WO2016200951A1 - Formulations for small intestinal delivery of rsv and norovirus antigens - Google Patents

Formulations for small intestinal delivery of rsv and norovirus antigens Download PDF

Info

Publication number
WO2016200951A1
WO2016200951A1 PCT/US2016/036461 US2016036461W WO2016200951A1 WO 2016200951 A1 WO2016200951 A1 WO 2016200951A1 US 2016036461 W US2016036461 W US 2016036461W WO 2016200951 A1 WO2016200951 A1 WO 2016200951A1
Authority
WO
WIPO (PCT)
Prior art keywords
vaccine
immunogenic composition
rsv
subjects
acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2016/036461
Other languages
English (en)
French (fr)
Inventor
George Trager
Sean Tucker
Leesun Kim
Ciaran Scallan
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Vaxart Inc
Original Assignee
Vaxart Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=57503876&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2016200951(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority to JP2017564358A priority Critical patent/JP6912394B2/ja
Priority to DK16808196.6T priority patent/DK3307239T3/da
Priority to KR1020187000421A priority patent/KR102678401B1/ko
Priority to AU2016274599A priority patent/AU2016274599B2/en
Priority to CN201680046440.8A priority patent/CN108024955A/zh
Priority to US15/580,651 priority patent/US11433146B2/en
Priority to CA2988761A priority patent/CA2988761A1/en
Priority to EP20195995.4A priority patent/EP3791859A1/en
Priority to EA201792512A priority patent/EA201792512A1/ru
Application filed by Vaxart Inc filed Critical Vaxart Inc
Priority to NZ738382A priority patent/NZ738382B2/en
Priority to EP16808196.6A priority patent/EP3307239B1/en
Priority to KR1020247005811A priority patent/KR102773575B1/ko
Priority to CN202311287963.XA priority patent/CN118045170A/zh
Priority to ES16808196T priority patent/ES2832504T3/es
Publication of WO2016200951A1 publication Critical patent/WO2016200951A1/en
Priority to ZA2017/08434A priority patent/ZA201708434B/en
Anticipated expiration legal-status Critical
Priority to US17/816,788 priority patent/US12186407B2/en
Priority to US18/956,413 priority patent/US20250082784A1/en
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/20Pills, tablets, discs, rods
    • A61K9/28Dragees; Coated pills or tablets, e.g. with film or compression coating
    • A61K9/2806Coating materials
    • A61K9/2833Organic macromolecular compounds
    • A61K9/284Organic macromolecular compounds obtained by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyvinyl pyrrolidone
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A61K48/0058Nucleic acids adapted for tissue specific expression, e.g. having tissue specific promoters as part of a contruct
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/20Pills, tablets, discs, rods
    • A61K9/2004Excipients; Inactive ingredients
    • A61K9/2009Inorganic compounds
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • A61K39/155Paramyxoviridae, e.g. parainfluenza virus
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/39Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0053Mouth and digestive tract, i.e. intraoral and peroral administration
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/20Pills, tablets, discs, rods
    • A61K9/2004Excipients; Inactive ingredients
    • A61K9/2022Organic macromolecular compounds
    • A61K9/205Polysaccharides, e.g. alginate, gums; Cyclodextrin
    • A61K9/2054Cellulose; Cellulose derivatives, e.g. hydroxypropyl methylcellulose
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/20Pills, tablets, discs, rods
    • A61K9/2004Excipients; Inactive ingredients
    • A61K9/2022Organic macromolecular compounds
    • A61K9/205Polysaccharides, e.g. alginate, gums; Cyclodextrin
    • A61K9/2059Starch, including chemically or physically modified derivatives; Amylose; Amylopectin; Dextrin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/20Pills, tablets, discs, rods
    • A61K9/28Dragees; Coated pills or tablets, e.g. with film or compression coating
    • A61K9/2806Coating materials
    • A61K9/2813Inorganic compounds
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/20Pills, tablets, discs, rods
    • A61K9/28Dragees; Coated pills or tablets, e.g. with film or compression coating
    • A61K9/2806Coating materials
    • A61K9/282Organic compounds, e.g. fats
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/20Pills, tablets, discs, rods
    • A61K9/28Dragees; Coated pills or tablets, e.g. with film or compression coating
    • A61K9/2806Coating materials
    • A61K9/2833Organic macromolecular compounds
    • A61K9/284Organic macromolecular compounds obtained by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyvinyl pyrrolidone
    • A61K9/2846Poly(meth)acrylates
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • A61P31/16Antivirals for RNA viruses for influenza or rhinoviruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/04Immunostimulants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525Virus
    • A61K2039/5256Virus expressing foreign proteins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/54Medicinal preparations containing antigens or antibodies characterised by the route of administration
    • A61K2039/541Mucosal route
    • A61K2039/542Mucosal route oral/gastrointestinal
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/57Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/57Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2
    • A61K2039/575Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2 humoral response
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/10011Adenoviridae
    • C12N2710/10041Use of virus, viral particle or viral elements as a vector
    • C12N2710/10043Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/10011Adenoviridae
    • C12N2710/10311Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10341Use of virus, viral particle or viral elements as a vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/10011Adenoviridae
    • C12N2710/10311Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10341Use of virus, viral particle or viral elements as a vector
    • C12N2710/10343Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011Details
    • C12N2760/18011Paramyxoviridae
    • C12N2760/18511Pneumovirus, e.g. human respiratory syncytial virus
    • C12N2760/18534Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/16011Caliciviridae
    • C12N2770/16034Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein

