WO2017005773A1 - Utilisation de micro-arn ciblant la bêta-caténine pour le traitement du cancer du foie - Google Patents

Utilisation de micro-arn ciblant la bêta-caténine pour le traitement du cancer du foie Download PDF

Info

Publication number
WO2017005773A1
WO2017005773A1 PCT/EP2016/065938 EP2016065938W WO2017005773A1 WO 2017005773 A1 WO2017005773 A1 WO 2017005773A1 EP 2016065938 W EP2016065938 W EP 2016065938W WO 2017005773 A1 WO2017005773 A1 WO 2017005773A1
Authority
WO
WIPO (PCT)
Prior art keywords
mir
hsa
mirna
subject
catenin
Prior art date
Application number
PCT/EP2016/065938
Other languages
English (en)
Inventor
Christophe GROSSET
Sarah LESJEAN
Francis SAGLIOCCO
Marie-Annick Buendia
Emilie INDERSIE
Original Assignee
Universite de Bordeaux
Institut National De La Sante Et De La Recherche Medicale
Universite Paris Sud - Paris Xi
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Universite de Bordeaux, Institut National De La Sante Et De La Recherche Medicale, Universite Paris Sud - Paris Xi filed Critical Universite de Bordeaux
Publication of WO2017005773A1 publication Critical patent/WO2017005773A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K33/00—Medicinal preparations containing inorganic active ingredients
    • A61K33/24—Heavy metals; Compounds thereof
    • A61K33/243—Platinum; Compounds thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/13—Amines
    • A61K31/135—Amines having aromatic rings, e.g. ketamine, nortriptyline
    • A61K31/138—Aryloxyalkylamines, e.g. propranolol, tamoxifen, phenoxybenzamine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/40—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
    • A61K31/407—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil condensed with other heterocyclic ring systems, e.g. ketorolac, physostigmine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/555—Heterocyclic compounds containing heavy metals, e.g. hemin, hematin, melarsoprol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7028—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages
    • A61K31/7034—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin
    • A61K31/704—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin attached to a condensed carbocyclic ring system, e.g. sennosides, thiocolchicosides, escin, daunorubicin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
    • A61K31/7052—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides
    • A61K31/706—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom
    • A61K31/7064—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines
    • A61K31/7068—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines having oxo groups directly attached to the pyrimidine ring, e.g. cytidine, cytidylic acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C12N2310/141—MicroRNAs, miRNAs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2330/00—Production
    • C12N2330/10—Production naturally occurring

