WO2016182660A1 - Peptide treatment for inflammation and fibrosis - Google Patents

Peptide treatment for inflammation and fibrosis Download PDF

Info

Publication number
WO2016182660A1
WO2016182660A1 PCT/US2016/026966 US2016026966W WO2016182660A1 WO 2016182660 A1 WO2016182660 A1 WO 2016182660A1 US 2016026966 W US2016026966 W US 2016026966W WO 2016182660 A1 WO2016182660 A1 WO 2016182660A1
Authority
WO
WIPO (PCT)
Prior art keywords
peptide
lys
asp
liver
fibrosis
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2016/026966
Other languages
English (en)
French (fr)
Inventor
Mario Chojkier
Martina Buck
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of California Berkeley
University of California San Diego UCSD
Original Assignee
University of California Berkeley
University of California San Diego UCSD
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of California Berkeley, University of California San Diego UCSD filed Critical University of California Berkeley
Priority to EP16793126.0A priority Critical patent/EP3294752B1/en
Priority to JP2017559043A priority patent/JP7372026B2/ja
Priority to CN201680024300.0A priority patent/CN107531752B/zh
Priority to NZ736840A priority patent/NZ736840B2/en
Priority to CA2984769A priority patent/CA2984769C/en
Priority to AU2016260190A priority patent/AU2016260190A1/en
Priority to US15/570,910 priority patent/US10434134B2/en
Priority to CN202210439797.XA priority patent/CN114621318A/zh
Priority to CN202111595612.6A priority patent/CN114181281A/zh
Publication of WO2016182660A1 publication Critical patent/WO2016182660A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/04Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/07Tetrapeptides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/08Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing oxygen, e.g. ethers, acetals, ketones, quinones, aldehydes, peroxides
    • A61K47/10Alcohols; Phenols; Salts thereof, e.g. glycerol; Polyethylene glycols [PEG]; Poloxamers; PEG/POE alkyl ethers
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/56Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
    • A61K47/59Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes
    • A61K47/60Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes the organic macromolecular compound being a polyoxyalkylene oligomer, polymer or dendrimer, e.g. PEG, PPG, PEO or polyglycerol
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/007Pulmonary tract; Aromatherapy
    • A61K9/0073Sprays or powders for inhalation; Aerolised or nebulised preparations generated by other means than thermal energy
    • A61K9/0078Sprays or powders for inhalation; Aerolised or nebulised preparations generated by other means than thermal energy for inhalation via a nebulizer such as a jet nebulizer, ultrasonic nebulizer, e.g. in the form of aqueous drug solutions or dispersions
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K5/00Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof
    • C07K5/04Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof containing only normal peptide links
    • C07K5/10Tetrapeptides
    • C07K5/1019Tetrapeptides with the first amino acid being basic
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K7/00Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04Linear peptides containing only normal peptide links
    • C07K7/06Linear peptides containing only normal peptide links having 5 to 11 amino acids
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K7/00Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04Linear peptides containing only normal peptide links
    • C07K7/08Linear peptides containing only normal peptide links having 12 to 20 amino acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Definitions

