell of the step (2) is characterized in that the sensor cell is cultured in an auxotrophic host cell which requires a specific nutrient, (i) a gene expression regulatory region, a first promoter whose activity is regulated by the gene expression regulatory region, 1 reporter gene whose expression is regulated by activation of a promoter and which encodes a gene encoding a fluorescent protein and an enzyme involved in nutritional requirement; And (ii) a gene encoding a transcription regulatory factor which is regulated by the second promoter and the second promoter and binds to the gene expression regulatory region only in the presence of a phenolic compound to activate the first promoter A gene construct comprising a second genetic construct is transformed and does not contain a metagenomic gene,
Wherein the sensor cell in step (2) detects a phenolic compound produced outside the sensor cell, and detecting and detecting a novel microorganism strain derived from a natural organism having a target enzyme.
The method according to claim 1,
Wherein the step (2) is a step of co-culturing a natural microorganism strain suspected of having the target enzyme or a naturally-occurring environmental sample containing the same, with the phenol-tag substrate and the sensor cell.
The method according to claim 1,
The step (2) comprises: culturing a natural microorganism having the target enzyme or a naturally-occurring environmental sample containing the same in an environment treated with the phenol-tag substrate to form a colony; And
And co-culturing the formed colonies and the sensor cells together.
The method according to any one of claims 1 to 3,
Wherein the nutrient is glutamic acid.
The method according to any one of claims 1 to 3,
Wherein the phenolic compound is selected from the group consisting of phenol, 2-chlorophenol, 2-iodophenol, 2-fluorophenol, o-cresol, 2-ethylphenol, m-cresol, 2-nitrophenol, catechol, 2-aminophenol, 2,3-dichlorophenol, 3-chlorophenol, 2,3-dimethylphenol, 3-nitrophenol, 4- chlorophenol, p-cresol, 2,5-dichlorophenol and 2,5- Phenol. &Lt; / RTI &gt;
The method according to any one of claims 1 to 3,
The phenol-tagged substrate may be an ester (-OOC-), an ether (-OC-), a glycoside (-O-Glc), a phosphoric acid ester (phospho-ester, -O-PO3 ), ortho-, meta-, para-position on the alkyl (-CH _3), hydroxyl (-OH), carboxyl (-COOH), amino (-NH _2), thiol (-SH), amide (amide, -NH-CO- or -CO-NH-), sulfide (-S-SH), halogen group (-Cl, -Br, -F) Benzene ring compounds.
The method according to any one of claims 1 to 3,
Wherein said transcriptional regulatory factor is selected from the group consisting of DmpR, DmpR mutants, XylR, MopR, PhhR, PhlR and TbuT.
The method according to any one of claims 1 to 3,
Wherein the enzyme involved in the nutritional requirement is a DAAT (D-amino acid aminotransferase) enzyme.
The method according to any one of claims 1 to 3,
Is selected from the group consisting of dependent promoter (PECO) - the first and the second promoter is a promoter, the promoter for general protein expression, trc promoter, T7 promoter, lac promoter, ara promoter and σ ⁵⁴ of dmpR or dmp operon of Pseudomonas .
The method according to any one of claims 1 to 3,
Wherein the gene expression regulatory region further comprises one or more factors selected from the group consisting of RBS (Ribosome Binding Site) and transcription termination factors that facilitate the expression of the reporter protein.
The method of claim 10,
Wherein said transcription termination factor is rrnBT1T2 or tL3.
The method according to any one of claims 1 to 3,
Wherein said host cell is selected from the group consisting of bacteria, fungi, plant cells and animal cells.
The method of claim 12,
Wherein the bacterium is E. coli.
The method of claim 12,
Wherein the fungus is yeast. delete delete delete delete

Images