Definitions

  • the present invention relates to the field of oncology.
  • it provides miRNAs useful for detecting and/or treating cancer.
  • Hepatoblastoma is an uncommon malignant liver neoplasm occurring in infants and children (1% of pediatric cancers, 0.02% of all cancers and around 3,500 new cases by year worldwide) with a 10-year survival of 61 % (Allan B et al, HPB 2013 , 15 :741 -46) .
  • miR- 34a (recently renamed miR-34a-5p in the last version of miRBase) is currently tested in phase I clinical trial for unresectable primary liver cancer or solid cancers with liver involvement (e.g. metastasis) in adults.
  • miR-34a regulates several key oncogenic targets including CTNNB 1, BCL2, E2F3, HDAC1, MET, MAK1, CDK4/6, PDGFR-a, WINT1/3 and NOTCH-1 (Bader, Front. Genet., 120, 1-9, Li Z and Rana TM, Nat Rev Drug Disc 2014) .
  • the inventors identified 5 new miRNAs (i.e., hsa-miR-548z, hsa-miR-624-5p, hsa-let-7i-3p, miR-885- 5p, miR-449b-3p) decreasing the level of the oncoprotein catenin beta 1 (CTNNB1) in HBL cell lines.
  • Hsa-miR-548z, hsa-miR-624-5p, hsa-let-7i-3p, miR-885-5p and miR-449b-3p are down-regulated in HBL tumors and inhibit in vitro HBL cell growth.
  • miR-34a the miRNA currently tested in phase-I clinical trial
  • PDX Patient-Derived Xenograft
  • the present invention relates to a molecule selected from the group consisting of hsa-miR-624-5p, hsa- miR-548z, hsa-let-7i-3p, hsa-miR-885-5p, hsa-miR-449b-3p or any combination thereof or a DNA or RNA encoding for said miRNA for use for treating a hepatoblastoma cancer.
  • the present invention also relates to the use of a molecule selected from the group consisting of hsa-miR-624-5p, hsa-miR-548z, hsa-let-7i-3p, hsa-miR-885-5p, hsa-miR-449b-3p or any combination thereof or a DNA or RNA encoding for said miRNA for the manufacture of a medicament for treating a liver cancer, particularly hepatoblastoma.
  • a molecule selected from the group consisting of hsa-miR-624-5p, hsa-miR-548z, hsa4et-7i-3p, hsa-miR-885-5p, hsa-miR-449b-3p or any combination thereof or a DNA or RNA encoding for said miRNA to said patient.
  • the molecule is selected from the group consisting of hsa-miR-624-5p, hsa-miR-548z, hsa-let-7i-3p, hsa-miR-449b-3p or any combination thereof or a DNA or RNA encoding for said miRNA.
  • the molecule is to be used in combination with one or more therapeutic agents, preferably another antitumor therapy, and in particular with cisplatin, doxorubicin, 5-Fluoro-uracil, sorafenib, gemcitabine, oxaliplatin, mitomycin C, tamoxifen, MSC2156119J, foretinib, refametinib, cabozantinib and tivantinib, or any combination thereof, preferably with doxorubicin, cisplatin, gemcitabine, oxaliplatin, carboplatin, mitomycin C, tamoxifen, sorafenib or any combination thereof.
  • the molecule is to be used in combination with cisplatin and/or doxorubicin for use in the treatment of HBL.
  • the molecule is to be used in combination with another antitumor therapy and a drug lowering the toxicity and side effects of the antitumor therapy.
  • drug lowering the toxicity and side effects of the antitumor therapy can be sodium thiosulfate or N-acetyl cysteine.
  • the therapeutic agent can be an immunotherapeutic agent such as drugs targeting immune system checkpoints such as PD- 1 or PD-L 1.
  • the molecule is to be used in combination with one or more immunotherapeutic agents, and in particular with monoclonal antibodies binding antigens on cancer cells or targeting immune system checkpoints (e.g. immune checkpoint inhibitors) and especially drugs targeting PD-1 or PD-L1 such as for example pembrolizumab, nivolumab, atezolizumab.
  • the molecule is to be used in combination with resection, radiofrequency ablation and/or percutaneous ethanol injection.
  • the molecule is to be used after or before resection, radiofrequency ablation and/or percutaneous ethanol injection.
  • the molecule is for use as neo-adjuvant therapy or adjuvant therapy.
  • the subject does not respond to the first line treatment and/or is not suitable for tumor resection or ablation and/or not suitable for liver transplantation.
  • the subject has a miRNA selected from the group consisting of hsa-miR-624-5p, hsa-miR-548z, hsa4et-7i-3p, hsa-miR-885-5p, hsa-miR-449b-3p or any combination thereof, preferably selected from the group consisting of hsa-miR- 624-5p, hsa-miR-548z, hsa-let-7i-3p, hsa-miR-449b-3p or any combination thereof, which is under- expressed in comparison with a healthy or non-tumoral control.
  • the present invention further relates to a method for selecting a subject suitable for a treatment by miRNA as disclosed herein comprising determining the level of a miRNA selected from the group consisting of hsa-miR-624-5p, hsa-miR-548z, hsa-let-7i-3p, hsa-miR-449b-3p or of a combination thereof in a biological sample from the subject, and selecting the subject if at least one of the miRNA is under-expressed in comparison with a healthy or non-tumoral control.
  • the present invention further relates to a method for selecting a subject suitable for a treatment by miRNA as disclosed herein comprising determining the level of CTNNB 1 thereof in a biological sample from the subject, and selecting the subject if CTNNB 1 is upper-expressed or overexpressed in comparison with a healthy or non-tumoral control.
  • the present invention also relates to the use of a miRNA selected from the group consisting of hsa-miR- 624-5p, hsa-miR-548z, hsa-let-7i-3p, hsa-miR-449b-3p or of any combination thereof as a marker for detecting a hepatoblastoma cancer or a susceptibility to develop a hepatoblastoma cancer.
  • said miRNA can be used in combination with hsa-miR-885-5p.
  • the present invention relates to a method for detecting a hepatoblastoma cancer or a susceptibility to develop a hepatoblastoma cancer in a subject, comprising determining the level of a miRNA selected from the group consisting of hsa-miR-624-5p, hsa-miR-548z, hsa-let-7i-3p, hsa-miR-449b-3p or of any combination thereof in a biological sample from the subject, an under-expression of at least one of the miRNA in comparison with a healthy or non-tumoral control being indicative of a hepatoblastoma cancer or a susceptibility to develop a hepatoblastoma cancer.
  • said miRNA can be used in combination with hsa-miR-885-5p.
  • the present invention also relates to the use of a miRNA selected from the group consisting of hsa-miR- 624-5p, hsa-miR-548z, hsa-let-7i-3p, hsa-miR-449b-3p or of any combination thereof as a marker for the prognosis in a subject having a hepatoblastoma cancer.
  • the present invention also relates to a method for determining the prognosis in a subject having a hepatoblastoma cancer, comprising determining the level of a miRNA selected from the group consisting of hsa-miR-548z, hsa-miR-624-5p, hsa-let-7i-3p, hsa-miR-449b-3p or of a combination thereof in a biological sample from the subject, the level of expression of said at least one of the miRNA being correlated with the clinical prognosis.
  • said miRNA can be used in combination with hsa-miR-885-5p.
  • the present invention relates to a kit or analytical tool for detecting a hepatoblastoma cancer or a susceptibility to develop a hepatoblastoma cancer in a subject or for selecting a subject suitable for a treatment by a molecule as disclosed herein or for determining the prognosis in a subject having a hepatoblastoma cancer, the kit comprising detection means specific for at least one miRNA selected from the group consisting of hsa-miR-624-5p, hsa-miR-548z, hsa-let-7i-3p, hsa-miR-449b-3p or for any combination thereof.
  • said kit further comprises detection means specific for hsa-miR- 885-5p.
  • FIG. 4 Effect of the nine miRNAs on the relative expression of wild-type (WT Exon 3; A) and exon 3-deleted ( ⁇ 3; B) beta-catenin proteins in a HBL patient-derived xenograft cell line.
  • HBL-214-J cells were transfected by the corresponding small RNA or miRNA (as shown).
  • FIG. 5 Relative expression of miR-34a-5p and 6 beta-catenin-regulating miRNAs in 34 normal liver (NL) and 40 HBL tumors. Non-parametric two-tailed Mann-Whitney test for unpaired data: ** p ⁇ 0.01, *** p ⁇ 0.001.
  • FIG. 10 Apoptosis of HuH6 cells at Day 3 following transfection by the corresponding small RNA or miRNA (Tetramethylrhodamine, methyl ester - TMRM - assay).
  • siCtrl RNA and etoposide (ETO) were used as negative and positive controls, respectively, si -cat: siRNA against ⁇ -catenine.
  • ANOVA test: p ⁇ 0.001 (n 3); Bonferroni's multiple comparisons test: ** p ⁇ 0.01 ; *** p ⁇ 0.001.
  • FIG. 11 Percentage of HuH6 cells in senescence at Day 3 following transfection by the corresponding small RNA or miRNA (beta-galactosidase staining assay).
  • siCtrl negative control RNA.
  • si -cat siRNA against ⁇ -catenine.
  • MiR-624-5p directly interacts with the 3 beta-catenin mRNA variants through the 3'-UTR.
  • A Predicted interaction site between beta-catenin 3'-UTR and miR-624-5p. The two point mutations inserted in beta-catenin 3'-UTR are as shown.
  • FIG. 1 Schematic representation of the three beta-catenin mRNA variants and localization of the predicted miR-624-5p site (thick line).
  • MiR-624-5p inhibits several genes associated with the Wnt/beta-catenin signaling pathway.
  • Huh6 cells were transfected with a control RNA (Ctrl), miR-624-5p or siRNA against ⁇ -catenine (si- ⁇ - catenin) and the relative expression of Wnt signaling-associated mRNA genes was measured. Genes down- (A, Top panel) or up- (B) regulated by miR-624-5p in Huh6 cells are as shown.
  • FIG. 14 MiR-624-5p inhibits HBL tumor development in vivo.
  • Huh6 cells were transfected with a control RNA (Ctrl)or miR-624-5p. 24 hours later, cells were collected and grafted on the chick CAM at day 10. The tumor growth was monitored from day 11 to day 16.
  • Catenin-beta 1 (CTNNB l) is described in Uniprot under ID P35222 and has a Reference Sequence of mRNA NM_001098209 and a Reference Sequence of protein NP_001091679.
  • identity refers to a relationship between the sequences of two or more nucleic acid molecules, as determined by comparing the sequences. In the art, “identity” also means the degree of sequence relatedness between amino acid or nucleic acid molecule sequences, as the case may be, as determined by the match between strings of nucleotide or amino acid sequences. “Identity” measures the percent of identical matches between two or more sequences with gap alignments addressed by a particular mathematical model or computer programs (i.e., "algorithms").
  • Non-limiting methods for determining identity are designed to give the largest match between the sequences tested. Methods to determine identity are codified in publicly available computer programs. Preferred computer program methods to determine identity between two sequences include, but are not limited to, the GCG program package, including GAP (Devereux, et al., Nucleic Acids Research 12:387 [1984] ; Genetics Computer Group, University of Wisconsin, Madison, Wis.), BLASTN, and FASTA (Atschul et al., J. Molec. Biol. 215:403-410 [1990]).
  • the BLAST X program is publicly available from the National Center for Biotechnology Information (NCBI) and other sources (BLAST Manual, Altschul] et al., NCB NLM NIH Bethesda, Md. 20894; Altschul et al., J. Mol. Biol. 215:403-410 [1990]).
  • NCBI National Center for Biotechnology Information
  • the well-known Smith Waterman algorithm may also be used to determine identity.
  • the GAP program is also useful with the above parameters.
  • the aforementioned parameters are the default parameters for nucleic acid molecule comparisons.