  • the invention is related to therapeutic peptides which inhibit phosphorylation of C/ ⁇ and their use for treating inflammation and fibrosis.
  • liver myofibroblasts (of different origins) is responsible for the development of liver fibrosis in chronic liver diseases, and remarkably, the clearance of myofibroblasts by apoptosis would allow recovery from liver injury and reversal of liver fibrosis.
  • blocking the progression of liver fibrosis would decrease development of primary liver cancer since the majority of hepatocellular carcinomas arise in cirrhotic livers.
  • liver cirrhosis its mortality is approximately 800,000 worldwide (32), and 27,000 in the US; ii) chronic liver diseases: there are 421,000 hospitalizations for chronic liver diseases in the US.
  • a medication that would prevent progression of liver fibrosis and decrease liver inflammation would impact the management of patients with non-alcoholic steatohepatitis (affects -10 million in the US and it is an 'epidemic' worldwide); hepatitis C ( ⁇ 3 million in the US and 170 million worldwide have chronic infection), hepatitis B ( ⁇ 1 million in the US and 350 million worldwide have chronic infection), as well as those less common chronic liver diseases afflicting adults (primary biliary cirrhosis; sclerosing cholangitis; autoimmune hepatitis; genetic hemochromatosis) and children (including biliary atresia; a-1 antitrypsin deficiency and other rare genetic disorders) for which at present there are no available treatments.
  • GR-MD-02 Galectin Therapeutics Inc. - Indication - NASH (fatty liver disease) patients with advanced fibrosis - Phase 2). This drug is delivered in liposomes and targets macrophages for apoptosis and not the liver myofibroblasts responsible for the fibrogenesis pathway.
  • Simtuzumab an antifibrotic monoclonal antibody against lysyl oxidase-like 2 (LOXL2) enzyme (Gilead Sciences- Indications: liver fibrosis; primary sclerosing cholangitis; nonalcoholic steatohepatitis - Phase 2). This drug may prevent progression of active fibrogenesis but will not reverse existing crosslinked collagen fibers. In addition, it may induce immunogenic reactions.
  • LXL2 lysyl oxidase-like 2
  • Obeticholic acid is a bile acid analog and agonist of the farnesoid X receptor (FXR) (Intercept Pharmaceuticals - OCA is being developed for a variety of chronic liver diseases including primary biliary cirrhosis (PBC), nonalcoholic steatohepatitis (NASH), and primary sclerosing cholangitis (PSC) - Phase 3).
  • PBC primary biliary cirrhosis
  • NASH nonalcoholic steatohepatitis
  • PSC primary sclerosing cholangitis
  • a major concern is that the blockade of the FXR is associated with the spontaneous development of liver tumors in the absence of the bile acid receptor farnesoid X receptor (26); and d) Emricasan (Conatus Pharmaceuticals - nonalcoholic fatty liver disease (NAFLD) subset of patients with inflammatory and/or fibrotic nonalcoholic steatohepatitis (NASH) - Phase 2).
  • This drug is an active caspase protease inhibitor.
  • a major concern is that prolonged inhibition of hepatocyte caspases may facilitate development of hepatocellular carcinoma and other organ tumors by eliminating a critical anti-tumor check-point (22).
  • IPF Idiopathic Pulmonary Fibrosis
  • Esbriet pirfenidone
  • Esbriet is newly approved by the FDA for the treatment of IPF.
  • the product description states that "Esbriet should be used with caution in patients with mild to moderate (Child Pugh Class A and B) hepatic impairment” and also those with mild, moderate or severe renal impairment.
  • the drug may also result in elevated liver enzymes; photosensitivity reaction or rash; gastrointestinal disorders and also drug reactions with concomitant administration with strong inhibitors of CYP1A2 (e.g., fluvoxamine);
  • OFEV nintedanib
  • the Safety Information Sheet regarding OFEV describes that the therapeutic can cause birth defects or death to an unborn baby, liver problems, bleeding and gastrointestinal disorders, and in more serious cases, stroke and heart attack; c) Oral prednisone (or some other form of corticosteroid) may decrease lung inflammation and the symptoms may improve significantly.
  • the steroids may be used in combination with other drugs.
  • the medication is immunosuppressive, and the response to therapy may be slow (6 months or more) and can present significant side effects including bone marrow suppression, blood disorders, and bladder inflammation; to name a few; and f)
  • a combination of prednisone, azathioprine, and N-acetylcysteine (NAC) has been used for the treatment of IPF patients.
  • NAC N-acetylcysteine
  • Inflammation contributes to the pathogenesis of most acute and chronic liver diseases 1 .
  • Excessive liver injury and inflammation associated with liver diseases induced by viral, toxic, immunologic, and metabolic diseases 2 results in liver dysfunction and in chronic conditions in the potential deposition of scar tissue and the development of cirrhosis, which is in turn a major contributor to the morbidity and mortality of patients affected by chronic liver diseases 2 ' 3 .
  • liver inflammation in toxic liver injury has been confirmed using macrophage ablation 5 , and further characterized in an experimental alcoholic liver injury model using an IL-1 receptor antagonist 6 , and in LPS/D-galactosamine induced liver injury using Adenosine-2A (A 2 A) receptor-ko mice 7 .
  • Fas-mediated IL-18 secretion from macrophages causes acute liver injury in mice 8 , and macrophage phagocytosis removes hepatocyte debris during hepatocyte injury 9 .
  • the signal transduction mechanisms in liver macrophages that are indispensable to amplify liver injury have been only partially characterized ⁇
  • the inflammasome is a protein complex that is essential for triggering activation of inflammatory reactions in macrophages as well as the consequent macrophage activation 1 ' 10 ' 11 .
  • the CCAAT/Enhancer Binding Protein- ⁇ (C/ ⁇ ) 12 ' 13 ' 14 has been shown to be a critical signaling molecule for macrophages as expression of a dominant inhibitor of C/ ⁇ DNA- binding sites 15 or a targeted deletion of C/ ⁇ results in impaired macrophage differentiation 16 .
  • C/ ⁇ expression is dramatically increased during differentiation of these cells, and is induced by macrophage modulators (LPS, IL-1, G-CSF, TGFP, vitamin D, retinoic acid) 13 ' 11 .
  • RSK-2 Ribosomal S-Kinase-2
  • ERK Extracellular-Regulated Kinase
  • MNK Kinase signaling pathway regulating cell survival ' ' ' .
  • phosphorylation-mutant C/EBPP-Glu217 which mimics phosphorylated C/EBPP-Thr217 in biological assays 22 , was sufficient to rescue the impaired macrophage function and activity induced by Anthrax lethal toxin 23 .
  • the invenmtion provides an isolated peptide comprising the amino acid sequence Lys-Ala-Val-Asp, wherein at least one amino acid is D-amino acid and wherein said peptide is capable of inhibiting phosphorylation of human CCAAT/Enhancer Binding Protein- ⁇ (C/ ⁇ ) at Threonine 266 (Thr 266) or of mouse C/ ⁇ at Thr 217.
  • the Ala and/or Val within the amino acid sequence Lys-Ala-Val-Asp is D-amino acid (DAla, DVal).
  • the peptide is capable of selectively inhibiting phosphorylation of human CCAAT/Enhancer Binding Protein- ⁇ (C/ ⁇ ) at
  • the peptide is capable of inhibiting activation of myofibroblasts and/or macrophage inflammasome. In one embodiment, the peptide is between four amino acids and eight amino acids long. In one embodiment, the peptide comprises the amino acid sequence selected from the group consisting of Lys-DAla-DVal-Asp, Lys-DAla-Val-
  • the peptide consists of the amino acid sequence selected from the group consisting of Lys-DAla-DVal-Asp, Lys-DAla-Val-Asp and Lys-Ala-DVal-Asp. In one specific embodiment, the peptide comprises the amino acid sequence Lys-DAla-DVal-Asp. In one specific embodiment, the peptide consists of the amino acid sequence Lys-DAla-DVal-Asp.
  • the peptide consists of amino acid sequence selected from the group consisting of Lys-Ser-Lys-Ala-Lys-Lys-Ala-Val-Asp-Lys-His-Ser-Asp (SEQ ID NO: 3), Lys-Ala-Lys-Lys-Ala-Val-Asp-Lys-His-Ser (SEQ ID NO: 4), and Ala-Lys- Lys-Ala-Val-Asp-Lys-His (SEQ ID NO: 5) (e.g., peptides wherein the Ala and/or Val within the amino acid motif Lys-Ala-Val-Asp is D-amino acid).
  • the peptides of the invention further comprise polyethylene glycol (PEG).
  • the peptides of the invention further comprise a linker of acid (Ac) or mercaptopropionic acid (Mpr) or trimethyl lock (TML) lactonization (see, e.g., Greenwald, Journal of Controlled Release. 74, 2001, 159- 171).
  • the carboxy terminal group of the peptides of the invention is OH, OCH 3 , or NH 2 group.
  • the peptides of the invention are cyclic peptides.
  • the peptide is selected from the group consisting of:
  • carboxy terminal group of the peptide is OH, OCH 3 , or H 2 group.
  • the peptide is selected from the group consisting of Lys-DAla-DVal- Asp, Ac-Lys-DAla-DVal-Asp, Mpr-Lys-DAla-DVal-Asp, PEG-Lys-DAla-DVal-Asp, PEG-Ac- Lys-DAla-DVal-Asp, and PEG-Mpr-Lys-DAla-DVal-Asp, wherein the carboxy terminal group of the peptide is OH, OCH 3 , or H 2 group.
  • the peptide is selected from the group consisting of Lys-DAla-DVal- Asp- H2, Ac-Lys-DAla-DVal-Asp-NH2, Mpr-Lys-DAla-DVal-Asp- H2, PEG-Lys-DAla- DVal-Asp- H2, PEG-Ac-Lys-DAla-DVal-Asp- H2, and PEG-Mpr-Lys-DAla-DVal-Asp-NH2.
  • the peptide has the structure as shown in formula (I):
  • the invention provides pharmaceutical compositions comprising one or more peptide(s) of the invention.
  • the peptide(s) is present in the composition in an amount effective to inhibit activation of myofibroblasts and/or macrophage inflammasome.
  • the invention provides a method for inhibiting tissue fibrosis in a subject in need thereof, said method comprising administering to the subject an effective amount of one or more peptides of the invention or a pharmaceutical composition comprising such one or more peptides.
  • the tissue is in the liver, lung or kidney.
  • the tissue fibrosis is associated with liver injury or liver inflammation.
  • the tissue fibrosis is associated with lung injury or lung inflammation.
  • the tissue fibrosis is associated with kidney injury or kidney inflammation.
  • the invention provides a method for inhibiting macrophage and/or T cell inflammation in a subject in need thereof, said method comprising administering to the subject an effective amount of one or more peptides of the invention or a pharmaceutical composition comprising such one or more peptides.
  • the invention provides a method for treating a tissue fibrotic disease in a subject in need thereof comprising administering to the subject an effective amount of one or more peptides of the invention or a pharmaceutical composition comprising such one or more peptides.
  • the disease is associated with liver injury, liver inflammation and/or liver fibrosis.
  • the disease is liver cirrhosis or liver fibrosis of any etiology.
  • the disease is selected from the group consisting of non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), alcoholic fatty liver disease, alcoholic steatohepatitis, hepatic steatosis, autoimmune hepatitis, chronic hepatitis C, chronic hepatitis B, primary biliary cirrhosis, secondary biliary cirrhosis, sclerosing cholangitis, alpha-1- antitrypsin deficiency, Wilson's disease, and biliary atresia.
  • the disease is associated with lung injury, lung inflammation and/or lung fibrosis.
  • the disease is selected from the group consisting of idiopathic pulmonary fibrosis, radiation-induced pneumonitis, chronic obstructive pulmonary disease, and emphysema.
  • the disease is associated with kidney injury, kidney inflammation and/or kidney fibrosis.
  • the disease is glomerulonephritis or interstitial-tubular fibrosis.
  • the disease is selected from the group consisting of skin fibrosis secondary to burns, keloids, hypertrophic post-surgical wounds, scleroderma, esophageal or gastro-intestinal fibrosis secondary to corrosive materials, esophageal or gastro-intestinal fibrosis secondary to inflammatory diseases, fibrosis secondary to ischemic diseases, peritoneal fibrosis, pancreatic fibrosis, post-radiation fibrosis, cardiac fibrosis secondary to infarcts, brain fibrosis secondary to ischemia or infarcts, post-traumatic brain fibrosis, post-traumatic muscle fibrosis, and synovial/joint fibrosis.
  • the invention provides a method for treating an inflammatory disease in a subject in need thereof comprising administering to the subject an effective amount of one or more peptides of the invention or a pharmaceutical composition comprising such one or more peptides.
  • the disease is selected from the group consisting of alcoholic liver disease, non-alcoholic steato-hepatitis (NASH), autoimmune hepatitis, chronic hepatitis C, chronic hepatitis B, primary biliary cirrhosis, secondary biliary cirrhosis, sclerosing cholangitis, alpha- 1 -antitrypsin deficiency, Wilson's disease, biliary atresia, idiopathic pulmonary fibrosis, radiation-induced pneumonitis, chronic obstructive pulmonary disease, lung emphysema, lung chronic infections and/or inflammation, glomerulonephritis, interstitial-tubular fibrosis, skin inflammation secondary to burns, scleroderma, psoriasis, inflammatory bowel diseases, esophageal injury and/or inflammation, esophageal or gastro-intestinal inflammation post- radiation, inflammatory cardiomyopathy, brain inflammation
  • the peptides or pharmaceutical compositions can be administered, e.g., systemically, by inhalation, topically, sublingually, orally, intranasally, or via a direct instillation to a tissue or organ.
  • the subject can be, e.g., human or veterinary animal or an experimental animal model.
  • FIG. 1 The therapeutic lead peptide inhibits the activation of liver myofibroblasts and liver injury that induces fibrosis following exposure to the human hepatotoxin CC14.
  • a single dose of CC14 was administered to C/ ⁇ - ⁇ mice (4). Eight hours later, animals received an IP injection of the therapeutic lead peptide (5 ⁇ g of peptide linked to PEG). Animals were sacrificed at 30 hr after the CC14 administration. The animals receiving only CC14 had intense activation of myofibroblasts (as determined by a-SMA) (upper row) and severe liver injury (as assessed by standard clinical examination just before sacrifice); the lead peptide blocked the discoloration and granular appearance of severe liver injury.
  • a-SMA severe liver injury
  • livers of treated mice were similar to control (second row).
  • the histopathology induced by CC14 was activation of myofibroblasts (a-SMA), severe liver injury (H&E stain) with collapse of the architecture (Reticulin stain).
  • the therapeutic PEG-30kDa-peptide decreased both the activation of myofibroblasts and the injury to the liver.
  • Liver fibrosis was determined by quantification of the Sinus stain (percentage fibrosis/ area) as described (7; 25): control (0.02+/- 0.01); lead peptide (0.8+/-0.7); alternate peptide 1 (2.1+/-1.0); alternate peptide 2 (3.5+/- 1.2) and CC14 (6.7+/-1.6 %). P ⁇ 0.0001 for lead peptide 1 and P ⁇ 0.001 for alternate peptides 1 and 2.
  • Figure 2B Liver fibrosis was detected histologically by the trichrome stain for liver fibrosis as it is the clinical standard.
  • the control animals (receiving only vehicle control) had negligible fibrosis (stage 0-1/VI); animals receiving CC14 for 16 weeks developed severe fibrosis (stage 5/VI or 6/VI; which would be clinically significant in patients); while animals receiving CC14 for 16 weeks and also the lead PEG-30kDa-peptide 1 starting at week-8 had minor fibrosis (stage 1-2/VI; which would not be clinically significant in patients).
  • FIG. 3 Phosphorylation of C/EBPP-Thr 217 was induced and necessary for the Thl/Thl7 response to Bleomycin. Lung inflammation was induced in C/EBPp wt mice treated with Bleomycin for 7 days. Purified lung T-cells (CD-4+); Phospho-C/EBPpThr217; IL-12Rp; IL-23R; and IL-4Ra were identified as described in Table 2 & Figure 5.
  • C/EBPP-Ala217 mice blocks phosphorylated C/EBPP-Thr217 in T-cells and were refractory to the induction of the Thl/Th2 phenotype with Bleomycin. In C/EBPP-Ala217 mice, Bleomycin induced T-cell expression of IL-4Ra (a Th2 phenotype).
  • FIG. 4 Phosphorylation of C/EBPP-Thr 217 was induced and necessary for the Thl/Thl7 response to Bleomycin. Lung inflammation was induced in C/EBPp wt mice treated with Bleomycin for 7 days. Purified lung T-cells (CD-4+-); Phospho-C/EBPpThr217; IL-12Rp; IL-23R; and IL-4Ra were identified as described Table 2 & Figure 5. The C/ ⁇ peptide blocks phosphorylated C/EBPP-Thr217 in T-cells, the Thl/Thl7 phenotype and induces T-cell expression of IL-4Ra (a Th2 phenotype)
  • FIG. 5 Thl/Thl7 cells were induced and associated with the activation of lung myofibroblasts in response to Bleomycin treatment. Evidences from Ml macrophage ablation experiments. On day-7 after Bleomycin treatment, the purified CD4+ mouse lung T-cells expressed IL-12R or IL-23R (a Thl/Thl7 phenotype) and aSMA (activated myofibroblasts).
  • Bleomycin and Clodronate a blocker of ATP production liposomes
  • Thl/Thl7 cells Blockade of Thl/Thl7 cells through Ml macrophage ablation for 21-days markedly inhibited Bleomycin-induced lung fibrosis (Trichrome), suggesting that the Thl/Thl7 phenotype but not the Th2 phenotype is responsible for this effect.
  • Th2 stimuli and the C/ ⁇ peptide induce apoptosis of isolated primary mouse lung Thl and Thl7 cells from Bleomycin-treated animals.
  • T-cells were isolated by CD- 4+ affinity and treated for 6 hr with 10 ⁇ g/ml of IL-10 or IL-4, or with 100 pM C/ ⁇ peptide. Apoptosis was detected as described (12).
  • the Th2 inducers and the C/ ⁇ peptide (P ⁇ 0.05) stimulated ex vivo apoptosis of Th-1 and Th-17 lung cells.
  • FIGs 7A-7B Human Thl and Thl7 cells induced proliferation of human lung myofibroblasts in co-culture.
  • Figure 7 A LMF were co-cultured with induced Thl or Thl 7 or Th2, control uninduced and Thl or Thl7 treated with the peptide. At least 100 cells per sample were counted for PCNA (N: 3) P ⁇ 0.01 for Thl and Thl7 cells (NS for the other co-culture systems).
  • Figure 7B Schematic representation of the Thl/Thl7-LMF; Th2-LMF; and Thl/Thl7 treated with peptide-LMF co-cultures.
  • FIG. 8 Phosphorylation of C/EBPP-Thr266 was induced and associated with the Thl response in lungs from IPF patients. A representative patient with IPF and a representative control individual were studied. DNA; Phospho-C/EBPpThr266; T-Bet; and GATA-3 were identified by confocal laser scanning microscopy.
  • FIG. 9 Phosphorylation of C/EBPP-Thr266 was induced and associated with the Thl/Thl7 response in lungs from IPF patients. A representative patient with IPF and a representative control individual were studied. Phospho- C/EBPpThr266; IL-12R; IL-23R; IL- 4Ra; and aSMA were identified by confocal laser scanning microscopy.
  • FIG. 10 Phosphorylation of C/ ⁇ on Thr266 was induced and necessary for the Thl/Thl7 response of human CD4+ T-cells to inflammatory inducers.
  • IL-23 a Thl7 inducer
  • they expressed the IL-23R and GATA-3 data not shown
  • FIG. 11 Phosphorylation of C/EBPP-Thr266 was induced and associated with the Thl/Thl7 response in lungs from IPF lung tissue. Freshly isolated T-cells were purified and characterized as described below. Phospho-C/EBPpThr266; IL-12R; IL-23R; and IL-4Ra; were identified by confocal laser scanning microscopy.
  • FIG. 12 Th2 stimuli and the C/ ⁇ peptide induced apoptosis of isolated primary human lung Thl and Thl7 cells from an IPF patient. T-cells were isolated by CD-4+ affinity and treated for 16 hr with 10 ⁇ g/ml of IL-10 or IL-4, or with 100 pM C/ ⁇ peptide. Apoptosis was detected as described (12). The Th2 inducers and the C/ ⁇ peptide (P ⁇ 0.05) stimulated ex vivo apoptosis of Th-1 and Th-17 lung cells.
  • FIGs 13a-13d The modulation of Fas-L induced liver injury and inflammation by phosphorylated C/EBPP-Thr217 in mice.
  • Fig. 13b Jo-2 Ab induced minimal injury to cultured primary hepatocytes isolated from the phosphorylation mimic C/EBPP-Glu217 transgenic mice (closed circles) when compared to hepatocytes from C/EBPP-wt mice ( open circles) , judging by the apoptosis annexin-V assay (P ⁇ 0.001). Control cultured primary hepatocytes from C/EBPP-wt untreated with Jo-2 had less than 5% baseline apoptosis.
  • Fig. 13c Jo-2 Ab induced minimal injury to cultured primary hepatocytes isolated from the phosphorylation mimic C/EBPP-Glu217 transgenic mice (closed circles) when compared to hepatocytes from C/EBPP-wt mice ( open circles) , judging by the apoptosis annexin-V assay (P ⁇ 0.001). Control cultured primary hepatocytes from C/EBPP-wt untreated with Jo-2 had less than 5% baseline
  • Jo-2 Ab stimulated a greater infiltration of F4/80+ macrophage inflammatory cells in the livers of C/EBPp-Glu217 mice than in the livers of C/EBPp-wt mice (P ⁇ 0.01).
  • Jo-2 Ab induced a greater area of hepatocyte apoptotic damage in the livers of C/EBPP-Glu217 mice than in the livers of C/EBPP-wt mice (P ⁇ 0.005).
  • Values are mean (SD) of at least 6 animals per group and representative of three experiments.
  • FIGs 14a-14b Activation of cultured primary liver macrophages by TGF-a is associated with phosphorylation of C/EBPP-Thr217.
  • Liver macrophages cultured in RPMI 1640, 10% fetal bovine serum with L-glutamine, 25 ⁇ FEPES and Penicillin/Streptomycin were treated for 8 hr with TGFa (10 ⁇ ).
  • Fig 14a After treatment with TGF-a , freshly isolated cultured liver macrophages from C/EBPP-wt mice expressed activated RSK-phospho- Ser380 and phosphorylation of endogenous C/ ⁇ on Thr217 ( O.OOl). Representative examples of triplicate samples from three experiments.
  • Fig. 14b Activation of cultured primary liver macrophages by TGF-a is associated with phosphorylation of C/EBPP-Thr217.
  • TGF-a induced also expression of NOS-2 in cultured liver macrophages ( O.Ol).
  • TO-PR03 was used to stain cellular DNA. Representative examples of triplicate samples from three experiments. Fluorescence and bright-field imaging were quantified using the Keyence microscope BZ9000 analysis software programs.
  • FIGs 15a-15e Phosphorylation of C/ ⁇ on Thr217 is induced and necessary for the liver macrophage activation after hepatotoxin treatment in mice.
  • Fig. 15a Acute administration of CCU stimulated a higher degree of macrophage infiltration in the livers of the phosphorylation mimic C/EBPp-Glu217 mice compared to C/EBPp-wt mice (P ⁇ 0.0001), as identified by the expression of F4/80 by microscopy.
  • the C/EBPP-Ala217 transgene suppressed CCl 4 -induced macrophage liver infiltration by about 90% when compared to C/EBPP-wt mice (P ⁇ 0.0001).
  • CCl 4 -induced macrophage liver infiltration was similar in TGFa transgenic mice and C/EBPP-wt mice (NS).
  • Fig. 15b The degree of hepatocyte apoptosis induced by CC1 4 was increased in C/EBPp-Glu217 mice (P ⁇ 0.005) and in TGFa mice (P ⁇ 0.05) but it was ameliorated in C/EBPp-Ala217 mice (P ⁇ 0.01) when compared to C/EBPp-wt mice.
  • Fig. 15c CC1 4 stimulated higher serum ALT in C/EBPp-Glu217 mice compared to C/EBPp-wt mice (P ⁇ 0.01).
  • the C/EBPP-Ala217 transgene suppressed CCl -induced serum ALT by about 50% when compared to C/EBPP-wt mice (P ⁇ 0.001).
  • CCl 4 -induced serum ALT was similar in TGFa transgenic mice and C/EBPp-wt mice (NS).
  • Fig. 15d The dominant negative peptide that blocks C/EBPp-Thr217 phosphorylation also inhibited the CCl -induction of liver macrophage infiltration by ⁇ 60 % (P ⁇ 0.01).
  • Fig. 15e The peptide inhibited the CCl -induction of hepatocyte apoptosis by ⁇ 45 % (P ⁇ 0.001). Values are mean (SD) of at least 6 animals per group and representative of two experiments.
  • FIG. 16a Macrophages are induced and necessary for the liver injury in response to hepatotoxin treatment in mice.
  • Fig. 16a C/EBPP-wt mice that received Clodronate liposomes to deplete macrophages 24 hr before the administration of CC1 4 , had a marked reduction in liver macrophages 30-hr after CC1 4 treatment ( ⁇ 90%; P ⁇ 0.005).
  • Fig. 16b Depletion of macrophages with Clodronate liposomes in C/EBPP-wt mice resulted in decreased liver injury at 30-hr after CC1 treatment as assessed by counting apoptotic hepatocytes in liver biopsies (P ⁇ 0.01).
  • Fig. 16c Macrophages are induced and necessary for the liver injury in response to hepatotoxin treatment in mice.