Definitions

  • Vaccines are an important means for preventing and/or treating a number of diseases and disorders (e.g., viral infection, bacterial infection, and cancer). Vaccinization is typically carried out using injection, which reduces participation due to inconvenience of traveling to a vaccination site and aversion to injections. Furthermore, injection of vaccines requires use of sterile kit, such as syringes and needles, and a skilled practitioner to administer.
  • diseases and disorders e.g., viral infection, bacterial infection, and cancer.
  • Vaccinization is typically carried out using injection, which reduces participation due to inconvenience of traveling to a vaccination site and aversion to injections.
  • injection of vaccines requires use of sterile kit, such as syringes and needles, and a skilled practitioner to administer.
  • influenza vaccine large-scale yearly campaigns are conducted to collect enough fertilized eggs to harvest and process sufficient virus to meet the needs of the market.
  • Cell culture or plant derived hemagglutinin (HA) may reduce the burden of egg acquisition and processing, but these approaches still require expensive sterile fill and finish to produce individual syringe needles, that need to be disposed of as a biohazard.
  • HA hemagglutinin
  • schools can be closed and social distancing mandated, yet mass influenza immunization typically requires lining up subjects at health clinics for injections.
  • Oral vaccines, for influenza or other pathogens could be sent through the mail thus avoiding most human to human contact.
  • Vaccines that can be delivered in a non-parenteral manner, e.g., orally or mucosally, are described in US Patent No. 8,222,224.
  • immunogenic compositions for eliciting an immune response in a subject comprising: an immunogenic biological agent encompassed by a deliver)-' agent that directs delivery of the immunogenic biological agent to the ileum of the subject.
  • the subject is a human.
  • the subject is a non-human animal, e.g., primate, mouse, rat, rabbit, horse, dog, cat, or poultry.
  • the immunogenic biological agent is selected from an immunogenic polypeptide (e.g., vims like particle, glycoprotein, phosphoprotein), carbohydrate, and lipid.
  • the immunologenic biological agent is an adenoviral vector encoding the viral protein 1 of norovirus or the fusion protein (F) of Respiratory syncytial virus (RSV).
  • RSV Respiratory syncytial virus
  • the viral protein 1 of norovirus is SEQ ID NO: 2 or SEQ ID NO: 4.
  • the fusion protein (F) of RSV is SEQ ID NO: 6.
  • the adenoviral vector comprises a nucleotide sequence of SEQ ID NO: 7.
  • the immunogenic biological agent is an expression vector encoding an immunogenic polypeptide.
  • the expression vector is a viral vector (e.g., adenoviral, AAV, retroviral, or lentiviral).
  • the viral vector is attenuated or replication incompetent.
  • the expression vector comprises a promoter (e.g., CMV, SV40 early or late, ⁇ -actin, etc.) operably linked to the sequence encoding the immunogenic polypeptide.
  • the expression vector further encodes double stranded (dsRNA).
  • the dsRNA encoding sequence is operably linked to a promoter, e.g., either the same promoter (using an Internal Ribosomai Entry Site (IRES)) or a different promoter as the promoter operably linked to the immunogenic polypeptide encoding sequence.
  • the immunogenic composition further comprises at least one adjuvant, e.g., a TLR3 agonist.
  • the TLR3 agonist is dsRNA or a dsRNA mimetic.
  • the enteric coating or matrix begins to dissolve before the immunogenic composition reaches the ileum, but retains at least 50% of the immunogenic biological agent until the immunogenic composition reaches the ileum.
  • the enteric coating retains the immunogenic biological agent through the stomach, duodenum, and jejunum, but releases the immunogenic biological agent in the ileum.
  • the immunogenic biological agent is covered by an enteric coating.
  • the enteric coating disintegrates at pH>5, e.g., 5.2, 5.5, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 7.0, 5.5-6.8, 5.8-6.8, etc.
  • the enteric coating is selected from the group consisting of methacrylic aci d- ethyl acrylaie copolymer (e.g., 1 : 1), type A, methacrylic acid copolymer, type C; a mixture of methacrylic copolymer types A and C; and Time Clock®.
  • the enteric- coating does not include cellulose acetate phthalate (CAP).
  • the enteric coating is of a thickness that results in release of the immunogenic biological agent in the ileum.
  • the enteric coating is methacrylic acid copolymer-based with a coverage of 5.5-10 milligram per square centimeter.
  • the deliver ⁇ ' agent is a radio-controlled capsule.
  • the enteric coating comprises Poly(methylacylic acid-co- methyl methacrylate) 1:1.
  • the enteric coating comprises Eudragit® L- 100.
  • the enteric coating comprises Eudragit® L-100, tri ethyl citrate, and talc, e.g., 1, 2, 3, 4 or 1-4 parts Eudragit® L-100, 1-2 parts tri ethyl citrate, and 1-2 parts talc.
  • enteric coating comprises a mixture of poly (methacy lie acid-co- methyl methacrylate) 1:1 and poly(methacylic acid-co-ethyl acrylate) 1:1.
  • poly(methacylic acid-co-ethyl acrylate) 1:1 is 1:4 to 4: 1, e.g., 1:3, 1 :2, 1 :1, 2:1, 3: 1.
  • the enteric coating comprises a mixture of Eudragit® L-100 and
  • the enteric coating comprises Eudragit® L-100 and Eudragit®L100-55, tri ethyl citrate, and talc, e.g., 1-4 parts Eudragit® L-100 and
  • the enteric coating comprises poly(methacylic acid-co-methyl methacrylate) 1:1 and
  • the enteric coating comprises a mixture of Eudragit® L-100 and Eudragit®S100. In some embodiments, the enteric coating comprises Eudragit® L-100 and Eudragit®S100, tri ethyl citrate, and talc, e.g., 1-4 parts Eudragit® L- 100 and Eudragit®S100, 1-2 parts tri ethyl citrate, and 1-2 parts talc.
  • the enteric coating comprises a mixture of poly(methacylic acid-co-methyl methacrylate) 1 :2 and poly(methacylic acid-co-ethyl acrylate) 1:1.
  • the ratio of polyfmethacylic acid-co-methyl methacrylate) 1 :2 and poly (methacy lie acid-co-ethyl acrylate) 1 :1 is 1:4 to 4:1, e.g., 1:3, 1:2, 1:1, 2:1, or 3:1.
  • the enteric coating comprises a mixture of Eudragit® L-100-55 and Eudragit®S100.
  • the enteric coating comprises Eudragit® L-100-55 and Eudragit®S100, tri ethyl citrate, and talc, e.g., 1-4 parts Eudragit® L-100-55 and Eudragit®S100, 1-2 parts tri ethyl citrate, and 1-2 parts talc.
  • the immunogenic composition is in the form of a tablet or capsule, e.g., in the form of a compressed tablet covered by enteric coating.
  • the immunogenic composition is encapsulated in a polymeric capsule comprising gelatin, hydroxypropylmethylcellulose, starch, or pullulan.
  • the immunogenic composition is in the form of microparticles less than 2mm in diameter, e.g., each microparticie covered with enteric coating as described herein.
  • an immunogenic composition to the ileum of a subject comprising orally administering the immunogenic composition as described above (i.e., an immunogenic biological agent encompassed by a deliver ⁇ ' agent that directs deliver of the immunogenic biological agent to the ileum, optionally including an adjuvant) to the subject.
  • the subject is a human.
  • the subject is a non-human animal.
  • the method results in an immune response in the subject that is at least 10% higher, e.g., at least 20%, 30%,
  • the immune response in the subject is at least 1.5-fold higher (e.g., 2-fold, 2.5-fold, 5-fold, or more) than the immune response in a subject (either the same subject at a different time, or a different subject) receiving the same immunogenic composition not directed to the ileum.
  • the immune response in the subject is at least 1.5-fold higher (e.g., 2-fold, 2.5-fold, 5-fold, or more) than the immune response in a subject (either the same subject at a different time, or a different subject) receiving the same immunogenic composition not directed to the ileum.
  • the immune response is an increase in antibodies specific for the immunogenic biological agent.
  • the immune response is a cellular immune response, e.g., an increase in cytokines such as IFN- ⁇ .
  • the immune response is immunization (e.g., the subject is resistant to infection by the virus, bacteria, etc. from which the immunogenic biological agent was derived).
  • an immunogenic composition as described above i.e., an immunogenic biological agent encompassed by a delivery agent that directs delivery of the immunogenic biological agent to the ileum, optionally including an adjuvant
  • the immune response is increased by at least 10%, e.g., at least 20%, 30%, 40%, 50%, 60%, 75%, 80%, 100% or more, compared to the immune response in a subject (either the same subject at a different time, or a different subject) receiving the same immunogenic composition not directed to the ileum.
  • the immune response in the subject is increased at least 1.5-fold (e.g., 2-fold, 2.5-fold, 5-fold, or more) compared the immune response in a subject (either the same subject at a different time, or a different subject) receiving the same immunogenic composition not directed to the ileum.
  • the immune response is an increase in antibodies specific for the immunogenic biological agent.
  • the immune response is a cellular immune response, e.g., an increase in cytokines such as IFN- ⁇ .
  • the immune response is immunization (e.g., the subject is resistant to infection by the virus, bacteria, etc. from which the immunogenic biological agent was derived).
  • T cell response to rAd-HA-dsRNA was determined by detecting IFN- ylevels 7 days post-administration. All of the individuals in the ileum-delivery group showed higher levels of IFN- ⁇ , compared to 75% of the jejunum-delivery group. The average IFN- ⁇ level was also significantly higher in the ileum-delivery group.
  • FIG. 3 Mi croneutralizing antibody (MN) responses to influenza A/CA/07/2009 were measured at day 0 and day 28 after immunization. The fold increase in MN titers was plotted for individual subjects that had an initial MN titer less than or equal to 40.
  • FIG. 4 Tablets were made using mi crocrystalline cellulose and starch, with 10% barium sulfate as a radiopaque material. These tablets were enteric coated with Eudragit LI 00® and given to female cynomolgus macaques by oral gastric tube. X-rays were taken over time post administration.
  • A Tablet in the stomach with the arrow pointing toward the tablet.
  • B One hour later, the tablet can be seen in the intestine, the white spot to the left of the spinal column with an arrow point toward it. It dissolved in the intestine within the next two hours, and cannot be seen.
  • FIG. 5 The numbers of ASCs are reported on days 7 and 35, 7 days after each immunization. Background ASCs at days 0 and 28 were miniscule, and not plotted. Average responses for day 7 are shown for each treated group with a horizontal line.
  • FIG. 6. Fold increase in MN titers for individual subjects. The dark shaded columns indicate where the titers rose between days 28 and 56, whereas the light shaded columns shows the response after the initial immunization. A line was drawn at two fold increases in MN to show which subjects had a detectable neutralizing antibody response.
  • FIG. 7 Antibody responses following a single oral immunization. A.
  • HAI Geometric Mean Titers vs Time. HAI titers were measured at 0, 1, and 6 months post immunization to evaluate the durability of the antibody response, C. MN titers, pre and post immunization are shown for individual subjects.
  • FIG. 8 Serum ELISA IgG Titers Versus Dose of VXA-G 1.1 -NN in mice. Mice were immunized with VXA-G1.1-NN of 1x108, 5x108 and 1x109. YXA-G i I -NX was delivered orally by gavage on days 0 and 28. The serum IgG responses against Norwalk VPl were measure by ELISA at week 8. ⁇ b Each icon represents an individual mouse. The top of the bar for each study indicates the GMT. As the dose was increased from 1x108 to 5x108 to 1x109, the semm VPl IgG titer showed a dose-dependent increase from 2x103 to 1x104 to 5x105.
  • FIG. 9 Fecal SIgA ELISA Titers Versus Dose of YXA-Gi .1 -NN in mice. Mice were immunized with VXA-G1.1-NN of 1x108, 5x108 and 1x109, VXA-G 1.1-NN was delivered orally by gavage on days 0 and 28. The fecal SIgA responses against Norwalk VPl were measure by ELISA at week 8. Each study has a total of 6 mice. Each icon represents an individual mouse. The top of the bar for each study indicates the GMT. As the dose was increased from 1x108 to 5x108 to 1x109, the fecal VPl slgA titer showed a dose-dependent increase from 1x103 to 2 103 to 3x104,
  • FIG. 10 Semm ELISA IgG Titers of VXA-G1.1-NN Versus VPl protein in mice. Mice were immunized with VXA-G 1.1-NN of 1x108 orally or Norwalk vims Wl protein (lug) intramuscularly on days 0 and 28. The semm IgG responses against Norwalk VPl were measured by ELISA at weeks 4 and 8. Each study has a total of 6 mice. Each icon represents an individual mouse. The top of the bar for each study indicates the geomean titer. Oral vaccine generated slightly higher semm IgG titer values than the i.m. protein vaccine.
  • FIG. 11 Fecal SIgA ELISA Titers Versus Dose of VXA-G 1.1 -NN in mice. Mice were immunized with VXA-G 1.1-NN of 1x108 orally or Norwalk vims VPl protein (lug) intramuscularly on days 0 and 28. The fecal IgA responses against Norwalk VPl were measure by ELISA at weeks 4 and 8. Each study has a total of 6 mice. Each icon represents an individual mouse. The top of the bar for each study indicates the geomean titer. The oral vaccine generated a dramatically higher fecal IgA immune response than the i.m. protein vaccine. [0027] FIG. 12.
  • VXA-G1.1-NN Oral immunization of VXA-G1.1-NN compared to VPl protein immunization for Serum ELISA Titers.
  • Mice were immunized with VXA-G 1.1-NN of 1x108 orally or Norwalk virus VPl protein (lug) in the presence of adjuvant, aluminium hydroxide intramuscularly on days 0 and 28.
  • the serum IgG responses against Norwalk Wl were measure by ELISA at weeks 4 and 8. Each study has a total of 6 mice. Each icon represents an individual mouse. The top of the bar for each study indicates the geomean titer.
  • Intramuscular injection with the VP I protein together with alum generated much higher serum titer Intramuscular injection with the VP I protein together with alum generated much higher serum titer.
  • FIG. 13 Oral immunization of VXA-G1.1- N compared to VP1 protein
  • mice were immunized with VXA-G1.1-NN of 1x108 orally or Norwalk virus VP1 protein (lug) in the presence of adjuvant, aluminium hydroxide intramuscularly on days 0 and 28.
  • the fecal IgA responses against Norwalk VP1 were measure by ELISA at weeks 4 and 8. Each study has a total of 6 mice. Each icon represents an individual mouse. The top of the bar for each study indicates the geomean titer. Even in the presence of adjuvant, aluminium hydroxide, the oral vaccine generated a higher fecal SIgA immune response than the i.m. protein vaccine.
  • FIG. 14 Serum and Fecal IgA Titers following Oral Immunization of VXA-G2.4- NS in mice. Mice were immunized with VXA-G2.4-NS of 1x108 orally on days 0 and 28. For comparison, oral delivered groups from study#3 were presented again. The serum IgG responses against Sydney VP1 were measure by ELISA at weeks 4 and 8 (A). The fecal SIgA response against the Sydney VP1 was measured by ELISA at week 8 (B). At 4 weeks, the Sydney strain vaccine generated better IgG titer values than the Norwalk vaccine. In addition, even at 4 weeks the titer values from the Sydney strain were slightly higher than the Nonvalk values at 8 weeks (A). The Sydney vaccine generated slightly higher fecal VPl IgA titer values than the Norwalk vaccine.
  • FIG. 15 Serum and Fecal IgA Titers following Oral Immunization of VXA-G2.4- NS in ferrets.
  • Ferrets were endoscopically administered VXA-G2.4-NS on days 0 and 2 (group 1) or days 0 and 28 (group2).
  • Ferrets in group3 were intramuscularly administered the recombinant VPl protein from the Sydney strain norovirus on days 0 and 28. Whereas group! generated higher IgG titer values than group2, group2 generated higher SIgA titer values than group 1.
  • Group3 failed to generate fecal SIgA response although serum IgG responses were generated.
  • FIG. 16 failed to generate fecal SIgA response although serum IgG responses were generated.
  • Serum IgG Serum IgG following Oral Immunization of VXA-G2.4-NS in Non human primates ( ⁇ , Cynomolgous macaque). NHPs were endoscopically administered VXA- G2.4-NS on days 0 and 56 (the "Noro" group). Serum IgG titers were measured by ELISA at day 0, 7, 28, 56, and 72.
  • FIG. 17 Anti-RSVF antibody titers in cotton rats at 4weeks post vaccination with Ad-RSVF vaccine vectors or control formalin inactivated RSV (FIRSV) or live wild-type RSVA2. Titers were determined using an anti-RSVF IgG ELISA.
  • FIG. 18 Palivizumab Competition using sera from cotton rats vaccinated with Ad- RSVF vaccine. ELISA plates were coated with an RSVA2 lysate at 1 ug/mL. Biotinylated Palivizumab (10 ng/mL) was mixed with serial 2-fold dilutions of control and test sera. Naive sera was used to determine 100% Palivizumab binding. Unlabelled Palivizumab was used as positive control. HRP-Strepavidin with TMB substrate was used to detect biotinylated Palivizumab. Inhibition was scored relative to 100% biotinyaled Paliziumab binding. The maximum dilution that gave 50% or greater neutralization activity was assigned as the competition titer.
  • FIG. 19 Enrollment criteria for the study of "High Titer Neutralizing Antibodies to Influenza Following Oral Tablet Immunization: A Randomized, Placebo-controlled Trial. ' " The major exclusion criteria are:
  • FIGs. 20A-20D Antibody responses following a single oral immunization of a recombinant Ad serotype 5 (rAd5) based oral vaccine against HI seasonal influenza.
  • FIG. 20A shows FIAI antibody titers pre and post immunization (days 0 and 28 respective) are shown for individual subjects.
  • FIG. 20B shows HAI GMT v. time. HAI titers were measured at 0, 1, and 6 months post immunization to evaluate the durability of the antivody response.
  • FIG. 20C shows MN titers pre and post immunization for individual subjects.
  • FIG 20D shows ASC response following immunization. The numbers of IgG and IgA ASCs are reported (per le6 PMBCs) 7 days after immunization.
  • FIGs. 21 A-21B Anti-Ad5 immunity and effects on neutralizing antibody responses.
  • FIG. 21 A shows Fold change in MN versus starting anti-Ad5 titer for vaccine treated subjects. Subjects were not pre-screened for anti-Ad5 titers, but retrospectively measured.
  • FIG. 21B shows fold change in HAI responses that were plotted for etiher Ad5 titer positive or negative, analogous as performed in FIG. 2, No trend was observed for Ad5 starting titers on the ability to elicit a neutralizing antibody response (by MN or HAI) to influenza virus.
  • FIG. 22 shows mice elicit robust antibody titers against RSV when given VXA- RSV-f.
  • Study No. WCB254 Balb/c mice were immunized with VXA-RSV-f at 0 and 3 weeks using three different routes of delivery. ELISA IgG antibody titers were measured at week 7. All routes of delivery generated significant immune responses against RSV;
  • FIGs. 23A-23C shows immunization of cotton rats with VXA-RSV-f vaccine induces antibody responses to RSV.
  • FIG. 23 A shows female cotton rats were immunized on week 0 and 4, and antibody titers against RSV-f were measured on week 8.
  • VXA-RSV-f immunization was significantly better than using RSV2 vims or FI-RSV for inducing IgG ELISA titers to RSV. (p ⁇ 0.0022 by Mann-Whitney)
  • FIG. 23B shows palivizumab competitive ELISA titers were evaluated using pooled serum samples from each of the previously described groups, FI-RSV vaccine was not able to induce epitope specific antibodies that compete for the binding of palivizumab, but the VXA-RSV-f vaccine and RSV2 treated groups were able to induce these titers.
  • FIG. 23 C shows the VXA-RSV-f vaccine induced neutralizing antibody responses to RSV following immunization of cotton
  • VXA-RSV-f and RSV2 groups were superior to the FI-RSV, and the no vaccine controls (no infection and buffer groups) at inducing neutralizing titers against RSV.
  • FIGs. 24A-24B show oral immunization induces potent antibodies to RSV in cotton rats.
  • Example XV- 112 Female cotton rats were immunized with VXA- RSV-f on week 0 and 4, and the total IgG antibody ELISA titers were measured on weeks 4 and 8. Dose dependent antibody responses were observed with IxlO 9 and lxl0 i0 trending better than the IxlO 8 IU dose group.
  • FIG. 24B Paiivizumab competitive ELISA titers were evaluated for the same groups as described before, but at week 8. Higher vaccine doses trended with higher Paiivizumab competitive antibody titers, but the results were not significantly different.
  • FIG. 24C shows oral immunization of VXA-RSV-f also induced dose dependent neutralizing antibody titers to RSV, with the 1x1010 group performing
  • FIGs. 25A-25C shows VXA-RSV-f protects against RSV replication and adaptive immune enhancements of RSV disease.
  • FIG 25B inflammation in the lungs was scored by immunohistology.
  • the vaccine groups (VXA-RSV- f and RSV2) did not cause adaptive immune enhanced inflammation (PB, PA, A, IP) as did the FI-RSV group.
  • FIG. 25C cytokine abundance levels were measured by qRT-PCR. Only the FI-RSV immunized group had substantial increases in the relative abundance of IL- 4 and IL-13, the Th2 cytokines measured.