  • gap opening penalties can be used by those of skill in the art, including those set forth in the Program Manual, Wisconsin Package, Version 9, September 1997.
  • the particular choices to be made will depend on the specific comparison to be made, such as DNA to DNA or RNA to DNA; and additionally, whether the comparison is between given pairs of sequences (in which case GAP or BestFit are generally preferred) or between one sequence and a large database of sequences (in which case FASTA or BLASTA are preferred).
  • the inventors identified miR-548z as a therapeutic agent against cancer, especially hepatoblastoma cancer.
  • the inventors identified miR-624-5p as a therapeutic agent against cancer, especially hepatoblastoma cancer.
  • let-7i-3p as a therapeutic agent against cancer, especially hepatoblastoma cancer.
  • let-7i-3p The seed sequence of let-7i-3p is encompassed in the sequence shown in bold highlighting.
  • the mature let-7i-3p is underlined.
  • the inventors identified miR-449b-3p as a therapeutic agent against cancer, especially hepatoblastoma cancer.
  • the inventors identified miR-885-5p as a therapeutic agent against cancer, especially hepatoblastoma cancer.
  • the seed sequence of miR-885-5p is encompassed in the sequence shown in bold highlighting.
  • the mature miR-885-5p is underlined.
  • microRNAs are well-known in the art and a person skilled in the art would understand that they include the conventional naturally occurring sequences (provided herein) but also any chemically modified versions and sequence homologues thereof. Chemically modified versions and sequence homologues of miRNAs are generally called miRNA mimic, analog or derivative. The miRNA mimic, analog or derivative has retained or enhanced activity of the original miRNA.
  • the miRNA can be mature miRNA, precursor (pre)-miRNA, primary (pri)-miRNA, a miRNA mimic, analog or derivative thereof.
  • prefix “hsa” indicates Homo sapiens or human. Even in its absence, all miRNA of the invention are human.
  • miRNA and microRNA can be identical and are substitutable.
  • the miRNA is a single-stranded nucleic acid molecule, especially a RNA molecule, of no more than 30 nucleotides in length, preferably no more than 25 bases in length, and generally about 21-23 nucleotides in length. It comprises a sequence which is identical or substantially identical to the seed sequence. By “substantially identical” is meant that at most 1 or 2 substitutions or deletions are allowed. In a preferred embodiment, it comprises a sequence identical to the seed sequence.
  • the seed sequence usually corresponds to a sequence located between position 2 and position 9 of the mature miRNA. For instance, the seed sequence may consist in the sequence between position 2 and position 7, 8 or 9 of the mature miRNA.
  • the miRNA comprises, essentially consists in or consists in a sequence which is at least 80%, 85%, 90%, 95% or 99% identical to the respective full length sequence of the mature miRNA.
  • the mature miRNA sequence is selected in the group consisting of SEQ ID Nos 1, 3, 5, 7 and 9, preferably selected in the group consisting of SEQ ID Nos 1, 3, 5, and 7.
  • the miRNA comprises, essentially consists in or consists in a sequence which is at least 80%, 85%, 90%, 95% or 99% identical to the respective full length sequence of the mature miRNA and comprises a sequence identical to the seed sequence.
  • the miRNAs as pre-miRNA has a stem-loop sequence and comprises a guide strand comprising the mature miRNA, and more specifically the seed sequence, and a passenger strand which is complementary or substantially complementary to the seed sequence of the guide strand.
  • an alternative miRNA can be a double-stranded molecule comprising two separate strands as defined before instead of the stem-loop structure.
  • the guide strand comprises a sequence which is identical or substantially identical to the seed sequence.
  • substantially identical is meant that at most 1 or 2 substitutions or deletions are allowed.
  • the guide strand comprises a sequence which is at least 80%, 85%, 90%, 95% or 99% identical to the respective full length sequence of the mature miRNA.
  • the mature miRNA sequence is selected in the group consisting of SEQ ID Nos 1, 3, 5, 7 and 9, preferably selected in the group consisting of SEQ ID Nos 1, 3, 5, and 7.
  • the guide strand of the miRNA comprises a sequence which is at least 80%, 85%, 90%, 95% or 99% identical to the guide strand of pre-miRNA as disclosed in a sequence selected in the group consisting of SEQ ID Nos 2, 4, 6, 8 and 10, preferably selected in the group consisting of SEQ ID Nos 2, 4, 6, and 8.
  • the guide strand of the miRNA comprises, essentially consists in or consists in a sequence of the guide strand of pre-miRNA as disclosed in a sequence selected in the group consisting of SEQ ID Nos 2, 4, 6, 8 and 10, preferably selected in the group consisting of SEQ ID Nos 2, 4, 6, and 8.
  • the passenger strand comprises a sequence which is at least 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% identical to the complement of the respective full length sequence of the mature miRNA.
  • the mature miRNA sequence is selected among the SEQ ID Nos 1, 3, 5, 7 and 9, preferably selected in the group consisting of SEQ ID Nos 1, 3, 5, and 7.
  • the passenger strand of the miRNA comprises a sequence which is at least 80%, 85%, 90%, 95% or 99% identical to the passenger strand of pre-miRNA as disclosed in a sequence selected in the group consisting of SEQ ID Nos 2, 4, 6, 8 and 10, preferably selected in the group consisting of SEQ ID Nos 2, 4, 6, and 8.
  • the passenger strand of the miRNA comprises, essentially consists in or consists in a sequence of the passenger strand of pre-miRNA as disclosed in a sequence selected in the group consisting of SEQ ID Nos 2, 4, 6, 8 and 10, preferably selected in the group consisting of SEQ ID Nos 2, 4, 6, and 8.
  • the miRNA is between 17 and 30 nucleotides in length, preferably 22-23 nucleotides in length, and comprises (i) a microRNA region having a sequence from 5' to 3' that is at least 80 % identical to at least one of SEQ ID Nos 1, 3, 5, 7 and 9, preferably SEQ ID Nos 1, 3, 5, and 7; and (ii) a complementary region having a sequence from 5' to 3' that is 60-100 % complementary to the microRNA region.
  • the microRNA region has a sequence that is at least 80, 85, 90, 95 or 100 % identical to at least one of SEQ ID Nos 1, 3, 5, 7 and 9, preferably SEQ ID Nos 1, 3, 5, and 7.
  • the miRNA comprises a hairpin structure.
  • the miRNA is between 17 and 30 nucleotides in length, preferably 22-23 nucleotides in length, and comprises (i) a first polynucleotide having a sequence from 5' to 3' that is at least 80 % identical to at least one of SEQ ID Nos 1, 3, 5, 7 and 9, preferably SEQ ID Nos 1, 3, 5, and 7; and (ii) a second separate polynucleotide having a sequence that is 60-100 % complementary to the first polynucleotide.
  • the microRNA region has a sequence that is at least 80, 85, 90, 95 or 100 % identical to at least one of SEQ ID Nos 1, 3, 5, 7 and 9, preferably SEQ ID Nos 1, 3, 5, and 7.
  • the miRNA can include some chemical modifications, in particular for increasing its stability, resistance to degradation and/or its cellular uptake.
  • microRNA molecules may be modified to stabilize the miRNAs against degradation, to enhance half -life, or to otherwise improve efficacy. Desirable modifications are described, for example, in US20070213292, US20060287260, US20060035254, US20060008822, WO2015131115, US2016053264, WO2010144485 and US20050288244, each of which is hereby incorporated by reference in its entirety.
  • the miRNA can include 5' cap, 3' cap, backbone modifications, ribose modifications, mismatch, as well as nucleobase modifications.
  • Ribose modifications include 2'-0-methyl, 2'-0-methoxy, 2'-0-fluorine, 2'-0-methoxyethyl, 2'-0- aminopropyl, 2'-amino.
  • Backbone modifications include phosphorothioate linkages or morpholinos.
  • the 5' cap refers to at least one modified nucleotide that block 5 ⁇ or 5' phosphate at the 5' terminus.
  • the modification can be selected among an amine group, biotin, a lower alkylamine group, NHCOCH3, an acetyl group, 2' oxygen-methyl (2'OMe), 4'thionucleotide, phosphorothioate linkage, abasic residue, inverted nucleotide or inverted abasic moiety, phosphorodithioate monophosphate and methylphosphonate moiety.
  • Modified bases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5- hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2- thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4- thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo (including 5-brom
  • the guide strand of pre-miRNA or mature miRNA can include 2'-fluorine modifications while the passenger strand can include 2'-0-methyl modifications.
  • the miRNA comprises one or more of the following (i) a replacement group for phosphate or hydroxyl of the nucleotide at the 5' terminus of the complementary strand or passenger strand (5' cap); (ii) one or more sugar modifications in the first or last 1-6 residues of the complementary strand or passenger strand; or (iii) non-complementarity between one or more nucleotides in the last 1 - 5 residues at the 3' end of the complementary strand or passenger strand and the corresponding nucleotides of the microRNA region or guide strand.
  • the miRNA comprises a fully complementary passenger strand comprising (i) modified nucleotides in the first and last two nucleotides of the passenger strand, and/or (ii) a terminal modification of the nucleotide at the 5 'end.
  • the passenger strand comprises modified nucleotides and fewer than half of the total number of nucleotides in the passenger are modified nucleotides. For instance, 2-10, 4-8 or 5-7 nucleotides in the passenger are modified nucleotides. In a particular embodiment, the modified nucleotides are selected from the group consisting of the two-three first and the two last nucleotides of the passenger strand.
  • the guide strand comprises at least one or two modified nucleotides.
  • the guide strand does not comprise modified nucleotides in the first two positions at the 5' end of the guide strand and/or in the last two positions at the 3' end of the guide strand.
  • the microRNA molecules may comprise alternate stretches or portions of nucleotides with 2' -O-methyl modifications and stretches or portions of nucleotides without the modification.
  • alternate stretches or portions it is meant that, when considering the double-stranded RNA molecule, for each pair of nucleotides, at least one nucleotide of the pair, preferably only one, has a 2' -O-methyl modification.
  • the length of the stretches/portions can vary from 1 to 7 consecutive nucleotides. Accordingly, just for illustrating this aspect, the mature miRNA may present one of the following structures:
  • N refers to a nucleotide having 2' -O-methyl modification.
  • the microRNA molecules may comprise stretches or portions of nucleotides with 2' -O-methyl modifications.
  • both nucleotide of the pair have 2' -O-methyl modifications.
  • the length of the stretches/portions can vary from 1 to 7 consecutive nucleotides.
  • N refers to a nucleotide having 2' -O-methyl modification.
  • the miRNA can present a modification at one or both 3' ends, preferable a modified sugar.
  • modified sugar is Triantennary N-acetyl galactosamine (GalNAC 3 ).
  • GalNAC 3 Triantennary N-acetyl galactosamine
  • the miRNA may be linked to a moiety allowing the targeting of the liver.