  • Fig. 16a C/EBPP-wt mice that received Clodronate liposomes to deplete macrophages 24 hr before the administration of
  • Clodronate liposomes pretreatment of C/EBPP-wt mice also decreased serum ALT levels by ⁇ 75% at 30-hr after CC1 4 treatment (P ⁇ 0.005).
  • Figs. 16d, 16e & 16f Clodronate liposomes induced an inhibition of TLR5, MyD88 and TLR4 expression in liver macrophages isolated from C/EBPP-wt mice at 30-hr after CC1 treatment compared to liver macrophages isolated from CC1 treated C/EBPP-wt mice that did not receive Clodronate liposomes (P ⁇ 0.001).
  • Values are mean (SD) of at least 6 animals per group and representative of two experiments.
  • FIGs 17a-17b Phosphorylated C/EBPP-Thr217 stimulates the inflammasome signal 1 complex in liver macrophages in mice.
  • Fig. 17a Thirty-hours after CC1 treatment, the CD- 1 l/CD-68 primary liver macrophages isolated from C/EBPP-wt mice expressed phosphorylated C/EBPP-Thr217 and inflammasome signal 1 complex gene products, TLR4, NFKB, IRF8 and MyD88. Expression of phosphorylated C/EBPp-Thr217, TLR4, NFKB, IRF8 and MyD88 was blocked in C/EBPP-Ala217 transgenic mice.
  • C/ ⁇ was immunoprecipitated and its associated proteins from freshly isolated primary liver macrophages 30 hr. after treatment of mice with vehicle or CC1 4 were analyzed.
  • Phosphorylated C/EBPp-Thr217 or C/EBPp-Glu217), but not unphosphorylated C/ ⁇ - Thr217 (or C/EBPp-Ala217), was associated with TLR4, NFKB, IRF8 and MyD88.
  • Treatment with CC1 4 (and macrophage activation) increased the association between phosphorylated C/EBPP-Thr217 and inflammasome signal 1 proteins.
  • ⁇ -Actin was use as internal control for sample loading. Representative examples of three independent experiments described as in Figs 15a-15e.
  • FIGs 1 8a- 1 8b Phosphorylated C/EBPP-Thr217 stimulates expression of the inflammasome complex signal 2 in liver macrophages in mice.
  • FIG. 18a Thirty-hours after CC1 4 treatment, the CD-l l/CD-68 primary liver macrophages purified from C/ ⁇ - ⁇ mice expressed phosphorylated C/EBPP-Thr217 and inflammasome signal 2 complex gene products, NALP3, TLR5, IL-lRl and the adaptor protein ASC. Expression of phosphorylated C/ ⁇ - Thr217, NALP3, TLR5, IL-lRl and the adaptor protein ASC was blocked in C/EBPp-Ala217 transgenic mice.
  • C/ ⁇ was immunoprecipitated and its associated proteins from freshly isolated primary liver macrophages 30 hr after treatment of mice with vehicle or CC1 4 were analyzed.
  • Phosphorylated C/EBPp-Thr217 or C/EBPp-Glu217), but not unphosphorylated C/ ⁇ - Thr217 (or C/EBPp-Ala217), was associated with NALP3, TLR5, IL-1R1 and the adaptor protein ASC.
  • Treatment with CC1 4 (and macrophage activation) increased the association between phosphorylated C/EBPP-Thr217 and inflammasome signal 2 proteins.
  • ⁇ -Actin was use as internal control for sample loading. Representative examples of three independent experiments described as in Figs 15a-15e.
  • FIGs 19a-19c Phosphorylated C/EBPP-Thr217 stimulates the expression of inflammasome structural and byproduct genes in liver macrophages in mice.
  • Fig. 19a Freshly isolated liver macrophages from the phosphorylation mimic C/EBPP-Glu217 mice expressed an activated transcriptosome related to the Inflammasome when compared to C/EBPP-wt mice.
  • FIG. 19b Freshly isolated C/EBPP-Ala217 liver macrophages from mice treated with CC1 4 express an inhibited inflammasome transcriptosome when compared to freshly isolated liver macrophages from C/EBPP-wt mice treated with CC1 4 .
  • FIGS. 20a-20j C/EBPP-Thr266 associated with the inflammasome complex in liver macrophages from patients with Toxic Oil Syndrome. Liver biopsies from all 16 patients were analyzed with TOS that were still available at the Universidad Complutense Medical Center, Madrid, Spain. These patients had a moderately severe acute liver injury. Figs. 20a & 20c. In TOS patients there was a marked increase in both macrophage infiltration of the liver ( ⁇ 20-fold; 1,004,683 +/- 140,485 vs. 41, 160 +/- 3,353; P ⁇ 0.001) (Fig.
  • FIG. 20a Liver macrophages in livers from patients with TOS expressed MyD-88, phosphorylated C/EBPP-Thr266, and TLR-5 when compared to macrophages in normal livers (Figs. 20e, 20g & 20i) (P ⁇ 0.001 for all).
  • FIG. 21 The phosphorylation mimic C/EBPP-Glu217 transgenic mice are more susceptible than control C/ ⁇ - ⁇ mice to liver injury induced by FAS-R activation.
  • Formalin fixed liver samples were stained with reticulin histochemistry or F4/80 immunohistochemistry.
  • the liver injury (reticulin stain) and the liver macrophage infiltration (F4/80) are induced by Jo-Ab(FAS) but the inductions is much more prominent in liver tissue from C/EBPP-Glu217 mice. Representative example of experiment described in Figures 13a- 13d above.
  • Lactacystin induces minimal injury to primary hepatocytes isolated from C/EBPP-Glu217 transgenic mice. Lactacystin induced minimal injury to cultured primary hepatocytes isolated from the phosphorylation mimic C/EBPP-Glu217 transgenic mice (closed circles) when compared to hepatocytes from C/ ⁇ - ⁇ mice (open circles), judging by the apoptosis annexin-V assay (PO.0001). Control cultured primary hepatocytes from C/EBPP-wt untreated with Lactacystin had less than 5% baseline apoptosis. Values are mean (SD) of triplicate samples and representative of two experiments.
  • FIG. 23a Representative histological samples of C/EBPp-wt, TGFa, C/EBPp-Glu217 (E), and C/EBPp-Ala217(A) after
  • Fig. 23b Representative histological samples of C/EBPP-wt mice after 30 hrs. treatment with vehicle or CCL4. Formalin fixed liver samples were stained with reticulin or F4/80 immunohistochemistry.
  • FIG. 24 Macrophage ablation prevents CC14-induced liver injury and macrophage infiltration. Histological samples of C/ ⁇ - ⁇ mice that received Clondronate liposomes to deplete macrophages 24 hr. before the administration of vehicle or CC14. Macrophage depleted mice had a marked reduction in liver injury (reticulin stain) and liver macrophage infiltration (F4/80) 30 hrs. after C114 treatment. Representative example of experiment described in Figures 16a-16f above.
  • FIGS 25a-25b Treatment with the PEG-30kDa-peptide IP, Intratracheal Instillation of the peptide (positive control), or the peptide by inhalation markedly reduced the degree of lung fibrosis; the expression of a-SMA (a marker of activated myofibroblasts), which was co- localized with C/EBPP-Thr217 phosphorylation.
  • all treatments decreased lung inflammation as determined by the expression of IL-23R (a marker of Th-17 cells).
  • Bleomycin increased lung fibrosis by > 5 -fold compared to control animals.
  • Figure 26 Treatment with the PEG-30kDa-peptide IP, Intratracheal Instillation of the peptide (positive control), or the peptide by inhalation as described in Figures 25a-25b. In spite of the short 14-day treatment, all treatments improved the Tidal Volume by > 35 % (P ⁇ 0.01).
  • Figure 27 illustrates that C/ ⁇ - ⁇ mice that received the PEG-30kDa-peptide or the peptide by inhalation had less lung injury than control C/EBPp-wt mice after Bleomycin treatment, judging by the remarkable inhibition in lung alveolar epithelial cell apoptosis ( ⁇ 60%), (P ⁇ 0.005).
  • FIG. 28 Representative Immunohistochemistry of a kidney biopsy from a patient with crescent glomerulonephritis. As documented for liver and lung inflammation and fibrosis, kidney glomerulonephritis has a marked increase in activated myofibroblasts (a-SMA) and an enhanced macrophage inflammatory reaction (F4/80). These cells were positive for C/EBPp-266 indicating the high feasibility of targeting kidney inflammation and fibrosis with the PEG- 30kDa-peptide.
  • a-SMA activated myofibroblasts
  • F4/80 enhanced macrophage inflammatory reaction
  • the term "subject” refers to humans, mammals and/or veterinary animals (e.g., cats, dogs, cows, horses, sheep, pigs, etc.), and experimental animal models. In certain embodiments, the subject refers to a human patient, including both genders in adult and child populations.
  • the terms “treat”, “treatment”, and the like mean to relieve or alleviate at least one symptom associated with such condition, or to slow or reverse the progression of such condition.
  • the term “treat” also denotes to arrest, delay the onset (i.e., the period prior to clinical manifestation of a disease) and/or reduce the risk of developing or worsening a disease.
  • a state, disorder or condition may also include (1) preventing or delaying the appearance of at least one clinical or sub-clinical symptom of the state, disorder or condition developing in a subject that may be afflicted with or predisposed to the state, disorder or condition but does not yet experience or display clinical or subclinical symptoms of the state, disorder or condition; or (2) inhibiting the state, disorder or condition, i.e., arresting, reducing or delaying the development of the disease or a relapse thereof (in case of maintenance treatment) or at least one clinical or subclinical symptom thereof; or (3) relieving the disease, i.e., causing regression of the state, disorder or condition or at least one of its clinical or sub-clinical symptoms.
  • John Wiley and Sons, Inc. Hoboken, NJ; Coligan et al. eds. (2005) Current Protocols in Immunology, John Wiley and Sons, Inc.: Hoboken, NJ; Coico et al. eds. (2005) Current Protocols in Microbiology, John Wiley and Sons, Inc. : Hoboken, NJ; Coligan et al. eds. (2005) Current Protocols in Protein Science, John Wiley and Sons, Inc. : Hoboken, NJ; and Enna et al. eds. (2005) Current Protocols in Pharmacology, John Wiley and Sons, Inc.: Hoboken, NJ. Additional techniques are explained, e.g., in U.S. Patent No. 7,912,698 and U.S. Patent Appl. Pub. Nos. 2011/0202322 and 2011/0307437.
  • the invention provides therapeutic peptides that are designed to block one phosphorylation on one molecular protein target in liver, lung, kidney, and/or other scar tissue to prevent and/or inhibit activation and production of myofibroblasts and/or macrophages so as to inhibit liver, lung, and/or other scar tissue inflammation and/or fibrosis. Since the peptides of the invention are nonessential to other mechanistic processes, they are highly specific and effective, while minimizing any potential off-target toxicity.
  • the invention provides therapeutic peptides that have high efficacy against the molecular target preventing activation of myofibroblasts and inhibiting liver, lung, and kidney fibrosis.
  • the invention further provides that by regulating the activation of the inflammasome in inflammatory macrophages and activate myofibroblasts, phosphorylated C/EBPP-Phospho-Thr266 (human homologue of mouse C/EBPP-Thr217) plays a major role in liver, lung, and kidney inflammation and injury.
  • C/EBPP-Phospho-Thr217 signaling that is evolutionarily conserved (identical in human C/EBPP-Phospho-Thr266) modulates macrophage inflammasome activity and liver injury induced by different acting hepatotoxins.
  • the therapeutic peptides also block activation of myofibroblasts through apoptotic mechanism, preventing progression and allowing regression of fibrosis of the scar tissue.
  • This invention provides therapeutic peptides which are designed to block phosphorylation on one protein, a single event critical to liver, lung, kidney, and/or other scar tissue production and nonessential to other mechanistic processes. Therefore, the candidate drugs are highly specific and effective, while minimizing any potential off-target toxicity.
  • the invention provides that by regulating the activation of the inflammasome in liver lung, and/or kidney macrophages, phosphorylated C/EBPP-Thr217 plays a major role in liver, lung, and/or kidney inflammation and injury.
  • C/EBPP-Phospho-Thr217 signaling that is evolutionarily conserved (identical in human C/EBPP-Phospho-Thr266) modulates macrophage inflammasome activity and liver, lung, and/or kidney injury induced by different acting hepato- kidney, and/or lung toxins.
  • the peptides of the invention have been shown to stimulate apoptosis and block fibrogenesis, preventing progression and inducing regression of liver, lung, kidney, and/or other tissue inflammations and/or fibrosis.
  • the peptides of the invention also show high efficacy against the molecular target, e.g., phosphorylation of C/EBPP-Thr217 in activated liver, lung, and/or kidney myofibroblasts and/or macrophages, preventing activation of myofibroblasts and/or macrophages and inhibiting liver, lung and/or kidney inflammations and fibrogenesis.
  • the invenmtion provides an isolated peptide comprising the amino acid sequence Lys-Ala-Val-Asp, wherein at least one amino acid is D-amino acid and wherein said peptide is capable of inhibiting phosphorylation of human CCAAT/Enhancer Binding Protein- ⁇ (C/ ⁇ ) at Threonine 266 (Thr 266) or mouse C/ ⁇ at Thr 217.
  • human and mouse C/ ⁇ sequences see, e.g., human: GenBank Gene ID 1051; mouse: GenBank Gene ID 12608.
  • the Ala and/or Val within the amino acid sequence Lys-Ala-Val-Asp is D-amino acid.
  • the peptide is capable of selectively inhibiting phosphorylation of human CCAAT/Enhancer Binding Protein- ⁇ (C/ ⁇ ) at Threonine 266 (Thr 266).
  • the peptide is capable of inhibiting activation of myofibroblasts and/or macrophage inflammasome.
  • the peptide is between four amino acids and eight amino acids long.
  • the peptide comprises the amino acid sequence selected from the group consisting of Lys-DAla-DVal-Asp, Lys-DAla-Val-Asp and Lys-Ala- DVal-Asp. In one embodiment, the peptide consists of the amino acid sequence selected from the group consisting of Lys-DAla-DVal-Asp, Lys-DAla-Val-Asp and Lys-Ala-DVal-Asp. In one embodiment, the peptide comprises the amino acid sequence Lys-DAla-DVal-Asp. In one embodiment, the peptide consists of the amino acid sequence Lys-DAla-DVal-Asp.
  • the peptide consists of amino acid sequence selected from the group consisting of Lys-Ser-Lys-Ala-Lys-Lys-Ala-Val-Asp-Lys-His-Ser-Asp (SEQ ID NO: 3), Lys-Ala-Lys-Lys- Ala-Val-Asp-Lys-His-Ser (SEQ ID NO: 4), and Ala-Lys-Lys-Ala-Val-Asp-Lys-His (SEQ ID NO: 5) (e.g., peptides wherein the Ala and/or Val within the amino acid motif Lys-Ala-Val-Asp is D-amino acid).
  • the peptide further comprises polyethylene glycol (PEG).
  • the peptide further comprises a linker of acid (Ac) or mercaptopropionic acid (Mpr) or trimethyl lock (TML) lactonization (see, e.g., Greenwald, Journal of Controlled Release. 74, 2001, 159-171).
  • the carboxy terminal group of the peptide is OH, OCH 3 , or NH 2 group.
  • the peptide is a cyclic peptide.
  • the peptide is selected from the group consisting of:
  • carboxy terminal group of the peptide is OH, OCH 3 , or H 2 group.
  • the peptide is selected from the group consisting of Lys-DAla-DVal- Asp, Ac-Lys-DAla-DVal-Asp, Mpr-Lys-DAla-DVal-Asp, PEG-Lys-DAla-DVal-Asp, PEG-Ac- Lys-DAla-DVal-Asp, and PEG-Mpr-Lys-DAla-DVal-Asp, wherein the carboxy terminal group of the peptide is OH, OCH 3 , or H 2 group.
  • the peptide is selected from the group consisting of Lys-DAla-DVal- Asp- H2, Ac-Lys-DAla-DVal-Asp-NH2, Mpr-Lys-DAla-DVal-Asp- H2, PEG-Lys-DAla- DVal-Asp- H2, PEG-Ac-Lys-DAla-DVal-Asp- H2, and PEG-Mpr-Lys-DAla-DVal-Asp-NH2.
  • the peptide has the structure as shown in formula (I):
  • the invention also encompasses C/EBPP-Ala- 217 amino acids 1 to 296 (mouse), C/EBPP-Ala-217 fragment amino acids 216 to 253 (mouse), and C/EBPP-Ala-217 amino acids 1 to 285 (mouse) (e.g., obtained based on GenBank Gene ID 12608 with Ala in position 217).
  • C/EBPP-Ala-217 amino acids 1 to 285 e.g., obtained based on GenBank Gene ID 12608 with Ala in position 217
  • Corresponding human sequences and fragments are also encompassed and can be obtained based on a human C/ ⁇ sequence with Ala in position 266 (e.g., based on GenBank Gene ID 1051 with Ala in position 266).
  • the peptides of the invention can be modified, e.g., by the use of hetero-bifunctional linkers.
  • end groups for heterobifunctional PEGs are maleimide, vinyl sulfones, pyridyl disulfide, amine, carboxylic acids, and NHS esters (see, e.g., Veronese, Francesco M. "peptide and protein PEGylation: a review of problems and solutions. " Biomatenals 22.5 (2001): 405-417).
  • the peptides of the invention may employ third generation Pegylation agents that are, e.g., branched, Y-shaped or comb-shaped (see, e.g., Ryan, Sinead M; Mantovani, Giuseppe; Wang, Xuexuan; Haddleton, David M; Brayden, David J (2008). "Advances in PEGylation of important biotech molecules: Delivery aspects". Expert Opinion on Drug Delivery 5 (4): 371-83).
  • the peptides of the invention can be multimerized and/or cyclized (e.g., Polypeptide Group).
  • Useful delivery technologies for the peptides of the invention include, e.g., LAR-depot microsphere polymer matrix (Midatech Pharma) and Protected Graft Copolymer (PGCTM) technology (PharmaIN).
  • LAR-depot microsphere polymer matrix Midatech Pharma
  • PPCTM Protected Graft Copolymer
  • the peptides of the invention can be modified in various ways to improve their pharmacokinetic and other properties.
  • Peptides can be modified at the amino (N-) terminus, and/or carboxy (C-) terminus and/or by replacement of one or more of the naturally occurring genetically encoded amino acids with an unconventional amino acid, modification of the side chain of one or more amino acid residues, peptide phosphorylation, and the like.
  • Amino terminus modifications include methylation (e.g., ⁇ NHCH 3 or— N(CH 3 ) 2 ), acetylation (e.g., with acetic acid or a halogenated derivative thereof such as a-chloroacetic acid, a-bromoacetic acid, or a-iodoacetic acid), adding a benzyloxycarbonyl (Cbz) group, or blocking the amino terminus with any blocking group containing a carboxylate functionality defined by RCOO-- or sulfonyl functionality defined by R ⁇ S0 2 — , where R is selected from alkyl, aryl, heteroaryl, alkyl aryl, and the like, and similar groups.
  • Carboxy terminus modifications include replacing the free acid with a carboxamide group or forming a cyclic lactam at the carboxy terminus to introduce structural constraints.
  • C- terminal functional groups of the compounds of the present invention include amide, amide lower alkyl, amide di(lower alkyl), lower alkoxy, hydroxy, and carboxy, and the lower ester derivatives thereof, and the pharmaceutically acceptable salts thereof.
  • proline analogues in which the ring size of the proline residue is changed from 5 members to 4, 6, or 7 members can be employed.
  • Cyclic groups can be saturated or unsaturated, and if unsaturated, can be aromatic or non-aromatic. Heterocyclic groups preferably contain one or more nitrogen, oxygen, and/or sulfur heteroatoms. Examples of such groups include the furazanyl, furyl, imidazolidinyl, imidazolyl, imidazolinyl, isothiazolyl, isoxazolyl, morpholinyl (e.g.
  • oxazolyl e.g., 1-piperazinyl
  • piperidyl e.g., 1-piperidyl, piperidino
  • pyranyl pyrazinyl, pyrazolidinyl, pyrazolinyl, pyrazolyl, pyridazinyl, pyridyl, pyrimidinyl, pyrrolidinyl (e.g., 1- pyrrolidinyl), pyrrolinyl, pyrrolyl, thiadiazolyl, thiazolyl, thienyl, thiomorpholinyl (e.g., thiomorpholino), and triazolyl.
  • These heterocyclic groups can be substituted or unsubstituted. Where a group is substituted, the substituent can be alkyl, alkoxy, halogen, oxygen, or substituted or unsubstituted phenyl.
  • Common examples of conventional amino acid replacements include stereoisomers (e.g., D-amino acids) and unnatural amino acids such as, for example, L-ornithine, L-homocysteine, L-homoserine, L-citrulline, 3-sulfino-L-alanine, N-(L-arginino)succinate, 3,4- dihydroxy-L-phenylalanine, 3-iodo-L-tyrosine, 3,5-diiodo-L-tyrosine, triiodothyronine, L- thyroxine, L-selenocysteine, N-(L-arginino)taurine, 4-aminobutylate, (R,S)-3-amino-2- methylpropanoate, a,a-disubstituted amino acids, N-alkyl amino acids, lactic acid, ⁇ -alanine, 3- pyridylalanine
  • the peptide compounds of the invention also serve as structural models for non- peptidic compounds with similar biological activity.
  • Those of skill in the art recognize that a variety of techniques are available for constructing compounds with the same or similar desired biological activity as the lead peptide compound, but with more favorable activity than the lead with respect to solubility, stability, and susceptibility to hydrolysis and proteolysis (see, e.g., Morgan and Gainor (1989) Ann. Rep. Med. Chem. 24:243-252). These techniques include replacing the peptide backbone with a backbone composed of phosphonates, amidates, carbamates, sulfonamides, secondary amines, and N-methylamino acids.
  • the present invention also provides conjugates of the disclosed peptide monomers.
  • the monomeric peptides of the present invention are dimerized or oligomerized, thereby enhancing their biological activity.
  • the peptide monomers of the invention may be oligomerized using the biotin/streptavidin system.
  • Biotinylated analogs of peptide monomers may be synthesized by standard techniques.
  • the peptide monomers may be C-terminally biotinylated.
  • These biotinylated monomers are then oligomerized by incubation with streptavidin [e.g., at a 4: 1 molar ratio at room temperature in phosphate buffered saline (PBS) or HEPES- buffered RPMI medium (Invitrogen) for 1 hour].
  • streptavidin e.g., at a 4: 1 molar ratio at room temperature in phosphate buffered saline (PBS) or HEPES- buffered RPMI medium (Invitrogen) for 1 hour.
  • biotinylated peptide monomers may be oligomerized by incubation with any one of a number of commercially available anti-biotin antibodies [e.g., goat anti-biotin IgG from Kirkegaard & Perry Laboratories, Inc. (Washington, DC)].
  • anti-biotin antibodies e.g., goat anti-biotin IgG from Kirkegaard & Perry Laboratories, Inc. (Washington, DC)].
  • the peptide monomers of the invention can be dimerized by covalent attachment to at least one linker moiety.
  • the linker (L K ) moiety can be a Ci-12 linking moiety optionally terminated with one or two - H- linkages and optionally substituted at one or more available carbon atoms with a lower alkyl substituent (e.g., - H-R- H- wherein R is a lower (Ci -6 ) alkylene substituted with a functional group such as a carboxyl group or an amino group, such as, for example, a lysine residue or a lysine amide).
  • polyethylene glycol may serve as the linker
  • L K that dimerizes two peptide monomers for example, a single PEG moiety may be simultaneously attached to the N-termini of both peptide chains of a peptide dimer.
  • the linker (L K ) moiety is preferably, but not necessarily, a molecule containing two carboxylic acids and optionally substituted at one or more available atoms with an additional functional group such as an amine capable of being bound to one or more PEG molecules.
  • an additional functional group such as an amine capable of being bound to one or more PEG molecules.
  • n is an integer from 0 to 10
  • m is an integer from 1 to 10
  • X is selected from O, S, N(CH 2 ) p Ri, NCO(CH 2 ) p Ri, and CHNRi
  • Ri is selected from H, Boc, Cbz, etc.
  • p is an integer from 1 to 10.
  • Linkers can be incorporated into the peptide during peptide synthesis.
  • a linker L K moiety contains two functional groups capable of serving as initiation sites for peptide synthesis and a third functional group (e.g., a carboxyl group or an amino group) that enables binding to another molecular moiety
  • the linker may be conjugated to a solid support. Thereafter, two peptide monomers may be synthesized directly onto the two reactive nitrogen groups of the linker L K moiety in a variation of the solid phase synthesis technique.
  • a linker L K moiety may be conjugated to the two peptide monomers of a peptide dimer after peptide synthesis. Such conjugation may be achieved by methods well established in the art.
  • the linker contains at least two functional groups suitable for attachment to the target functional groups of the synthesized peptide monomers. For example, a linker with two free amine groups may be reacted with the C-terminal carboxyl groups of each of two peptide monomers.
  • linkers containing two carboxyl groups may be reacted with the N-terminal or side chain amine groups, or C-terminal lysine amides, of each of two peptide monomers.
  • a peptide monomer or dimer may further comprise one or more spacer moieties.