  • FIGs. 26A-26C shows oral immunization induces protection against RSV replication and disease.
  • Example XV-112 animals immunized orally show dose dependent immune responses to RS V infection, with the highest dose leading to complete protection in the lungs and almost complete protection in the nose. In contrast, there was no protection in the buffer control group.
  • FIG. 26B inflammation was compared between vaccine doses and the buffer control group.
  • the inventors have discovered that delivery of an immunogenic biological agent to a particular part of the small intestine, i.e., the ileum, results in a much greater therapeutic response than when the agent is not targeted, or is targeted to a different site. This allows for design of more effective vaccines, reduced costs for materials, and reduced side effects for the recipient.
  • Immunogenic refers to the ability of an agent to give rise to an immune response in a host, either humoral or cell-mediated. Immunogenic agents are typically "foreign" to the host, e.g., from a different species, or from a bacteria, virus, or fungus. A non-foreign agent can be immunogenic, e.g., in the case of an autoimmune response. Certain cancer cell-specific agents can be exploited as immunogenic agents, allowing the host's immune system to attack the cancer.
  • biological agent refers to a nucleic acid, polypeptide, glycoprotein, carbohydrate, lipid, or modified form thereof (e.g. methylated, glycosylated, detectably labeled).
  • Biological agents are distinguished from small molecule drugs in that they can be created by biological processes (including recombinant techniques) instead of chemical synthesis.
  • Biological agents can, however, be chemically modified or include non-natural nucleotides or amino acids.
  • Biological agents can also be non-naturally occurring, e.g., recombinant or chimeric entities.
  • an immunogenic biological agent refers to an agent that acts directly as an antigen (e.g., is recognized by a T cell receptor or antibody), or an agent that, once expressed in a ceil, acts as an antigen.
  • an immunogenic biological agent can include an expression vector encoding an immunogenic polypeptide.
  • antigen refers to a polypeptide, glycoprotein, lipoprotein, lipid, carbohydrate, or other agent that is bound (e.g., recognized as “foreign") by a T cell receptor and/or antibody.
  • Antigens are commonly derived from bacterial, viral, or fungal sources.
  • the term "derived from” indicates that the antigen is essentially as it exists in its natural antigenic context, or that it has been modified to be expressed under certain conditions, to include only the most immunogenic portion, or to remove other potentially harmful associated components, etc.
  • An "immunogenically effective dose or amount" of a composition as described herein is an amount that elicits or modulates an immune response specific for an antigen selected for vaccination. Immune responses include humoral immune responses and cell- mediated immune responses. An immunogenic composition can be used therapeutically or prophyfactically to treat or prevent disease at any stage.
  • Humoral immune responses are mediated by ceil free components of the blood, e.g., plasma or serum; transfer of the serum or plasma from one individual to another transfers humoral immunity.
  • Humoral immune responses are typically B ceil -mediated, e.g., antibody production,
  • Cell mediated immune responses are mediated by antigen specific lymphocytes; transfer of the antigen specific lymphocytes from one individual to another transfers immunity.
  • Cell-mediated immune responses are mediated at least in part by T cells, and can be detected, e.g., by detecting T cell-specific cytokines or increase in T ceil proliferation.
  • the "ileum” is the longest of the three segments that form the small intestine, along with the duodenum and jejunum. It is makes up the terminal portion, between the jejunum and cecum.
  • An enteric coating is a barrier applied to oral medications that prevents the therapeutic agent inside from being digested in the low pH environment of the stomach and duodenum ( ⁇ pH 3).
  • a delivery agent such as an enteric coating, matrix, or capsule, is said to retain an encompassed or embedded therapeutic agent when at least 60%, e.g., at least about 70%, 75%, 80%, 85%, 90%, 95%o, or 100% of the original administered amount of therapeutic agent remains encompassed or embedded within the agent.
  • the delivery agent e.g., enteric coating or matrix
  • the enteric coating is said to "disintegrate ' " once the coating thickness is reduced at least 10%, e.g., at least 25%, 50%, or 75%> compared to the original administered thickness.
  • Disintegration is not an absolute term, as it can occur over a different time course depending on conditions. For example, a coating that is designed to disintegrate in 5 minutes at pH 6.5 may disintegrate, albeit slowly, at pH 6 (e.g., in 1 hour). Disintegration does not necessarily indicate that the encompassed or embedded therapeutic agent is released. The therapeutic agent can, however, begin to be released before the enteric coating or matrix is entirely disintegrated.
  • chimeric or “recombinant” as used herein with reference indicates that the nucleic acid, protein or vector, has been modified by the introduction of a heterologous nucleic acid or protein or the alteration of a native nucleic acid or protein.
  • chimeric and recombinant vectors include nucleic acid sequences that are not found within the native (non-chimeric or non- recombinant) form of the vector.
  • a chimeric viral expression vector refers to a viral expression vector comprising a nucleic acid sequence encoding a heterologous (e.g., immunogenic) polypeptide.
  • An "expression vector” is a nucleic acid construct, generated recombinant! ⁇ ' or synthetically, with a series of specified nucleic acid elements that permit transcription of a particular nucleic acid in a host cell.
  • the expression vector can be part of a plasmid, virus, or nucleic acid fragment.
  • the expression vector includes a nucleic acid to be transcribed operably linked to a promoter.
  • Viral expression vectors are typically rendered replication incompetent or attenuated,
  • a viral ly-derived vector can include the components of the expression vector required for expression of a desired sequence, but omit those involved in, e.g., replication or other pathogenic effects,
  • promoter and "expression control sequence” are used herein to refer to a nucleic acid control sequence that directs transcription of a nucleic acid.
  • Promoter sequences are typically near the start site of transcription, such as a TATA element in the case of a polymerase II type promoter.
  • a promoter can also include distal enhancer or repressor elements, which can be located as much as several thousand base pairs from the start site of transcription. Promoters include constitutive and inducible promoters.
  • “constitutive” promoter is a promoter that is active under most environmental and
  • an "inducible" promoter is a promoter that is active under environmental or developmental regulation.
  • operably linked refers to a functional linkage between a nucleic acid expression control sequence (such as a promoter, or array of transcription factor binding sites) and a second nucleic acid sequence, wherein the expression control sequence directs transcription of the nucleic acid corresponding to the second sequence.
  • heterologous when used with reference to portions of a nucleic acid indicates that the nucleic acid comprises two or more subsequences that are not found in the same relationship to each other in nature.
  • the nucleic acid is typically recombinantly produced, having two or more sequences from unrelated genes arranged to make a new functional nucleic acid, e.g., a promoter from one source and a coding region from another source.
  • heterologous portions of a protein indicates that the protein comprises two or more subsequences that are not found in the same relationship to each other in nature (e.g., a fusion protein).
  • a heterologous nucleic acid or protein is one that is not found in a particular environment in nature, e.g., a heterologous mouse protein in a human cell.
  • nucleic acid and “polynucleotide” are used interchangeably herein to refer to polymers of deoxyribonucleotides or ribonucleotides in either single- or double- stranded form.
  • the terms encompass genes, cDNA, RNA, and oligonucleotides (short polynucleotides).
  • the terms encompass nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non- naturally occurring, which have similar binding properties as the reference nucleic acid, and which are metabolized in a manner similar to the reference nucleotides.
  • nucleotide typically refers to a nucleic acid monomer.
  • nucleic acid sequence also encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions) and complementary sequences, as well as the sequence explicitly indicated.
  • degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer et al, Nucleic Acid Res. 19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985); Rossolini et al., Mol. Cell. Probes 8:91-98 (1994)).
  • a “therapeutic dose” or “therapeutically effective amount” or “effective amount” of a composition as described herein is an amount that prevents, alleviates, abates, or reduces the severity of symptoms of diseases and disorders associated with the source of the antigen selected for vaccination (e.g., a virus, bacteria, a parasite, or a cancer).
  • antibody refers to a polypeptide encoded by an immunoglobulin gene or fragments thereof that specifically bind and recognizes an antigen.
  • Immunoglobulin sequences include the kappa, lambda, alpha, gamma, delta, epsilon, and mu constant region sequences, as well as myriad immunoglobulin variable region sequences.
  • Light chains are classified as either kappa or lambda.
  • Heavy chains are classified as gamma, mu, alpha, delta, or epsilon, which in turn define the immunoglobulin classes, IgG, IgM, IgA, IgD and IgE, respectively.
  • T cells refer to a particular class of lymphocytes that express a specific receptor (T cell receptor) encoded by a family of genes.
  • the recognized T cell receptor genes include alpha, beta, delta, and gamma loci, and the T cell receptors typically (but not universally) recognize a combination of MI 1( plus a short peptide.
  • T cells are typically broadly classified as T helper ceils (CD4+) and cytotoxic T cells (CD8+).
  • Antibodies are naturally produced by B cells, e.g., Antibody Secreting Cells (ASCs).
  • Mature B cells can be naive, plasma B cells (activated and antibody -producing), memory, B-l, marginal-zone B cells, follicular B cells, and regulator ⁇ ' B cells.
  • An adaptive immune response refers to T cell and/or B cell and/or antibody recognition of antigen.
  • Antigen presenting cells are cells that are able to present immunogenic peptides or fragments thereof to T cells to activate or enhance an immune response.
  • APCs include dendritic cells, macrophages, B cells, monocytes and other cells that may be engineered to be efficient APCs.
  • Such cells may, but need not, be genetically modified to increase the capacity for presenting the antigen, to improve activation and/or maintenance of the T cell response, to have anti-tumor effects per se and/or to be immunologically compatible with the receiver (i.e., matched HLA haplotype).
  • APCs may be isolated from any of a variety of biological fluids and organs including bone marrow, peripheral blood, tumor and peritumoral tissues, and may be autologous, allogeneic, syngeneic or xenogeneic cells. APCs typically utilize a receptor from the major histocompatability (MHC) locus to present short polypeptides to T cells.
  • MHC major histocompatability
  • An adjuvant is a non-specific immune response enhancer. Suitable adjuvants include, for example, cholera toxin, monophosphoryl lipid A (MPL), Freund's Complete Adjuvant, Freund's Incomplete Adjuvant, Quil A, and Al(OH). Adjuvants can also be those substances that cause APC activation and enhanced presentation of T cells through secondary signaling molecules like Toll-like receptors, e.g., double-stranded RNA (dsRNA), dsRNA mimetics, bacterial flagelia, LPS, CpG DNA, and bacterial lipopeptide (Reviewed recently in [Abreu et al., J Immunol, 174(8), 4453-4460 (2005)]).
  • dsRNA double-stranded RNA
  • dsRNA mimetics e.g., dsRNA mimetics
  • bacterial flagelia e.g., bacterial flagelia, LPS, CpG DNA, and bacterial lipopeptide
  • polypeptide peptide
  • protein protein
  • amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non- naturally occurring amino acid polymer.
  • amino acid refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids.
  • Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g.., hydroxyproline, ⁇ - carboxygiutamate, and O-phosphoserine.
  • Amino acid analogs refers to compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e., a carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norieucine, methionine sulfoxide, methionine methyl sulfonium. Such analogs have modified R groups ⁇ e.g., norieucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid.
  • Amino acid mimetics refers to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that functions in a manner similar to a naturally occurring amino acid.
  • Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes.
  • Constantly modified variants applies to both amino acid and nucleic acid sequences. With respect to particular nucleic acid sequences, conservatively modified variants refers to those nucleic acids which encode identical or essentially identical amino acid sequences, or where the nucleic acid does not encode an amino acid sequence, to essentially identical sequences. Because of the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode any given protein. For instance, the codons GCA, GCC, GCG and GCU all encode the amino acid alanine. Thus, at every position where an alanine is specified by a codon, the codon can be altered to any of the corresponding codons described without altering the encoded polypeptide.
  • nucleic acid variations are "silent variations," which are one species of conservatively modified variations. Even,' nucleic acid sequence herein which encodes a polypeptide also describes every possible silent variation of the nucleic acid.
  • each codon in a nucleic acid except AUG, which is ordinarily the only codon for methionine, and TGG, which is ordinarily the only codon for tryptophan
  • TGG which is ordinarily the only codon for tryptophan
  • amino acid sequences one of skill will recognize that individual substitutions, deletions or additions to a nucleic acid, peptide, polypeptide, or protein sequence which alters, adds or deletes a single amino acid or a small percentage of amino acids in the encoded sequence is a "conservatively modified variant" where the alteration results in the substitution of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art. Such conservatively modified variants are in addition to and do not exclude polymorphic variants, interspecies homologs, and alleles of the invention.
  • the following eight groups each contain amino acids that are conservative substitutions for one another: 1) Alanine (A), Glycine (G); 2) Aspartic acid (D), Glutamic acid (E); 3) Asparagine (N), Glutamine (Q); 4) Arginine I, Lysine (K); 5) isoieucine (I), Leucine (!,), Methionine (M), Valine (V); 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W); 7) Serine (S), Threonine (T); and 8) Cysteine (C), Methionine (M) (see, e.g., Creighton, Proteins (1984)).
  • the phrase "selectively (or specifically) hybridizes to” refers to the binding, duplexing, or hybridizing of complementary (or largely complementary) nucleotides in a complex mixture (e.g., total cellular or library DNA or R A).
  • Polynucleotides may comprise a native sequence (i.e., an endogenous sequence that encodes an individual polypeptide or dsRNA or a portion thereof) or may comprise a variant of such a sequence.
  • Polynucleotide variants may contain one or more substitutions, additions, deletions and/or insertions such that at least one biological activity of the encoded polypeptide (e.g., immunogenicity) is not diminished, relative to a polypeptide comprising native antigens.
  • Polynucleotide variants may contain one or more substitutions, additions, deletions and/or insertions such that the adjuvant activity of an encoded dsRNA is not diminished, relative to a dsRNA that does not contain the substitutions, additions, deletions and/or insertions.
  • Variants preferably exhibit at least about 50%, 55%, 60%, 65%>, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to a polynucleotide sequence that encodes a native polypeptide or a portion thereof or a dsRNA.
  • polynucleotide or polypeptide sequences refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i.e., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%o, 96%, 97%>, 98%, 99%>, or more identity over a specified region), when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using one of the following sequence comparison algorithms or by manual alignment and visual inspection.
  • sequences are then said to be “substantially identical.”
  • This definition also refers to the compliment of a test polynucleotide sequence.
  • the identity exists over a region that is at least about 10 to about 100, about 20 to about 75, about 30 to about 50 amino acids or nucleotides in length.
  • a "control" sample or value refers to a sample that serves as a reference, usually a known reference, for comparison to a test sample.
  • a test sample can be taken from a test condition, e.g., in the presence of a test compound or treatment, and compared to samples from known conditions, e.g., in the absence of the test compound (negative control), or in the presence of a known compound (positive control).
  • negative control a biological sample from a known healthy (non-infected) individual
  • an example of a positive control would be a biological sample from a known infected patient.
  • a control can also represent an average value or a range gathered from a number of tests or results.
  • controls can be designed for assessment of any number of parameters.
  • a control can be devised to compare therapeutic benefit based on pharmacological data (e.g., half-life) or therapeutic measures (e.g., comparison of benefit and/or side effects).
  • Controls can be designed for in vitro applications.
  • controls are valuable in a given situation and be able to analyze data based on comparisons to control values. Controls are also valuable for determining the significance of data. For example, if values for a given parameter are widely variant in controls, variation in test samples will not be considered as significant.
  • diagnosis refers to a relative probability that a subject has a disorder such as an infection or cancer.
  • prognosis refers to a relative probability that a certain future outcome may occur in the subject. The terms are not intended to be absolute, as will be appreciated by any one of skill in the field of medical diagnostics.
  • treatment refers to any reduction in the severity of symptoms.
  • treatment can refer to a reduction of infectious agent, reduced symptoms, etc.
  • treatment can refer to, e.g., reducing tumor size, number of cancer cells, growth rate, metastatic activity, reducing cell death of non-cancer cells, etc.
  • treat and prevention are not intended to be absolute terms. Treatment and prevention can refer to any comparative reduction or apparent absence of infectious agent, delay in onset, amelioration of symptoms, improvement in patient survival, increase in survival time or rate, etc.
  • Treatment and prevention can be complete (undetectable level s of infectious agent or neoplastic cells) or partial, such that fewer infectious agent or neoplastic cells are found in a patient than would have occurred without the presently described immunogenic biological agents.
  • the effect of treatment can be compared to an individual or pool of individuals not receiving the treatment, or to the same patient prior to treatment or at a different time during treatment.
  • the severity of infection or disease is reduced by at least 10%, as compared, e.g., to the individual before administration or to a control individual not undergoing treatment.
  • the severity of infection or disease is reduced by at least 25%, 50%, 75%, 80%, or 90%, or in some cases, no longer detectable using standard diagnostic techniques.
  • Subject "patient,” “individual” and like terms are used interchangeably and refer to, except where indicated, mammals such as humans and non-human primates, as well as rabbits, rats, mice, goats, pigs, and other mammalian species.
  • mammals such as humans and non-human primates, as well as rabbits, rats, mice, goats, pigs, and other mammalian species.
  • the term does not necessarily indicate that the subject has been diagnosed with a particular disease, but typically refers to an individual under medical supervision.
  • a patient can be an individual that is seeking treatment, monitoring, adjustment or modification of an existing therapeutic regimen, etc. II.
  • Immunogenic biological agents are used interchangeably and refer to, except where indicated, mammals such as humans and non-human primates, as well as rabbits, rats, mice, goats, pigs, and other mammalian species.
  • the term does not necessarily indicate that the subject has been diagnosed with a particular disease, but typically refers to an individual under medical supervision.
