WO2017002080A1 - Système de détection de toxines liées à une intoxication paralysante par des mollusques à base de micro-organismes génétiquement modifiés - Google Patents

Système de détection de toxines liées à une intoxication paralysante par des mollusques à base de micro-organismes génétiquement modifiés Download PDF

Info

Publication number
WO2017002080A1
WO2017002080A1 PCT/IB2016/053950 IB2016053950W WO2017002080A1 WO 2017002080 A1 WO2017002080 A1 WO 2017002080A1 IB 2016053950 W IB2016053950 W IB 2016053950W WO 2017002080 A1 WO2017002080 A1 WO 2017002080A1
Authority
WO
WIPO (PCT)
Prior art keywords
sensing
biosensor system
dna construct
genetically modified
reporter gene
Prior art date
Application number
PCT/IB2016/053950
Other languages
English (en)
Inventor
Emilia DIAZ
Cristobal ALLER
Felipe VAREA
Original Assignee
Kaitek Labs Spa
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Kaitek Labs Spa filed Critical Kaitek Labs Spa
Publication of WO2017002080A1 publication Critical patent/WO2017002080A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
    • C12Q1/18—Testing for antimicrobial activity of a material
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/70—Mechanisms involved in disease identification
    • G01N2800/709—Toxin induced

Definitions

  • Red tide refers to blooms where a certain microalgae types, either toxic or non-toxic, generate a red or brown color in ocean waters. Red tide related microalgae have been largely associated with the production of high levels of neurotoxins which are detrimental to human health
  • each cell can be used as a biological computer, capable of analyzing its close environment or its own functions, and then add logical gates that will allow the biological entity to translate the information it has gathered to a possible user, mimicking a digital user interface. This is the base of the biosensors described in the present invention.
  • biosensor refers merely to a device capable of sensing a certain characteristic within a biological medium. This biosensor's functions are then limited to measuring physical and chemical changes which harbor a biological application.
  • the concept of biosensor is broadened and is understood as a device that results from the combination of biological or synthetic parts within a base biological or synthetic entity. The resulting device is capable, through the biological or synthetic parts therein contained, of receiving a certain input signal from its environment, processing this information and then providing a certain output related to it. This allows the device to provide certain analytical information, be it quantitative or qualitative about for example the presence, absence or concentration of a target metabolite that the device is capable of recognizing.
  • the method described therein includes incubating a plurality of mouse neuroblastoma cells, which are responsive in a dose-dependent manner to sodium channel-activating toxins, with a medium comprising a solution of ouabain and veratridine, and a portion of the fluid sample to be analyzed. Following this, different additional stages are required to remove the medium and the fluid sample, and to incubate the cell cultures with an indicator which is acted upon by living cells to form a measurable product.
  • the US patent method is different to the present invention because in addition to only treating higher mammalian cell cultures with the potentially toxin-containing medium, said method forcedly requires an additional stage with an indicator to obtain a response with a measureable product to the presence of the toxin.
  • the present invention only requires any genetically modified cell or microorganism to contact the potentially toxin-containing medium, which can then provide a detection result within 24 hours.
  • US patent application 20030108980 A1 refers to bioluminescent methods for direct visual detection of environmental compounds.
  • This application relates to devices and methods that utilize immobilized bacteria that act as genetically modified bioreporters capable of emitting visible light to the naked eye in the presence of selected analytes.
  • This patent application exemplifies one of its practical embodiments as an E. coli strain modified through the incorporation of a merRop/lux gene cassette into its genome.
  • the present invention is not limited to the detection of certain selected analytes.
  • the present invention incorporates metabolic routes and different stages to provide a response to the user.
  • Jellett Rapid Testing now Scotia Rapid Testing (www.iellett.ca). provides three commercial tests for three toxic groups: ASP, DSP and PSP. The tests are qualitative ('yes or no' response) and are based on immunoassay techniques, which allow them to recognize very specific conformations of toxin strands, therefore leading to a considerable amount of false negative results.
  • the tests require three steps: preparing the sample (which usually entails grinding the mollusk tissue), preparing the extract (through a chemical extraction process, converting ground shellfish into a liquid form) and finally applying the test itself. The final stage takes between 35 minutes and 1 hour. These tests include a positive control, are single-use, have a shelf life of one year and may be stored between 4 and 25°C.
  • Abraxis Kits provides ELISA-like tests for marine biotoxin testing. It is described as an enzyme-linked immunoabsorbent assay for the detection of PSP/DSP (+) in water and contaminated samples. It allows for both quantitative and qualitative detection. For meat testing, it requires extra preparation stages. The testing stage takes about an hour, and requires pipetting and other basic laboratory techniques. It produces a colored signal (blue) which is inversely proportional to the content of toxin in the sample. The color reaction must be stopped and evaluated using an ELISA plate reader, and the final concentration of the samples is determined by interpolating the data using a standard curve constructed with each run. This test must be used in temperatures between 10-30°C, stored in refrigerators (4-8°C) and the associated solutions must be at room temperature (20-25°C) before use.