  • spacer moieties may be attached to a peptide monomer or to a peptide dimer (e.g., such spacer moieties may be attached to the linker L K moiety that connects the monomers of a peptide dimer).
  • spacer moieties may be attached to a peptide via the carbonyl carbon of a lysine linker, or via the nitrogen atom of an iminodiacetic acid linker.
  • Such a spacer may connect a peptide to an attached water soluble polymer moiety or a protecting group.
  • the spacer moiety is a C 1-12 linking moiety optionally terminated with -NH- linkages or carboxyl (-COOH) groups, and optionally substituted at one or more available carbon atoms with a lower alkyl substituent.
  • the spacer is R- COOH wherein R is a lower (Ci -6 ) alkylene optionally substituted with a functional group such as a carboxyl group or an amino group that enables binding to another molecular moiety.
  • the spacer may be a glycine (G) residue, or an amino hexanoic acid.
  • the spacer is -NH-R-NH- wherein R is a lower (Ci -6 ) alkylene substituted with a functional group such as a carboxyl group or an amino group that enables binding to another molecular moiety.
  • R is a lower (Ci -6 ) alkylene substituted with a functional group such as a carboxyl group or an amino group that enables binding to another molecular moiety.
  • the spacer may be a lysine (K) residue or a lysine amide (K-NH 2 , a lysine residue wherein the carboxyl group has been converted to an amide moiety -CONH 2 ).
  • a spacer can be incorporated into the peptide during peptide synthesis.
  • a spacer contains a free amino group and a second functional group ⁇ e.g., a carboxyl group or an amino group) that enables binding to another molecular moiety
  • the spacer may be conjugated to the solid support. Thereafter, the peptide may be synthesized directly onto the spacer's free amino group by standard solid phase techniques.
  • a spacer containing two functional groups is first coupled to the solid support via a first functional group.
  • a linker L K moiety having two functional groups capable of serving as initiation sites for peptide synthesis and a third functional group (e.g., a carboxyl group or an amino group) that enables binding to another molecular moiety is conjugated to the spacer via the spacer's second functional group and the linker's third functional group.
  • two peptide monomers may be synthesized directly onto the two reactive nitrogen groups of the linker L K moiety in a variation of the solid phase synthesis technique.
  • a solid support coupled spacer with a free amine group may be reacted with a lysine linker via the linker's free carboxyl group.
  • the linker contains at least one functional group suitable for attachment to the target functional group of the synthesized peptide.
  • a spacer with a free amine group may be reacted with a peptide's C- terminal carboxyl group.
  • a linker with a free carboxyl group may be reacted with the free amine group of a peptide's N-terminus or of a lysine residue.
  • a spacer containing a free sulfhydryl group may be conjugated to a cysteine residue of a peptide by oxidation to form a disulfide bond.
  • Water soluble polymer moieties The peptide monomers, dimers, or multimers of the invention may further comprise one or more water soluble polymer moieties. Preferably, these polymers are covalently attached to the peptide compounds of the invention. Included with the below description, the U.S. Patent Application Serial Number 10/844,933 and International Patent Application No. PCT/US04/14887, filed May 12, 2004, are incorporated by reference herein in their entirety.
  • water-soluble polymers such as polyethylene glycol (PEG)
  • PEG polyethylene glycol
  • Attachment of such polymers is thought to enhance biological activity, prolong blood circulation time, reduce immunogenicity, increase aqueous solubility, and enhance resistance to protease digestion (see, e.g., J. M. Harris, Ed., "Biomedical and Biotechnical Applications of Polyethylene Glycol Chemistry,” Plenum, New York, 1992; Knauf, et al. (1988) J. Biol. Chem. 263; 15064; Tsutsumi, et al. (1995) J. Controlled Release 33 :447; Kita, et al.
  • PEG polyethylene glycol
  • the water soluble polymers useful for the peptide compounds of the invention may be, for example, polyethylene glycol (PEG), copolymers of ethylene glycol/propylene glycol, carboxymethylcellulose, dextran, polyvinyl alcohol, polyvinyl pyrrolidone, poly-l,3-dioxolane, poly-l,3,6-trioxane, ethylene/maleic anhydride copolymer, polyaminoacids (either homopolymers or random copolymers), poly(n-vinyl pyrrolidone)polyethylene glycol, propropylene glycol homopolymers, polypropylene oxide/ethylene oxide copolymers, and polyoxy ethyl ated polyols.
  • PEG polyethylene glycol
  • copolymers of ethylene glycol/propylene glycol carboxymethylcellulose
  • dextran polyvinyl alcohol
  • polyvinyl pyrrolidone poly-l,3-dioxolane
  • the water soluble polymer may be of any molecular weight, and may be branched or unbranched.
  • a preferred PEG for use in the present invention comprises linear, unbranched PEG having a low molecular weight. It is understood that in a given preparation of PEG, the molecular weights will typically vary among individual molecules. Some molecules will weight more, and some less, than the stated molecular weight. Such variation is generally reflect by use of the word "about” to describe molecular weights of the PEG molecules.
  • Peptides, peptide dimers and other peptide-based molecules of the invention can be attached to water-soluble polymers (e.g., PEG) using any of a variety of chemistries to link the water-soluble polymer(s) to the receptor-binding portion of the molecule (e.g., peptide + spacer).
  • a typical embodiment employs a single attachment junction for covalent attachment of the water soluble polymer(s) to the receptor-binding portion, however in alternative embodiments multiple attachment junctions may be used, including further variations wherein different species of water-soluble polymer are attached to the receptor-binding portion at distinct attachment junctions, which may include covalent attachment junction(s) to the spacer and/or to one or both peptide chains.
  • the dimer or higher order multimer will comprise distinct species of peptide chain (i.e., a heterodimer or other heteromultimer).
  • a dimer may comprise a first peptide chain having a PEG attachment junction and the second peptide chain may either lack a PEG attachment junction or utilize a different linkage chemistry than the first peptide chain and in some variations the spacer may contain or lack a PEG attachment junction and said spacer, if PEGylated, may utilize a linkage chemistry different than that of the first and/or second peptide chains.
  • An alternative embodiment employs a PEG attached to the spacer portion of the receptor-binding portion and a different water-soluble polymer (e.g., a carbohydrate) conjugated to a side chain of one of the amino acids of the peptide portion of the molecule.
  • a PEG attached to the spacer portion of the receptor-binding portion and a different water-soluble polymer (e.g., a carbohydrate) conjugated to a side chain of one of the amino acids of the peptide portion of the molecule.
  • PEG polyethylene glycol
  • Suitable reactive PEG species include, but are not limited to, those which are available for sale in the Drug Delivery Systems catalog (2003) of NOF Corporation (Yebisu Garden Place Tower, 20-3 Ebisu 4-chome, Shibuya-ku, Tokyo 150-6019) and the Molecular Engineering catalog (2003) of Nektar Therapeutics (490 Discovery Drive, Huntsville, Alabama 35806).
  • PEG reagents are often preferred in various embodiments: mPEG2- HS, mPEG2-ALD, multi-Arm PEG, mPEG(MAL)2, mPEG2(MAL), mPEG- H2, mPEG-SPA, mPEG-SBA, mPEG-thioesters, mPEG-Double Esters, mPEG-BTC, mPEG-ButyrALD, mPEG-ACET, heterofunctional PEGs ( H2-PEG-COOH, Boc-PEG- HS, Fmoc-PEG- HS, HS-PEG-VS, HS-PEG-MAL), PEG acrylates (ACRL-PEG- HS), PEG- phospholipids (e.g., mPEG-DSPE), multiarmed PEGs of the SU BRITE series including the GL series of glycerine-based PEGs activated by a chemistry chosen
  • the number of polymer molecules attached may vary; for example, one, two, three, or more water soluble polymers may be attached to a peptide of the invention.
  • the multiple attached polymers may be the same or different chemical moieties (e.g., PEGs of different molecular weight).
  • the degree of polymer attachment (the number of polymer moieties attached to a peptide and/or the total number of peptides to which a polymer is attached) may be influenced by the proportion of polymer molecules versus peptide molecules in an attachment reaction, as well as by the total concentration of each in the reaction mixture.
  • the optimum polymer versus peptide ratio in terms of reaction efficiency to provide for no excess unreacted peptides and/or polymer moieties
  • the desired degree of polymer attachment e.g., mono, di-, tri-, etc.
  • the molecular weight of the polymer selected whether the polymer is branched or unbranched, and the reaction conditions for a particular attachment method.
  • activated PEG may be covalently bound to amino acid residues via a reactive group, such as a free amino group in N-terminal amino acid residues and lysine (K) residues or a free carboxyl group in C-terminal amino acid residues.
  • Sulfhydryl groups e.g., as found on cysteine residues
  • enzyme-assisted methods for introducing activated groups e.g., hydrazide, aldehyde, and aromatic-amino groups
  • activated groups e.g., hydrazide, aldehyde, and aromatic-amino groups
  • PEG molecules may be attached to peptide amino groups using methoxylated PEG ("mPEG”) having different reactive moieties.
  • mPEG methoxylated PEG
  • Such polymers include mPEG-succinimidyl succinate, mPEG-succinimidyl carbonate, mPEG-imidate, mPEG-4- nitrophenyl carbonate, and mPEG-cyanuric chloride.
  • PEG molecules may be attached to peptide carboxyl groups using methoxylated PEG with a free amine group (mPEG-NH 2 ).
  • the desired PEGylated compound may be purified from the mixture of PEGylated compounds.
  • the N-terminally PEGylated form may be purified from a population of randomly PEGylated peptides (i.e., separating this moiety from other monoPEGylated moieties).
  • Site-specific PEGylation at the N-terminus, side chain, and C-terminus can be performed through (i) solid-phase synthesis (see, e.g., Felix, et al. (1995) Int. J. Peptide Protein Res. 46:253) or (ii) attaching a peptide to extremities of liposomal surface-grafted PEG chains in a site-specific manner through a reactive aldehyde group at the N-terminus generated by sodium periodate oxidation of N-terminal threonine (see, e.g., Zalipsky, et al. (1995) Bioconj . Chem.
  • selective N-terminal PEGylation may be accomplished by reductive alkylation which exploits differential reactivity of different types of primary amino groups (lysine versus the N-terminal) available for derivatization in a particular protein.
  • a carbonyl group containing PEG is selective attached to the N-terminus of a peptide.
  • PEGylation takes place predominantly at the N-terminus of the protein, with no significant modification of other reactive groups ⁇ e.g., lysine side chain amino groups).
  • the PEG should have a single reactive aldehyde for coupling to the protein ⁇ e.g., PEG proprionaldehyde may be used).
  • Site-specific mutagenesis is a further approach which may be used to prepare peptides for site-specific polymer attachment.
  • the amino acid sequence of a peptide is designed to incorporate an appropriate reactive group at the desired position within the peptide.
  • WO 90/12874 describes the site-directed PEGylation of proteins modified by the insertion of cysteine residues or the substitution of other residues for cysteine residues.
  • the linker or spacer contains a reactive group and an activated PEG molecule containing the appropriate complementary reactive group is used to effect covalent attachment.
  • the linker or spacer reactive group contains a terminal amino group (i.e., positioned at the terminus of the linker or spacer) which is reacted with a suitably activated PEG molecule to make a stable covalent bond such as an amide or a carbamate.
  • Suitable activated PEG species include, but are not limited to, mPEG-para- nitrophenyl carbonate (mPEG- PC), mPEG-succinimidyl carbonate (mPEG-SC), and mPEG- succinimidyl propionate (mPEG-SPA).
  • the linker or spacer reactive group contains a carboxyl group capable of being activated to form a covalent bond with an amine-containing PEG molecule under suitable reaction conditions.
  • Suitable PEG molecules include mPEG- H 2 and suitable reaction conditions include carbodiimide-mediated amide formation or the like.
  • the peptides of the invention may be prepared by classical methods known in the art. These standard methods include exclusive solid phase synthesis, automated solid phase synthesis, partial solid phase synthesis methods, fragment condensation, classical solution synthesis, and recombinant DNA technology (See, e.g., Merrifield J. Am. Chem. Soc. 1963 85:2149 and Merrifield et al., 1982, Biochemistry, 21 :502).
  • a preferred method for peptide synthesis is solid phase synthesis.
  • Solid phase peptide synthesis procedures are well-known in the art (see, e.g., Stewart, Solid Phase Peptide Syntheses, Freeman and Co.: San Francisco, 1969; 2002/2003 General Catalog from Novabiochem Corp, San Diego, USA; Goodman, Synthesis of Peptides and Peptidomimetics, Houben-Weyl, Stuttgart 2002).
  • synthesis is typically commenced from the C-terminal end of the peptide using an a-amino protected resin.
  • a suitable starting material can be prepared, for instance, by attaching the required a-amino acid to a chloromethylated resin, a hydroxymethyl resin, a polystyrene resin, a benzhydrylamine resin, or the like.
  • a chloromethylated resin is sold under the trade name BIO-BEADS SX-1 by Bio Rad Laboratories (Richmond, CA).
  • BIO-BEADS SX-1 Bio Rad Laboratories (Richmond, CA).
  • BIO-BEADS SX-1 Bio Rad Laboratories (Richmond, CA).
  • BIO-BEADS SX-1 Bio Rad Laboratories (Richmond, CA).
  • the preparation of the hydroxymethyl resin has been described (Bodonszky, et al. (1966) Chem. Ind. London 38: 1597).
  • the benzhydrylamine (BHA) resin has been described (Pietta and Marshall, 1970, Chem. Commun., 650), and the hydrochloride form is commercially available
  • an a- amino protected amino acid may be coupled to a chloromethylated resin with the aid of a cesium bicarbonate catalyst, according to the method described by Gisin (1973, Helv. Chim. Acta 56: 1467).
  • the a-amino protecting group is removed, for example, using trifluoroacetic acid (TFA) or hydrochloric acid (HQ) solutions in organic solvents at room temperature. Thereafter, a-amino protected amino acids are successively coupled to a growing support-bound peptide chain.
  • TFA trifluoroacetic acid
  • HQ hydrochloric acid
  • the a-amino protecting groups are those known to be useful in the art of stepwise synthesis of peptides, including: acyl-type protecting groups ⁇ e.g., formyl, trifluoroacetyl, acetyl), aromatic urethane-type protecting groups [e.g., benzyl oxycarboyl (Cbz) and substituted Cbz], aliphatic urethane protecting groups [e.g., t- butyloxycarbonyl (Boc), isopropyloxycarbonyl, cyclohexyloxycarbonyl], and alkyl type protecting groups ⁇ e.g., benzyl, triphenylmethyl), fluorenylmethyl oxycarbonyl (Fmoc), allyloxycarbonyl (Alloc), and l-(4,4-dimethyl-2,6-dioxocyclohex-l-ylidene)ethyl (Dde).
  • the side chain protecting groups typically ethers, esters, trityl, PMC
  • the side chain protecting group must be removable upon the completion of the synthesis of the final peptide and under reaction conditions that will not alter the target peptide.
  • the side chain protecting groups for Tyr include tetrahydropyranyl, tert-butyl, trityl, benzyl, Cbz, Z-Br-Cbz, and 2,5-dichlorobenzyl.
  • the side chain protecting groups for Asp include benzyl, 2,6- dichlorobenzyl, methyl, ethyl, and cyclohexyl.
  • the side chain protecting groups for Thr and Ser include acetyl, benzoyl, trityl, tetrahydropyranyl, benzyl, 2,6-dichlorobenzyl, and Cbz.
  • the side chain protecting groups for Arg include nitro, Tosyl (Tos), Cbz, adamantyloxycarbonyl mesitoylsulfonyl (Mts), 2,2,4,6,7-pentamethyldihydrobenzofurane-5-sulfonyl (Pbf), 4-mthoxy- 2,3,6-trimethyl-benzenesulfonyl (Mtr), or Boc.
  • the side chain protecting groups for Lys include Cbz, 2-chlorobenzyloxycarbonyl (2-Cl-Cbz), 2-bromobenzyloxycarbonyl (2-Br-Cbz), Tos, or Boc.
  • each protected amino acid is generally reacted in about a 3-fold excess using an appropriate carboxyl group activator such as 2-(lH- benzotriazol-l-yl)-l, 1,3,3 tetramethyluronium hexafluorophosphate (HBTU) or dicyclohexylcarbodimide (DCC) in solution, for example, in methylene chloride (CH 2 C1 2 ), N- methyl pyrrolidone, dimethyl formamide (DMF), or mixtures thereof.
  • an appropriate carboxyl group activator such as 2-(lH- benzotriazol-l-yl)-l, 1,3,3 tetramethyluronium hexafluorophosphate (HBTU) or dicyclohexylcarbodimide (DCC) in solution, for example, in methylene chloride (CH 2 C1 2 ), N- methyl pyrrolidone, dimethyl formamide (DMF), or mixtures thereof.
  • the desired peptide is decoupled from the resin support by treatment with a reagent, such as trifluoroacetic acid (TFA) or hydrogen fluoride (HF), which not only cleaves the peptide from the resin, but also cleaves all remaining side chain protecting groups.
  • a reagent such as trifluoroacetic acid (TFA) or hydrogen fluoride (HF)
  • TFA trifluoroacetic acid
  • HF hydrogen fluoride
  • the side chain protected peptide can be decoupled by treatment of the peptide resin with ammonia to give the desired side chain protected amide or with an alkylamine to give a side chain protected alkylamide or dialkylamide. Side chain protection is then removed in the usual fashion by treatment with hydrogen fluoride to give the free amides, alkylamides, or dialkylamides.
  • the resins used to prepare the peptide acids are employed, and the side chain protected peptide is cleaved with base and the appropriate alcohol (e.g., methanol). Side chain protecting groups are then removed in the usual fashion by treatment with hydrogen fluoride to obtain the desired ester.
  • the resultant peptide can be further purified using FIPLC.
  • Synthetic amino acids that can be substituted into the peptides of the present invention include, but are not limited to, N-methyl, L-hydroxypropyl, L-3, 4-dihydroxyphenylalanyl, ⁇ amino acids such as L- D ⁇ -hydroxylysyl and D- D ⁇ -methylalanyl, L- ⁇ -methylalanyl, ⁇ amino acids, and isoquinolyl.
  • D-amino acids and non-naturally occurring synthetic amino acids can also be incorporated into the peptides of the present invention.
  • the peptides of the present invention may be synthesized by employing recombinant DNA technology by expressing one or more polynucleotide comprising a peptide coding region.
  • the invention provides isolated polynucleotides comprising nucleotide sequences encoding the peptides of the invention.
  • Expression may be achieved in any conventional expression system known in the art by isolating a DNA fragment encoding the peptide of interest and cloning into an expression vector.
  • Useful compounds of the present invention are not limited to peptides incorporating natural and/or non-natural amino acids.
  • the invention also encompasses various peptidomimetics such as, e.g., peptoids (a class of peptidomimetics whose side chains are appended to the nitrogen atom of the peptide backbone, rather than to the a-carbons).
  • peptoids a class of peptidomimetics whose side chains are appended to the nitrogen atom of the peptide backbone, rather than to the a-carbons.
  • a number of non-peptide molecules having similar functional properties to the peptides of the invention can be developed to incorporate disparate chemical functional groups within a single molecule.
  • scaffolding molecules These molecules are often referred to as scaffolding molecules, or scaffolds, since they can accommodate a wide range of chemical functionality and can be designed to present the chemical functional groups in a wide array of relative geometric orientations in space.
  • Molecular scaffold systems include, but are not limited to, carbohydrates (see, e.g., Tamaruya et al., Angew Chem. Int. Ed. Engl., 2004, 43(21):2834-7), peptide nucleic acids (PNA's), (see, e.g.,
  • compositions of this invention may include pharmaceutically acceptable salts of the components therein.
  • Pharmaceutically acceptable salts include the acid addition salts (formed with the free amino groups of the peptide) that are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, tartaric, mandelic and the like.
  • Salts formed with the free carboxyl groups can be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium or ferric hydroxides, and such organic bases as isopropyl amine, trimethylamine, 2-ethylamino ethanol, histidine, procaine and the like.
  • inorganic bases such as, for example, sodium, potassium, ammonium, calcium or ferric hydroxides
  • organic bases such as isopropyl amine, trimethylamine, 2-ethylamino ethanol, histidine, procaine and the like.
  • Pharmaceutically acceptable carriers are familiar to those skilled in the art and can include sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water or aqueous solution saline solutions and aqueous dextrose and glycerol solutions are preferably employed as carriers, particularly for injectable solutions. Suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by E.W. Martin.
  • acceptable carriers and diluents include saline and sterile water, and may optionally include antioxidants, buffers, bacteriostats, and other common additives.
  • compositions can also be formulated as pills, capsules, granules, or tablets which may contain, in addition to a peptide of this invention, diluents, dispersing and surface active agents, binders, and lubricants. Proper formulation is dependent upon the route of administration chosen.
  • the optimal therapeutically effective amount of a compound or composition of this invention may be determined experimentally, taking into consideration the exact mode of administration, the form in which the drug is administered, the indication toward which the administration is directed, the subject involved (e.g., body weight, health, age, sex, etc.), and the preference and experience of the physician or veterinarian in charge.
  • dose- response curves derived from animal systems can be used to determine testing doses for administration to humans.
  • the dose and frequency of administration should meet or exceed those anticipated for use in any clinical trial.
  • the dose of the compound in the compositions of the present invention is determined to ensure that the dose administered continuously or intermittently will not exceed an amount determined after consideration of the results in test animals and the individual conditions of a patient.
  • a specific dose naturally varies (and is ultimately decided according to the judgment of the practitioner and each patient's circumstances) depending on the dosage procedure, the conditions of a patient or a subject animal such as age, body weight, sex, sensitivity, feed, dosage period, drugs used in combination, seriousness of the disease, etc.
  • Toxicity and therapeutic efficacy of the compositions of the invention can be determined by standard pharmaceutical procedures in experimental animals, e.g., by determining the LD 50 (the dose lethal to 50% of the population) and the ED 50 (the dose therapeutically effective in 50% of the population).
  • the dose ratio between therapeutic and toxic effects is the therapeutic index and it can be expressed as the ratio ED 50 /LD 50 .
  • All known peptide delivery methods can be used to deliver the peptides of the present invention to the target tissues.
  • the specific type of delivery useful for a given peptide is determined by its specific size, flexibility, conformation, biochemical properties of constituent amino acids, and amino acid arrangement.
  • Peptide composition also determines, in part, the degree of protein binding, enzymatic stability, cellular sequestration, uptake into non-target tissue, clearance rate, and affinity for protein carriers.