  • a patient can be an individual that is seeking treatment,
  • An immunogenic biological agent is any biological agent that causes an immune response in the host, e.g., human host.
  • the immunogenic biological agent can thus be a
  • the immunogenic biological agent directly causes an immune response, e.g., is itself a target immunogen (antigen).
  • the immunogenic biological agent is a polynucleotide encoding the target immunogen.
  • APC antigen presenting cell
  • the immunogenic biological agent can be administered alone, in combination with a second, third, and/or fourth immunogenic biological agent (e.g., in the case of a multi -target preventative vaccine), and/or in combination with an adjuvant to increase the immune response.
  • Expression vectors for use as described herein can include virally -derived vectors, e.g., recombinant adeno-associated virus (AAV) vectors, retroviral vectors, adenoviral vectors, modified vaccinia Ankara (MVA) vectors, and lentiviral (e.g., HSV-1 -derived) vectors (see, e.g., Brouard etal. (2009) British J. Ph rm. 157: 153).
  • Virally-derived vectors for therapeutic use are typically rendered replication incompetent or attenuated.
  • the adenoviral genome can be modified to remove the E l and E3 genes.
  • the replication deficient vector can be administered to a cell that expresses the El gene such that recombinant adenovirus (rAd) is produced by the cell.
  • rAd recombinant adenovirus
  • This rAd can be harvested and used for a single round of infection to deliver the transgenic composition to another cell within a mammal in order to elicit immune responses to an encoded polypeptide antigen.
  • suitable viral vectors include adenovirus 5, including, for example. Ad 5 with deletions of the E1/E3 regions and Ad5 with a deletion of the E4 region as described in US Patent No. 8,222,224 and Scallan et al. Clinical and Vaccine Immunology 2013; 20(1): 85-94.
  • An exemplary Ad5 viral vector backbone is provided in SEQ ID NO: 7.
  • Other suitable adenoviral vectors include strains 2, orally tested strains 4 and 7, enteric adenoviruses 40 and 41, and other strains (e.g.
  • Ad34, Ad26, or Ad35 that are sufficient for delivering an antigen and eliciting an adaptive immune response to the transgene antigen [Lubeck et al, Proc Natl Acad Sci USA, 86(17), 6763-6767 (1989), Shen et al ., J Virol,
  • the viral vector does not need to have been isolated from humans, but can come from a non-human such as chimpanzee adenovirus 3 (ChAd3) (see, e.g., Colloca et al. (2012) Sci. Transl. Med. 4:115; Stanley eial. (2014) Nat. Med. doi:10.1038/nm.3702).
  • ChoAd3 chimpanzee adenovirus 3
  • the adenoviral vector is a live, replication incompetent adenoviral vector (such as El and E3 deleted rAd5), live and attenuated adenoviral vector (such as the E1B55K deletion viruses), or a live adenoviral vector with wild-type replication.
  • Transcriptional and translational control sequences in expression vectors to be used as described herein can be provided by viral sources.
  • promoters and enhancers are derived, e.g., from beta actio, adenovirus, simian virus (SV40), and human cytomegalovirus (CMV).
  • CMV cytomegalovirus
  • vectors allowing expression of proteins under the direction of the CMV promoter, SV40 early promoter, SV40 later promoter, metallothionein promoter, murine mammary tumor virus promoter, Rous sarcoma virus promoter, transducer promoter, or other promoters shown effective for expression in mammalian cells are suitable. Additional viral and non-viral promoter, control and/or signal sequences may be used, provided such control sequences are compatible with the host cells to be transfected.
  • Immunogens for use as described herein can be derived from antigens, such as, for example, viral antigens, bacterial antigens, cancer antigens, fungal antigens, or parasite antigens (see, e.g., US Patent No. 8,222,224 for a list of antigens that can be used as described herein).
  • antigens such as, for example, viral antigens, bacterial antigens, cancer antigens, fungal antigens, or parasite antigens (see, e.g., US Patent No. 8,222,224 for a list of antigens that can be used as described herein).
  • antigens that can be used as described herein are those derived from norovirus (e.g., VP1) and Respirator)' syncytial vims (RSV) (e.g., ).
  • suitable antigens include those from the influenza virus (e.g., HA, NA, Ml, NP), human immunodeficiency virus (HIV, e.g., gag, pol, env, etc.), human papilloma virus (HPV, e.g., capsid proteins such as LI), Venezuelan Equine Encephalomyelitis (VEE) virus, Epstein Barr virus, herpes simplex virus (HSV), human herpes virus, rhinoviruses, cocksackievi rases, enteroviruses, hepatitis A, B, C, E, and G (HA , HBV, HCV, HEV, HGV e.g., surface antigen), mumps virus, rubella virus, meas
  • influenza virus
  • Suitable viral antigens also include viral nonstructural proteins, e.g., proteins encoded by viral nucleic acid that do not encode for structural polypeptides, in contrast to those that make capsid or the protein surrounding a vims.
  • Non -structural proteins include those proteins that promote viral nucleic acid replication, viral gene expression, or post- translationsal processing, such as, for example, Nonstructural proteins 1, 2, 3, and 4 (NS1, NS2, NS3, and NS4, respectively) from Venezuelan Equine encephalitis (VEE), Eastern Equine Encephalitis (EEE), or Semliki Forest.
  • Bacterial antigens can be derived from, for example, Staphylococcus aureus, Staphylococcus epidermis, Helicobacter pylori, Streptococcus bovis, Streptococcus pyogenes, Streptococcus pneumoniae, Listeria monocytogenes, Mycobacterium tuberculosis, Mycobacterium leprae, Cory neb acterium diphtheriae, Borrelia burgdorferi, Bacillus anthracis, Bacillus cereus, Clostridium botulinum, Clostridium difficile, Salmonella typhi, Vibrio chloerae, Haemophilus influenzae, Bordetella pertussis, Yersinia pestis, Neisseria gonorrhoeae, Treponema pallidum, Mycopiasm sp., Legionella pneumophila, Rickettsia typhi
  • Parasite antigens can be derived from, for example, Giardia lamblia, Leishmania sp,, Trypanosoma sp., Trichomonas sp,, Plasmodium sp, (e.g., P. falciparum surface protein antigens such as pfs25, pfs28, pfs45, pfs84, pfs 48/45, pfs 230, Pvs25, and Pvs28);
  • Schistosoma sp. Mycobacterium tuberculosis (e.g., Ag85, MPT64, ESAT-6, CFP10, R8307, MTB-32 MTB-39, CSP, LSA-1, LSA-3, EXP1, SSP-2, SALSA, STARP, GLURP, MSP-1, MSP-2, MSP-3, MSP-4, MSP-5, MSP-8, MSP-9, AMA-1, Type 3 integral membrane protein, RESA, EBA-175, and DBA).
  • Mycobacterium tuberculosis e.g., Ag85, MPT64, ESAT-6, CFP10, R8307, MTB-32 MTB-39, CSP, LSA-1, LSA-3, EXP1, SSP-2, SALSA, STARP, GLURP, MSP-1, MSP-2, MSP-3, MSP-4, MSP-5, MSP-8, MSP-9, AMA-1, Type 3 integral membrane protein, RESA, EBA-17
  • Fungal antigens can be derived from, for example, Tinea pedis, Tinea corporus, Tinea cruris. Tinea unguium, Cladosporium carionii, Coccidioides immitis, Candida sp., Aspergillus fumigatus, and Pneumocystis carinii.
  • Cancer antigens include, for example, antigens expressed or over-expressed in colon cancer, stomach cancer, pancreatic cancer, lung cancer, ovarian cancer, prostate cancer, breast cancer, skin cancer (e.g., melanoma), leukemia, or lymphoma.
  • Exemplary cancer antigens include, for example, HPV LI, HPV L2, HPV El, HPV E2, placental alkaline phosphatase, AFP, BRCA1, Her2/neu, CA 15-3, CA 19-9, CA- 25, CEA, Hcg, urokinase- type plasminogen activator (Upa), plasminogen activator inhibitor, CD53, CD30, CD25, C5, CDl la, CD33, CD20, ErbB2, CTLA-4. See Sliwkowski & Meliman (2013) Science
  • compositions further comprise at least one adjuvant.
  • Suitable adjuvants include, for example, the lipids and non-lipid compounds, cholera toxin (CT), CT subunit B, CT derivative CTK63, E. coli heat labile enterotoxin (LT), LT derivative LTK63, Al(OH) 3 , and polyionic organic acids as described in e.g., WO2004/020592, Anderson and Crowle, Infect, Immun, 31(1):413-418 (1981), Roterman et al., J. Physiol. Pharmacol., 44(3):213-32 (1993), Arora and Crowle, J. Reticuloendothei.
  • Suitable polyionic organic acids include for example, 6,6'-[3,3'-demithyl[l,r-biphenyl]-4,4'-diyl]bis(azo)bis[4- amino-5-hydrox- y-l,3-naphthalene-disulfonic acid] (Evans Blue) and 3,3'-[1, ⁇ biphenyl]- 4,4'-diylbis(azo)bis[4-amino-l-naphthalenesulfonic acid] (Congo Red). It will be appreciated by those of skill in the art that the polyionic organic acids may be used for any nucleic acid- based vaccination method in conjunction with any type of administration.
  • TLR-3 agonists e.g., dsRNA, and mimetics thereof such as polyLC, poly A:U, and polyLpolyC
  • TLR-3 agonists include, for example, short hairpin RNA, virally derived RNA, short segments of RNA that can form double-strands or short hairpin RNA, and short interfering RNA (siRNA).
  • the TLR-3 agonist is virally derived dsRNA, e.g., dsRNA derived from a Sindbis virus or dsRNA viral
  • the TLR-3 agonist is a short hairpin RNA.
  • Short hairpin RNA sequences typically comprise two complementary sequences joined by a linker sequence.
  • the particular linker sequence is not a critical aspect of the invention. Any appropriate linker sequence can be used so long as it does not interfere with the binding of the two complementary sequences to form a dsRNA.
  • TLR-3 agonists can result in pro-inflammatory cytokine release (e.g.
  • IL-6, IL-8, TNF-alpha, IFN-alpha, IFN-beta when contacted with a responder ceil (e.g., a dendritic cell, a peripheral blood mononuclear cell, or a macrophage) in vitro or in-vivo.
  • a responder ceil e.g., a dendritic cell, a peripheral blood mononuclear cell, or a macrophage
  • Suitable adjuvants include topical immunomodulators such as, members of the imidazoquinoline family such as, for example, imiquimod and resiquimod (see, e.g., Hengge et al, Lancet Infect. Dis. 1(3): 189-98 (2001).
  • Additional suitable adjuvants are commercially available as, for example, additional alum-based adjuvants (e.g., Alhydrogel, Rehydragel, aluminum phosphate, Algammulin); oil based adjuvants (Freund's Incomplete Adjuvant and Complete Adjuvant (Difco Laboratories, Detroit, Mich.), Specol, RIBI, TiterMax, Montanide ISA50 or Seppic MONTANIDE ISA 720); nonionic block copolymer-based adjuvants, cytokines (e.g., GM-CSF or Flat3-ligand);
  • additional alum-based adjuvants e.g., Alhydrogel, Rehydragel, aluminum phosphate, Algammulin
  • oil based adjuvants Red's Incomplete Adjuvant and Complete Adjuvant (Difco Laboratories, Detroit, Mich.), Specol, RIBI, TiterMax, Montanide ISA50 or Seppic MONTANIDE ISA 720
  • Merck Adjuvant 65 Merck Adjuvant 65 (Merck and Company, Inc., Rahway, N. J.); AS-2 (SmithKline Beecham, Philadelphia, Pa.); salts of calcium, iron or zinc; an insoluble suspension of acyiated tyrosine; acyiated sugars; cationically or anionically derivatized polysaccharides; polyphosphazenes; biodegradable microspheres; monophosphoryl lipid A and Quil A. Cytokines, such as GM- CSF or interleukin-2, -7, or -12, are also suitable adjuvants. Hemocyanins (e.g., keyhole limpet hemocyanin) and hemoerythrins can also be used as adjuvants.
  • Hemocyanins e.g., keyhole limpet hemocyanin
  • hemoerythrins can also be used as adjuvants.
  • Polysaccharide adjuvants such as, for example, chitin, chitosan, and deacetylated chitin are also suitable as adjuvants.
  • suitable adjuvants include muramyl dipeptide (MDP, N acetylmuramyl L aianyl D isogiutamine) bacterial peptidoglycans and their derivatives (e.g., threonyl-MDP, and MTPPE).
  • MDP muramyl dipeptide
  • N acetylmuramyl L aianyl D isogiutamine bacterial peptidoglycans and their derivatives (e.g., threonyl-MDP, and MTPPE).
  • BCG and BCG cell wall skeleton (CWS) can be used as adjuvants, with or without trehalose dimycolate. Trehalose dimycolate can be used itself (see, e.g., US Patent No. 4,5
  • Detoxified endotoxins are also useful as adjuvants alone or in combination with other adjuvants (see, e.g., US Patent Nos. 4,866,034; 4,435,386; 4,505,899; 4,436,727; 4,436,728; 4,505,900, and 4,520,019).
  • the saponins QS21, OS 17, QS7 are also useful as adjuvants (see, e.g., US Patent No. 5,057,540; EP 0362 279; WO 96/33739; and WO
  • Suitable adjuvants include Montanide ISA 720 (Seppic, France), SAF (Chiron, Calif, United States), ISCOMS (CSL), MF-59 (Chiron), the SBAS series of adjuvants (e.g., SB AS-2, SBAS-4 or SBAS-6 or variants thereof!, available from SmithKline Beecham, Rixensart, Belgium), Detox (Corixa, Hamilton, Mont.), and RC-529 (Corixa, Hamilton, Mont.).
  • SBAS series of adjuvants e.g., SB AS-2, SBAS-4 or SBAS-6 or variants thereof!, available from SmithKline Beecham, Rixensart, Belgium
  • Detox Corixa, Hamilton, Mont.
  • RC-529 Corixa, Hamilton, Mont.
  • Superantigens are also contemplated for use as adjuvants in the present invention.
  • Superantigens include Staphylococcus exoproteins, such as the alpha, beta, gamma, and delta enterotoxins from S. aureus and S. epidermidis, and the alpha, beta, gamma, and delta E. coli exotoxins.
  • Staphylococcus enterotoxins are known as staphylococcal enterotoxin A (SEA) and staphylococcal enterotoxin B (SEB), with enterotoxins through E (SEE) being described (Rott et al., 1992).
  • Streptococcus pyogenes B SEB
  • Clostridium perfringens enterotoxin Bowness et al., 1992
  • CAP cytoplasmic membrane-associated protein
  • TSST 1 toxic shock syndrome toxin I
  • the adjuvant(s) can be designed to induce, e.g., an immune response predominantly of the Thl or Th2 type.
  • High levels of Thl-type cytokines e.g., IFN-gamma, TNF-alpha, IL-2 and IL-12
  • Th2-type cytokines e.g., IL-4, IL-5, IL-6 and IL ⁇ 10
  • an immune response that includes Thl- and Th2-type responses will typically be elicited.
  • compositions and methods for ileal deliver ⁇ ' can rely on appropriate coatings, matrices, and devices such as those described below.
  • appropriate coatings, matrices, and devices such as those described below.
  • Enteric coatings are used to shield substances from the low pH environment of the stomach and delay release of the enclosed substance until it reaches a desired target later in the digestive tract.
  • Enteric coatings are known, and commercially available. Examples include pH-sensitive polymers, bio-degradable polymers, hydrogeis, time-release systems, and osmotic delivery systems (see, e.g., Chourasia & Jain (2003) J. Pharm. Pharmaceutical Sci. 6:33).
  • GIT The pH of the gastrointestinal tract
  • pH sensitive coatings can be used that dissolve in the ileum or just before the ileum.
  • Examples include Eudragit® L and S polymers (threshold pH's ranging from 5.5-7.0); polyvinyl acetate phthalate (pH 5,0), hydroxypropyl methylcellulose phthalate 50 and 55 (pH 5,2 and 5,4, respectively), and cellulose acetate phthalate (pH 5.0).
  • the polymer coating typically dissolves at about pH 6.8 and allows complete release within about 40 min (see, e.g., Huyghebaert et al. (2005) Int. J. Pharm. 298:26).
  • a therapeutic substance can be covered in layers of different coatings, e.g., so that the outermost layer protects the substance through low pH conditions and is dissolved when the tablet leaves the stomach, and at least one inner layer that dissolves as the tablet passes into increasing pH. Examples of layered coatings for deliver ⁇ ' to the distal ileum are described, e.g., in WO2013148258.
  • Biodegradable polymers typically rely on the enzymatic activity of microflora living in the GIT.
  • the ileum harbors larger numbers of bacteria than earlier stages, including lactobacilli and enterobacteria.
  • Osmotic-controlled Release Oral delivery Systems (OROS®; Alza) is an example of an osmotic system that degrades over time in aqueous conditions. Such materials can be manipulated with other coatings, or in varying thicknesses, to deliver specifically to the ileum (see, e.g., Coniey et al. (2006) Cnrr. Med. Res. Opin. 22: 1879).
  • Combination polymers for deliver ⁇ ' to the ileum are reported in WO2000062820.
  • Examples include Eudragit® LI00-55 (25 mg/ capsule) with tri ethyl citrate (2.4 mg/ capsule), and Povidone K-25 (20 mg/ tablet) followed by Eudragit® FS30D (30 mg/ ' tablet).
  • pH sensitive polymers can be applied to effect deliver ⁇ ' to the ileum, as described above and, e.g., methacrylic acid copolymers (e.g., poly(methacylic acid-co-methyl methacrylate) 1 :1), cellulose acetate phthalate, hydroxypropyl methyl cellulose phthalate, hydroxypropyl methylcellulose acetate succinate, polyvinyl acetate phthalate, cellulose acetate trimeliitate, carboxymethyi ethyl- cellulose, shellac or other suitable poiymer(s).
  • methacrylic acid copolymers e.g., poly(methacylic acid-co-methyl methacrylate) 1 :1
  • cellulose acetate phthalate hydroxypropyl methyl cellulose phthalate
  • hydroxypropyl methylcellulose acetate succinate polyvinyl acetate phthalate
  • cellulose acetate trimeliitate carboxymethyi eth
  • the coating layer can also be composed of film-forming polymers being sensitive to other luminal components than pH, such as bacterial degradation or a component that has such a sensitivity when it is mixed with another film-forming polymer.
  • film-forming polymers being sensitive to other luminal components than pH, such as bacterial degradation or a component that has such a sensitivity when it is mixed with another film-forming polymer.
  • examples of such components providing delayed release to the ileum are polymers comprising azo bond(s), polysaccharides such as pectin and its salts, galactomannans, amylose and chondroitin, disulphide polymers and glycosides.
  • Components with varying pH, water, and enzymatic sensitivities can be used in combination to target a therapeutic composition to the ileum.
  • the thickness of the coating can also be used to control release.
  • the components can also be used to form a matrix, in which the therapeutic composition is embedded. See generally, Frontiers in Drug Design & Discovery (Bentham Science Pub. 2009) vol. 4.
  • site-specific deliver ⁇ ' can be via capsules that release upon an externally generated signal.
  • HF high-frequency
  • the original HF capsule concept has since been updated and the result marketed as InteliSite®.
  • the updated capsule is a radio-frequency activated, non-disintegrating delivery system. Radiolabeling of the capsule permits the determination of the capsule location within a specific region of the GI tract via gamma scintigraphy. When the capsule reaches the desired location in the GI tract, external activation opens a series of windows to the capsule drug reservoir.
  • the immunogenic biological agent can be enclosed in a radio-controlled capsule, so that the capsule is tracked and signaled once it reaches the ileum.
  • the capsule is signaled at a given time after administration that corresponds to when the capsule is expected to arrive in the ileum, with or without detecting,
  • compositions can be used for prophylactic and therapeutic purposes as described herein. As explained above, pharmaceutical compositions can be prepared to protect against stomach degradation such that the administered immunogenic biological agent reach the desired location. Methods for microencapsulation of DNA and drugs for oral delivery are described, e.g., in US2004043952.
  • An immunogenic pharmaceutical composition can contain pharmaceutically acceptable salts of the immunogenic biological agent ⁇ e.g., immunogenic polypeptide, or polynucleotide encoding an immunogenic polypeptide).
  • Such salts may be prepared from pharmaceutically acceptable non-toxic bases, including organic bases (e.g., salts of primary, secondary and tertiary amines and basic amino acids) and inorganic bases (e.g., sodium, potassium, lithium, ammonium, calcium and magnesium salts).
  • organic bases e.g., salts of primary, secondary and tertiary amines and basic amino acids
  • inorganic bases e.g., sodium, potassium, lithium, ammonium, calcium and magnesium salts.
  • Some particular examples of salts include phosphate buffered saline and saline (e.g., for ingestion, nasal delivery, or injection).
  • a delayed release coating or an additional coating of the formulation can contain other film-forming polymers being non-sensitive to luminal conditions for technical reasons or chronographic control of the drag release.
  • Materials to be used for such purpose includes, but are not limited to, sugar, polyethylene glycol, polyvinylpyrrolidone, polyvinyl alcohol, polyvinyl acetate, hydroxypropyl cellulose, methyl cellulose, ethylceliulose, hydroxypropyi methylcellulose, carboxymethylcellulose sodium and others, used alone or in mixtures.
  • Additives such as dispersants, colorants, pigments, additional polymers, e.g., poiyfethylacrylat, methylmethacrylat), anti -tacking and anti-foaming agents can be included into a coating layer.
  • Other compounds may be added to increase film thickness and to decrease diffusion of acidic gastric juices into the core material.
  • the coating layers can also contain pharmaceutically acceptable plasticizers to obtain desired mechanical properties.
  • plasticizers are for instance, but not restricted to, triacetin, citric acid esters, phthalic acid esters, dibutyi sebacate, cetyi alcohol, polyethylene glycols, glycerol monoesters, polysorbates or other plasticizers and mixtures thereof.
  • the amount of plasticizer can be optimised for each formula, and in relation to the selected polymer(s), selected plasticizer(s) and the applied amount of said polymer(s).