  • the disclosure provides a nucleic acid molecule or any modified molecule derivatives encoding or leading to a miRNA as disclosed above and a recombinant expression vector comprising a recombinant nucleic acid sequence operatively linked to an expression control sequence, wherein expression of the recombinant nucleic acid sequence provides a miRNA sequence, a precursor miRNA sequence, or a primary miRNA sequence as described herein.
  • the resulting sequence e.g., primary or precursor miRNAs
  • the recombinant expression vector comprises at least one sequence selected from the group consisting of SEQ ID Nos 1-10, preferably of SEQ ID Nos 1-8.
  • any suitable expression vector can be used such as, for example, a DNA vector (e.g., viral vector, plasmid, etc.).
  • the expression vector is selected for expression in a eukaryotic cell such as, for example, a mammalian cell.
  • a eukaryotic cell such as, for example, a mammalian cell.
  • the expression cassette is comprised in a viral vector, or plasmid DNA vector or other therapeutic nucleic acid vector or delivery vehicle, including liposomes and the like. miRNA therapeutic uses.
  • the miRNA miR-548z, miR-624-5p, let-7i-3p, miR-449b-3p, miR-885-5p and any combination thereof as disclosed above can be used for treating a hepatoblastoma.
  • the present disclosure also relates a pharmaceutical composition comprising miR-548z, miR-624-5p, let-7i-3p, miR-449b-3p, miR-885-5p and any combination thereof.
  • the miRNA can be selected in the group consisting of miR-548z, miR-624-5p, let-7i-3p, miR-449b-3p, miR-885-5p and any combination of two, three, four or five miRNA.
  • the miRNA can be selected in the group consisting of miR-548z, miR-624-5p, let-7i-3p, miR- 449b-3p, and any combination of two, three, or four miRNA.
  • the combination may include at least miR-548z and 1-4 miRNA selected among miR-624- 5p, let-7i-3p, miR-449b-3p, and miR-885-5p, e.g., miR-548z and miR-624-5p; miR-548z and let-7i-3p; miR-548z and miR-449b-3p; miR-548z and miR-885-5p; miR-548z, miR-624-5p, and let-7i-3p; miR- 548z, miR-624-5p, and miR-449b-3p; miR-548z, miR-624-5p, and miR-885-5p; miR-548z, let-7i-3p, and miR-449b-3p; miR-548z, let-7i-3p, and miR-885-5p; miR-548z, miR-449b-3p; miR-885-5p; miR-548z, miR-449b-3p; miR-548z, let-7
  • the combination can further comprise an additional miRNA, for instance miR-34a.
  • the combination may include at least miR-624-5p and 1-4 miRNA selected among miR-548z, let-7i-3p, miR-449b-3p, and miR-885-5p, e.g., miR-624-5p and let-7i-3p; miR-624- 5p and miR-449b-3p; miR-624-5p and miR-885-5p; miR-624-5p, let-7i-3p and miR-449b-3p; miR-624- 5p, let-7i-3p and miR-885-5p; miR-624-5p, miR-449b-3p and miR-885-5p; and miR-624-5p, let-7i-3p, miR-449b-3p and miR-885-5p.
  • the combination can further comprise an additional miRNA, for instance miR-34a.
  • the combination may include at least let-7i-3p and 1 -4 miRNA selected among miR-548z, miR-624-5p, miR-449b-3p, and miR-885-5p, e.g., let-7i-3p and miR-449b-3p; let-7i- 3p and miR-885-5p; and let-7i-3p, miR-449b-3p and miR-885-5p.
  • the combination may include at least miR-449b-3p and 1-4 miRNA selected among miR-548z, miR-624-5p, let-7i-3p, and miR-885-5p, e.g., miR-449b-3p and miR-885- 5p.
  • the combination can further comprise an additional miRNA, for instance miR-34a.
  • the combination may include at least miR-885-5p and 1-4 miRNA selected among miR-548z, miR-624-5p, let-7i-3p, and miR-449b-3p.
  • the combination can further comprise an additional miRNA, for instance miR-34a.
  • the miRNA and any combination thereof can be used for treating a hepatoblastoma.
  • Their use for the treatment of other specific solid cancers with or without liver involvement can also be contemplated, in particular breast, colorectal, esophageal, lung, melanoma, pancreatic, stomach, ovaries, neuroendocrine, uterus, CNS (central nervous system) and brain cancer.
  • the subject can be a child.
  • the liver cancer is a hepatoblastoma and the subject is a child.
  • the subject does not respond to the first line treatment and/or is not suitable for tumor resection or ablation.
  • the miRNA or combination thereof can be used in combination with one or more therapeutic agents, especially any antitumor treatment.
  • the miRNA is to be used in combination with resection, radioirequency ablation and/or percutaneous ethanol injection.
  • the molecule is to be used after or before resection, radioirequency ablation and/or percutaneous ethanol injection.
  • the miRNA is to be used in combination with a chemotherapy.
  • the present invention relates to a pharmaceutical composition
  • a pharmaceutical composition comprising one or several miRNA selected from the group consisting of hsa-miR-548z, hsa-miR-624-5p, hsa-let-7i-3p, hsa-miR-449b-3p, hsa-miR-885-5p or any combination thereof and another drug, in particular an antitumor drug.
  • a product comprising one or several miRNA selected from the group consisting of hsa-miR-548z, hsa-miR-624- 5p, hsa-let-7i-3p, hsa-miR-449b-3p, hsa-miR-885-5p or combination thereof and another drug, in particular an antitumor drug, as a combined preparation for simultaneous, separate or sequential use, preferably for treating a solid cancer, in particular a hepatoblastoma.
  • the miRNA can be selected in the group consisting of miR-548z, miR-624-5p, let-7i-3p, miR-449b-3p, and any combination of two, three, or four miRNA.
  • the antitumor drug can selected from the group consisting of an inhibitor of topoisomerases I or II, a DNA crosslinker, a DNA alkylating agent, an anti-metabolic agent and inhibitors of the mitotic spindles. It can also be an immunotherapy.
  • doxorubicin doxorubicin, cisplatin, carboplatin, gemcitabine, oxaliplatin, mitomycin C, tamoxifen, paclitaxel, larotaxel, taxol, lapatinib, docetaxel, methotrexate, capecitabine, vinorelbine, cyclophosphamide, gemcitabine, amrubicin, cytarabine, etoposide, camptothecin, dexamethasone, dasatinib, tipifarnib, bevacizumab, sirolimus, temsirolimus, everolimus, lonafarnib, cetuximab, erlotinib, gefitinib, imatinib mesylate, rituximab, trastuzumab, nocodazole, sorafenib, sunitinib, bortezomib, MSC2156
  • the molecule is to be used in combination with another antitumor therapy and a drug lowering/decreasing the toxicity and side effects of the antitumor therapy.
  • the drug lowering the toxicity and side effects of the antitumor therapy can be sodium thiosulfate or N-acetyl cysteine.
  • the molecule is to be used in combination with cisplatin and, sodium thiosulfate or N-acetyl cysteine.
  • the molecule is to be used in combination with doxorubicin and, sodium thiosulfate or N-acetyl cysteine.
  • Inhibitors of topoisomerases I and/or II include, but are not limited to, etoposide, topotecan, camptothecin, irinotecan, amsacrine, intoplicin and anthracyclines such as doxorubicin, epirubicin, daunorubicin, idarubicin and mitoxantrone.
  • Inhibitors of Topoisomerase I and II include, but are not limited to, intoplicin.
  • DNA crosslinkers include, but are not limited to, cisplatin, carboplatin and oxaliplatin. In a preferred embodiment, the DNA crosslinker is cisplatin.
  • Anti-metabolic agents block the enzymes responsible for nucleic acid synthesis or become incorporated into DNA, which produces an incorrect genetic code and leads to apoptosis.
  • Non-exhaustive examples thereof include, without limitation, folic acid antagonists, pyrimidine analogs, purine analogs and adenosine deaminase inhibitors, and more particularly Methotrexate, Floxuridine, Cytarabine, 6- Mercaptopurine, 6- Thioguanine, Fludarabine phosphate, Pentostatine, 5-fluorouracil, gemcitabine and capecitabine.
  • the DNA-damaging anti-tumoral agent can be alkylating agents including, without limitation, nitrogen mustards, ethylenimine derivatives, alkyl sulfonates, nitrosoureas, metal salts and triazenes.
  • alkylating agents including, without limitation, nitrogen mustards, ethylenimine derivatives, alkyl sulfonates, nitrosoureas, metal salts and triazenes.
  • Non- exhaustive examples thereof include Uracil mustard, Chlormethine, Cyclophosphamide (CYTOXAN(R)), Ifosfamide, Melphalan, Chlorambucil, Pipobroman, Triethylenemelamine, Triethylenethiophosphor amine, Busulfan, Carmustine, Lomustine, cisplatin, carboplatin, oxaliplatin, thiotepa, Streptozocin, dacarbazine, and Temozolomide.
  • the therapeutic agent can also be an immunotherapeutic drug.
  • immunotherapeutic drug refers to a cancer therapeutic treatment with therapeutic antibodies.
  • antibodies are directed against specific antigens such as the unusual antigens that are presented on the surface of tumors or targeting immune system checkpoints (e.g. immune checkpoint inhibitors).
  • immune system checkpoints e.g. immune checkpoint inhibitors.
  • therapeutic antibodies functions to deplete tumor cells in a patient.
  • therapeutic antibodies specifically bind to antigens present on the surface of the tumor cells, e.g. tumor specific antigens present predominantly or exclusively on tumor cells.
  • therapeutic antibodies may also prevent tumor growth by blocking specific cell receptors.
  • the immunotherapeutic drug may target multiple elements of the immune pathway: a therapy that enhances tumor antigen presentation; a therapy that inhibits negative immune regulation e.g., by inhibiting CTLA-4 and/or PD1/PD-L1/PD-L2 pathway and/or depleting or blocking Tregs or other immune suppressing cells; a therapy that stimulates positive immune regulation, e.g., with agonists that stimulate the CD- 137, OX-40, and/or GITR pathway and/or stimulate T cell effector function; a therapy that increases systemically the frequency of anti-tumor T cells; a therapy that depletes or inhibits Tregs, such as Tregs in the tumor, e.g., using an antagonist of CD25 (e.g., daclizumab) or by ex vivo anti-CD25 bead depletion; a therapy that impacts the function of suppressor myeloid cells in the tumor; a therapy that enhances immunogenicity of tumor cells (e.g., anthracyclines); adopt
  • the immunotherapeutic drug is a drug targeting PD-1 or PD-L1.
  • the PD- 1/PD-Ll agent is preferably selected from the group consisting of Nivolumab (Opdivo, Bristol-Myers Squibb), Pembrolizumab (Keytruda, MK-3475, Merck), Pidilizumab (CT-011, Cure Tech), BMS 936559 (Bristol Myers Squibb), atezolizumab or MPDL3280A (Roche), and a combination thereof.
  • the combined association of one or several miRNA as disclosed herein with another antitumor drug can allow the use of a lower/decreased amount of the other antitumor drug that could result in a reduction of the adverse effects and toxicity.
  • the amount of the other antitumor drug can be a sub-therapeutic amount. More specifically, the other antitumor drug is used at lower dosage than the conventional dosage used in chemotherapy for the same indication and the same administration route when it is used alone (i.e., an amount equal to or preferably lower than the one used in conventional chemotherapy), also called herein a sub-therapeutic amount.
  • the amount can be for instance 90, 80, 70, 60, 50, 40, 30, 20 or 10 % of the conventional therapeutic dosage (in particular for the same indication and the same administration route).
  • the conventional therapeutic dosages are those acknowledged by the drug approvals agencies (e.g., FDA or EMEA) and can be found in reference Manuals such as Merck Manuals (www.merck.com/mmpe/lexicomp/).
  • the administration frequency of the other antitumor drug or its treatment period can be reduced.
  • the treatment period may be reduced, for instance by 90, 80, 70, 60 or 50%.