  • Other aspects independent of peptide composition must also be considered, such as cerebral blood flow, diet, age, sex, species (for experimental studies), dosing route, and effects of existing pathological conditions.
  • the peptides and/or the pharmaceutical composition comprising the peptides of the invention can be administered to a subject (e.g., human or animal) in need via various administration routes, including, but not limited to, systemic administration, inhalation, topical, sublingual, oral, intranasal, and/or direct instillation (e.g, intratracheal instillation for lung treatment).
  • a subject e.g., human or animal
  • various administration routes including, but not limited to, systemic administration, inhalation, topical, sublingual, oral, intranasal, and/or direct instillation (e.g, intratracheal instillation for lung treatment).
  • the peptides of the invention can be formulated for any suitable administration, with or without any pharmaceutically acceptable carrier, excipients, solvents, and/or solutions, and in certain proper dosage.
  • Examples of delivery methods useful for obtaining effective tissue delivery of the peptides of the invention include, without limitation (reviewed, e.g., in Witt and Davis, AAPS Journal, 2006; 8(1): E76-E88.):
  • invasive procedures e.g., direct injection [e.g., using an external pump or i.v. line], transient osmotic opening, shunts, and biodegradable implants);
  • lipidization e.g., methylation, dimethylation, or halogenation of constituent amino acids or acylation or alkylation of the N-terminal amino acid
  • structural modification to enhance stability e.g., use of D-amino acids, N-acylation, or cyclization, e.g., via a disulfide-bridge or via a hydrazide bridge
  • glycosylation e.g., adding simple sugars such as, e.g., glucose or xylose
  • increasing affinity for nutrient transporters e.g., adding hexose or large neutral amino acid carriers which facilitate delivery of substrates to the brain
  • forming a prodrug by conjugating a peptide to a molecule with a known transporter activity or to a lipophilicity enhancer, which is cleaved at or near the site of action (e.g.,
  • an important aspect of the present invention is to keep the size of the resulting delivered peptide sufficiently small (e.g., by using cleavable conjugates).
  • oral solid dosage forms which are described generally in Remington's Pharmaceutical Sciences, 18th Ed. 1990 (Mack Publishing Co. Easton PA 18042) at Chapter 89, which is herein incorporated by reference.
  • Solid dosage forms include tablets, capsules, pills, troches or lozenges, cachets, pellets, powders, or granules.
  • liposomal or proteinoid encapsulation may be used to formulate the present compositions (as, for example, proteinoid microspheres reported in U.S. Patent No. 4,925,673).
  • Liposomal encapsulation may be used and the liposomes may be derivatized with various polymers ⁇ e.g., U.S.
  • Patent No. 5,013,556 A description of possible solid dosage forms for the therapeutic is given by Marshall, K. In: Modern Pharmaceutics Edited by G.S. Banker and C.T. Rhodes Chapter 10, 1979, herein incorporated by reference.
  • the formulation will include a peptide of the invention (or chemically modified forms thereof) and inert ingredients which allow for protection against the stomach environment, and release of the biologically active material in the intestine.
  • liquid dosage forms for oral administration including pharmaceutically acceptable emulsions, solutions, suspensions, and syrups, which may contain other components including inert diluents; adjuvants such as wetting agents, emulsifying and suspending agents; and sweetening, flavoring, and perfuming agents.
  • the peptides may be chemically modified so that oral delivery of the derivative is efficacious.
  • the chemical modification contemplated is the attachment of at least one moiety to the component molecule itself, where said moiety permits (a) increase in peptide stability (e.g., by inhibition of proteolysis) and (b) efficient uptake into the blood stream from the stomach or intestine.
  • common delivery- improving peptide modifications include PEGylation or the addition of moieties such as propylene glycol, copolymers of ethylene glycol and propylene glycol, carboxymethyl cellulose, dextran, polyvinyl alcohol, polyvinyl pyrrolidone, polyproline, poly-l,3-dioxolane and poly- 1,3,6-tioxocane (see, e.g., Abuchowski and Davis (1981) "Soluble Polymer-Enzyme Adducts," in Enzymes as Drugs. Hocenberg and Roberts, eds. (Wiley-Interscience: New York, NY) pp. 367-383; and Newmark, et al. (1982) J. Appl. Biochem. 4: 185-189).
  • moieties such as propylene glycol, copolymers of ethylene glycol and propylene glycol, carboxymethyl cellulose, dextran, polyvinyl alcohol, polyvinyl pyrrolidon
  • the location of release may be the stomach, the small intestine (the duodenum, the jejunum, or the ileum), or the large intestine.
  • the release will avoid the deleterious effects of the stomach environment, either by protection of the peptide (or derivative) or by release of the peptide (or derivative) beyond the stomach environment, such as in the intestine.
  • a coating impermeable to at least pH 5.0 is essential.
  • examples of the more common inert ingredients that are used as enteric coatings are cellulose acetate trimellitate (CAT), hydroxypropylmethylcellulose phthalate (HPMCP), HPMCP 50, HPMCP 55, polyvinyl acetate phthalate (PVAP), Eudragit L30D, Aquateric, cellulose acetate phthalate (CAP), Eudragit L, Eudragit S, and Shellac. These coatings may be used as mixed films.
  • a coating or mixture of coatings can also be used on tablets, which are not intended for protection against the stomach. This can include sugar coatings, or coatings which make the tablet easier to swallow.
  • Capsules may consist of a hard shell (such as gelatin) for delivery of dry therapeutic ⁇ i.e. powder), for liquid forms a soft gelatin shell may be used.
  • the shell material of cachets could be thick starch or other edible paper. For pills, lozenges, molded tablets or tablet triturates, moist massing techniques can be used.
  • the peptide (or derivative) can be included in the formulation as fine multiparticulates in the form of granules or pellets of particle size about 1 mm.
  • the formulation of the material for capsule administration could also be as a powder, lightly compressed plugs, or even as tablets. These therapeutics could be prepared by compression.
  • Colorants and/or flavoring agents may also be included.
  • the peptide (or derivative) may be formulated (such as by liposome or microsphere encapsulation) and then further contained within an edible product, such as a refrigerated beverage containing colorants and flavoring agents.
  • diluents could include carbohydrates, especially mannitol, lactose, anhydrous lactose, cellulose, sucrose, modified dextrans and starch.
  • Certain inorganic salts may be also be used as fillers including calcium triphosphate, magnesium carbonate and sodium chloride.
  • Some commercially available diluents are Fast-Flo, Emdex, STA-Rx 1500, Emcompress, and Avicel.
  • Disintegrants may be included in the formulation of the therapeutic into a solid dosage form.
  • Materials used as disintegrates include but are not limited to starch, including the commercial disintegrant based on starch, Explotab. Sodium starch glycolate, Amberlite, sodium carboxymethylcellulose, ultramylopectin, sodium alginate, gelatin, orange peel, acid carboxymethyl cellulose, natural sponge and bentonite may all be used.
  • the disintegrants may also be insoluble cationic exchange resins.
  • Powdered gums may be used as disintegrants and as binders, and can include powdered gums such as agar, Karaya or tragacanth. Alginic acid and its sodium salt are also useful as disintegrants.
  • Binders may be used to hold the peptide (or derivative) agent together to form a hard tablet and include materials from natural products such as acacia, tragacanth, starch and gelatin. Others include methyl cellulose (MC), ethyl cellulose (EC) and carboxymethyl cellulose (CMC). Polyvinyl pyrrolidone (PVP) and hydroxypropylmethyl cellulose (FIPMC) could both be used in alcoholic solutions to granulate the peptide (or derivative).
  • MC methyl cellulose
  • EC ethyl cellulose
  • CMC carboxymethyl cellulose
  • PVP Polyvinyl pyrrolidone
  • FEPMC hydroxypropylmethyl cellulose
  • An antifrictional agent may be included in the formulation of the peptide
  • Lubricants may be used as a layer between the peptide (or derivative) and the die wall, and these can include but are not limited to; stearic acid including its magnesium and calcium salts, polytetrafluoroethylene
  • PTFE PTFE
  • Soluble lubricants may also be used such as sodium lauryl sulfate, magnesium lauryl sulfate, polyethylene glycol of various molecular weights, Carbowax 4000 and 6000.
  • Glidants that might improve the flow properties of the drug during formulation and to aid rearrangement during compression might be added.
  • the glidants may include starch, talc, pyrogenic silica and hydrated silicoaluminate.
  • surfactant might be added as a wetting agent.
  • Surfactants may include anionic detergents such as sodium lauryl sulfate, dioctyl sodium sulfosuccinate and dioctyl sodium sulfonate.
  • anionic detergents such as sodium lauryl sulfate, dioctyl sodium sulfosuccinate and dioctyl sodium sulfonate.
  • Cationic detergents might be used and could include benzalkonium chloride or benzethomium chloride.
  • nonionic detergents that could be included in the formulation as surfactants are lauromacrogol 400, polyoxyl 40 stearate, polyoxyethylene hydrogenated castor oil 10, 50 and 60, glycerol monostearate, polysorbate 20, 40, 60, 65 and 80, sucrose fatty acid ester, methyl cellulose and carboxymethyl cellulose. These surfactants could be present in the formulation of the protein or derivative either alone or as a mixture in different ratios.
  • Additives which potentially enhance uptake of the peptide (or derivative) are for instance the fatty acids oleic acid, linoleic acid and linolenic acid.
  • Controlled release oral formulations may be desirable.
  • the peptide (or derivative) could be incorporated into an inert matrix which permits release by either diffusion or leaching mechanisms, e.g., gums.
  • Slowly degenerating matrices may also be incorporated into the formulation.
  • Some enteric coatings also have a delayed release effect.
  • Another form of a controlled release is by a method based on the Oros therapeutic system (Alza Corp.), i.e. the drug is enclosed in a semipermeable membrane which allows water to enter and push drug out through a single small opening due to osmotic effects.
  • coatings may be used for the formulation. These include a variety of sugars which could be applied in a coating pan.
  • the peptide (or derivative) could also be given in a film coated tablet and the materials used in this instance are divided into 2 groups.
  • the first are the nonenteric materials and include methyl cellulose, ethyl cellulose, hydroxyethyl cellulose, methylhydroxy-ethyl cellulose, hydroxypropyl cellulose, hydroxypropyl -methyl cellulose, sodium carboxy-methyl cellulose, providone and the polyethylene glycols.
  • the second group consists of the enteric materials that are commonly esters of phthalic acid.
  • a mix of materials might be used to provide the optimum film coating.
  • Film coating may be carried out in a pan coater or in a fluidized bed or by compression coating.
  • Preparations according to this invention for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, or emulsions.
  • non-aqueous solvents or vehicles are propylene glycol, polyethylene glycol, vegetable oils, such as olive oil and corn oil, gelatin, and injectable organic esters such as ethyl oleate.
  • Such dosage forms may also contain adjuvants such as preserving, wetting, emulsifying, and dispersing agents. They may be sterilized by, for example, filtration through a bacteria retaining filter, by incorporating sterilizing agents into the compositions, by irradiating the compositions, or by heating the compositions. They can also be manufactured using sterile water, or some other sterile injectable medium, immediately before use.
  • the present invention encompasses any delivery device that is suitable for administration by inhalation or intranasal administration of the compositions of the invention. Preferably, such means administers a metered dosage of the composition.
  • the composition of the present invention may be packed in any appropriate form or container as long as a means is provided to deliver the composition to the oral or lung or nasal mucosa.
  • useful delivery devices include, e.g., instillation catheters, droppers, unit-dose containers, squeeze bottles pump sprays, airless and preservative-fee sprays, compressed air nebulizers, metered-dose inhalers, insufflators and pressurized metered dose inhalers.
  • compositions of the invention can be placed in a container provided with a conventional dropper/closure device, e.g. comprising a pipette or the like, preferably delivering a substantially fixed volume of composition/drop.
  • a conventional dropper/closure device e.g. comprising a pipette or the like
  • the aqueous solution may be dispensed in spray form by a variety of methods known to those skilled in the art.
  • such compositions will be put up in an appropriate atomising device, e.g. in a pump-atomiser, or the like.
  • the atomising device will be provided with appropriate means, such as a spray adaptor for delivery of the aqueous spray to the nans.
  • nasal sprays include nasal actuators produced by Ing. Erich Pfeiffer GmbH, Radolfzell, Germany (see U.S. Pat. No. 4,511,069, U.S. Pat. No. 4,778,810, U.S. Pat. No. 5,203,840, U.S. Pat. No. 5,860,567, U.S. Pat. No. 5,893,484, U.S. Pat. No. 6,227,415, and U.S. Pat. No. 6,364, 166.
  • Additional aerosol delivery forms may include, e.g., compressed air-, jet-, ultrasonic-, and piezoelectric nebulizers.
  • the spray may be bottled under pressure in an aerosol device.
  • the propellant may be a gas or a liquid (e.g. a fluorinated and/or chlorinated hydrocarbon).
  • the spray composition may be suspended or dissolved in a liquid propellant. Stabilizing and/or suspending agents and/or co-solvents may be present.
  • a dry powder may be readily dispersed in an inhalation device as described in U.S. Pat. No. 6,514,496 and Garcia-Arieta et al., Biol. Pharm. Bull. 2001; 24: 1411-1416.
  • a powder or liquid may be filled into a soft or hard capsule or in a single dose device adapted for nasal administration.
  • the powder may be sieved before filled into the capsules such as gelatine capsules.
  • the delivery device may have means to break open the capsule.
  • the powdery nasal composition can be directly used as a powder for a unit dosage form.
  • the contents of the capsule or single dose device may be administered using e.g. an insufflator. Preferably it will be provided with means ensuring dosing of a substantially fixed amount of composition.
  • the composition of the invention can be provided as a nasal insert having the peptide(s) of the invention.
  • the insert may be retained in the naris, but flushed by the nasal mucus, and may be designed to release the Peptide, fragment or derivative of the invention at the same place in the naris.
  • Suitable nasal insert types include nasal plugs, tampons and the like. Further examples of nasal inserts, their characteristics and preparation are described in EP 490806.
  • Delivery devices are important not only for delivering the peptides of the invention, but also for providing an appropriate environment for storage. This would include protection from microbial contamination and chemical degradation.
  • the device and formulation should be compatible so as to avoid potential leaching or adsorption.
  • the delivery device (or its packaging) can be optionally provided with a label and/or with instructions for use.
  • the peptides of the invention can be administered using any standard administration route and technique known in the art.
  • the peptides can also be delivered using a vector (such as a viral vector) with the ability to express a peptide of this invention.
  • Fibrotic diseases that could be targeted by the peptides of invention include, but not limited to, liver diseases, including but not limited to, liver cirrhosis and fibrosis of any etiology (alcoholic; non-alcoholic steato-hepatitis; autoimmune hepatitis; chronic hepatitis C; chronic hepatitis B; primary biliary cirrhosis; secondary biliary cirrhosis; sclerosing cholangitis; alpha- 1 -antitrypsin deficiency; Wilson's disease; biliary atresia); lung diseases, including but not limited to, idiopathic pulmonary fibrosis; radiation-induced pneumonitis; chronic obstructive pulmonary disease; emphysema; secondary to chronic infections and inflammation; kidney diseases, including but not limited to, glomerulonephritis and interstitial-tubular fibrosis; skin diseases, including but not limited to, secondary to burns
  • liver diseases including but not limited to, liver inflammation diseases including but not limited to, alcoholic liver disease; non-alcoholic steato-hepatitis; autoimmune hepatitis; chronic hepatitis C; chronic hepatitis B; primary biliary cirrhosis; secondary biliary cirrhosis; sclerosing cholangitis; alpha- 1 -antitrypsin deficiency; Wilson's disease; biliary atresia; lung inflammation associated with Idiopathic pulmonary fibrosis; radiation-induced pneumonitis; chronic obstructive pulmonary disease; emphysema; secondary to chronic infections and inflammation; kidney inflammation associated with glomerulonephritis; interstitial-tubular fibrosis; skin inflammation secondary to burns; scleroderma; psoriasis; esophageal-ga
  • Peptides of the invention can be used as part of combination treatments with various other treatments known for the specific diseases which are being targeted.
  • liver myofibroblasts (of different origins) is responsible for the development of liver fibrosis in chronic liver diseases (13; 15; 19; 20), and remarkably, the clearance of myofibroblasts by apoptosis would allow recovery from liver injury and reversal of liver fibrosis (7; 20; 24).
  • liver experts that inhibiting or reversing myofibroblastic activation of different cellular origins is critical for the treatment of liver fibrosis (7; 15; 19; 20; 24).
  • blocking the progression of liver fibrosis would decrease development of primary liver cancer since the majority of hepatocellular carcinomas arise in cirrhotic livers (34).
  • the rationales for developing the therapeutic peptides of the invention are provided as follows: a) activation of myofibroblasts is responsible for the development of liver fibrosis in chronic liver diseases of all causes (13; 15; 19; 20); b) inhibition of myofibroblastic activity by apoptosis would allow recovery from liver injury and potentially reversal of liver fibrosis (7; 20; 24); c) phosphorylated C/EBPP-Thr217 is indispensable for the survival of activated liver myofibroblasts by binding to the inactive procaspase 8 complex and preventing its self-cleavage and activation (4); d) phosphorylation of C/EBPP-Thr217 in activated liver myofibroblasts is improtant for the progression of liver fibrosis.
  • liver macrophages (of different origins) is responsible for the development of liver inflammation in acute and chronic liver diseases. Excessive liver injury and inflammation associated with liver diseases induced by viral, toxic, immunologic, and metabolic diseases (13), results in liver dysfunction and in chronic conditions in the potential deposition of scar tissue and the development of cirrhosis (15). Amplification of liver injury can be mediated by macrophages (14, 40). [00168] Expression of genes required for Inflammasome activation is indispensable for macrophage activation and Inflammasome function.
  • C/ ⁇ appears to be an important signaling molecule for macrophages because its expression is dramatically increased during differentiation of these cells, and it is induced by macrophage modulators (LPS, IL-1, G-CSF, TGFP, vitamin D, retinoic acid) (Akira et al., 1990) ⁇ Friedman, 2007 2075 /id ⁇ .
  • LPS macrophage modulators
  • IL-1 IL-1
  • G-CSF TGFP
  • vitamin D retinoic acid
  • C/ ⁇ can regulate the expression of inflammatory cytokines and chemokines, which are linked to the Inflammasome activation ⁇ Friedman, 2007 2075 /id ⁇ .
  • Phosphorylated C/EBPP-Thr217 facilitates survival of activated LMF by binding to the inactive procaspase 8 complex and preventing its self-cleavage and activation (6).
  • Phosphorylation of C/EBPP-Thr217 in activated LMF is critical for the progression of lung fibrosis. This was determined by using classical Bleomycin-induced lung fibrosis models in mice, primary mouse and human LMF in tissue culture and cell-free systems (5; 6). Phosphorylation of human C/EBPP-Thr266 in activated LMF occurs in human lung fibrosis of IPF (5).
  • mice expressing the non-phosphorylatable C/EBPP-Ala217 transgene are refractory to the induction of LMF activation and proliferation by Bleomycin (5).
  • the non-phosphorylatable C/EBPP-Ala217 facilitates the death of activated LMF by binding to the inactive procaspase and inducing its self-cleavage and activation (5).
  • the non-phosphorylatable C/EBPP-Ala217 dominant negative transgene was present within the death receptor complex II, with active caspase 8, and was linked to apoptosis of activated LMF in transgenic mice (3; 5; 6).
  • Blocking phosphorylation of C/EBPp-Thr217 with the C/EBPp-Ala217 transgene or by C/ ⁇ gene knock-out decreases the fibrotic response of the lung (5; 25).
  • the decreased fibrotic response of the lung to Bleomycin in C/EBPP-ko mice (25) suggests that the important target of RSK in activated LMF is C/EBPP-Thr217 rather than other RSK phosphoacceptors on c-Fos, CREB, CBP or other proteins.
  • the inhibitory parent peptide prevents the phosphorylation of C/ ⁇ - Thr217 in LMF activated in culture by a collagen type 1 matrix or in vivo by lung injury (5).
  • Asp-NH2 (SEQ primary Myofibroblasts ID NO: 6) mouse and and in mouse human models of liver hepatocytes fibrosis
  • mice expressing the dominant negative, full-length C/EBPP-Ala217 have a normal phenotype and are fertile.
  • the invention provides efficacy and safety of the therapeutic peptides.
  • the invention provides that the three selected PEG-peptides were very effective in preventing the activation of primary human and mouse liver myofibroblasts in culture (see Table 1). Their efficacy was comparable to that of the parent peptide. Neither the parent peptide nor any of the three selected peptides induced hepatocyte injury to human or mouse cultured primary hepatocytes or to mice in vivo (at 100-fold the therapeutic dose) (Table 1).
  • Assays were used in a step-wise manner to select the safest and most efficient peptides (including apoptosis assays in activated primary human liver myofibroblasts; cell-free caspase 8 activation assays; acute liver injury/fibrogenesis models; toxicology assays in highly differentiated, primary human hepatocyte cultures and in mice).
  • EXAMPLE 1 Pilot Studies of In Vivo Efficacy and Safety of the Lead Therapeutic PEG- 30kDa-peptide in Acute Liver Injury and Activation of Liver Myofibroblasts
  • Tetrachloride (CC14) was administered to normal mice (4). Eight hours later, animals received an IP injection of the lead therapeutic PEG-30kDa-peptide (5 ⁇ g of the peptide linked [peptide to PEG at 1 :60] to the PEG-30kDa). Animals were sacrificed after 30 hr, at the peak of hepatocyte death as measured by ALT (a clinical end-point used routinely in clinical practice and by the FDA in the evaluation of liver toxicity in human drug studies) (16). Mice receiving only CC14 had intense expression of a-SMA in the liver, a main indicator of activated liver myofibroblasts (4;7), compared with the minor expression in mice receiving both CC14 and the lead therapeutic PEG-peptide.
  • the lead PEG-30kDa-peptide decreased the acute liver injury ( Figure 1).
  • the serum ALT was markedly induced by the hepatotoxin CC14 (10,554+/- 867 IU/dL) but improved in spite of only a single treatment of the therapeutic lead peptide, 8 hr after the injury was established (6,754 +/- 905 IU/dL).