  • the method and biosensor system of the present invention are not based on a structural detection of the toxins or their toxic metabolites. Instead, they rely on the toxicological effect produced by said metabolites in at least one genetically modified cell. Given the concatenation of the stages of the method, the present invention allows the measurement of the toxicity itself as opposed to that of a specific toxin structure.
  • the inventors of the present invention utilizing tools of synthetic biology, have designed and constructed a biosensor system comprising concatenated metabolic routes that confers to a number of microbial, neuronal or cardiovascular cell, among others the capacity to sense the amount of toxin present in its medium.
  • This biosensor system later shows a response, signal or change that informs the presence or absence of marine toxins to the user.
  • Figure 1 Illustrates a scheme of the three stages/routes that the system of the invention entails. These are (A) detection route (B) regulation or tuning route and (C) organoleptic route.
  • Figure 2 Illustrates a scheme of the minimum two stages/routes that the system of the invention entails. These are (A) detection route and (B) organoleptic route
  • Figure 3 Schematically illustrate the genetically modified microorganism/cells with each one of the tested plasmid vectors, (A) reporter gene under oxidative stress promotor (B) reporter gene under osmotic stress promotor and (C) reporter gene under cooper channel promoter.
  • FIG. 4 Graphics show the fluorescence vs time on E. coli normalized for the amount of microorganism (optical density at 600 nm) for different plasmid vector constructs for sensing oxidative stress (oxyR, grxA), osmotic stress (osmC) and potassium flux (kck, trkA).
  • oxygenative stress oxygen
  • grxA oxidative stress
  • osmC osmotic stress
  • kck, trkA potassium flux
  • Figure 5 Graphic shows the fluorescence vs time on E. coli normalized for the amount of microorganism (optical density at 600 nm) for different plasmid vector constructs for sensing oxidative stress (SodB; SodC; ahpC; katG; katE) that are tested with Saxitoxin, toxic extract and hydrogen peroxide as a positive control, showing reaction to all.
  • SodB oxidative stress
  • SodC SodC
  • ahpC ahpC
  • katG katE
  • Figure 6 Graphic shows the fluorescence vs time on E. coli normalized for the amount of microorganism (optical density at 600 nm) for different plasmid vector constructs for sensing osmotic stress, oxidative stress and potasium flux (SodB; ahpC; katE; oxyR; katG; kch; trkA) working in tandem and treated with toxic shellfish extract (6A).
  • Graphic shows the fluorescence vs time on E. coli normalized for the amount of microorganism (optical density at 600 nm) for at least two different plasmid vector constructs for sensing osmotic stress (osmB) and oxidative stress and potassium flux (grxA) (6B).
  • the graphic has a negative control, corresponding to the microorganism without any treatment.
  • FIG. 7 Graphic show luminescence production by Saccharomyces cerevisiae under exposition to toxic shellfish extract and pure saxitoxin.
  • the plasmid contained in the S. cerevisiae has a luciferase gene regulated by copper inducible promoter (CUP1 ). Positive control was tested with the addition of 40 uM Cu++ to the media and negative control shows the basal expression of luciferase without addition of Cu++.
  • CUP1 copper inducible promoter
  • the present invention provides a product corresponding to a biosensor system based on at least one cell selected from neuronal or cardiovascular cell lines, among other eukaryote cells and microbial cells such as Escherichia coli, Saccharomyces cerevisiae, among other bacteria and yeasts, which are suitable to be genetically modified in a standardized manner, with vectors that have already been used for this purpose, and that can be found in prior art.
  • vectors can be selected from pGEM-T vector, pYES2.1/V5-His-TOPO®, Biobrick plasmid backbone, pUA66, pSal1 luc-skl, among others.
  • This biosensor system is capable of detecting or sensing the presence of diverse toxins, independent of their source of origin or chemical nature.
  • the present invention utilizes the mode of action mechanism of the diverse toxins associated to red tide to indicate their presence or absence in a sample. This is achieved by an interaction between the marine toxin, selected from the group formed by saxitoxins, domoic acid, yessotoxins, okadoic acid, brevetoxins, azaspiracids, among others; and the genetically modified cell, which for the purposes of the present invention is also referred to as a biosensor.
  • the following table summarizes some of the toxins that can be sensed through the method and product of the present invention, including their chemical nature, syndrome generated by its consumption in higher vertebrates, and the genus/species of algae of origin to date.
  • Prorocentrum arenarium belizeanum, concavem, lima acuminata, actua
  • Gymnodimines Lipophilic - Karenia Selliforme
  • the present invention also refers to a method of detection which in general allows: (1 ) detection of the toxin, or some of its related metabolites, by the biosensor, (2) optionally, necessary amplification to obtain a measurement at the cellular level, and (3) organoleptic change. This last step is the final result-displaying effect resulting from applying the method of this invention.