  • Suitable pharmaceutical ingredients include, for example, water, saline, alcohol, a fat, a wax, a buffer, a solid carrier, such as mannitol, lactose, starch, magnesium stearate, sodium saccharine, talcum, cellulose, glucose, sucrose, and magnesium carbonate, or biodegradable microspheres (e.g., polylactate polygiycolate). Suitable biodegradable microspheres are disclosed, for example, in US Patent Nos. 4,897,268;
  • compositions may also comprise non-immunogenic buffers (e.g., neutral buffered saline or phosphate buffered saline), carbohydrates (e.g., glucose, mannose, sucrose or dextrans), mannitol, proteins, polypeptides or amino acids such as glycine, antioxidants, bacteriostats, chelating agents such as EDTA or glutathione, adjuvants (e.g., aluminum hydroxide), suspending agents, thickening agents and/or preservatives.
  • non-immunogenic buffers e.g., neutral buffered saline or phosphate buffered saline
  • carbohydrates e.g., glucose, mannose, sucrose or dextrans
  • mannitol e.g., proteins, polypeptides or amino acids
  • proteins e.glycine
  • antioxidants e.g., mannitol
  • chelating agents such as EDTA or glutathione
  • the pharmaceutical compositions for ileum deliver ⁇ ' as described herein are designed to elicit an immune response from an individual that is specific for an immunogenic biological agent included in the pharmaceutical composition.
  • the pharmaceutical composition can be used prophylactically or therapeutically as a vaccine to avoid or reduce a viral infection, bacterial infection, parasitic infection, fungal infection, or cancer.
  • the pharmaceutical compositions can be used to treat at any stage, e.g., at the pre-cancer, cancer, or metastatic stages, or to prevent disease or infection.
  • compositions described herein may be used to prevent or treat infection, such as influenza, hepatitis, or HIV, or for prevention or treatment of cancer.
  • compositions are typically administered to an individual that may or may not be afflicted with the disease, disorder, or infection.
  • a disease, disorder, or infection is diagnosed prior to administration, e.g., using criteria generally accepted in the art.
  • viral infection may be diagnosed by the measurement of viral titer in a sample from the patient
  • bacterial infection may be diagnosed by detecting the bacteria in a sample from the patient
  • cancer may be diagnosed by detecting the presence of a malignant tumor.
  • Pharmaceutical compositions can be administered either prior to or following surgical removal of primary tumors and/or treatment such as administration of radiotherapy or conventional chemotherapeutic drugs.
  • Immunotherapy is typically active immunotherapy, in which treatment relies on the in vivo stimulation of the endogenous host immune system to react against, e.g., tumors or bacterial ly or virally infected cells, with the administration of immune response-modifying agents (e.g., immunogenic biological agents).
  • immune response-modifying agents e.g., immunogenic biological agents
  • Frequency of administration of the prophylactic or therapeutic compositions described herein, as well as dosage, will vary from individual to individual, and can be readily established using standard techniques. Typically, between 1 and 52 doses can be administered over a 52 week period. In some embodiments, 3 doses are administered, at intervals of 1 month, or 2-3 doses are administered every 2-3 months. In some embodiments, a combination of more than one antigen can be administered simultaneously or sequentially, e.g., an annual influenza vaccine that contains individual components directed at each subtype of influenza or multiple clades within a subtype. In some embodiments, the intervals are more like once a year, e.g., an annual flu vaccine based on the particular current strain. Booster vaccinations can be given periodically thereafter. Alternate protocols may be appropriate for individual patients and particular diseases and disorders.
  • a suitable dose is an amount of an immunogenic biological agent that, when administered as described above, is capable of promoting, e.g., an anti-tumor, an anti-viral, or an antibacterial, immune response, and is at least 15-50% above the basal (untreated) level, or at least 5-50% (e.g., 5%, 10%, 20%, 30%, 50%, 1.5-fold, 2-fold, or higher) above the level from non-ileum targeted treatment.
  • an immunogenic biological agent that, when administered as described above, is capable of promoting, e.g., an anti-tumor, an anti-viral, or an antibacterial, immune response, and is at least 15-50% above the basal (untreated) level, or at least 5-50% (e.g., 5%, 10%, 20%, 30%, 50%, 1.5-fold, 2-fold, or higher) above the level from non-ileum targeted treatment.
  • Such response can he monitored by measuring the antitumor antibodies in a patient or by vaccine-dependent generation of cytolytic T cells capable of killing, e.g., the patient's tumor cells, the patient's virally infected cells, or the patient's bactenally infected cells in vitro.
  • cytolytic T cells capable of killing, e.g., the patient's tumor cells, the patient's virally infected cells, or the patient's bactenally infected cells in vitro.
  • Such vaccines can also generate an immune response that leads to an improved clinical outcome (e.g., complete or partial or longer disease-free survival, reduced viral titers) in vaccinated patients as compared to non-vaccinated patients, or patients receiving non-ileum targeted treatment.
  • an appropriate dosage and treatment regimen provides the active compound(s) in an amount sufficient to provide therapeutic and/or prophylactic benefit.
  • a response can be monitored by establishing an improved clinical outcome (e.g., reduced or negative viral titer, more frequent remissions, complete or partial, or longer disease-free survival) in treated patients as compared to patients treated with non-ileum targeted treatment, or non-treated patients.
  • Such immune responses can generally be evaluated using standard proliferation, cytotoxicity or cytokine assays described above, which can be performed using samples obtained from a patient before and after treatment.
  • detection of immunocomplexes formed between an immunogenic polypeptide and antibodies in body fluid that are specific for the immunogenic polypeptide can be used to monitor the effectiveness of therapy, e.g., for a disease or disorder in which the immunogenic polypeptide is associated .
  • Samples of body fluid taken from an individual prior to and subsequent to initiation of therapy e.g., ileum-targeted therapy
  • initiation of therapy e.g., ileum-targeted therapy
  • immunocomplexes in the second sample (post-targeted therapy) relative to the first sample (pre-targeted therapy) reflects successful therapy.
  • Radio-controlled capsules were given to healthy normal volunteers, with the vaccine either released early in the small intestine (jejunum) or later in the small intestine (ileum).
  • the use of the radio-controlled capsules for delivery of small molecule drugs has been described, but not for vaccine delivery (Digenis et ai. (1991) Crit. Rev. Ther. Drug Carrier Sy si 7:309).
  • the vaccine was composed of recombinant adenovirus expressing the influenza antigen HA from A/CA/04/2009 (rAd-HA-dsRNA) (see, e.g., US2012/0244185).
  • rAd-HA-dsRNA recombinant adenovirus expressing the influenza antigen HA from A/CA/04/2009
  • ASC Antibody Secreting Ceil
  • T cell responses were also determined by detecting interferon- ⁇ release (IFN- ⁇ ) using the ELISPOT® assay.
  • Figure 2 shows that 12/12 of the ileum-dosed group had increased levels of IFN- ⁇ , compared to 8/12 of the jejunum-dosed group 7 days post- administration. In addition, IFN- ⁇ levels were significantly higher in the ileum-dosed group than in the jejunum-dosed group.
  • MN Microneutralizing
  • Increased MN antibody levels are indicative of a neutralizing antibody response.
  • the fold increases in MN titers were plotted for individual subjects. The number of subjects with a positive increase was 9 out of 10 for the ileum delivered vaccine versus 6 out of 10 for jejunum delivered vaccine (Figure 3).
  • the geometric mean titers (GMT) were similar between the two groups, with ileum GMT rising from 22 to 92 versus the jejunum GMT rising from 18 to 90. The results indicate that ileum release is more reliable at inducing neutralizing antibody responses to influenza, possibly leading to a greater percentage of subjects protected against influenza.
  • Tablets were hand made using microcrystalline cellulose (PH-101, FMC) and starch (Starch 1500, Colorcon) incorporating 10% barium sulfate as a radiopaque material containing fumed silica as a flow aid and magnesium stearate as a tablet lubricant.
  • the tablets of 7.14 mm diameter and 150 mg weight were coated with Eudragit® L-100 in a pan coater using 10% coating solids weight gain as a guide to whether the enteric coating was added, coating solids contained 4 parts Eudragit® polymer to one part tri ethyl citrate and J part talc.
  • As an initial test of enteric coating performance four cynomolgus macaques were given tablets using an oral gastric tube.
  • the oral gastric tube is solid and rigid, but hollow- down the middle for instilling liquids. It has a flexible silicone tube on the leading end of the rigid tube that can hold a small tablet in place.
  • the tube and pill apparatus were threaded down the esophagus of restrained monkeys until the leading end passed through the cardiac sphincter and into the stomach. A flush of orange juice was used to dislodge the pill into the stomach. X-rays were taken at set time points, and examined for location and dissolution of the tablet. Table 1 summarizes the results.
  • Figure 4 shows that the tablets were completely intact in the low pH environment of the stomach; there was no evidence of premature dissolution of the tablets. While large for a monkey, the tablets were able to pass through the stomach intact into the intestine. In the intestine, they dissolved at a reasonable rate and were completely dissolved in 3 out of 4 monkeys. In the 4 th monkey, the pill left the stomach sometime after 3 hours and the pill had not dissolved at the time of the last x-ray. Overall, the tablets performed in an acceptable manner and the Eudragit® L-100 coating was selected for future human studies.
  • a phase 1 sequentially enrolled clinical study, with a randomized and placebo- controlled cohort to evaluate safety, and immunogemcity of a recombinant Ad serotype 5 (rAd5) based oral vaccine against HI seasonal influenza was completed.
  • the rAd5 vector (rAd-HA-dsRNA with HA from A/CA/04/2009) was described in Example 1.
  • the study had an active phase of approximately 3 months, and was conducted in accordance with applicable Good Clinical Practice guidelines, the United States Code of Federal Regulations, and the International Conference on Harmonization guidelines. Informed consent was obtained from all subjects after discussion of the risks. IRB approval was given before dosing of subjects.
  • GMP Good manufacturing practice
  • Purification was performed by ion exchange chromatography, followed by buffer exchange. Purified vector was mixed with excipients, lyophilized, and then tableted at Lonza using microcrystalline cellulose and starch as tableting bulk. Tablets were enteric coated with Eudragit® L 100 (Evonik Industries, Darmstadt, Germany) using a Vector HiCoater® LDCS- 5 coater (Vector Freund, Cedar Rapids, LA). The final product was released in one lot, and titered by standard IU assay. Placebo was prepared as similarly sized and shaped tablets containing 150 mg of microcrystalline cellulose, without enteric coating. The study compared 10 9 IU, 10 10 IU, and placebo treated subjects for the ability to elicit an immune response to transgene.
  • Subjects were given tablets on days 0 and 28.
  • the numbers of circulating pre-piasma B cells in peripheral blood were measured by ASC assays on days 0 and 7 after the initial dose, and at days 28 and 35 after the second dose (the second dose was delivered at day 28). Results show that ASC counts could be measured 7 days after each immunization in the treated groups, but not the placebo group ( Figure 5). Average responses were higher on day 7, and higher in the high dose group than the low dose group. Background ASCs on days 0 and 28 were negligible, and negligible for the placebo group at all time points. For the high dose group, an average of 105 +/- 33 and 27 +/- 12 ASCs were found for days 7 and 35 respectively.
  • Tablet disintegration was tested with 150 mg tablets prepared as described above, and coated with 8, 10, or 12% total solids weight gain, utilizing Eudragit® LIOO, Eudragit® LlOO-55, or 1:1 (w/w) mixture of LIOO and L100-55 polymers, applied as an organic solvent suspension.
  • tablets prepared with each coating polymer, and at each level of coating application were pre-exposed to USP simulated gastric fluid (SGF, pH 1,6, no pepsin) for 120 minutes in a VanKel Bio ⁇ Dis III reciprocating cylinder dissolution test apparatus at 37 °C at a reciprocation rate of 10 dips per minute (DPM).
  • SGF simulated gastric fluid
  • DPM VanKel Bio ⁇ Dis III reciprocating cylinder dissolution test apparatus
  • the tablets were then transferred to USP simulated intestinal fluid (SIF, pH 6.8, no pancreatin).
  • disintegration was recorded to the nearest 5 minutes.
  • the data indicate that the rate of disintegration is influenced by the environmental pH and differs between the two polymers. Again, the results can be used for proper selection of a coating composition to accomplish drug retention through the stomach and upper small intestine.
  • HAI Hemagglutination Inhibition
  • the placebo group had no IgA spots on day 7, but one subject had a high background smear and a measurable IgG ASC response with smaller spots than normally observed.
  • Subjects were retrospectively measured for their anti -vector titers pre- and post- immunization. Following oral immunization, a few vaccine-treated subjects had an increase in neutralizing antibody responses to Ad5, which led to a 2 -6-fold increase in the GM neutralizing antibody titers, compared to 1 - 0-fold GM fold rise in the placebo treated subjects. In the vaccine group, HAI and MN responses trended similarly for individual subjects. Eight subjects were Ad 5 negative before immunization, and four were Ad5 positive before immunization. One subject that was Ad5 positive did not HAI seroconvert, however, one subject that was Ad 5 positive had the highest increase in HAI titers (64 fold) of any of the subjects in the study.
  • MN GMFR was calculated at 29 for the 12 vaccine treated subjects with 92% of subjects showing a greater than 4-fold rise in MN titers.
  • HAI SC rate among vaccine treated subjects was 75%> with over 92% of subjects having a 4-fold rise in HAI titers ( Figure 7A).
  • MN titers were higher than the HAI titers. It is possible that the MN assay is more sensitive or that the oral rAd based vaccine elicits stronger neutralizing responses outside the head region than protein injected vaccines.
  • HAI responses are elicited with injected commercial vaccines, but HAI titers are known to wane.
  • non-HIV infected volunteers had a 67% drop in GMT HAI titers between 1 and 6 months post immunization (Crum-Cianflone et al. (2011) Vaccine
  • HAI Hemagglutination Inhibition
  • Randomization and Masking The study was designed to evaluate the vaccine (VXA-A1 ⁇ 1) in 12 subjects at a single dose of 1 x 10 11 infectious units (IU) with 12 subjects given a placebo control. There were 3 sequentially enrolled sentinel vaccine-treated subjects, with each subject dosed no more frequently than one every 24 h. After a week of monitoring for vaccine-related toxicities, the remaining subjects in the treated cohort (9) were randomized along with 12 placebo controls. Randomization was performed by computer generated assignment, and study drug was distributed with concealed identity to the blinded staff by the unblinded pharmacist. Ail investigative site staff as well as persons directly involved with immunological assays or the assessment of clinical safety remained blind to treatment assignments. All subjects were blinded in the study .
  • the rAd vector (non-replicating Ad5) carries DNA which encodes the HA (A/CA/04/2009) transgene whose expression is driven by a CMV promoter and a molecular dsRNA hairpin driven by a separate promoter, GMP drug substance was produced in Wave bags (GE Healthcare, Waukesha, WI) at Lonza Biologicals (Houston, TX). Purification was performed by ion exchange chromatography, followed by buffer exchange. Purified vector was mixed with excipients, lyophilized, and then tabieted at Lonza using microcrystalline cellulose and starch as tableting bulk.
  • Placebo was prepared as similarly sized and shaped tablets containing 150 mg of microcrystalline cellulose, without enteric coating,
  • Endpoints The primary endpoint for this study is safety and the secondary endpoint is immunogenicity through the active phase, primarily by HAI titers and HAI
  • Vacutainer® tubes (BD, Franklin Lakes, NJ) and PBMCs were isolated the same day using LymphoprepTM tubes (Axis-Shield, Norway), PBMCs were frozen and thawed using serum free reagents according to the manufacturer's instructions (Cellular Technology Ltd [CTL], Shaker Heights, OH).
  • CTL Cellular Technology Ltd
  • ASCs Antibody Secreting cells
  • Enzyme linked immunosorbent (ELI Spot) kits for IgG and IgA secreting B cells were performed according to manufacturer's instructions (Mabtech, Mariemont, OH). Cells were cultured (between 1 -5 X 10 4 to 5 X 10 3 cells per well) in triplicate wells, in CTL-Test medium to optimize spots.
  • HA protein Protein Sciences Corp, Men den, CT
  • HAI and MN titers less than 10 were marked as 5 as suggested by regulatory advice.
  • the norovirus VP1 vaccines (VXA-G2.4-NS and VXA-G1 , 1-NN) of the invention has the same replication-defective viral vector backbone and adjuvant RNA sequence as described in US Patent No. 8,222,224 and Seal lan et al Clinical and Vaccine Immunology 2013; 20(1): 85-94.
  • the sequence of the vector backbone is provided in SEQ ID NO: 7.
  • VXA-G2.4-NS is an El/E3-deleted replication-incompetent serotype 5 adenovirus vector designed for use as a vaccine for the prevention of norovirus disease (NVD).
  • the recombinant adenovirus (rAd) vector codes for a 1.6 kb gene from the viral protein 1 (VP1) of norovirus (G2.4 Sydney strain) and an adjuvant dsRNA sequence that enhances the immunogenicity of the expressed antigen in the gut mucosa via its TLR3 agonistic activity.
  • the VP1 gene has been codon-optimized for expression in mammalian cells and is expressed using a human cytomegalovirus intermediate early region (hCMVIE) enhancer/promoter and a bovine growth hormone polyadenylation (pA) signal.
  • This expression cassette also includes the first intron of human ⁇ -globin to enhance transgene expression.
  • a second hCMVTE promoter is used to express the adjuvant RNA sequence.
  • the adjuvant sequence is derived from a luciferase sequence and has been reported to stimulate the induction of type I interferons in vitro (2).
  • the adjuvant is expressed as a short hairpin RNA, comprising a 21- nucleotide sequence (GAAACGATATGGGCTGAATAC) as a tandem sequence in forward and reverse orientations separated by six nucleotides that comprise the loop of the RNA.
  • the 21-nucleotide forward and reverse RNA sequences anneal to form the stem of the loop.
  • This adjuvant cassette utilizes a synthetic poly A (SPA).
  • VXA-G2.4-NS and the related VXA-G1.1-NN
  • VXA-G1.1-NN elicited substantial and reliable antibody responses in both systemic serum IgG and intestinal (fecal) IgA response in test animals.
  • a unique immune response elicited by oral vaccination is the induction of antibodies derived from local sources of B cells. After oral vaccination or enteric infection, B cells residing in the lamina basement (underneath the gut epithelial cells) predominantly produce dimeric antibodies of the IgA isotype . IgA antibodies pass across the gut epithelial cells into the lumen through facilitated transport, leaving a secretory component attached to dimeric IgA.
  • SIgA secretory IgA or SIgA.
  • SIgA serve as an additional external barrier to block enteric infection. SIgA are eventually flushed out of the system, and can be detected in fecal samples.
  • the secondary objective of the immunogenicity studies was to compare two routes of immunization (oral with VXA-G2.4-NS vs. i.m. with VP1 protein).
  • the VP1 protein was compared since VPl VLP based injectable vaccine is one of the few norovirus vaccines under development.
  • SIgA are induced by mucosal immunization but a much lesser degree by parenteral immunization. Therefore, we investigated intestinal SIgA response induced by oral VXA-G2.4-NS delivery compared to injectable recombinant VPl protein based vaccines.
  • VXA-Gl.l-NN Immunization on 8 weeks VPl
  • VXA-G2.4-NS Immunization on 4 and 8 VPl F.LISA
  • the primary objective of the initial mice immunogenicity studies was to determine if the vector backbone expressing a norovims VP1 from Norwalk virus or the Sydney strain could induce an antibody response to VP1 from Norwalk virus or the Sydney strain as measured by ELISA.
  • rAd expressing the Norwalk VP2 strain and the dsRNA adjuvant (VXA-G1.1-NN) was delivered orally by gavage on days 0 and 28.
  • a dose titration was conducted (study#l and study#2).
  • Norwalk virus VP1 specific IgG and slgA responses were measured from serum and fecal samples, respectively at 8 weeks.