  • the albumin mRNA (the major indicator of normal liver- specific gene expression) (14) was decreased by 16 fold and the IL-6 and T F-a mRNAs (the main indicators of liver inflammation) were increased by 3- and 85-fold, respectively by CC14 from control values.
  • the therapeutic lead PEG peptide markedly improved these values (albumin mRNA: decreased only 2 fold, IL-6 mRNA was normal, and TNF-a was only 4 fold increased from control values).
  • the other two alternative PEG Peptide 1 and Peptide 2 performed similarly to the lead PEG peptide in minimizing acute liver injury and activation of myofibroblasts.
  • the early safety profile of the therapeutic peptides is very high in an acute mouse model of liver injury and activation of liver myofibroblasts.
  • EXAMPLE 2 High Efficacy of the Lead Therapeutic Peptide in a Chronic Mouse Model of Liver Fibrosis
  • the therapeutic lead PEG-peptides underwent a systematic analysis of efficacy and safety in a classical chronic liver fibrosis model (7; 15; 24; 38).
  • CC14 a human hepatotoxin
  • the three selected therapeutic PEG-peptides were administered once a week IP (7 ⁇ g of peptide linked to PEG) starting at week 8, once severe liver fibrosis was already established.
  • the efficacy of the three selected PEG peptides included quantitative analysis of liver fibrosis (7).
  • CC14 administration to mice for 16-wk induced liver cirrhosis ( Figures 2A and 2B).
  • this example provides that the lead therapeutic peptide having the amino acid sequence of Ac-Lys-D-Ala-D-Val-Asp-NH2 was highly effective in preventing progression and inducing regression of liver fibrosis after cirrhosis was established after administration of CCU for 8 weeks.
  • the Ac-Lys-D-Ala-D-Val-Asp- H2 was administered IP (7 ⁇ g of peptide linked to PEG-30kDa) once /week for an additional 4 or 8 weeks.
  • the CC1 4 administration continued for 4 or 8 weeks.
  • the Ac-Lys-D-Ala-D-Val-Asp- H2 peptide inhibited liver fibrosis by 8-fold.
  • EXAMPLE 3 Phosphorylation of C ⁇ on Thr217 in mouse T-cells is induced and associated with the inflammatory Thl/Thl7 response to Bleomycin treatment - Inhibitory effects of the C ⁇ peptide
  • EXAMPLE 5 Isolation and purification of T- cells from Bleomycin-treated mice and their ex vivo inhibition by the C ⁇ peptide and Th2 inducers
  • CD4+ T-cells were isolated and purified from 165 mg of C/EBPP-wt mouse lung on day-7 after Bleomycin treatment using specific antibodies against surface receptors. Greater than 95 % of the T-cells were Thl or Thl7. These Thl/Thl7-cells were treated ex vivo for 4 hr with 10 ⁇ g/ml of IL-4, IL-10 (Th2 inducers) or ⁇ C/ ⁇ peptide (an inhibitor of C/EBPP-Thr217 phosphorylation).
  • Th2 inducers The stimulation of apoptosis of Thl/Thl7 cells by Th2 inducers was unexpected (suggesting an up- regulation of IL-4 and IL-10 signaling pathways) and offers an exciting tool to analyze the Thl/Thl7 regulation (Figure 6).
  • EXAMPLE 6 Human Thl and Thl7 but not Th2 cells induce proliferation of human lung myofibroblasts in a co-culture system - Evidence that inhibition of C EBP-P-Thr266 phosphorylation blocks lung inflammatory cells
  • LMF proliferation was analyzed by the presence of proliferating cell nuclear antigen (PCNA; DNA polymerase ⁇ auxiliary protein), an S-phase marker (12).
  • PCNA proliferating cell nuclear antigen
  • LMF cell proliferation was stimulated by Thl and Thl7 cells ( Figure 12) ⁇ 4-fold above control LMF (cultured with uninduced precursor T-cells) ( Figure 7) (P ⁇ 0.01).
  • LMF cell proliferation was not stimulated by either Th2 cells ( Figure 12) or T-cells treated with IL-12 or IL-23 plus the C/ ⁇ peptide ( Figure 7).
  • human LMF cell proliferation an important step in their activation, is stimulated by human Thl and Thl7 cells. This novel system will allow analysis of Th-cell /LMF interactions.
  • EXAMPLE 7 Human Thl/Thl7 cells are the prevalent phenotype in IPF
  • Thl/Thl7 phenotype were obtained using freshly isolated, human CD-4+ human blood T-cells. After treatment with human recombinant IL-12 (a Thl inducer), normal human blood CD-4+ T- cells expressed the IL-12RP and T-Bet (a Thl phenotype). When normal human CD-4+ T- cells were treated ex vivo with IL-23 (a Thl7 inducer), they expressed the IL-23R ( Figure 10) and GATA-3 (data not shown) (a Thl7 phenotype). Induction of Thl and Thl7 cells was linked to phosphorylation of endogenous C/ ⁇ on Thr217.
  • EXAMPLE 9 Isolation and purification of T- cells from fresh IPF lung tissue and their ex vivo response to the C/ ⁇ peptide and Th2 inducers
  • CD4+ T-cells were isolated and purified from 0.5 mg of a fresh IPF lung biopsy using specific antibodies against surface receptors. Greater than 95 % of the T-cells were Thl or Thl7, judging by their IL-12R and IL-23R markers ( Figure 11). Greater than 90% of the T-cells expressed Thl7 markers. These Thl/Thl7-cells were treated ex vivo for 16 hr with 10 ⁇ g/ml of IL-4, IL-10 (Th2 inducers) or ⁇ C/ ⁇ peptide (an inhibitor of human C/ETn ⁇ -Thr266 phosphorylation).
  • Examples 3-9 above demonstrate that a) C/EBPP-Thr217 phosphorylation is necessary for the activation of human and mouse myofibroblasts.
  • the novel peptides of the invention inhibit myofibroblast activation; b) C/EBPP-Thr217 phosphorylation is necessary for Bleomycin-induced activation of lung Thl and Thl7 cells; c) selective depletion of Thl and Thl7 cells, but not of Th2 cells, through ablation of phagocytic Ml macrophages prevents Bleomycin-induced activation of LMF and lung fibrosis; d) human Thl and Thl7 cells but not Th2 cells stimulate proliferation/activation of human LMF in co-culture; e) the clinical relevance of these findings was confirmed by the presence of phosphorylated C/EBPP-Thr266 in lung Thl and Thl7 cells in IPF lung tissue and in T-cells freshly isolated from IPF lung tissue; f) the lung T-cells in IPF are >95%
  • EXAMPLE 10 C/EBPp-Thr217 Phosphorylation Stimulates Macrophage
  • mice expressing either the C/EBPP-Ala217, a dominant negative, nonphosphorylatable mutation, or C/EBPP-Glu217, a dominant positive, phosphorylation mimic mutation of the C/EBPP-Thr217 phosphoacceptor were generated as described previously 27 and back-crossed to the parental wild-type inbreed FVB mice for >10 generations.
  • the presence of the rsv gene was used to identify these transgenic mice by PCR.
  • the primer sequences for the RSV PCR were custom designed (RSV.2271 sense TAGGGTGTGTTTAGGCGAAA (SEQ ID NO: l), and RSV.2510 antisense TCTGTTGCCTTCCTAATAAG (SEQ ID NO:2). ⁇ 20 ⁇ ] Animal Procedures
  • C/EBPP-Glu217 mice 27 each received intraperitoneal injections of CC1 4 (70 ⁇ CC1 4 and 30 ⁇ of mineral oil) or mineral oil (70 ⁇ saline and 30 ⁇ mineral oil), or Jo-2 Ab (Fas-L; 0.2 ⁇ g/g body weight) or saline vehicle (50 ⁇ ) only once.
  • C/EBPP-wt mice 25 g each received intraperitoneal injections of CC1 4 (70 ⁇ CC1 4 and 30 ⁇ of mineral oil) or mineral oil (70 ⁇ saline and 30 ⁇ mineral oil) once but after 8 hr animals received either 50 ⁇ saline (vehicle) or the cell permeant Ac-KAla217VD-CH0 21 (American Peptide) (100 ⁇ g IP).
  • animals were sacrificed 30 hr after the last CC1 4 injection or 8 hr after the Fas-L injection.
  • Liver macrophages were isolated at density gradient of 13% and then affinity purified by magnetic beads linked to CD-l l/CD-68 Antibodies (Miltenyl Biotechnology). No CSF-1 or supplements were used. An aliquot was plated on glass coverslips and allowed to sit 1 hr. at 37 C and then fixed with acetone: methanol. Liver macrophages were identified by their typical morphology, adherence to glass, and with antibodies against F-4/80 and CD-68. Purity of these preparations was greater than 95%. Aliquot of macrophages were cultured in RPMI 1640, 10 % fetal bovine serum with L-glutamine, 25 uM HEPES and Penicillin/Streptomycin. In some experiments, liver macrophages were treated for 8 hr. with TGFa (10 ⁇ ).
  • TO-PRO-3 Molecular Probes, Eugene, Oregon
  • TO-PRO-3 was used to analyze nuclear morphology. Fluorescence and bright-field imaging were quantified using the Keyence microscope BZ9000 analysis software programs. The inter-observer agreement was >90%.
  • liver macrophage expression of 86 inflammation genes was determined by using the RT 2 Quantitative Real-Time PCR Array as described by the manufacturer (SABiosciences; Valencia, CA). Control and experimental freshly isolated liver macrophage samples were analyzed together with internal control samples for the RNA purification and amplification steps, as well as for housekeeping genes ( ⁇ -actin), using the Bio-Rad iQ5 real-time PCR detection system (Bio-Rad, Hercules, CA) 21 . Isolation of total RNA, treatment with DNase, precipitation with chloroform, and cDNA synthesis was performed using 1 ⁇ g of total RNA as described for RT-PCR following the manufacturer's recommendations.
  • Pre-cleared freshly isolated liver macrophage cell lysates were incubated for 2 hr. with purified C/ ⁇ antibodies followed by the addition of A/G+ agarose (Santa Cruz Biotechnology) for 12 hr.
  • the immunoprecipiiation reactions each contained 500 xo, of total protein and 2 p.g antibody (or purified ]gG pre-immune serum as negative control).
  • Imniiinoprecipitates were washed 3 times in 500 ml cell lysis buffer and resolved by SDS- PAGE, and C/EBPp-Phospliol 3 ⁇ 4r217, TLR4, NFKB, IRF8, MyD88, NALP3, TLR-5, IL-1R1, ASC ⁇ -actin, active caspase 3, IL- ⁇ , and IL-18 detected by western biot, following the chemolurninescence protocol (Perkin-Elmer, Shelton, Connecticut) using specific antibodies l8,
  • Results are expressed as mean ( ⁇ SD or ⁇ SE). Either the Student-? or the Wilcoxon Mann-Whitney tests were used to evaluate the differences of the means between groups for parametric and non-parametric populations, respectively, with a P value of ⁇ 0.05 as significant.
  • liver injury was determined after exposure to hepatotoxins (Fas and CCU) in mice by quantitative histology and immunohistochemistry 24 , cell death assays 23 , and by measuring serum alanine aminotransferase (ALT) levels 21 , an indicator of liver injury used routinely in patient care as well as by the Food and Drug Administration in clinical drug studies 25 .
  • Fas-mediated IL-18 secretion by macrophages and injection of a Fas agonist antibody (Jo-2 Ab) 26 induces severe liver injury in mice.
  • mice expressing the dominant positive, phosphorylation mimic C/EBPP-Glu217 transgene were more susceptible than control C/EBPP-wt mice to liver injury induced by Fas-R activation with Jo-2 Ab, judging by the serum ALT levels (P ⁇ 0.0001) (Fig. 13a) and histology (Fig. 21).
  • Mice expressing the dominant negative, non-phosphorylatable, C/EBPP-Ala217 transgene were highly resistant to Fas-L induction of liver injury (P ⁇ 0.01) (Fig. 13a).
  • Fas-L Jo-2 Ab
  • induced minimal injury to cultured primary hepatocytes isolated from the phosphorylation mimic C/EBPP-Glu217 transgenic mice when compared to hepatocytes from C/EBPP-wt mice, judging by the apoptosis annexin-V assay (P ⁇ 0.001) (Fig. 13b).
  • Control cultured primary hepatocytes from C/EBPP-wt untreated with Jo-2 had less than 5% baseline apoptosis.
  • Fas receptor CD95
  • Fas-L also stimulated a greater infiltration of F4/80+ macrophage inflammatory cells in the livers of C/EBPP-Glu217 mice than in the livers of C/EBPP-wt mice (Fig. 13c and Fig. 21), which corresponded to a greater area of hepatocyte apoptotic damage (Fig. 13d and Fig. 21).
  • liver macrophages contribute to the amplification of liver injury induced by Fas-L in C/EBPP-Glu217 mice and are the general mechanism of injury in C/EBPP-wt mice , as reported for Fas-L and other animal models of liver injury 4 ' 5 ' 6 ' 7 ' 8 . Because expression of C/ ⁇ in macrophages is of great relevance to the maturation and function of these cells 13 ' 14 ' 15 ' 16 ' 1V , it was assessed whether phosphorylated C/EBPP-Thr217 modulates the polarization of inflammatory primary liver macrophages, isolated as reported previously 23 .
  • CC1 4 which is a classical and predictable hepatotoxin that induces oxidative stress in rodent and human livers 21 ' 30 ' 31 .
  • C/EBPP-wt mice received either an intraperitoneal injection of the cell permeant, dominant negative C/ ⁇ peptide (100 ⁇ g) or vehicle (50 ⁇ saline).
  • CC1 4 stimulated ⁇ 20-fold macrophage infiltration of the liver in C/EBPP-wt mice after 30 hr. (P ⁇ 0.005), as identified by the expression of F4/80 by quantitative microscopy 23 (Fig. 15a).
  • CC1 4 administration induced even a higher degree of macrophage infiltration in the livers of the phosphorylation mimic C/EBPP-Glu217 mice ( ⁇ 40- folds) (P ⁇ 0.0001) (Fig. 15a).
  • Macrophages are induced and necessary for the liver injury in response to hepatotoxin treatment in mice
  • C/EBPP-wt mice received Clodronate liposomes to deplete macrophages 24 hr. before the administration of the hepatotoxin 5 . These animals had a marked reduction in liver macrophages infiltration ( ⁇ 90%; P ⁇ 0.005) (Fig. 16a and Fig. 24), and in liver injury at 30-hr. after CC1 4 treatment as assessed by counting apoptotic hepatocytes in liver biopsies (P ⁇ 0.01) (Fig. 16b and Fig. 24) and by the measurement of serum ALT ( ⁇ 75%; P ⁇ 0.005) (Fig. 16c).
  • Clodronate liposomes induced an inhibition of TLR5, MyD88 and TLR4 expression in liver macrophages isolated from
  • a priming stimulus (signal 1), acting through NFKB pathway, often precedes assembly of the inflammasome complex in order to upregulate the expression of pro-IL- ⁇ and NALP3.
  • the cytosolic sensors oligomerize to form an activation platform for caspase l 32 .
  • CD-l l/CD-68 primary liver macrophages purified from C/EBPP-wt mice expressed phosphorylated C/EBPP-Thr217, which was co- expressed with critical components of the inflammasome signal 1 complex gene products, including TLR4 , NFKB, IRF8 and MyD88 (Fig. 17a) 1 .
  • liver macrophages isolated from TGFa transgenic mice which have an stimulated MAPK signaling
  • phosphorylated C/EBPP-Thr217 was associated with the expression of critical protein components of the inflammasome signal 1 complex, including TLR4, NFKB, IRF8 and MyD88 (Fig. 17a).
  • TLR4, NFKB, IRF8 and MyD88 critical protein components of the inflammasome signal 1 complex
  • IRF8 and MyD88 Fig. 17a
  • Expression of phosphorylated C/EBPP-Thr217 is also required for the induction of the inflammasome multiprotein complex signal 2 in liver macrophages stimulated by hepatotoxin treatment since both were blocked in the nonphosphorylatable C/EBPP-Ala217 mice (Fig. 18b).
  • liver macrophages isolated from the phosphorylation mimic C/EBPP-Glu217 mice, even in the absence of hepatotoxin treatment, expressed a partially activated (primed) inflammasome signal 2 complex (Fig. 18a).
  • phosphorylated C/EBPP-Thr217 was associated with the expression of critical components of the inflammasome signal 2 complex, including NALP3, TLR5, IL-lRl and ASC (Fig. 18a).
  • liver macrophages from the phosphorylation mimic C/EBPP-Glu217 mice express an activated transcriptosome related to the Inflammasome when compared to C/EBPP-wt mice.
  • TOS Toxic Oil Syndrome
  • ALT (lU/mL) [00253] 277 (50) [00254] 171 to 382 [00255] AST (IU/mL( [00256] 138 (20) [00257] 94 to 181
  • TOS is characterized by oxidative stress that results in an acute inflammatory liver injury
  • livers of TOS afflicted patients had similar features to the CC1 4 animal models with acute inflammatory liver injury was analyzed.
  • Liver macrophages characterized by the expression of specific markers as described above, in livers from patients with TOS expressed phosphorylated C/EBPP-Thr266 (the exact homologue of mouse Thr217) when compared to macrophages in normal livers (Fig. 20g & 20h). It was found that the TOS livers have increased markers characteristic of the activated inflammasome, MyD-88 and TLR-5 (Fig. 20f & 20j) when compared to macrophages in normal livers (Fig. 20e & 20i).
  • Thr217 in the activation of the inflammasome in liver macrophages resulting in amplification of the liver injury induced by CC1 4 or by Fas-L.
  • C/EBPP-Thr217 phosphorylation is required for macrophage infiltration of the liver after a liver injury induced in mice by the oxidative stress hepatotoxin CC1 4 or by Fas-L, and for macrophage activation in primary liver macrophage cultures (stimulated by TGFa, an inducer of C/EBPP-Thr217 phosphorylation 18 ).
  • phosphorylation of C/EBPP-Thr217 in liver macrophages was required for stimulating the expression of the multiprotein complex inflammasome signal 1 (NFKB, IRF8, the adaptor protein MyD88 and TLR4) and of the inflammasome signal 2 pathway (NALP3, TLR5, IL-1R1 and the adaptor protein ASC) 1 ' n> 33 .
  • the central component of an inflammasome is a member of the NALP family, and this protein associates with the adaptor protein apoptosis-associated speck-like protein (ASC), which in turn recruits pro-inflammatory-caspase precursors (such as pro-caspase-1) 36 .
  • ASC adaptor protein apoptosis-associated speck-like protein
  • NALP3 which the inventors found in their model of inflammasome activation in liver macrophages, is able to form inflammasomes while mutations in the gene that encodes NALP3 (CIAS1) cause several auto-inflammatory disorders, indicating its physiological relevance 36 .
  • liver macrophage inflammasome genes ASC, IRF-1, IRF-4 IRF-5, TCAM-2, TRL-6, TRAF-6, Myo-D88, Nod-1 and Rel
  • IL- ⁇ , IL-6, IL-10, IL-15, IL-18, IL-23a and CXCL-3 the increased gene expression of direct and indirect cytokine inflammasome byproducts of liver macrophages
  • liver macrophages from mice treated with CC1 4 expressed an inhibited inflammasome transcnptosome when compared to freshly isolated liver macrophages from C/EBPP-wt mice treated with CC1 4 . This included the decreased expression of inflammasome genes (IRF-4,
  • NALP-a NALP-3, TCAM-2, TRL-1, TRL-3, TRL-5, TRL-6, TRL-7, TRL-8, TRL-9, Nod-1 and Rel
  • IL- ⁇ direct and indirect cytokine inflammasome byproducts
  • the C/EBPP-Ala217 mutant functions as a trans-dominant negative of the
  • C/EBPP-Thr217 phosphorylation 21 In contrast, the C/EBPP-Glu217 mutant functions as a trans-dominant positive of the C/EBPP-Thr217 phosphorylation 18 .
  • phosphorylation of C/EBPP-Thr217 in macrophages may stimulate macrophage proliferation/survival as reported for the Anthrax lethal toxin 23 and/or facilitates migration to and direct destruction or phagocytosis of the injured hepatocytes.
  • CC1 4 increased the liver macrophage infiltration by ⁇ 20-fold, while the macrophage stimulating factor TGFa in transgenic mice , which lack hepatocyte injury, did not increase macrophage liver infiltration.
  • Macrophage infiltration is also observed in the livers of animals treated acutely with Fas-L, suggesting that regardless of the mechanisms of liver injury, the stimulation of C/EBPP-Thr217 phosphorylation in macrophages modulates the infiltration of the liver by these cells.
  • the Fas-L experiments are physiologically relevant since significant elevations of soluble Fas-L occur in patients with drug-induced liver injury or alcoholic liver disease 38 ' 39 .
  • Acute FasL administration (acting on TNF superfamily receptors) induced greater macrophage infiltration, and liver injury in the phosphorylation mimic C/EBPP-Glu217 transgenic mice.
  • Mice expressing the C/EBPP-Ala217 transgene were refractory to development of liver injury by Fas-L.
  • Adenosine ⁇ (A 2 A) receptor-ko mice 7 Adenosine is required for sustained inflammasome activation via the A2A receptor and the HIF- ⁇ pathway .
  • both A 2 A adenosine receptors and C/ ⁇ are required for IL-10 production by macrophages exposed to Escherichia coli 40 , suggesting a potential convergence of phosphorylated C/EBPP-Thr217 and the A 2A signaling pathways in activated liver macrophages .
  • TOS Toxic Oil Syndrome
  • the findings presented in this example provide a novel signaling mechanism through 0/ ⁇ - ⁇ 1 ⁇ 217 (human Thr266) for the inflammasome multiprotein complex activation in liver macrophages as a critical step for the development of liver inflammation and injury 1 .
  • Liver inflammation and injury are major contributors to the morbidity and mortality of acute and chronic liver diseases in humans 1 ' 2 ' 3 ' 1 .
  • IL- ⁇ ⁇ receptor antagonists 6 , A 2 A receptor antagonists 7 , and small molecule peptido mimetics, as targeted inhibitors of human 0/ ⁇ - ⁇ 1 ⁇ 266 phosphorylation, in liver macrophages are potential candidates for the prevention and treatment of inflammatory liver injury.
  • EXAMPLE 11 High Efficacy of the Therapeutic PEG-30kDa-peptide in the
  • C/ ⁇ - ⁇ mice received Bleomycin administration as described above. On day-
  • mice received i) PEG-30kDa-Lys-DAla-DVal-Asp- H 2 intraperitoneally (IP) 10 ⁇ g of peptide linked to PEG, on days 10, 17 and 24); or ii) peptide PEG-30kDa-Lys-DAla-DVal-Asp- H 2 by inhalation (mean particle size 1.3 ⁇ - which reaches efficiently the alveoli-, 800 ⁇ g of peptide on days 10, 17 and 24; specific inhalation parameters are shown in Table 2).
  • IP intraperitoneally
  • the peptide was administered for less than 1 hour a day [on days 10, 17, and 21] via nose-only inhalation of the test material aerosol at a nominal concentration of 1.0 mg/L [800 ⁇ g/ dose]; or iii) peptide PEG-30kDa-Lys-DAla-DVal-Asp- H 2 by intratracheal instillation (40 ⁇ g of peptide on days 10, 17 and 24).
  • Control groups received sterile water instead of Bleomycin; peptide IP; peptide by inhalation; or peptide by intratracheal instillation. Animals were sacrificed on day 27. The left lung was inflated with fixative, analyzed by trichrome stain and quantified in its entirety by the Odyssey Visualization microscopy software protocol to minimize analytical errors as described previously (Ramamoorthy et al., 2009, American Journal of Physiology, Endocrinology and Metabolism 297: e392-401). The right lung was snap frozen in liquid nitrogen and used for FMH, immunoblots and qRT-PCR.
  • EXAMPLE 12 Marked increase in the number of Activated Myofibroblasts
  • Kidney biopsies from three patients with kidney fibrosis secondary to glomerulonephritis were analyzed. These biopsies showed extensive glomerular fibrosis with a marked increase in the number of activated myofibroblasts (indicated by the expression of a-SMA) as well as the marked expression of Phospho-C/EBPpThr266 ( human homologue of mouse Phospho-C/EBPpThr217) and inflammation with activated macrophages (indicated by F4/80) (Fig. 28).
  • kidney fibrosis can also be feasible by targeting Phospho- C/EBPp-Thr266 with the PEG-30kDa-peptide of the invention.
  • EXAMPLE 13 The Intermediate Molecule Released from the PEG30kDa- Mpr-peptide in vivo is Pharmacologically Active
  • the following shows the structure of the testing peptide, of which one of the the lead molecules is the Mpr-linked PEG peptide (aka PEG-30kDa-Mpr-peptide).
  • the Mpr-peptide can also be a therapeutic as an additional formulation since it releases the active peptide. Therefore, it could be administered as an alternative formulation for the treatment of various tissue fibrotic diseases.
  • Cyclin/PCNA is the auxiliary protein of DNA polymerase-delta. Nature 326: 515-7, 1987.
  • Buck M and Chojkier M C/EBPB Associates With Caspase 8 Complex Proteins and Modulates Apoptosis in Hepatic Stellate Cells. J Clin Gastroenterol 41 : S295-99, 2007. 10. Buck M. Direct infection and replication of naturally occurring hepatitis C virus genotypes 1, 2, 3, and 4 in normal human hepatocyte cultures. PLOS One 3 : 2660, 2008.
  • LAP a novel member of the C/EBP gene family, encodes a liver-enriched transcriptional activator protein. Genes Dev 4: 1541-51, 1990.
  • Cyclin/PCNA is the auxiliary protein of DNA polymerase-delta. Nature 326: 515-517, 1987.
  • C/EBP beta CCAT -Enhancer-binding protein beta
  • Wilson MS Wilson MS, Elnekave E, Mentink-Kane MM, Hodges MG, Pesce JT, Ramalingam TR, Thompson RW, Kamanaka M, Flavell RA, Keane-Myers A, Cheever AW and Wynn TA.
  • IL- 13Ra2 and IL-10 coordinately suppress airway inflammation, airway -hyperreactivity, and fibrosis in mice. Journal of Clinical Investigation 111: 2941-2951, 2007.
  • NF-IL6 nuclear factor for IL-6 expression
  • Poli, V., Mancini, F.P. & Cortese, R. IL6-DBP a nuclear protein involved in interleukin- 6 signal transduction, defines a new family of leucine zipper proteins related to C/EBP. Cell 63, 643-653 (1990).