  • the method depicted by the present invention is simple, where in one embodiment the invention does not require additional steps to observe an organoleptic response that can be appreciated by the user. While in other embodiments, a pretreatment stage may be required within the method of the invention to achieve bioavailability, by liberating and solubilizing the toxin present in the sample. Alternatively, for the purposes of this invention, an organoleptic response/change can also mean a suitable result such as any data measurable by the user, with or without the assistance of additional means.
  • the biosensor system of this invention consists of three distinct and consecutive stages that are:
  • Detection stage corresponds to one or several synthetic (i.e.: artificially, non-natural occurring) reactions introduced to the biosensor cell, which recognizes an exogenous molecule, identifying a characteristic metabolite or the particular effect thereof, that will serve to trigger the reaction. This stage determines the object to be sensed by the biosensor, optionally;
  • Organoleptic stage where a determined organoleptic change is produced to transmit the information to the user interface system.
  • the biosensor system and method thereof can be performed in a simpler manner, said method consists in two consecutive stages that are:
  • Detection stage corresponds to one or several synthetic (i.e.: artificially, non-natural occurring) reactions introduced to the biosensor cell, which recognizes an exogenous molecule, which recognizes cellular effects caused by marine biotoxins. Again this stage determines the object to be sensed by the biosensor system; and
  • Organoleptic stage where a determined organoleptic change is produced to transmit the information to the user interface system.
  • the user interface can be but is not limited to: an isolated cell, a cell culture contained in an adequate matrix, a lyophilized cell culture, among others.
  • the present invention provides a biosensor system for detection of Paralytic Shellfish Poisoning (PSP) related toxins, which comprises:
  • a second component consisting of at least one genetically modified microorganism, that contains at least one DNA construct for sensing oxidative stress comprising a promoter sequence and a reporter gene;
  • genetically modified microorganisms for sensing osmotic stress construct and oxidative stress reacts to the presence of PSP related toxins through expression of at least one reporter gene.
  • work in tandem means that either one or both of a first and second biosensor system reacts with the presence of a one or more PSP biotoxins, so the user can determine its presence in less than 24 hours through an organoleptic response.
  • the first component of the biosensor system having at least one DNA construct for sensing osmotic stress has a promoter sequence selected from osmB, spr, yehZ, osmE, osmC, among others.
  • the selected promoter must be compatible with the host microorganism, in other words, the plasmid vector is designed to ensure transcription of the reporter gene
  • the second component of the biosensor system having at least one DNA construct for sensing oxidative stress has a promoter sequence selected from: ygjG, ybgS, ybgS, tktB, lysR, talA, pdhR, dps, gadW, hdhA, gadB, tarn, psiF, sufl, narU, ycaC, rssA, yhhT, yncG, yncG, mscL, grxA, hdeD, osmE, yiaG, bolA, sip, wrbA, yjbJ, yjeB, chaB, oxyR, ompC, ahpC, ahpF, among others.
  • the selected promoter must be compatible with the host microorganism, in other words, the plasmid vector is designed to ensure transcription of the reporter gene
  • the biosensor system of claim 1 first and second components having at least one DNA construct comprising a reporter gene selected from any luminescent, fluorescent or colorimetric protein, such as, eGFP, GFP, crtEBI, mCherry, luciferase, amilCP, among others.
  • a reporter gene selected from any luminescent, fluorescent or colorimetric protein, such as, eGFP, GFP, crtEBI, mCherry, luciferase, amilCP, among others.
  • the biosensor system optionally comprises a third component consisting of at least one genetically modified microorganism that contains at least one DNA construct for sensing cooper fluxes comprising a promoter sequence and a reporter gene.
  • the promoter is selected from any prior art promoter related to cooper flux membrane protein, such as, Cup1 .
  • plasmid vectors For the first embodiment of the invention, several metabolic pathways that might be affected by the presence of PSP related toxins are identified from a literature review and selected for construction of plasmid vectors. Any of the aforementioned promoters and reporter genes can be selected to construct a plasmid vector to transform the at least one microorganism. These targets genes, promoter and reporter, are chosen in a way their combined effects can allow for specific detection by having numerous sensors working in tandem based on different biological effects provoked by target toxins. Each one of the microorganisms of this embodiment present a detection route, an organoleptic route and optionally, a tuning route, all of them are artificially introduced in the cells.
  • the targets explored for this embodiment correspond to oxidative stress related promoters such as oxyR and grxA; and osmolality-related gene osmC. Additionally, channel proteins such as cupl , and saxitoxin-specific Saxiphilin can be used additionally to determine specificity of the biosensor system.
  • detection routes correspond to the addition of said genetic parts
  • organoleptic routes correspond to the addition of a reporter gene.
  • Escherichia coli DH5a and JM109 were cultured in liquid LB media (NaCI 5g/L; yeast extract 5g/L; tryptone 10 g/L) at 37°C and stored in LB media with agar (NaCI 5g/L; yeast extract 5g/L; triptona 10 g/L; agar 15 g/L) for one month periods at a 4°C and with 15% glycerol at -80°C for periods longer than a month.
  • Saccharomyces cerevisiae By4741 and By4742 cultures were cultured in YPD media (yeast extract 10 g/L; peptone 20 g/L; glucose 2%) and stored in YPD and 20% agar plates for monthly periods or in glycerol stock for longer periods.
  • YPD media yeast extract 10 g/L; peptone 20 g/L; glucose 26%