  • the interval between treatments with the other antitumor drug can be increased, for instance by 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100% or by 1.5, 2, 2.5 or 3 fold.
  • the present invention relates to a method of treating a patient with a hepatoblastoma cancer comprising (a) administering to the patient a therapeutically effective amount of a molecule selected from the group consisting of hsa-miR-548z, hsa-miR-624-5p, hsa-let-7i-3p, hsa-miR-449b-3p, hsa-miR-885-5p or any combination thereof or a DNA or RNA encoding for said miRNA; and (b) administering a second therapy, wherein the molecule sensitizes the patient to the second therapy.
  • the second therapy is another antitumor drug.
  • the other antitumor drug is cisplatin or doxorubicin.
  • the other antitumor drug is administered in a sub-therapeutic amount.
  • the miRNA can be selected in the group consisting of miR-548z, miR-624-5p, let-7i-3p, miR-449b-3p, and any combination of two, three, or four miRNA.
  • miRNAs, pharmaceutical compositions, or products of the invention can be used in humans with existing cancer or tumour, including at early or late stages of progression of the cancer.
  • the miRNAs, pharmaceutical compositions, or products of the invention will not necessarily cure the patient who has the cancer but will delay or slow the progression or prevent further progression of the disease, ameliorating thereby the patients' condition or survival.
  • the miRNAs, pharmaceutical compositions, or products of the invention reduce the development of tumors, reduce tumor burden, produce tumor regression in a mammalian host and/or prevent metastasis occurrence and cancer relapse.
  • the pharmaceutical composition of the invention is administered in a therapeutically effective amount.
  • the term “treatment”, “treat” or “treating” refers to any act intended to ameliorate the health status of patients such as therapy, prevention, prophylaxis and retardation of the disease.
  • such term refers to the amelioration or eradication of a disease or symptoms associated with a disease.
  • this term refers to minimizing the spread or worsening of the disease resulting from the administration of one or more therapeutic agents to a subject with such a disease.
  • the treatment may reduce the development of tumors, reduce tumor burden, produce tumor regression in a mammalian host and/or prevent metastasis occurrence and cancer relapse.
  • the effective amount or “therapeutically effective” it is meant the quantity of the pharmaceutical composition of the invention which prevents, removes or reduces the deleterious effects of the treated disease in mammals, including humans. It is understood that the administered dose may be adapted by those skilled in the art according to the patient, the pathology, the mode of administration, etc.
  • the effective amount can be the amount necessary for decreasing or repressing the expression of CTNNB 1 gene, e.g., by at least 10, 20, 30, 40 or 50 % in comparison to the expression in a normal tissue.
  • the effective amount can be the amount necessary for decreasing the tumour growth, inducing tumour regression, decreasing, slowing or preventing the occurrence of metastasis and/or cancer relapse, and/or reducing the development of tumors.
  • a miRNA may be administered in dosages between about 0.01 and 100 mg/kg of body weight (e.g., 1, 5, 10, 20, 25, 50, 75, and 100 mg/kg). In other embodiments, the dosage ranges from between about 10 and 500 mg/m 2 /day.
  • the miRNA can be administered 1, 2, 3, 4, 5, 6, or 7 times by week.
  • the pharmaceutical composition of the invention can comprise a pharmaceutically acceptable carrier.
  • Pharmaceutically acceptable carriers are covalently or non-covalently bound, admixed, encapsulated, conjugated, operably-linked, or otherwise associated with the miRNA such that the pharmaceutically acceptable carrier increases the cellular uptake, stability, solubility, half-life, binding efficacy, specificity, targeting, distribution, absorption, or renal clearance of the miRNA.
  • Pharmaceutically acceptable carriers of the invention are viral and non- viral miRNA delivery systems/mechanisms that increase uptake of the miRNA by targeted cells.
  • pharmaceutically acceptable carriers of the invention are liposomes, lipids, for example cationic lipids, anionic lipids, amphoteric lipids or uncharged lipids, cationic polymers, polymers, hydrogels, micro- or nano-capsules (biodegradable), microspheres (optionally bioadhesive), cyclodextrins, proteinaceous vectors, or any combination of the preceding elements.
  • pharmaceutically acceptable carriers that increase cellular uptake can be modified with cell-specific proteins or other elements such as receptors, ligands, antibodies to specifically target cellular uptake to a chosen cell type.
  • the person skilled in the art has several delivery means available as shown for instance by Zhang et al (2013, J Control Release, 172, 962-974), Garzon et al (2010, Nat Rev Drg Discov, 9, 775-789), and Zhao et al (2009, Exp. Opin. Drug Deliv. 6:673-686).
  • the delivery system can be selected among the lipid-based delivery system, the PEI (polyethylenimine)-based delivery system, dendrimers, PLGA (poly(lactide-co-glycolide)) particles, WO 15023775, and the like.
  • the pharmaceutically acceptable carriers will protect the miRNA against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems.
  • a controlled release formulation including implants and microencapsulated delivery systems.
  • Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, poly anhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. The materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc.
  • Examples of materials which can form hydrogels include polylactic acid, polyglycolic acid, PLGA polymers, alginates and alginate derivatives, gelatin, collagen, agarose, natural and synthetic polysaccharides, polyamino acids such as polypeptides particularly poly (lysine), polyesters such as polyhydroxybutyrate and poly- epsilon.-caprolactone, poly anhydrides; polyphosphazines, poly(vinyl alcohols), poly(alkylene oxides) particularly poly(ethylene oxides), poly(allylamines)(PAM), poly(acrylates), modified styrene polymers such as poly(4-aminomethylstyrene), pluronic polyols, polyoxamers, poly(uronic acids), poly(vinylpyrrolidone) and copolymers of the above, including graft copolymers.
  • polyamino acids such as polypeptides particularly poly (lysine)
  • polyesters such as polyhydroxybutyrate
  • Liposomal suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.
  • exemplary cationic lipids include, but are not limited to, 1-dialkenoyl-sn-glycero-S- ethylphosphocholines (EPCs), such as 1 - dioleoyl-sn-glycero-S-ethylphosphocholine, l,2-distearoyl-sn-glycero-3-ethylphosphocholine, 1,2- dipalmitoyl-sn-glycero-3-ethylphosphocholine, pharmaceutically acceptable salts thereof, and mixtures thereof.
  • EPCs 1-dialkenoyl-sn-glycero-S- ethylphosphocholines
  • Exemplary polycationic lipids include, but are not limited to, tetramethyltetrapalmitoyl spermine (TMTPS), tetramethyltetraoleyl spermine (TMTOS), tetramethlytetralauryl spermine (TMTLS), tetramethyltetramyristyl spermine (TMTMS), tetramethyldioleyl spermine (TMDOS), pharmaceutically acceptable salts thereof, and mixtures thereof.
  • TTPS tetramethyltetrapalmitoyl spermine
  • TTOS tetramethyltetraoleyl spermine
  • TTLS tetramethlytetralauryl spermine
  • TTMTMS tetramethyltetramyristyl spermine
  • TMDOS tetramethyldioleyl spermine
  • polycationic lipids include, but are not limited to, 2,5-bis(3-aminopropylamino)-N-(2-(dioctadecylamino)-2- oxoethyl)pentanamide (DOGS); 2,5-bis(3-aminopropylamino)-N-(2-(di(Z)-octadeca-9-dienylamino)-2-oxoethyl) pentanamide (DOGS- 9-en); 2,5-bis(3-aminopropylamino)-N-(2-(di(9Z,12Z)-octadeca-9,12-dienylamino)-2- oxoethyl)pentanamide (DLinGS); 3-beta-(N4-(N 1, Nd-dicarbobenzoxyspermidinearbamoychole-sterol (GL-67); l,3-dioleoy
  • cationic lipids examples include U.S. Pat. Nos. 4,897,355; 5,279,833; 6,733,777; 6,376,248; 5,736,392; 5,334,761 ; 5,459,127; 2005/0064595; U.S. Pat. Nos. 5,208,036; 5,264,618; 5,279,833; 5,283,185; 5,753,613; and 5,785,992.
  • Non-cationic lipids such as neutral, zwitterionic, and anionic lipids.
  • exemplary non-cationic lipids include, but are not limited to, 1,2- Dilauroyl-sn-glycerol (DLG); 1 ,2-Dimyristoyl-snglycerol (DMG); 1,2- Dipalmitoyl-sn-glycerol (DPG); 1 ,2-Distearoyl-sn-glycerol (DSG); l,2-Dilauroyl-sn-glycero-3- phosphatidic acid (sodium salt; DLPA); l,2-Dimyristoyl-snglycero-3-phosphatidic acid (sodium salt; DMPA); l,2-Dipalmitoyl-sn-glycero-3- phosphatidic acid (sodium salt; DPP A); l,2-Distearoyl-sn-glycero-3-phosphatedic acid (sodium
  • non-cationic lipids include, but are not limited to, polymeric compounds and polymer-lipid conjugates or polymeric lipids, such as pegylated lipids, including polyethyleneglycols, N-(Carbonylmethoxypolyethyleneglycol-2000)-l,2- dimyristoyl-sn-glycero-3-phosphoethanolamine (sodium salt; DMPE-MPEG-2000); N-(Carbonyl- methoxypolyethyleneglycol-5000)-l,2- dimyristoyl-sn-glycero-3-phosphoethanolamine (sodium salt; DMPE-MPEG-5000) ; NtCarbonyl-methoxypolyethyleneglycol 2000)-l,2-dipalmitoyl-sn-glycero-3 - phosphoethanolamine (sodium salt; DPPE-MPEG-2000); N-(Carbonyl-methoxypolyethyleneglycol 500O)-l,2-dipalmito
  • non- cationic lipids include, but are not limited to, dioleoylphosphatidylethanolamine (DOPE), diphytanoylphosphatidylethanolamine (DPhPE), 1,2- Dioleoyl-sn-Glycero-3- Phosphocholine (DOPC), l,2-Diphytanoyl-sn-Glycero-3-Phosphocholine (DPhPC), cholesterol, and mixtures thereof.
  • DOPE dioleoylphosphatidylethanolamine
  • DPhPE diphytanoylphosphatidylethanolamine
  • DOPC 1,2- Dioleoyl-sn-Glycero-3- Phosphocholine
  • DPhPC 1,2- Dioleoyl-sn-Glycero-3-Phosphocholine
  • cholesterol and mixtures thereof.
  • Pharmaceutically-acceptable carriers of the invention further include anionic lipids.
  • anionic lipids include, but are not limited to, phosphatidylserine, phosphatidic acid, phosphatidylcholine, platelet-activation factor (PAF), phosphatidylethanolamine, phosphatidyl- DL-glycerol, phosphatidylinositol, phosphatidylinositol (pi(4)p, pi(4,5)p2), cardiolipin (sodium salt), lysophosphatides, hydrogenated phospholipids, sphingoplipids, gangliosides, phytosphingosine, sphinganines, pharmaceutically acceptable salts thereof, and mixtures thereof.
  • nucleic acid molecules for use herein are described, e.g., in Akhtar, et al., Trends Cell Bio. 2: 139, 1992; Delivery Strategies for Antisense Oligonucleotide Therapeutics, ed. Akhtar, 1995; Maurer, et al., Mol. Membr. Biol. 16: 129-140, 1999; Hofland and Huang, Handb. Exp. Pharmacol. 137: 165-192, 1999; and Lee, et al., ACS Symp. Ser. 752: 184-192, 2000. Sullivan, et al., International PCT Publication No. WO 94/02595, further describes general methods for delivery of enzymatic nucleic acid molecules.
  • Amphoteric liposomes can also be used as pharmaceutically acceptable carriers such as those disclosed in US 8,580,297 (the disclosure thereof being incorporated herein by reference).
  • the materials can also be obtained commercially from Marina Biotech (Smarticles ® ).
  • the miRNA and pharmaceutical composition can be administered by local or systemic routes.
  • the miRNA and pharmaceutical composition can be administered or suitable for being administered by enteral routes, parenteral routes (including subcutaneous, intravenous, intramuscular, intratumoral, or intraperitoneal), or by rectal, topical, transdermal, or oral routes.
  • the nucleic acid molecules of the present invention may be alternatively delivered into a target cell using a viral vector.