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Epidemiology (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Rheumatology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Pain & Pain Management (AREA)
  • Immunology (AREA)
  • Dispersion Chemistry (AREA)
  • Otolaryngology (AREA)
  • Pulmonology (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Medicinal Preparation (AREA)
PCT/US2016/026966 2015-05-12 2016-04-11 Peptide treatment for inflammation and fibrosis Ceased WO2016182660A1 (en)

Priority Applications (9)

Application Number Priority Date Filing Date Title
EP16793126.0A EP3294752B1 (en) 2015-05-12 2016-04-11 Peptide treatment for inflammation and fibrosis
JP2017559043A JP7372026B2 (ja) 2015-05-12 2016-04-11 炎症および線維症のペプチド治療
CN201680024300.0A CN107531752B (zh) 2015-05-12 2016-04-11 用于炎症和纤维化的肽治疗
NZ736840A NZ736840B2 (en) 2016-04-11 Peptide treatment for inflammation and fibrosis
CA2984769A CA2984769C (en) 2015-05-12 2016-04-11 Peptide treatment for inflammation and fibrosis
AU2016260190A AU2016260190A1 (en) 2015-05-12 2016-04-11 Peptide treatment for inflammation and fibrosis
US15/570,910 US10434134B2 (en) 2015-05-12 2016-04-11 Peptide treatment for inflammation and fibrosis
CN202210439797.XA CN114621318A (zh) 2015-05-12 2016-04-11 用于炎症和纤维化的肽治疗
CN202111595612.6A CN114181281A (zh) 2015-05-12 2016-04-11 用于炎症和纤维化的肽治疗