  • Bacteria culture had already been transformed with resistance plasmids; the corresponding antibiotics ampicillin and kanamycin, added to the respective LB media.
  • yeast a selective media was used that did not contain the corresponding amino acid uracil or leucine (Yeast Nitrogen Base 1.72 g/L, NH4SO4 5 g/L; Drop out mix 0.94 g/L)
  • the plasmids used as vector backbones were pGEM-T vector (Promega), pYES2.1 /V5-His-TOPO® (ThermoFisher), Biobrick plasmid backbone (iGEM), pUA66 (Dharmacon E.coli promoter collection), pSaM luc-skl (P. Leskinen, M. Virta and M. Karp. One-step measurement of firefly luciferase activity in yeast. Yeast Functional Analysis Report. v20: 1 109-1 1 13).
  • the selected reporter genes included amilCP, eGFP and luciferase.
  • the plasmids were constructed with Escherichia coli DH5a and JM109 as hosts. In order to evaluate the performance of a construct containing the desired insert, a colony PCR was conducted. For the case of yeast, the verification of the inclusion is proceeded by the transformation in By4741 and By4742.
  • SodB 2 CCGCTCGAGGCACAGGTC 10 CGGGATCCTGGTGCTTGCCGT
  • SodC 3 CCGCTCGAGTGCGACGTG 11 CGGGATCCATCCGTAAAGCGG
  • ahpA 8 CCGCTCGAGCTATCTCATC 16 CGGGATCCAAGGAGATGAGG
  • Shellfish contaminated with red tide toxins were taken from the southern coast of Chile and the following methodology was performed to extract the toxins. After blending and homogenization, 100 mL 0.1 N HCI was added per 100 g of shellfish pulp. The pH was adjusted to 3 with 0.1 N NaOH or 5N HCI and gently boiled at 70°C. The extract was centrifuged at 4,000 x g at 4 °C for 5 min; the supernatant was then concentrated to 1/10 of the initial volume at 70 S C. Proteins were precipitated by centrifuging at 4,000 x g for 10 min.
  • Every potential biosensor constructed was screened by exposure to different concentrations of Saxitoxin standard (NRC Canada) as well as toxic mollusk extract (Rubio, D.P., Roa, L.G., Soto, D.A., Velasquez, F.J., Gregorcic, N.A, Soto, J.A, Martinez, M.C., Kalergis, A.M., Vasquez, A.E., Purification and characterization of saxitoxin from Mytilus cilensis of southern Chile, Toxicon (2015), doi: 10.1016/j.toxicon.2015.09.045) and stimuli that garnered a positive response according to literature, such as H 2 0 2 and Cu.
  • a Perkin Elmer EnSpire microplate reader or a Promega Glomax luminometer was used to measure either fluorescence or luminiscence.
  • each promoter oxyR, grxA, and osmC - in an independent manner - reacts with a variable range of higher fluorescence.
  • osmC does not show a high fluorescence difference in respect to the negative control when treated with the complete toxic extract; however, a higher difference is noticed for saxitoxin doses directly.
  • Figure 5 shows several promoters of oxidative stress that are tested with Saxitoxin, toxic extract and hydrogen peroxide as a positive control, showing reaction to all.
  • SodB and katG promoters it is clear that each of this promoters are reacting to oxidative stress as it can be proved with the addition of hydrogen peroxide, thus, confirming that the toxic effect of the PSP toxins could lead to a oxidative stress on the cells, and also, that this response can be measured using reporter genes.
  • Figure 6a and 6b shows the combined effect on fluorescent reporter expression under several promoters working in tandem. It is noticed that fluorescence is higher compared to the negative control, for complete toxic extract and pure saxitoxin (at a higher concentration).
  • Figure 7 shows the relative units of luminescence that are released when a luciferase/luciferine reaction occurs in S. cerevisiae with and without copper.
  • the graph also shows the effect of adding a toxic shellfish extract containing PSP related toxins or Saxitoxin standard to a culture before incubating with copper at 40uM. It is clear that adding the shellfish extract inhibits the entrance of copper ions to the cell, and the subsequent light emission is similar in shape to the negative control which was incubated without copper.
  • biosensor system of this present invention was evaluated in relation to other techniques commercially available today. The results of these tests are demonstrated in the following table.
  • Bioassay refers to the capacity to detect biological toxicity in relation to, for example, the toxin structure or metabolite.
  • the fact that the mouse bioassay meets these parameters is today, one of the main reasons why this method is maintained as a standard.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Toxicology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention concerne un procédé et un système de biodétection pour la détection rapide et sensible de toxines liées à l'intoxication paralysante par des mollusques (PSP) ou à des efflorescences d'algues nocives (HAB), un phénomène couramment connu par marée rouge. La présente invention concerne également l'obtention de micro-organismes génétiquement modifiés, tels que des bactéries, une levure, des lignées cellulaires neuronales, des lignées cellulaires cardiovasculaires, ou n'importe quelle autre cellule qui contient au moins une voie de détection servant de cible à effet toxicologique. Une telle voie de détection est capable de détecter son environnement et de fournir une réponse ou un signal correspondant à la présence ou à l'absence de biotoxines d'origine marine liées à la PSP ou HAB ou leurs métabolites toxiques associés. Ainsi, le domaine d'application de la présente invention appartient aux techniques de biotechnologie utilisées pour fournir des procédés et des biodétecteurs de métabolites environnementaux toxiques pour la santé humaine.
PCT/IB2016/053950 2015-06-30 2016-06-30 Système de détection de toxines liées à une intoxication paralysante par des mollusques à base de micro-organismes génétiquement modifiés WO2017002080A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201562187014P 2015-06-30 2015-06-30
US62/187,014 2015-06-30