  • the viral vector may be any virus which can serve as a viral vector. Suitable viruses are those which infect the target cells, can be propagated in vitro, and can be modified by recombinant nucleotide technology known in the art.
  • Viral vectors expressing nucleic acids of the invention can be constructed based on viral backbones including, but not limited to, a retrovirus, lentivirus, adenovirus, adeno-associated virus, pox virus or alphavirus.
  • Adenovirus-associated vectors are an appealing method since they have acceptable toxicity profiles and have been successfully used to restore miRNA expression.
  • the viral vector is a non-replicating viral vector.
  • the viral vector is a non-integrative viral vector, in particular for preventing any oncogenic effect associated with the knock-down of tumor suppressor gene by insertional mutation.
  • the viral vector is a non-replicating non-integrative viral vector.
  • the non-replicating poxvirus vector is selected from: a Modified Vaccinia virus Ankara (MVA) vector, a NYVAC vaccinia virus vector, a canarypox (ALVAC) vector, and a fowlpox (FPV) vector.
  • the adenovirus vector is a non- replicating adenovirus vector (wherein non-replicating is defined as above).
  • Adenoviruses can be rendered non- replicating by deletion of the El or both the El and E3 gene regions.
  • an adenovirus may be rendered non-replicating by alteration of the El or of the El and E3 gene regions such that said gene regions are rendered non- functional.
  • a non-replicating adenovirus may lack a functional El region or may lack functional El and E3 gene regions.
  • the adenovirus vector is selected from: a human adenovirus vector, a simian adenovirus vector, a group B adenovirus vector, a group C adenovirus vector, a group E adenovirus vector, an adenovirus 6 vector, a PanAd3 vector, an adenovirus C3 vector, a ChAdY25 vector, an AdC68 vector, and an Ad5 vector.
  • One or several miRNA selected from the group consisting of miR-548z, miR-624-5p, let-7i-3p, miR- 449b-3p, can be used as a biomarker. More specifically, they can be used as a biomarker of a hepatoblastoma. In addition, they can be used as a biomarker of the outcome of a hepatoblastoma. Their expression can be correlated with the good or bad prognosis. Therefore, they can be used for detecting a hepatoblastoma cancer or a predisposal or susceptibility to develop a hepatoblastoma cancer or for predicting clinical prognosis of a hepatoblastoma cancer.
  • the present invention relates to kits and methods for providing information useful for detecting a hepatoblastoma cancer or a predisposal or susceptibility to develop a hepatoblastoma cancer, or for predicting clinical prognosis or outcome of a hepatoblastoma cancer or for selecting a subject suitable for a treatment by a miRNA as disclosed above.
  • the present invention also relates to a kit for detecting a hepatoblastoma cancer or a susceptibility to develop a hepatoblastoma cancer in a subject or for selecting a subject suitable for a treatment by a miRNA as disclosed above or for determining the prognosis of a subject having a hepatoblastoma cancer, the kit comprising detection means for at least one miRNA selected from the group consisting of miR-548z, miR-624-5p, let-7i-3p, miR-449b-3p or for any combination thereof.
  • the kit comprises detection means specific for at least 2, 3, 4 or 5 of miR-548z, miR-624-5p, let-7i-3p, miR- 449b-3p and miR-885-5p.
  • the kit does not comprise detection means specific for more than 10 miRNAs.
  • Detection means are preferably primers or probes specific for miR-548z, miR-624-5p, let-7i-3p, miR- 449b-3p or miR-885-5p.
  • the one or several miRNA are selected from the group consisting of miR-548z, miR-624-5p, let-7i-3p, and miR-449b-3p.
  • the kit may comprises detection means specific for one of the following combination: miR-624-5p, let-7i-3p, miR-449b-3p, and miR-885-5p, e.g., miR- 548z and miR-624-5p; miR-548z and let-7i-3p; miR-548z and miR-449b-3p; miR-548z and miR-885- 5p; miR-548z, miR-624-5p, and let-7i-3p; miR-548z, miR-624-5p, and miR-449b-3p; miR-548z, miR- 624-5p, and miR-885-5p; miR-548z, let-7i-3p, and miR-449b-3p; miR-548z, let-7i-3p, and miR-885- 5p; miR-548z, miR-449b-3p, and miR-885- 5p; miR-548z, miR-449b-3p, and miR-885- 5p
  • the present invention also relates to the use of the kit for detecting a hepatoblastoma cancer or a susceptibility to develop a hepatoblastoma cancer in a subject or for selecting a subject suitable for a treatment by a miRNA as disclosed above or for determining the prognosis or clinical outcome in a subject having a hepatoblastoma cancer.
  • an under-expression of the miRNA as disclosed herein is indicative of a hepatoblastoma cancer, a predisposition to develop a hepatoblastoma cancer or a suitability to be treated with the miRNA as disclosed herein.
  • the under-expression of the miRNAs as disclosed herein is indicative of a hepatoblastoma.
  • the present invention relates to a method for determining if a subject has or is predisposed to a hepatoblastoma cancer, comprising determining the level of one or several miRNA selected from the group consisting of miR-548z, miR-624-5p, let-7i-3p, and miR-449b-3p in the biological sample from the subject, and wherein the subject has or is predisposed to a hepatoblastoma cancer if the level of one of said one or several miRNA is decreased when compared to a non-tumoral control or healthy subject.
  • the method may comprise an initial step of providing a biological sample from the subject.
  • the method may further comprise determining the level of miR- 885-5p.
  • the method may further comprise determining the expression level of catenin-beta 1 , an increased level of expression when compared to a healthy or non-tumoral control being indicative of a hepatoblastoma, a predisposition to develop a hepatoblastoma.
  • the present invention also relates to a method for selecting a subject suitable for a treatment by a miRNA selected from the group consisting of miR-548z, miR-624-5p, let-7i-3p, miR-449b-3p and miR-885-5p or any combination thereof, comprising determining the level of one or several miRNA selected from the group consisting of miR- 548z, miR-624-5p, let-7i-3p, miR-449b-3p and miR-885-5p in the biological sample from the subject, and selecting the subject if at least one of said miRNA is under-expressed in comparison with a healthy or non-tumoral control.
  • the method may comprise an initial step of providing a biological sample from the subject.
  • the biological sample from the subject is a tumor sample.
  • the present invention also relates to a method for selecting a subject suitable for a treatment by a miRNA selected from the group consisting of miR- 548z, miR-624-5p, let-7i-3p and miR-449b-3p or any combination thereof, determining the level of catenin-beta 1 thereof in a biological sample from the subject, and selecting the subject if catenin-beta 1 is upper-expressed or overexpressed in comparison with a healthy or non-tumoral control.
  • the biological sample from the subject is a tumor sample.
  • the method may further comprise administering an effective amount of a miRNA selected from the group consisting of miR-548z, miR-624-5p, let-7i-3p, miR-449b-3p and miR-885-5p or any combination thereof to said subject.
  • the present invention further relates to a method for determining a clinical prognosis or outcome in a subject having a hepatoblastoma. The method comprises determining the level of one or several miRNA selected from the group consisting of miR-624-5p miR-548z, , let-7i-3p and miR-449b-3p in the biological sample from the subject. The clinical prognosis is correlated with the level of expression of the miRNA.
  • the method may further comprise determining the level of miR-885-5p.
  • the level of miRNA can be determined by any method available to the one skilled in the art such as Northern blot analysis, RT-PCR, quantitative RT-PCR, microarray, in situ hybridization, RNA sequencing. miRNA expression can be quantified in a two-step polymerase chain reaction process of modified RT-PCR followed by quantitative PCR. miRNA expression can be quantified by hybridization on a microarray, RNA sequencing, slides or chips. For instance, probes or primers may be coupled to a support. Such supports are well known to those of ordinary skill in the art and include, but are not limited to glass, plastic, metal, or latex. The support can be planar or in the form of a bead or other geometric shapes or configurations known in the art.
  • the determination of the expression level can be carried out by forming a preparation comprising nucleic acid from said biological samples, an oligonucleotide probe or probes adapted to anneal to one or several miRNA selected from the group consisting of miR-548z, miR-624-5p, let-7i- 3p, miR-449b-3p or miR-885-5p, a thermostable DNA polymerase, deoxynucleotide triphosphates and co-factors; providing polymerase chain reaction conditions sufficient to amplify all or part of said nucleic acid molecule; analyzing the amplified products of said polymerase chain reaction for the presence of miRNA; and optionally comparing the amplified product with a normal matched control.
  • a preparation comprising nucleic acid from said biological samples, an oligonucleotide probe or probes adapted to anneal to one or several miRNA selected from the group consisting of miR-548z, miR-624-5p, let-7i- 3p,
  • the method can further comprise one or more of the steps including: (a) obtaining a sample from the patient, (b) isolating nucleic acids from the sample, (c) labeling the nucleic acids isolated from the sample, and (d) hybridizing the labeled nucleic acids to one or more probes.
  • the levels of miRNA are considered as under-expressed when decreased by at least 1.5 or 2 fold when compared to a normal control. More particularly, the levels are decreased by 3, 4, 5, 6, 7, 8, 9 or at least 10-fold compared to a normal control level.
  • the biological sample from the subject can be a sample from blood, blood plasma or serum, lymph fluid, spinal or cerebrospinal fluid, saliva, sputum, lavage, urine, feces, bronchoaveolar lavage, or human tissue biopsy, especially a tumor sample.
  • the sample is a blood sample, a liver sample or a liver tumor sample.
  • a normal, non-tumoral or healthy control is the miRNA in a sample from a histologically matched sample, for instance a subject which has no cancer or the miRNA in a normal or non-tumoral or healthy tissue taken at a reasonable distance of the tumor in a patient with a cancer.
  • Beta-catenin is an oncogene, especially in liver, and actively participates in HBL (hepatoblastoma) by sustaining tumoral cell proliferation, dedifferentiation and sternness (Armengol et al, 2011, Int J Biochem Cell Biol, 43, 265-270; Cairo et al, 2008, Cancer Cell, 14, 471-484).
  • HBL hepatoblastoma
  • the inventors' project aims at identifying miRNAs negatively regulating beta-catenin in HBL cells and blocking its oncogenic effect.
  • DFS-FunREG Dual Fluorescence-FunREG
  • UTRs beta-catenin 5'+3' untranslated regions
  • Tomato transgene a library of 1712 miRNA mimics (Qiagen, miRBase V17.0). 26 miRNAs decreasing the eGFP/Tomato ratio equal to or below an arbitrary threshold fold change value of -0.78 were pre-selected as candidates.
  • the inventors found miR-483-3p, a miRNA already known to target beta-catenin (Veronese et al, 2011, 108, 4840-4845) and miR-885-5p, which is down-regulated in HBL tumors compared to normal liver (NL) (Magrelli et al, 2009, 2, 157-163).