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201562160173P 2015-05-12 2015-05-12
US62/160,173 2015-05-12

Publications (1)

Publication Number Publication Date
WO2016182660A1 true WO2016182660A1 (en) 2016-11-17

Family

ID=57248348

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/026966 Ceased WO2016182660A1 (en) 2015-05-12 2016-04-11 Peptide treatment for inflammation and fibrosis

Country Status (7)

Country Link
US (1) US10434134B2 (https=)
EP (1) EP3294752B1 (https=)
JP (1) JP7372026B2 (https=)
CN (3) CN114181281A (https=)
AU (1) AU2016260190A1 (https=)
CA (1) CA2984769C (https=)
WO (1) WO2016182660A1 (https=)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018126009A1 (en) * 2016-12-29 2018-07-05 University Of Miami Method for modulating inflammasome activity and inflammation in the lung
CN111770539A (zh) * 2019-04-02 2020-10-13 电信科学技术研究院有限公司 一种lmf选择方法、终端定位服务方法及装置
US11840565B2 (en) 2016-12-29 2023-12-12 University Of Miami Methods and compositions for treating virus-associated inflammation
US12139518B2 (en) 2018-10-25 2024-11-12 Nexel Co., Ltd. Compositions and methods for treating or preventing fibrosis
US12570735B2 (en) 2018-07-03 2026-03-10 University Of Miami Compositions and methods for treating inflammasome related diseases or conditions

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2016260190A1 (en) * 2015-05-12 2017-11-23 The Regents Of The University Of California Peptide treatment for inflammation and fibrosis
WO2021101966A1 (en) * 2019-11-18 2021-05-27 The Board Of Trustees Of The Leland Stanford Junior University Treatment of fibrosis with combined blockade of il-6 and immune checkpoint
CN114134191B (zh) * 2020-09-04 2023-12-12 琛蓝(美国)营养制品股份有限公司 一种抗炎护肾的蛤蜊肽的制备方法和应用
CN112960780B (zh) * 2021-03-03 2023-02-03 龙江环保集团股份有限公司 一种生物膜载体的预处理方法及生物法污水处理工艺
DE102022203153A1 (de) 2022-03-31 2023-10-05 Psa Automobiles Sa Stauraumanordnung für einen Innenraum eines Fahrzeugs, Fahrzeug mit der Stauraumanordnung und Verfahren zur Benutzung einer Stauraumanordnung
KR102772405B1 (ko) * 2022-06-10 2025-02-26 (주)케어젠 근육 손실 저해 및 근육량 증진 활성을 갖는 펩타이드 및 이의 용도
CN115850440B (zh) * 2022-12-09 2023-07-11 中国人民解放军陆军军医大学 一种长链MyD88诱饵肽及其作为药物的用途

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100035825A1 (en) * 2000-10-27 2010-02-11 Mario Chojkier Treatment Of Disease By Inducing Cell Apoptosis

Family Cites Families (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7402567B2 (en) * 2000-10-27 2008-07-22 The Regents Of The University Of California Treatment of disease by inducing cell apoptosis
WO2002054938A2 (en) * 2000-10-27 2002-07-18 The Regents Of The University Of California Treatment of disease by inducing cell apoptosis
CN1678336A (zh) * 2002-02-21 2005-10-05 加州大学校务委员会 用细胞凋亡诱导方法治疗疾病
US7119071B2 (en) * 2002-05-21 2006-10-10 University Of Medicine And Dentistry Of New Jersey Amino terminal substance P compositions and methods for using the same
MX2007013430A (es) * 2005-04-29 2008-03-19 Univ California Peptidos y peptidos mimeticos para tratar patologias caracterizadas por una respuesta inflamatoria.
CN101227918A (zh) * 2005-04-29 2008-07-23 加州大学评议会 治疗以炎症反应为特征的病理的肽和肽模拟物
US8865657B2 (en) * 2005-08-19 2014-10-21 New York University Compositions and methods for inactivating or suppressing inflammatory cells
EP2324048A2 (en) * 2008-07-30 2011-05-25 Cosmix Therapeutics Llc Peptide therapeutics that bind vegf and methods of use thereof
HK1198333A1 (zh) * 2011-07-19 2015-04-02 Thrasos Innovation, Inc. 抗纤维化肽及其在用於治疗以纤维化为特徵的疾病和病症的方法中的用途
CA2864100A1 (en) * 2012-02-14 2013-08-22 The Regents Of The University Of California Systemic delivery and regulated expression of paracrine genes for cardiovascular diseases and other conditions
AU2016260190A1 (en) * 2015-05-12 2017-11-23 The Regents Of The University Of California Peptide treatment for inflammation and fibrosis

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100035825A1 (en) * 2000-10-27 2010-02-11 Mario Chojkier Treatment Of Disease By Inducing Cell Apoptosis

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
BUCK ET AL.: "C/EBPbeta-Thr217 phosphorylation signaling contributes to the development of lung injury and fibrosis in mice.", PLOS ONE, vol. 6, no. 10, 5 October 2011 (2011-10-05), pages e25497 1 - 18., XP055328632 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018126009A1 (en) * 2016-12-29 2018-07-05 University Of Miami Method for modulating inflammasome activity and inflammation in the lung
US11840565B2 (en) 2016-12-29 2023-12-12 University Of Miami Methods and compositions for treating virus-associated inflammation
US12570735B2 (en) 2018-07-03 2026-03-10 University Of Miami Compositions and methods for treating inflammasome related diseases or conditions
US12139518B2 (en) 2018-10-25 2024-11-12 Nexel Co., Ltd. Compositions and methods for treating or preventing fibrosis
CN111770539A (zh) * 2019-04-02 2020-10-13 电信科学技术研究院有限公司 一种lmf选择方法、终端定位服务方法及装置
US12004117B2 (en) 2019-04-02 2024-06-04 Datang Mobile Communications Equipment Co., Ltd. LMF selection method and terminal location service method and device

Also Published As

Publication number Publication date
CN114621318A (zh) 2022-06-14
CA2984769C (en) 2023-03-21
JP2018520999A (ja) 2018-08-02
CN107531752A (zh) 2018-01-02
US20180125919A1 (en) 2018-05-10
CA2984769A1 (en) 2016-11-17
EP3294752B1 (en) 2020-11-04
NZ736840A (en) 2024-05-31
JP7372026B2 (ja) 2023-10-31
AU2016260190A1 (en) 2017-11-23
EP3294752A1 (en) 2018-03-21
US10434134B2 (en) 2019-10-08
CN107531752B (zh) 2022-05-10
EP3294752A4 (en) 2018-12-19
CN114181281A (zh) 2022-03-15

Similar Documents

Publication Publication Date Title
CA2984769C (en) Peptide treatment for inflammation and fibrosis
JP6676589B2 (ja) 薬物動態特性の改善されたコンプスタチンアナログ
KR101242795B1 (ko) 글루카곤 유사 펩티드-2(glp-2) 유사체
CN104147591B (zh) Jnk信号转导通路的细胞可渗透性肽抑制剂用于治疗各种疾病的应用
JP2017186374A (ja) グルカゴン様ペプチド−2組成物およびその作製法および使用法
MX2014007799A (es) Peptidos y metodos para usarlos.
JP7778301B2 (ja) Regnase-1が関与する疾患の治療および/または予防方法
US20070042962A1 (en) Peptide dependent upregulation of telomerase expression
ES2900106T3 (es) Nuevos péptidos y nueva combinación de péptidos para el uso en la inmunoterapia contra el carcinoma hepatocelular (CHC) y otros tipos de cáncer
HK40076050A (en) Peptide treatment for inflammation and fibrosis
US9050374B2 (en) Inhibitors against endosomal/lysosomal enzymes
KR102510514B1 (ko) 세포 살상제
TW202233650A (zh) Masp抑制性化合物及其用途
US20240002441A1 (en) Peptides and uses thereof in modulation of amyloid-beta protein degrading proteases
US8367801B2 (en) Proteinaceous compounds
Akhter Isolation of VGF derived neuropeptide receptor
EP4013442A1 (en) Treatment
WO2020000061A1 (en) Renal treatment
BR112022013957B1 (pt) Inibidor peptídico do receptor de interleucina-23, composição farmacêutica, e uso dos mesmos

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16793126

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 15570910

Country of ref document: US

ENP Entry into the national phase

Ref document number: 2984769

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2017559043

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2016260190

Country of ref document: AU

Date of ref document: 20160411

Kind code of ref document: A