  • the serum VP1 IgG titer showed a dose-dependent increase geometric mean titer (GMT) increase from 2x10" to lxl 0 4 to 5xl0 5 ( Figure 8).
  • GTT geometric mean titer
  • the oral vaccine of the invention generated sli ghtly higher serum IgG titer values than the intramuscular protein vaccine ( Figure 10). In the fecal study, oral vaccine generated a dramatically higher intestinal SIgA immune response than the intramuscular protein vaccine ( Figure 11).
  • the objective of the ferret study was to ( i) determine whether the oral vaccine of the invention could induce an intestinal SIgA as well as systemic serum IgG response compared to recombinant Sydney VP1 protein and (2) compare SIgA and IgG response with two different immunization schedules. Twenty ferrets were randomized into 3 groups (4 males and 4 females in each of groups 1 and 2 and 2 males and 2 females in Group 3). On day 0 and 2, animals in group I were endoscope cally administered VXA-G2.4-NS.
  • the oral vaccine of the invention could manipulate the immune response to benefit the individual.
  • the oral vaccine Before norovirus infection, the oral vaccine will induce gut homing B cells to secrete VP1 specific SIgA antibody. IgA enriched gut homing B cells in PBMC were detected in previous studies. SIgA will pass across the intestinal epithelial ceils to the alimentary tract (gut lumen). After norovirus infection, SIgA will act as a blocking
  • a gut pathogen is an excellent match for the oral platform because the oral delivery method activates immune cells with the desired gut homing property and intestinal SIgA is the most effective gut immune response to combat a gut pathogen.
  • Phase 1 VXA-G24-NS study synopsis This study is a phase 1, randomized, double-blind, placebo-controlled, dose-ranging trial to determine the safety and immunogenicity of an adenoviral -vector based norovirus vaccine (vxa-g2,4-ns) expressing gii.4 vpl and dsrna adjuvant administered orally to healthy volunteers.
  • the study will be conducted in 1-2 U.S. sites on healthy adult volunteers age 18 to 49 years. Subject participation in the study will last ⁇ 1 year following successful screening and enrollment. After vaccination subjects will be followed for one month for efficacy (immunogenicity) and for 12 months for safety.
  • VXA-G2.4-NS is an E1/E3 -deleted replication-defective Adenovirus serotype 5 vaccine vector for prevention of norovirai gastroenteritis caused by Norovirus GII.4.
  • the vaccine vector encodes for a full-length VP1 (major capsid protein) gene from Norovirus GII.4 Sydney and is described in detail in Example 6.
  • the GII.4 VP1 gene is expressed using a human Cytomegalovirus (CMV)
  • hCMVie intermediate early region
  • dsRNA double-stranded RNA
  • VXA-G2.4-NS Single administration of VXA-G2.4-NS at a low dose of 1x1010 IU, a high dose of 1x1011 IU or placebo. The number of tablets per dose will be calculated based on the release assay results for the drug product.
  • Two sentinel groups will enroll three subjects each in an open-label manner (Cohorts 1 and 3) to receive VXA-G2.4-NS prior to enrolling either of the randomized, controlled cohorts (Cohorts 2 and 4). Within the double-blinded groups
  • Cohort 4 1x1011 IU ⁇ 0,5 logs (u 20) or placebo (n 10) [0171] Subjects in Cohorts 2 and 4 will be randomized in a 2: 1 ratio to VXA-G2.4-NS at 1x1010 IU (low dose) or 1x10 1 IU (high dose), respectively, or placebo.
  • the primary objective is to determine the safety of a VXA-G2.4-NS norovirus vaccine candidate.
  • the secondary objective is to determine the immunogenicity of a VXA- G2.4-NS norovirus vaccine candidate at two dose levels
  • Cohort 1 low dose sentinel group
  • Cohort 2 will enroll 3 subjects to receive a single dose of VXA-G2.4-NS at 1x1010 IU on Day 0.
  • the 3 subjects will be enrolled sequentially (one per day), in an open-label manner.
  • the study will enroll continuously during this phase unless the criteria for pre- established stopping rules are met (see below). Should this happen, enrollment of subsequent subjects will not be initiated until the study Safety Monitoring Committee (SMC) has completed review of safety data and offered the recommendation to proceed. The safety assessment will be performed with the treatment assignments coded in Cohort 2, If the SMC needs treatment information to assess an AE/SAE, the code will be revealed for that subject.
  • SMC Safety Monitoring Committee
  • the study will enroll continuously during this phase unless the criteria for pre- established stopping rules are met (see Halting Rules below). Should this happen, enrollment of subsequent subjects will not be initiated until the SMC has completed review of safety data and offered the recommendation to proceed.
  • the safety assessment will be performed with the treatment assignments coded in Cohort 4. If the SMC needs treatment information to assess an AE/SAE, the code will be revealed for that subject.
  • mun ogeni city evaluations will be obtained at baseline prior to vaccination, and at Days 7 and 28 following vaccination. Subjects will also be evaluated for persistent immunogenicity at Day 180 and be followed for safety for 12 months following vaccination.
  • Inclusion criteria include:
  • ALT aspartate aminotransferase
  • AST aspartate aminotransferase
  • WBC white blood cells
  • NNS Normal or grade 1 abnormality with no clinical significance (NCS) for albumin, amylase, blood urea nitrogen (BUN), calcium, creatine phosphokinase (CPK), creatinine, glucose, magnesium, potassium, sodium, total protein, eosinophils (increase), hemoglobin, lymphocytes (decrease), and platelets;
  • NCS normal or grade 1 abnormality with no clinical significance
  • Exclusion criteria include:
  • Such conditions may include but are not limited to:
  • Immunogenicity will be evaluated using cellular and humoral immune function assays from blood samples obtained at baseline (pre-dose) and at Study Days 7 and/or 28 depending on the assay. In addition, a final evaluation for persistent immunogenicity will be performed at Day 180.
  • the following assessments will be performed : Serum IgG VP1; Histo-biood group antigen-blocking antibodies (BT50); IgG ASC VP1; IgA ASC VP1 ; Flow cytometric B cell immunophenotyping; Pre-plasma B cell culture for IgG VP 1 and IgA VPl; Fecal IgA VPl; HAI; and Anti-Ad5.
  • Safety analyses include: i) Standard descriptive demography; 2) Proportion of subjects in each treatment group will be tabulated for each local and systemic solicited reactogenicity event and any unsolicited AEs, AE severity will be classified using
  • Immunogenicity analy ses include: 1) Serum IgG VP1 and Histo-blood group antigen- blocking antibodies (BT50); 2) Additional exploratory analyses will include IgG ASC VP1; IgA ASC VP1; Flow cytometric B cell immunophenotyping, Pre-plasma B cell culture for IgG VP ! and IgA VP1; Fecal IgA VPl ; HAI; Anti-Ad5.
  • Serum IgG VP1 and Histo-blood group antigen- blocking antibodies (BT50) 2) Additional exploratory analyses will include IgG ASC VP1; IgA ASC VP1; Flow cytometric B cell immunophenotyping, Pre-plasma B cell culture for IgG VP ! and IgA VP1; Fecal IgA VPl ; HAI; Anti-Ad5.
  • BT50 Histo-blood group antigen- blocking antibodies
  • Safety will be summarized by treatment group. Local and systemic reactogenicity, AEs, clinical laboratory results, and vital signs will be summarized descriptively by study visit. Number and percentage of subjects who experience acute symptoms of conjunctivitis, upper respiratory infection, loose stools and/or diarrhea within 14 days following initial vaccination will be compared by treatment group using Fisher's exact test.
  • Respirator ⁇ - syncytial virus is the most important cause of lower respiratory tract infection (LRl) in infants and young children and is a major cause of LRTI in the elderly and immune-compromised patients where it can have devastating effects, causing significant morbidity and mortality. It is estimated to infect 5-10% of nursing home residents per year, with rates of pneumonia or death of 10-20% and 2-5% respectively (Falsey et al. 2000). There is no approved vaccine though there is an approved prophylactic monoclonal antibody, Palivizumab, for disease prevention in high-risk infants.
  • Ad-RSVF Ad-RSVF expressing the fusion protein (F) of RSV and a dsRNA adjuvant was generated as described above.
  • the Ad vaccine vector was produced in 293 cells, purified and a titer determined. The vector was then evaluated first in mice where significant immune response was elicited to the fusion protein (data not shown) and then in the relevant RSV animal model, cotton rats. As an oral delivery method has not been optimized in Cotton rats the intra-nasai route was chosen as an alternate mucosal route of delivery.
  • VXA-RSV-f is an El /E3 -deleted replication-incompetent serotype 5 adenovirus vector designed for use as a vaccine for the prevention of RSV and administered by the oral route.
  • the recombinant adenovirus (rAd) vector codes for 1) the fusion (F) gene from the RSV A2 strain (Genbank# HQS 17243.1) and 2) an adjuvant dsR A sequence that enhances the immunogenicity of the expressed F antigen in the gut mucosa via its TLR3 agonistic activity.
  • the vaccine backbone is identical to that in Vaxart's ND1.1, VXA-A1.1 and VXA- BYW.10 vaccines for pandemic and seasonal influenza A and B, respectively, currently in clinical development; the only change being that VXA-RSV-f has a different surface protein (F protein) being expressed.
  • the RSV F protein gene has been codon-optimized for expression in mammalian cells and is expressed using a human cytomegalovirus intermediate early region (hCMVIE) enhancer/promoter and a bovine growth hormone polyadenyiation (pA) signal.
  • This expression cassette also includes the first intron of human ⁇ -globin to enhance transgene expression.
  • a second hCMVIE promoter is used to express the adjuvant RNA sequence.
  • the adjuvant sequence is derived from a luciferase sequence and has been reported to stimulate the induction of type I interferons in vitro (1).
  • the adjuvant is expressed as a short hairpin RNA, comprising a 21 -nucleotide sequence
  • This adjuvant cassette utilizes a synthetic poly A (SPA).
  • SPA synthetic poly A
  • Vaxart has conducted preclinical studies to determine the immunogenic potential of VXA-RSV-f in mice and cotton rats. These studies showed that vaccination with VXA-RS V- f elicited substantial systemic serum IgG responses in test animals.
  • Vaxart's RSV vaccine (VXA-RSV-f) will use the same replication-defective viral vector backbone and adjuvant RNA sequence as the company's pandemic and seasonal influenza virus programs.
  • boral delivery was conducted by gavage by Sigmovir (Rockville, MD)
  • the primary objective of the initial mouse immunogenicity study was to determine if the Vaxart vector backbone expressing the RSV F protein could induce an antibody response to RSV as measured by ELISA.
  • two cotton rat studies were performed. The objectives of the cotton rat studies were to demonstrate that VXA-RSV-f could elicit potent antibodies to RSV, and that the vaccine could elicit protective immune responses against RSV. Further, the cotton rat studies were used to determine that VXA-RSV-f induced adaptive immune responses did not enhance RSV disease, such as those recorded for the old formalin inactivated RSV vaccine (FI-RSV).
  • mice (6 females/group) were immunized with VXA-RSV-f using three different routes of deliveiy in order to determine whether the construct was immunogenic. Animals were immunized with 1x10 s IU on weeks 0 and 3 using three different routes of deliver ⁇ '
  • the objectives of the first cotton rat study were to determine the ability of VXA-RSV-f to induce antibody responses and to protect against RSV disease and viral replication.
  • the cotton rat is considered an important model for preclinical development of RSV vaccines because of the susceptibility of the animal to RSV infection, and the reproducibility of the lung inflammation /cytokine skewing phenotype when given formalin inactivated RSV vaccine (FI-RSV) followed by RSV challenge (2).
  • VXA-RSV-f vaccine treated animals were compared for ELISA IgG titers on week 8 with a no infection/no vaccine control group (No infection), an adenovirus storage buffer alone (buffer) group and a FI-RSV vaccine group at 1 : 100 dilution of a stock (Lot #100) made by Pfizer from the RSV-A2 strain (3).
  • a rAd that expresses the adjuvant without the antigen at lxlO 9 IU was given i.n. and used as a control.
  • RSV2 wild- type RSV strain A2
  • the objectives of the second cotton rat study were to determine if cotton rats could be immunized orally with the VXA-RSV-f vaccine and induce significant immune responses. Challenge was optional, subsequent to effective oral immunization. Oral immunization can be difficult in animals, and prior documented experience for rAd oral dosing in cotton rats was not available. For this reason, a dose titration of the VXA-RSV-f vaccine was performed with doses at IxlO 8 , IxlO 9 , and IxlO 10 IU given by oral gavage to stomach-neutralized cotton rats to approximate human oral tablet delivery. Animals were immunized on weeks 0 and 4 and the antibody titers were measured on weeks 4 and 8. A buffer only group was used as a control, to show the background effects of no immunization.
  • Lung inflammation was measured by immunohistology and qRT-PCR analysis on day 5 post RSV infection. Four different regions were assessed by immunohistology to determine if the vaccine led to adaptive immune enhancement of disease.
  • the VXA-RSV-f vaccine did not induce significantly increased lung pathology scores for penbroncolitis (PB), perivasculitis (PV), interstitial pneumonia (IP), and alveolitis (A) as compared to the FI-RSV vaccine, the "positive" control for lung inflammation (Figure 25B), and did not lead to increases in the relative abundance of IL-4 or IL-13 ( Figure 25C). Groups given i.n.
  • PB and PV including the Buffer, RSV2, and adjuvant control groups, but not necessarily for IP and A
  • the adjuvant group (without expression of RS V F protein) induced a high level of PB post RS V challenge, but induced only low levels of IP and A. Buffer and adjuvant alone control groups did not induce a significant increase in the relative abundance of IL-4 or IL-13 niRNA as the FI-RSV group did ( Figure 25B).
  • the FI-RSV vaccine group induced an average relative abundance above 1 for IL-4 and above 3 for IL-13, compared to below 0.1 and 0,3 respectively for the VXA- RSV-f and RSV2 vaccine groups (Figure 25C).
  • Mail delivery is already used for a wide-variety of oral medications and has already been suggested as a means to deliver critical medicines to veterans during a pandemic. Further, tableting is a rapid, sanitary process that does not require the expensive sterile fill and finishing process that injected vaccines require.
  • HAI Hemagglutination Inhibition
  • Randomization and Masking [0217] The study was designed to evaluate the vaccine (VXA-Al- 1) in 12 subjects at a single dose of 1 x 1011 infectious units (IU) with 12 subjects given a placebo control. There were 3 sequentially enrolled sentinel vaccine-treated subjects, with each subject dosed no more frequently than one every 24 h. After a week of monitoring for vaccine-related toxicities, the remaining subjects in the treated cohort (9) were randomized along with 12 placebo controls. Randomization was performed by computer generated assignment, and study drug was distributed with concealed identity to the blinded staff by the unblinded pharmacist. All investigative site staff as well as persons directly involved with
  • the rAd vector (non-replicating Ad5) carries DNA which encodes the HA
  • Tablets were enteric coated with Eudragit LI 00® (Evonik Industries, Darmstadt, Germany) using a Vector Hi-Coater system (Vector Freund, Cedar Rapids, LA). The final product was released in one lot, and titered by standard IU assay at Lonza. Placebo was prepared as similarly sized and shaped tablets containing 150 mg of microcrystalline cellulose, without enteric coating.
  • Endpoints [0222] The primary emlpoint for this study is safety and the secondary endpoint is immunogenicity through the active phase, primarily by HAI titers and HAI seroconversions. Additional immunological endpoints include MN titers and ASCs.
  • PBMCs were frozen and thawed using serum free reagents according to the manufacturers instructions (Cellular Technology Ltd [CTL], Shaker Heights, OH).
  • ASCs Antibody Secreting cells
  • Enzyme linked immunosorbent (ELISpot) kits for IgG and IgA secreting B ceils were performed according to manufacturer's instructions (Mabtech, Mariemont, OH). Cells were cultured (between 1 ⁇ 5 X 104 to 5 X 105 ceils per well) in triplicate wells, in CTL-Test medium to optimize spots.
  • HA protein Protein Sciences Corp, Meriden, CT
  • HAI and MN Titers were performed by Focus Diagnostics (Cypress, CA) similarly as described previously (Greenberg eta!. The New England Journal of Medicine 2009;
  • HAI and MN were measured against MDCK derived A/CA/07/2009 and egg derived A/CA/07/2009 respectively. HAI and MN titers less than 10 were marked as 5 as suggested by regulatory advice. Adenovirus neutralizing titers were measured as described before 2.
  • Least square (LS) means 95 CI of the LS means, difference of LS means and the 95 CI of the difference of LS means were obtained from the model.
  • LS Least square
  • Another ANCOVA model included age, sex, and body mass index (BMI) as covariates was performed as well.
  • HAI responses were measured on days 0 and 28 ( Figure 20A). No placebo treated subject seroconverted, but one placebo had a high day 0 value (which would have excluded the subject if measured at screening). None of the vaccine subjects had a starting HAI titer > 20. After immunization, nine subjects in the vaccine group reached seroprotective levels (HAI >40) ( Figure 20A). Of the eleven 4-fold risers (92%), nine seroconverted (SC) with the other 2 subjects showing a 4-fold increase in HAI titer from 5 to 20. The vaccine group had a statistically significant increase in the number of 4-fold responders versus placebo (11 versus 0, with P ⁇ 0-0000 by Fisher's Exact Test).
  • the Geometric (LS) Mean Titer (GMT) for the vaccine group was calculated to be 71 -5 (95 CI: 45 - 114) on Day 28, a 7-7-fold Geometric (LS) Mean Fold Rise (GMFR) over the initial GMT of 7 ⁇ 9 (95 CI: 4 ⁇ 6 - 13-6) on Day 0.
  • the GMT on Day 28 for placebo group was 10 1 (95 CI: 6-4 - 16-2) on Day 28, a 1 - 1-fold GMFR over initial GMT of 1 -0 (95 CI: 6-4 - 18-9) on Day 0.
  • the placebo group had no IgA spots on day 7, but one subject had a high background smear and a measurable IgG ASC response with smaller spots than normally observed.
  • Subjects were measured for their anti -vector titers pre- and post-immunization. Following oral immunization, a few vaccine-treated subjects had an increase in neutralizing antibody responses to Ad5, which led to a 2-6-fold increase in the GM neutralizing antibody titers, compared to 1 ⁇ 0-fold GM fold rise in the placebo treated subjects. In the vaccine group, HAI and MN responses trended similarly for individual subjects. Eight subjects were Ad5 negative before immunization, and four were Ad5 positive before immunization. One subject that was Ad5 positive did not HAI seroconvert, however, one subject that was Ad5 positive had the highest increase in HAI titers (64 fold) of any of the subjects in the study ( Figure 21 B).
  • Ad5 immunity can be an issue with injected vaccines, it may not be the case with oral immunization with a non-replicating vector where neutralizing antibody titers do not seem to hinder performance (Xiang et al. Journal of virology 2003; 77(20): 10780-9).
  • the ability to elicit a neutralizing immune response to influenza did not appear to be impacted after oral immunization with the vaccine tablet ( Figure 21).
  • One of the subjects with the highest anti-Ad5 titer to start had the highest measured increase in neutralizing antibody responses by MN and HAI assay ( Figure 21). While i.m.
  • An oral formulation could greatly facilitate vaccine administration, particularly during a pandemic when rapid distribution is needed.
  • individual county health departments in California had to have a plan for distribution.
  • PODs points of distribution
  • PODs in Los Angeles County this translated to 143,000 people per day. In a city of 9 million, assuming supplies or qualified personnel were not in short supply, it would take more than 60 days to complete an immunization campaign.
  • H1N1 pandemic vaccine As an alternative, if the H1N1 pandemic vaccine was delivered by US mail and self-admini stered by tablet, all 9 million subjects could be immunized within a single day without people having to stand in line, and risking exposure to the growing outbreak. While there are regulator ⁇ ' hurdles to overcome, our tablet vaccine appears to be stable at room temperature for greater than 270 days and can tolerate short-term excursions at higher temperatures (G Trager, unpublished data), which should make this approach technically feasible.
  • oral influenza vaccine based on rAd administration can elicit antibody responses to influenza in greater than 90% of subjects. While this is an early clinical stage study and several studies will need to be completed that address issues such as interference and repeated seasonal use, these results look encouraging for safety and immunogenicit .