Publications (1)

Publication Number Publication Date
WO2017002080A1 true WO2017002080A1 (fr) 2017-01-05

Family

ID=57607952

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2016/053950 WO2017002080A1 (fr) 2015-06-30 2016-06-30 Système de détection de toxines liées à une intoxication paralysante par des mollusques à base de micro-organismes génétiquement modifiés

Country Status (1)

Country Link
WO (1) WO2017002080A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106950327A (zh) * 2017-03-13 2017-07-14 中国水产科学研究院黄海水产研究所 复杂基质中贝类毒素的筛查与确证方法

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6117643A (en) * 1997-11-25 2000-09-12 Ut Battelle, Llc Bioluminescent bioreporter integrated circuit
KR20030075820A (ko) * 2002-03-21 2003-09-26 한국해양연구원 녹색형광단백질 유전자를 이용한 삭시톡신 검출용바이오센서
US20120045835A1 (en) * 2009-02-13 2012-02-23 Elisa Michelini Portable device based on immobilized cells for the detection of analytes

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6117643A (en) * 1997-11-25 2000-09-12 Ut Battelle, Llc Bioluminescent bioreporter integrated circuit
KR20030075820A (ko) * 2002-03-21 2003-09-26 한국해양연구원 녹색형광단백질 유전자를 이용한 삭시톡신 검출용바이오센서
US20120045835A1 (en) * 2009-02-13 2012-02-23 Elisa Michelini Portable device based on immobilized cells for the detection of analytes