  • a secondary screen using HuH6 cells expressing an eGFP transgene lacking beta-catenin 5 '+3 '-UTRs and the Tomato was performed with the 26 miRNA candidates. Following this step, no false positive hit was found. Therefore the 26 miRNA candidates were retained for further analyses.
  • the inventors then studied if these 9 beta-catenin-repressing miRNAs regulate mRNA level. As shown in Figure 2, 7 out of 9 beta-catenin-repressing miRNAs also decreased the amount of mRNA. miR-1205 had no effect and unexpectedly, miR-492 slightly induced beta-catenin mRNA expression by a mechanism that remains to be determined.
  • mutated beta-catenin was more resistant to miRNA-mediated silencing, with only 4 out of the 9 miRNAs inducing a significant decrease of its expression in HepG2 cells and 3 (miR-548z, miR-5095 and miR- 1205) having a tendency to repress mutated beta-catenin expression.
  • the inventors identified and validated 9 new beta-catenin-inhibiting miRNAs in HBL-derived HuH6 and HepG2 cells.
  • the inventors also tested another childhood liver cancer cell line derived from a patient xenograft cell line, named HB-214-J, which also carry CTNNB1 deletion in exon 3 in one allele.
  • HB-214-J a patient xenograft cell line
  • all miRNAs had a negative effect on wild-type beta-catenin, except miR-885-5p and miR-449b-3p ( Figure
  • miR-34a-5p the miRNA currently tested in clinic for the treatment of patients with liver cancer (see www.mirnatherapeutics.com) (Bader et al, 2012, Front Genet, 3, 120), was not deregulated in HBL tumors compared to NL ( Figure
  • the inventors also tested two other childhood liver cancer cell lines, HepG2 and HB-214-J.
  • the four miRNAs showed similar cell growth inhibition pattern (Figure 8) despite some differences in the inhibition of wild-type or exon 3-deleted beta-catenin protein.
  • let- 7i-3p modestly inhibited the growth of these cells while it was particularly efficient in Huh6 cells ( Figure 7).
  • miR-449b-3p efficiently inhibited the growth of HepG2 and HB-214-J cells, while it had a modest effect on Huh6 cell growth (Figure 7).
  • the inventors To explain the negative effect of the 5 miRNAs on HuH6 cell growth, the inventors first measured the number of cells in the different phases of the cell cycle. As shown in Figure 9, the 5 miRNAs reduced HuH6 cell cycling by lengthening G0/G1 phase and shortening S phase. Here again miR-548z, miR- 624-5p and let-7i-3p were the most potent, thereby explaining the strong inhibitory effect previously observed with these 3 miRNAs on HBL cell growth in Figures 7 and 8. These 3 miRNAs blocked HuH6 cell cycling as effectively as a specific siRNA targeting beta-catenin, but much more efficiently than miR-34a-5p. The inventors then measured the rate of cell death after miRNA transfection.
  • the inventors identified 9 new miRNAs that down-regulate beta-catenin expression in the two HBL-derived cell lines Huh6 and HepG2 (Table 1). Five of them (miR-548z, miR-624-5p and let- 7i-3p, miR-885-5p and miR-449b-3p) were significantly less expressed in tumors compared to NL suggesting their involvement in the up-regulation of beta-catenin and its role in HBL. Table 1: Main results summary
  • miR-548z, miR-624-5p, Let-7i-3p, miR-885-5p and miR-449b-3p are potent tumor suppressors in HBL (miR-548z, miR-624-5p being more effective than Let-7i-3p, miR- 34a-5p, miR-885-5p and miR-449b-3p) and mediate their antitumor effect through the down-regulation of beta-catenin and likely of other (onco)genes that remain to be identified.
  • the present data strongly support the finding that in vitro miR-624-5p, miR-548z, and Let-7i-3p, miR-885-5p and miR-449b-3p act as powerful tumor suppressors in HBL.
  • MiR-624-5p directly targets the 3 '-UTR of the three beta-catenin mRNA variants
  • the inventors aimed at determining how miR-624-5p regulates beta-catenin through its 3'-UTR.
  • miR-624-5p regulates beta-catenin through its 3'-UTR.
  • various prediction algorithms miRDB, RNA22-HSA, TargetMiner and Miranda
  • 16B sequence is common to the three beta-catenin mRNA variants ( Figure 12B).
  • MiR-624-5p inhibits the transcriptional activity of Wnt pathway oncogenes
  • miR-624-5p inhibits Wnt/beta-catenin pathway activity
  • the inventors investigated the consequence of this inhibition on the downstream targets and Wnt pathway-associated genes by measuring the expression of numerous Wnt/beta-catenin pathway-related genes in Huh6 cells transfected with miR-624-5p, si- -catenin or a control RNA.
  • the genes down-regulated by miR-624-5p (NRP1, SIX1, BIRC5, ABCB1, CCND1 and FGF9) have a role in cell proliferation, cell cycle progression, cell survival, migration, tumor growth and/or drug resistance (Table 3 and Figure 13 A).
  • AXIN2 a direct target of beta-catenin/TCF4/LEF transcription complex and a member of the GSK- 3/APC/AXIN2 beta-catenin degradation complex, was also highly inhibited by miR-624-5p.
  • MiR-624- 5p also caused the up-regulation of genes ( Figure 13B).
  • MiR-624-5p inhibits HBL tumor growth in vivo
  • the tumor CAM model is a simple and robust xenograft model that recapitulates major stages of tumor progression including cell proliferation, angiogenesis and tumor cell-host interactions and that has been previously used for testing small non- coding RNA-mediated gene knockdown on tumor growth. Since HuH6 tumors grow inside the CAM, no macroscopic difference was visible at day 13 and 16 ( Figure 14A, row 1). However, after formalin- fixation we observed that grafted Huh6 cells formed a vascularized tissue mass, which was clearly smaller with miR-624-5p compared to control ( Figure 14A, row 2).
  • the lentiviral pL-GFP and pL-Tomato plasmids were designed as previously described (Maurel, M., et al, 2013).
  • the lentiviral pL-5'UTR-Bcat-GFP was obtained by inserting the full 5 'UTR sequence of the beta-catenin mRNA in the BamH I site of the pL-GFP plasmid.
  • the lentiviral pL-GFP-3'UTR-Bcat was obtained by inserting the full 3 'UTR sequence, with the exception of the last 23nt, between the Nde I- Kpn I sites in the pL-GFP plasmid.
  • the pL-5'UTR-Bcat-GFP-3'UTR-Bcat construct was obtained by inserting both 5' and 3'UTR in the pL-GFP as described.
  • the 5'UTR-Bcat and 3'UTR-Bcat sequences used for these clonings are derived from the reference sequence NM_001904.3. All constructions were verified by sequencing.
  • hepatoblastoma (HB)-derived HuH6 andHepG2 cell lines were grown in DMEM medium (Invitrogen) containing respectively 1 or 4.5 g/L of D-glucose supplemented with 10% FCS and 1% penicillin/streptomycin antibiotics at 37°C in a 5% C02 -humidified atmosphere.
  • HBL-214-J cell line were grown in Advanced DMEM/F-12 (Invitrogen) supplemented with 8% FCS, 1% penicillin/streptomycin antibiotics and 2mM L-Glutamine.
  • Lentiviral particles were added to the target cells and incubated for 72 h. Then the cells were washed twice in PBS and grown in the presence of complete medium for a week before use. Cells were washed in PBS, detached with trypsin/EDTA, collected and analyzed by FACS using a BD LSRFortessa (BD Biosciences, San Jose, CA, USA) and the BD FACSDiva software as described previously (Laloo, B., et al, 2009).
  • RNAs Small interfering RNAs, miRNA mimics, Cell transfection and Cisplatin treatment
  • Human miScript miRNA Mimic 96 Set miRBase V17.0
  • the miRNA mimics and the 1027281 negative siRNA control (si Ctrl) were from Qiagen. Hairpin inhibitors were from Dharmacon.
  • the siRNA against beta-catenin (si ⁇ -catenin) was 5' ACCAGTTGTGGTTAAGCTCTT 3' (SEQ ID No 11).
  • Small non-coding RNAs or hairpin inhibitors were transferred into the target cells by reverse transfection using Lipofectamine RNAi Max (Invitrogen) according to manufacturer's instructions at a final concentration of 15 nM. Then transfected cells were grown from 3 to 6 days before analysis. DF-FunREG screening
  • DF-FunREG screening was performed as previously described (Maurel M. et al, Hepatology 2013) with few modifications. 15,000 Tomato/eGFP Huh6 cells were plated per well of 96-well microplates and reverse transfected by each miRNA mimic of the miScript set. Three days after transfection, cells were washed in PBS and fluorescence signals were measured using the Envision multiplate reader (Perkin Elmer). Finally the eGFP/Tomato ratios were calculated and compared to the ratio obtained by the transfection of 1027281 negative siRNA control.
  • liver samples 36 HBL and 33 normal liver [NL] samples including 27 pairs of tumor and adjacent NL
  • SIOPEL Liver Tumor and Tissue Banking www.siopel.org
  • Samples were obtained with written informed consent and the study protocol was approved by the ethic committees of SIOPEL and of the French Government (HEPATOBIO project: N°ID-RCB-A00180-49; CPP N°CO-15-003; CNIL N°915640; CCTIRS N°15.700; MESR N° DC2009-939).
  • Liver samples were clinically, histologically, and genetically characterized (Supplementary Table SI). Liver tissues were immediately frozen in liquid nitrogen and stored at -80°C until used for molecular studies.
  • Sybergreen microRNA assays (miScript PCR System, Qiagen) were used to quantify the absolute expression of mature miRNAs in liver samples or in cell lines.
  • Blocker and Odyssey infrared imaging system were from LI-COR Biosciences (ScienceTec, Les Ulis, France). Specific protein signal was normalized to the house-keeping protein GAPDH.
  • the mouse monoclonal anti-beta-catenin (610154) antibody was from BD Biosciences and the rabbit polyclonal anti-GAPDH (FL-335) antibody was from Santa Cruz.
  • PCRs were done as described previously (Laloo B. et al, MCP 2009; Jalvy-Delvaille S. et al, NAR 2012) with the exception of cDNA synthesis which were done with the Maxima Reverse Transcriptase (Thermo Scientific).
  • Primers used in Real time quantitative PCR amplifications were: Forward beta- catenin: 5'- TCTTACACCCACCATCCCAC-3' (SEQ ID No 12); Reverse beta-catenin: 5'- GCACGAAC AAGC AACTGAAC-3 ' (SEQ ID No 13) Forward RNA 18s: 5'- GGATCC ATTGGAGGGC AAGT-3 ' (SEQ ID No 14); Reverse RNA 18s: 5'- CCGCTCCCAAGATCCAACTA-3' (SEQ ID No 15).
  • TMRM tetramethylrhodamine methyl ester
  • Caspase-Glo® 3/7 Assay System Promega
  • Cell cycle was studied with the APC/BrdU flow kit from BD Pharmingen according to manufacturer' s instructions. Briefly, 2.10 5 cells were transfected and seeded into 6-well plates in a volume of 2 iriL. Three days later, BrdU was added in each well 45 minutes before harvesting the cells and incorporated into newly synthesized DNA by cells entering and progressing through the S phase of the cell cycle. The incorporated BrdU was stained with an APC anti-BrdU fluorescent antibody and the levels of cell- associated BrdU were then measured by flow cytometry on the FACS CANTO II (BD Bioscience). Cell senescence assay
  • Huh6 cells transfection and eggs implantation Six days after eggs opening, Huh6 cells are transfected with either 1027281 negative siRNA control or miR-624-5p from Qiagen at a final concentration of 15 nM by forward transfection using Lipofectamine RNAi Max (Invitrogen) according to manufacturer's instructions. One day later, cells are washed in PBS, detached with trypsin/EDTA and collected.
  • Tumour growth monitoring, fixation and CAM collection Pictures of the growth tumour are done every day until 6 days using the stereomicroscope (SMZ745T) and camera (DS-Fi2) from Nikon and then analysed with the NSI Element D software. Tumours are fixed with Neutral Buffered Formalin (Diapath) at 3 days and 6 days after implantation and included in paraffin.