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Virology (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Inorganic Chemistry (AREA)
  • Nutrition Science (AREA)
  • Physiology (AREA)
  • Pulmonology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicinal Preparation (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/US2016/036461 2015-06-12 2016-06-08 Formulations for small intestinal delivery of rsv and norovirus antigens Ceased WO2016200951A1 (en)

Priority Applications (17)

Application Number Priority Date Filing Date Title
ES16808196T ES2832504T3 (es) 2015-06-12 2016-06-08 Formulaciones para administración de antígenos de norovirus y rsv en el intestino delgado
NZ738382A NZ738382B2 (en) 2016-06-08 Formulations for small intestinal delivery of rsv and norovirus antigens
KR1020187000421A KR102678401B1 (ko) 2015-06-12 2016-06-08 Rsv 및 노로바이러스 항원들의 소장 내의 전달을 위한 제형들
AU2016274599A AU2016274599B2 (en) 2015-06-12 2016-06-08 Formulations for small intestinal delivery of RSV and norovirus antigens
CN201680046440.8A CN108024955A (zh) 2015-06-12 2016-06-08 用于rsv和诺如病毒抗原的小肠递送的制剂
US15/580,651 US11433146B2 (en) 2015-06-12 2016-06-08 Formulations for small intestinal delivery of RSV and norovirus antigens
CA2988761A CA2988761A1 (en) 2015-06-12 2016-06-08 Formulations for small intestinal delivery of rsv and norovirus antigens
EP20195995.4A EP3791859A1 (en) 2015-06-12 2016-06-08 Formulations for small intestinal delivery of rsv and norovirus antigens
EA201792512A EA201792512A1 (ru) 2015-06-12 2016-06-08 Составы для доставки антигенов респираторного синтициального вируса и норовируса в тонкий кишечник
JP2017564358A JP6912394B2 (ja) 2015-06-12 2016-06-08 Rsvおよびノロウイルス抗原の小腸送達のための製剤
KR1020247005811A KR102773575B1 (ko) 2015-06-12 2016-06-08 Rsv 및 노로바이러스 항원들의 소장 내의 전달을 위한 제형들
DK16808196.6T DK3307239T3 (da) 2015-06-12 2016-06-08 Formuleringer til indgivelse af RSV- og norovirusantigener i tyndtarmen
EP16808196.6A EP3307239B1 (en) 2015-06-12 2016-06-08 Formulations for small intestinal delivery of rsv and norovirus antigens
CN202311287963.XA CN118045170A (zh) 2015-06-12 2016-06-08 用于rsv和诺如病毒抗原的小肠递送的制剂
ZA2017/08434A ZA201708434B (en) 2015-06-12 2017-12-12 Formulations for small intestinal delivery of rsv and norovirus antigens
US17/816,788 US12186407B2 (en) 2015-06-12 2022-08-02 Formulations for small intestinal delivery of RSV and norovirus antigens
US18/956,413 US20250082784A1 (en) 2015-06-12 2024-11-22 Formulations for small intestinal delivery of rsv and norovirus antigens