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
SORENSEN ET AL.: "Making bio-sense of toxicity: new developments in whole- cell biosensors", CURRENT OPINION IN BIOTECHNOLOGY, vol. 17, 2006, pages 11 - 16, XP024962767, DOI: doi:10.1016/j.copbio.2005.12.007 *
WALAWALKAR ET AL.: "Engineering whole- cell biosensors to evaluate the effect of osmotic conditions on bacteria", ANN MICROBIOL, vol. 63, 2013, pages 1283 - 1290, XP055343034 *
ZHANG ET AL.: "Current Techniques for Detecting and Monitoring Algal Toxins and Causative Harmful Algal Blooms", J ENVIRON ANAL CHEM, vol. 2, no. 1, 2015, pages 123 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106950327A (zh) * 2017-03-13 2017-07-14 中国水产科学研究院黄海水产研究所 复杂基质中贝类毒素的筛查与确证方法

Similar Documents

Publication Publication Date Title
Durham et al. Recognition cascade and metabolite transfer in a marine bacteria‐phytoplankton model system
Kurmayer et al. Application of real-time PCR for quantification of microcystin genotypes in a population of the toxic cyanobacterium Microcystis sp
Cheng et al. The depressed central carbon and energy metabolisms is associated to the acquisition of levofloxacin resistance in Vibrio alginolyticus
Spence et al. Cell cycle–regulated modification of the ribosome by a variant multiubiquitin chain
Ishii et al. Single-cell analysis and isolation for microbiology and biotechnology: methods and applications
Perry‐O’Keefe et al. Filter‐based PNA in situ hybridization for rapid detection, identification and enumeration of specific micro‐organisms
Amaro et al. Functional GFP-metallothionein fusion protein from Tetrahymena thermophila: a potential whole-cell biosensor for monitoring heavy metal pollution and a cell model to study metallothionein overproduction effects
Zhu et al. Comparative proteomic analysis of sensitive and multi-drug resistant Aeromonas hydrophila isolated from diseased fish
Saker et al. Multiplex PCR for the detection of toxigenic cyanobacteria in dietary supplements produced for human consumption
Mastronunzio et al. Postgenomic analyses reveal development of infectious Anaplasma phagocytophilum during transmission from ticks to mice
Casasola-Rodríguez et al. Detection of VBNC Vibrio cholerae by RT-Real Time PCR based on differential gene expression analysis
CN102520172A (zh) 单增李斯特氏菌核酸层析检测试剂盒及其检测方法和应用
Lu et al. LAMP-based method for a rapid identification of Legionella spp. and Legionella pneumophila
Bittencourt‐Oliveira et al. Microcystin‐producing genotypes from cyanobacteria in Brazilian reservoirs
Martins et al. Peptide diversity in strains of the cyanobacterium Microcystis aeruginosa isolated from Portuguese water supplies
Plotnikov et al. High-throughput sequencing of the 16S rRNA gene as a survey to analyze the microbiomes of free-living ciliates Paramecium
Dennert et al. Conservation tillage and organic farming induce minor variations in Pseudomonas abundance, their antimicrobial function and soil disease resistance
Yen et al. Detection and quantification of major toxigenic Microcystis genotypes in Moo-Tan reservoir and associated water treatment plant
Adams et al. A dual luciferase reporter system for B. burgdorferi measures transcriptional activity during tick-pathogen interactions
Sidelev et al. Distribution of microcystin-producing genes in Microcystis colonies from some Russian freshwaters: Is there any correlation with morphospecies and colony size?
US10526663B2 (en) Method of detecting a microorganism in a sample by a fluorescence based detection method
Thanh Nguyen et al. Candida albicans Bgl2p, Ecm33p, and Als1p proteins are involved in adhesion to saliva-coated hydroxyapatite
Dos Reis et al. Evaluation of VITEK® 2 and MALDI-TOF/MS automated methodologies in the identification of atypical Listeria spp. isolated from food in different regions of Brazil
WO2017002080A1 (fr) Système de détection de toxines liées à une intoxication paralysante par des mollusques à base de micro-organismes génétiquement modifiés
Savela et al. Rapid quantification of mcyB copy numbers on dry chemistry PCR chips and predictability of microcystin concentrations in freshwater environments

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16817359

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16817359

Country of ref document: EP

Kind code of ref document: A1