Abstract

La présente invention concerne des micro-ARN ciblant la bêta-caténine 1 (CTNNB1) destinés à être utilisés dans le traitement de l'hépatoblastome.
PCT/EP2016/065938 2015-07-07 2016-07-06 Utilisation de micro-arn ciblant la bêta-caténine pour le traitement du cancer du foie WO2017005773A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP15306113.0 2015-07-07
EP15306113 2015-07-07

Publications (1)

Publication Number Publication Date
WO2017005773A1 true WO2017005773A1 (fr) 2017-01-12

Family

ID=53673043

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2016/065938 WO2017005773A1 (fr) 2015-07-07 2016-07-06 Utilisation de micro-arn ciblant la bêta-caténine pour le traitement du cancer du foie

Country Status (1)

Country Link
WO (1) WO2017005773A1 (fr)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019014398A1 (fr) 2017-07-11 2019-01-17 Actym Therapeutics, Inc. Souches bactériennes immunostimulatrices modifiées et utilisations
WO2020014543A2 (fr) 2018-07-11 2020-01-16 Actym Therapeutics, Inc. Souches bactériennes immunostimulatrices modifiées et utilisations associées
WO2020030750A1 (fr) * 2018-08-08 2020-02-13 Theramir Ltd Thérapie à base de microarn ciblant des cancers positifs à lcp-1
WO2020047161A2 (fr) 2018-08-28 2020-03-05 Actym Therapeutics, Inc. Souches bactériennes immunostimulatrices modifiées et utilisations associées
CN111154870A (zh) * 2019-08-05 2020-05-15 江苏省肿瘤医院 一种鼻咽癌转移诊断和/或预后评估的生物标记
JP2020515618A (ja) * 2017-03-28 2020-05-28 ディセルナ ファーマシューティカルズ インコーポレイテッド ベータカテニン発現を減少させて免疫療法を強化する

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008073923A2 (fr) * 2006-12-08 2008-06-19 Asuragen, Inc. Gènes et voies régulés par miarn comme cibles d'intervention thérapeutique

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008073923A2 (fr) * 2006-12-08 2008-06-19 Asuragen, Inc. Gènes et voies régulés par miarn comme cibles d'intervention thérapeutique

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
ARMANDO MAGRELLI ET AL: "Altered microRNA Expression Patterns in Hepatoblastoma Patients", TRANSLATIONAL ONCOLOGY, vol. 2, no. 3, 18 August 2009 (2009-08-18), United States, pages 157 - 163, XP055239293, ISSN: 1936-5233, DOI: 10.1593/tlo.09124 *
CAIRO S ET AL: "Hepatic Stem-like Phenotype and Interplay of Wnt/beta-Catenin and Myc Signaling in Aggressive Childhood Liver Cancer", CANCER CELL, CELL PRESS, US, vol. 14, no. 6, 9 December 2008 (2008-12-09), pages 471 - 484, XP002508978, ISSN: 1535-6108, DOI: 10.1016/J.CCR.2008.11.002 *
GYUGOS MÓNIKA ET AL: "microRNA expression might predict prognosis of epithelial hepatoblastoma", VIRCHOWS ARCHIV, SPRINGER INTERNATIONAL, BERLIN, DE, vol. 464, no. 4, 26 February 2014 (2014-02-26), pages 419 - 427, XP035373127, ISSN: 0945-6317, [retrieved on 20140226], DOI: 10.1007/S00428-014-1549-Y *
M. J. MURRAY ET AL: "Solid Tumors of Childhood Display Specific Serum microRNA Profiles", CANCER EPIDEMIOLOGY, BIOMARKERS AND PREVENTION., vol. 24, no. 2, 21 November 2014 (2014-11-21), US, pages 350 - 360, XP055255104, ISSN: 1055-9965, DOI: 10.1158/1055-9965.EPI-14-0669 *
PEZ FLORIANE ET AL: "Wnt signaling and hepatocarcinogenesis: Molecular targets for the development of innovative anticancer drugs", JOURNAL OF HEPATOLOGY, vol. 59, no. 5, 29 July 2009 (2009-07-29), pages 1107 - 1117, XP028755494, ISSN: 0168-8278, DOI: 10.1016/J.JHEP.2013.07.001 *
SURASAK SANGKHATHAT ET AL: "In vitro RNA interference against [beta]-catenin inhibits the proliferation of pediatric hepatic tumors", INTERNATIONAL JOURNAL OF ONCOLOGY, 1 March 2006 (2006-03-01), GR, XP055255259, ISSN: 1019-6439, DOI: 10.3892/ijo.28.3.715 *

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11572559B2 (en) 2017-03-28 2023-02-07 Dicerna Pharmaceuticals, Inc. Reducing beta-catenin expression to potentiate immunotherapy
JP2020515618A (ja) * 2017-03-28 2020-05-28 ディセルナ ファーマシューティカルズ インコーポレイテッド ベータカテニン発現を減少させて免疫療法を強化する
EP3600423A4 (fr) * 2017-03-28 2021-01-13 Dicerna Pharmaceuticals, Inc. Diminution d'expression de bêta-caténine afin de potentialiser une immunothérapie
JP7295804B2 (ja) 2017-03-28 2023-06-21 ディセルナ ファーマシューティカルズ インコーポレイテッド ベータカテニン発現を減少させて免疫療法を強化する
US11168326B2 (en) 2017-07-11 2021-11-09 Actym Therapeutics, Inc. Engineered immunostimulatory bacterial strains and uses thereof
WO2019014398A1 (fr) 2017-07-11 2019-01-17 Actym Therapeutics, Inc. Souches bactériennes immunostimulatrices modifiées et utilisations
WO2020014543A2 (fr) 2018-07-11 2020-01-16 Actym Therapeutics, Inc. Souches bactériennes immunostimulatrices modifiées et utilisations associées
WO2020030750A1 (fr) * 2018-08-08 2020-02-13 Theramir Ltd Thérapie à base de microarn ciblant des cancers positifs à lcp-1
WO2020047161A2 (fr) 2018-08-28 2020-03-05 Actym Therapeutics, Inc. Souches bactériennes immunostimulatrices modifiées et utilisations associées
US11242528B2 (en) 2018-08-28 2022-02-08 Actym Therapeutics, Inc. Engineered immunostimulatory bacterial strains and uses thereof
US11779612B2 (en) 2019-01-08 2023-10-10 Actym Therapeutics, Inc. Engineered immunostimulatory bacterial strains and uses thereof
CN111154870A (zh) * 2019-08-05 2020-05-15 江苏省肿瘤医院 一种鼻咽癌转移诊断和/或预后评估的生物标记
CN111154870B (zh) * 2019-08-05 2023-06-23 江苏省肿瘤医院 一种鼻咽癌转移诊断和/或预后评估的生物标记

Similar Documents

Publication Publication Date Title
WO2017005773A1 (fr) Utilisation de micro-arn ciblant la bêta-caténine pour le traitement du cancer du foie
US9353373B2 (en) Bi-functional short-hairpin RNA (bi-shRNA) specific for single-nucleotide KRAS mutations
US9683237B2 (en) Multiple targeted RNAI for the treatment of cancers
WO2016106405A1 (fr) Compositions d'arn interférents et méthodes de traitement des tumeurs malignes
JP2019512489A (ja) マイクロｒｎａおよびその使用方法
US20140121262A1 (en) Methods of Using microRNA-26a to Promote Angiogenesis
WO2017005771A1 (fr) Utilisation de micro-arn ciblant la glypicane pour le traitement du cancer du foie
JP2016064989A (ja) 癌を治療するための医薬組成物、およびｐｄ−１阻害剤による治療に対する感受性を評価する方法
US20130281513A1 (en) siRNA FOR INHIBITION OF Hif1alpha EXPRESSION AND ANTICANCER COMPOSITION CONTAINING THE SAME
US20210277396A1 (en) Methods and compositions for sensitization of tumor cells to immune therapy
US20210380978A1 (en) The long non-coding RNA INCA1 and Homo sapiens heterogeneous nuclear ribonucleoprotein H1 (HNRNPH1) as therapeutic targets for immunotherapy
WO2013165320A1 (fr) Traitement du cancer par augmentation de l'expression de socs6
JP5887413B2 (ja) 非小細胞肺癌におけるｔｍ４ｓｆ４の発現または活性を調節することによって癌細胞の放射線耐性ならびに増殖、転移および浸潤を低減させる方法
ES2844398T3 (es) ARNip modificado y composición farmacéutica que comprende el mismo
CA3163139A1 (fr) Compositions et methodes pour le traitement du cancer
US20220186227A1 (en) Therapeutic Targets for Oncogenic KRAS-Dependent Cancers
US11168327B2 (en) STEAP2 inhibitors for the treatment of liver cancers
WO2023086552A2 (fr) Transcrits d'arnlnc dans la genèse de mélanomes
WO2024003350A1 (fr) Polythérapie pour mélanome
KR20160022273A (ko) 신규한 암 진단용 마커 및 이를 이용한 항암제
US10011877B2 (en) Treatment of bladder cancer to overcome chemoresistance
WO2023212572A2 (fr) Arn non codant long 122 (lnc122) pour le traitement du cancer
WO2015038593A1 (fr) Ciblage des microarn 26a/b pour le traitement des maladies neurodégénératives
CA2680058C (fr) Induction d'apoptose et inhibition de proliferation cellulaire par modulation de l'activite carnitine palmitoyltransferase 1c
Mody Investigation of Micro-RNA-based Approaches to Overcome Epithelial-Mesenchymal Transition in Pancreatic Cancer

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16736433

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16736433

Country of ref document: EP

Kind code of ref document: A1