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201562175081P 2015-06-12 2015-06-12
US62/175,081 2015-06-12

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US15/580,651 A-371-Of-International US11433146B2 (en) 2015-06-12 2016-06-08 Formulations for small intestinal delivery of RSV and norovirus antigens
US17/816,788 Continuation US12186407B2 (en) 2015-06-12 2022-08-02 Formulations for small intestinal delivery of RSV and norovirus antigens

Publications (1)

Publication Number Publication Date
WO2016200951A1 true WO2016200951A1 (en) 2016-12-15

Family

ID=57503876

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/036461 Ceased WO2016200951A1 (en) 2015-06-12 2016-06-08 Formulations for small intestinal delivery of rsv and norovirus antigens

Country Status (12)

Country Link
US (3) US11433146B2 (enExample)
EP (2) EP3307239B1 (enExample)
JP (2) JP6912394B2 (enExample)
KR (2) KR102678401B1 (enExample)
CN (2) CN118045170A (enExample)
AU (1) AU2016274599B2 (enExample)
CA (1) CA2988761A1 (enExample)
DK (1) DK3307239T3 (enExample)
EA (1) EA201792512A1 (enExample)
ES (1) ES2832504T3 (enExample)
WO (1) WO2016200951A1 (enExample)
ZA (1) ZA201708434B (enExample)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2020505335A (ja) * 2017-01-06 2020-02-20 スタビリテック バイオファーマ リミテッド ウイルス
EP3307239B1 (en) 2015-06-12 2020-09-16 Vaxart, Inc. Formulations for small intestinal delivery of rsv and norovirus antigens
JP2021503962A (ja) * 2017-11-30 2021-02-15 メディカゴ インコーポレイテッド 改変ノロウイルスvp1タンパク質及び改変ノロウイルスvp1タンパク質を含むvlp

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108904795B (zh) * 2018-08-29 2022-07-05 温氏食品集团股份有限公司 一种猪流行性腹泻病毒的口服疫苗的制备方法
US20210311600A1 (en) * 2020-04-06 2021-10-07 Kirk David Bacon Seat Selection Application For Social Distancing Compliance
WO2024193965A1 (en) * 2023-03-17 2024-09-26 Glaxosmithkline Biologicals Sa Rsv-f-encoding nucleic acids

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100111989A1 (en) 2006-12-21 2010-05-06 Pevion Biotech Ag Rsv f-protein and its use
US8222224B2 (en) 2006-02-28 2012-07-17 Vaxart, Inc. Chimeric adenoviral vectors
US20150071994A1 (en) * 2012-03-29 2015-03-12 Therabiome, Llc Gastrointestinal site-specific oral vaccination forumulations active on the ileum and appendix

Family Cites Families (50)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4152413A (en) 1978-08-18 1979-05-01 Chromalloy American Corporation Oral vaccine for swine dysentery and method of use
US4520019A (en) 1982-04-29 1985-05-28 Ribi Immunochem Research, Inc. Stable composition and preparation thereof
US4579945A (en) 1982-04-29 1986-04-01 Ribi Immunochem Research, Inc. Purification of trehalose dimycolates
US4505899A (en) 1982-05-26 1985-03-19 Ribi Immunochem Research, Inc. Refined detoxified endotoxin product
US4435386A (en) 1982-05-26 1984-03-06 Ribi Immunochem Research, Inc. Refined detoxified endotoxin product
US4505900A (en) 1982-05-26 1985-03-19 Ribi Immunochem Research, Inc. Refined detoxified endotoxin product
US4436728A (en) 1982-05-26 1984-03-13 Ribi Immunochem Research, Inc. Refined detoxified endotoxin product
US4436727A (en) 1982-05-26 1984-03-13 Ribi Immunochem Research, Inc. Refined detoxified endotoxin product
US4866034A (en) 1982-05-26 1989-09-12 Ribi Immunochem Research Inc. Refined detoxified endotoxin
US5075109A (en) 1986-10-24 1991-12-24 Southern Research Institute Method of potentiating an immune response
US5811128A (en) 1986-10-24 1998-09-22 Southern Research Institute Method for oral or rectal delivery of microencapsulated vaccines and compositions therefor
CA1331443C (en) 1987-05-29 1994-08-16 Charlotte A. Kensil Saponin adjuvant
US5057540A (en) 1987-05-29 1991-10-15 Cambridge Biotech Corporation Saponin adjuvant
US4897268A (en) 1987-08-03 1990-01-30 Southern Research Institute Drug delivery system and method of making the same
ES2109362T3 (es) * 1991-06-21 1998-01-16 Univ Cincinnati Unas proteinas administrables oralmente y metodo para hacerlas.
JPH08505625A (ja) 1993-01-11 1996-06-18 ダナ−ファーバー キャンサー インスティチュート 細胞毒性tリンパ球応答の誘導
US6224911B1 (en) 1993-03-16 2001-05-01 Syntex (U.S.A.) Llc Process for the preparation of enteric coated pharmaceutical dosage forms
WO1995003035A1 (en) 1993-07-23 1995-02-02 Massachusetts Institute Of Technology Polymerized liposomes with enhanced stability for oral delivery
GB9412394D0 (en) * 1994-06-21 1994-08-10 Danbiosyst Uk Colonic drug delivery composition
AUPM873294A0 (en) 1994-10-12 1994-11-03 Csl Limited Saponin preparations and use thereof in iscoms
CN1176658A (zh) 1994-10-24 1998-03-18 蛇药制品有限公司 治疗和预防艰难梭菌疾病的疫苗和抗毒素
UA56132C2 (uk) 1995-04-25 2003-05-15 Смітклайн Бічем Байолоджікалс С.А. Композиція вакцини (варіанти), спосіб стабілізації qs21 відносно гідролізу (варіанти), спосіб приготування композиції вакцини
US6676935B2 (en) 1995-06-27 2004-01-13 Cell Genesys, Inc. Tissue specific adenoviral vectors
AU4133397A (en) 1996-10-28 1998-05-22 Pfizer Inc. Oral vaccines for young animals with an enteric coating
FR2759293B1 (fr) 1997-02-11 1999-04-30 Ethypharm Lab Prod Ethiques Microgranules contenant du cisplatine, procede de fabrication, preparation pharmaceutique et utilisation en polychimiotherapie ou en association avec une radiotherapie
AUPO856097A0 (en) 1997-08-14 1997-09-04 Commonwealth Scientific And Industrial Research Organisation Vector
US6328967B1 (en) 1998-03-12 2001-12-11 Allergenics, Inc. Delivery system to modulate immune response
GB9818591D0 (en) 1998-08-27 1998-10-21 Danbiosyst Uk Pharmaceutical composition
US7264771B2 (en) 1999-04-20 2007-09-04 Baxter International Inc. Method and apparatus for manipulating pre-sterilized components in an active sterile field
US6355270B1 (en) 1999-01-11 2002-03-12 The Regents Of The University Of California Particles for oral delivery of peptides and proteins
AU783099B2 (en) 2000-01-07 2005-09-22 Rohm Gmbh & Co. Kg Selective activation of a TH1 or TH2 lymphocyte regulated immune response
AU2003240978A1 (en) 2002-05-31 2003-12-19 Genteric, Inc. Multi-functional polyamines for delivery of biologically-active polynucleotides
WO2004020592A2 (en) 2002-08-30 2004-03-11 Genteric, Inc. Retroductal salivary gland genetic vaccination
GB2407500A (en) 2003-11-03 2005-05-04 Ist Superiore Sanita Use of microparticles for antigen delivery
US20060128653A1 (en) 2004-12-10 2006-06-15 Chunlin Tang Pharmaceutical formulation of decitabine
TW200626185A (en) 2004-12-17 2006-08-01 Bpsi Holdings Inc Enteric film coating composition containing entericpolymer micronized with detackifier
JP2009298707A (ja) 2008-06-11 2009-12-24 Ohara Yakuhin Kogyo Kk 粒子加工方法
WO2010002418A2 (en) 2008-07-01 2010-01-07 The Johns Hopkins University Quick-dissolving oral thin film for targeted delivery of therapeutic agents
AU2009322285B2 (en) 2008-12-03 2016-07-28 Bausch Health Ireland Limited Formulations of guanylate cyclase C agonists and methods of use
US20120276167A1 (en) 2009-07-13 2012-11-01 Vaxgene Corporation Immunoprotection by oral administration of recombinant lactococcus lactis mini-capsules
WO2011026111A1 (en) 2009-08-31 2011-03-03 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Oral delivery of a vaccine to the large intestine to induce mucosal immunity
EP2477652B1 (en) 2009-09-16 2015-04-15 Vaxart, Inc. Immunization strategy to prevent h1n1 infection
US20130273154A1 (en) 2011-03-02 2013-10-17 Joseph M. Fayad Oral formulations Mimetic of Roux-en-Y gastric bypass actions on the ileal brake; Compositions, Methods of Treatment, Diagnostics and Systems for treatment of metabolic syndrome manifestations including insulin resistance, fatty liver disease, hpperlipidemia, and type 2 diabetes
US20130195800A1 (en) * 2010-03-23 2013-08-01 Intrexon Corporation Vectors Conditionally Expressing Therapeutic Proteins, Host Cells Comprising the Vectors, and Uses Thereof
CA2804501C (en) * 2010-07-06 2021-01-26 Novartis Ag Noro virus derived immunogenic compositions and methods
CN103153289B (zh) 2010-08-25 2016-08-31 格兰特·鲁弗斯·斯柏林二世 改进型肠溶活性物质给药
US9370528B2 (en) 2011-03-02 2016-06-21 Volant Holdings Gmbh Compositions, methods of treatment and diagnostics for treatment of hepatic steatosis alone or in combination with a hepatitis C virus infection
AU2013243971B2 (en) 2012-04-04 2017-01-05 Vaxform Llc Improved adjuvant system for oral vaccine adminstration
IL247301B (en) 2014-02-20 2022-07-01 Vaxart Inc Formulations for small intestinal delivery
EP3307239B1 (en) 2015-06-12 2020-09-16 Vaxart, Inc. Formulations for small intestinal delivery of rsv and norovirus antigens

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8222224B2 (en) 2006-02-28 2012-07-17 Vaxart, Inc. Chimeric adenoviral vectors
US20100111989A1 (en) 2006-12-21 2010-05-06 Pevion Biotech Ag Rsv f-protein and its use
US20150071994A1 (en) * 2012-03-29 2015-03-12 Therabiome, Llc Gastrointestinal site-specific oral vaccination forumulations active on the ileum and appendix

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
BAILEY ET AL., VIROLOGY, vol. 202, no. 2, 1994, pages 695 - 706
BROUARD ET AL., BRITISH J. PHARM., vol. 157, 2009, pages 153
COLLOCA ET AL., SCI. TRANSL. MED., vol. 4, 2012, pages 115
LUBECK ET AL., PROC NATL ACAD SCI USA, vol. 86, no. 17, 1989, pages 6763 - 6767
MUTWARI ET AL., IMMUNOLOGY, vol. 97, 1999, pages 455
SCALLAN ET AL., CLINICAL AND VACCINE IMMUNOLOGY, vol. 20, no. 1, 2013, pages 85 - 94
See also references of EP3307239A4
SHEN ET AL., J VIROL, vol. 75, no. 9, 2001, pages 4297 - 4307
STANLEY ET AL., NAT. MED., 2014

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3307239B1 (en) 2015-06-12 2020-09-16 Vaxart, Inc. Formulations for small intestinal delivery of rsv and norovirus antigens
JP2020505335A (ja) * 2017-01-06 2020-02-20 スタビリテック バイオファーマ リミテッド ウイルス
JP2021503962A (ja) * 2017-11-30 2021-02-15 メディカゴ インコーポレイテッド 改変ノロウイルスvp1タンパク質及び改変ノロウイルスvp1タンパク質を含むvlp
US12076388B2 (en) 2017-11-30 2024-09-03 Aramis Biotechnologies Inc. Modified norovirus VP1 proteins and VLPS comprising modified norovirus VP1 proteins
JP7579143B2 (ja) 2017-11-30 2024-11-07 アラミス バイオテクノロジーズ インコーポレイテッド 改変ノロウイルスvp1タンパク質及び改変ノロウイルスvp1タンパク質を含むvlp

Also Published As

Publication number Publication date
JP6912394B2 (ja) 2021-08-04
AU2016274599A1 (en) 2018-01-18
ZA201708434B (en) 2020-02-26
ES2832504T3 (es) 2021-06-10
KR102773575B1 (ko) 2025-02-27
EP3307239A1 (en) 2018-04-18
DK3307239T3 (da) 2020-11-23
JP2018521030A (ja) 2018-08-02
EA201792512A1 (ru) 2018-06-29
KR20240031420A (ko) 2024-03-07
EP3307239B1 (en) 2020-09-16
JP7269285B2 (ja) 2023-05-08
EP3307239A4 (en) 2019-02-20
JP2021169480A (ja) 2021-10-28
AU2016274599B2 (en) 2021-09-02
KR102678401B1 (ko) 2024-06-26
US11433146B2 (en) 2022-09-06
US12186407B2 (en) 2025-01-07
NZ738382A (en) 2025-02-28
CN118045170A (zh) 2024-05-17
KR20180018657A (ko) 2018-02-21
US20180161458A1 (en) 2018-06-14
US20250082784A1 (en) 2025-03-13
EP3791859A1 (en) 2021-03-17
CN108024955A (zh) 2018-05-11
US20220378944A1 (en) 2022-12-01
CA2988761A1 (en) 2016-12-15

Similar Documents

Publication Publication Date Title
US12186407B2 (en) Formulations for small intestinal delivery of RSV and norovirus antigens
US20250032602A1 (en) Formulations for small intestinal delivery
AU2018202765A1 (en) Gastrointestinal site-specific oral vaccination formulations active on the ileum and appendix
US20230210980A1 (en) Chimeric adenoviral vectors
US20240093234A1 (en) Chimeric adenoviral vectors

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16808196

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2988761

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2017564358

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 201792512

Country of ref document: EA

ENP Entry into the national phase

Ref document number: 20187000421

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2016808196

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2016274599

Country of ref document: AU

Date of ref document: 20160608

Kind code of ref document: A

WWG Wipo information: grant in national office

Ref document number: 738382

Country of ref document: NZ