WO2016173540A1 - Herbicide-tolerant maize plant dbn9888, and nucleotide sequence and method for detecting same - Google Patents

Abstract

Provided are a nucleotide sequence for detecting a maize event DBN9888 existing in a biological sample and a detecting method therefor.

Description

Herbicide-tolerant maize plant DBN9888 and nucleic acid sequence and method for detecting same

This application claims priority to Chinese Patent Application No. 201510219905.2, entitled "Nucleic Acid Sequence for Detection of Herbicide Tolerant Maize Plant DBN9888 and Its Detection Method", filed on April 30, 2015, Chinese Patent Application No. 201510219905.2 The entire content of which is incorporated herein by reference.

Technical field

The present invention relates to a nucleic acid sequence for detecting a herbicide-tolerant corn plant DBN9888 and a method for detecting the same, in particular to a glyphosate-tolerant and glufosinate-tolerant corn plant DBN9888 and a test biological sample comprising specific Method of DNA molecule of transgenic maize event DBN9888.

Background technique

N-phosphonomethylglycine, also known as glyphosate, is a systemic, chronic broad-spectrum herbicide. Glyphosate is a competitive inhibitor of phosphoenolpyruvate (PEP), a synthetic substrate for 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), which inhibits PEP and 3-phosphonic acid Conversion of the two substrates to 5-enolpyruvylshikimate-3-phosphoshikimic acid under EPSPS catalysis, thereby blocking the synthesis of the aromatic amino acid synthesis precursor-shikimate, causing the protein synthesis to interfere with the plant And the death of bacteria.

Glyphosate tolerance can be achieved by expression of a modified EPSPS. The modified EPSPS has a lower affinity for glyphosate, and thus in the presence of glyphosate, EPSPS retains their catalytic activity, i.e., glyphosate tolerance is obtained.

Maize (Zea mays L.) is a major food crop in many parts of the world. Herbicide tolerance in corn production is an important agronomic trait, especially for glyphosate herbicides. The tolerance of maize to glyphosate herbicides can be obtained by transgenic methods to express glyphosate herbicide tolerance gene (EPSPS, CP4) in maize plants, such as maize event NK603, maize event MON88017 and the like.

The widespread adoption of glyphosate-tolerant tillage systems and the increasing use of glyphosate have led to the prevalence of glyphosate-resistant weeds in recent years. In the face of growers facing glyphosate resistant weeds or more difficult to control In areas where weed species are transformed, growers can compensate for the weakness of glyphosate by mixing or alternating with other herbicides that can control missing weeds.

Glufosinate is a non-systemic, non-selective herbicide in phosphinothricin herbicides. Mainly used for post-emergence control of annual or perennial broad-leaved weeds, by L-phosphinothricin (the active ingredient in glufosinate) against glutamine synthase (an enzyme essential for ammonia detoxification in plants) ) irreversible inhibition to control weeds. Unlike glyphosate root killing, glufosinate first kills leaves and can be transported in the xylem of plants through plant transpiration, with a quick-acting effect between paraquat and glyphosate.

The enzyme phosphinothricin N-acetyltransferase (PAT) isolated from Streptomyces catalyzes the conversion of L-phosphinothricin to its inactive form by acetylation. A plant-optimized form of the gene expressing PAT has been used in soybeans to confer tolerance to glufosinate herbicides, such as soybean event A5547-127. Therefore, the use of glufosinate herbicides in combination with glufosinate tolerance traits can be a non-selective means of effectively managing glyphosate-resistant weeds.

At the same time, with the large-scale cultivation of transgenic insect-resistant corn, a small number of surviving insects/pests may develop resistance after several generations of reproduction. Herbicide-tolerant transgenic corn is grown as a non-anti-insect transgenic corn in a certain ratio with transgenic insect-resistant corn, which can delay insect/pest resistance.

It is known that the expression of foreign genes in plants is influenced by their chromosomal location, possibly due to the proximity of the chromatin structure (such as heterochromatin) or transcriptional regulatory elements (such as enhancers) to the integration site. To this end, it is often necessary to screen a large number of events to identify events that can be commercialized (ie, events in which the introduced target gene is optimally expressed). For example, it has been observed in plants and other organisms that the amount of expression of the introduced gene may vary greatly from event to event; there may also be differences in spatial or temporal patterns of expression, such as relative expression of transgenes between different plant tissues. There is a difference in that the actual expression pattern may be inconsistent with the expression pattern expected from the transcriptional regulatory elements in the introduced gene construct. Therefore, it is often necessary to generate hundreds and thousands of different events and to screen out from these events a single event with the expected expression and expression pattern of the transgene for commercial purposes. Events with expected transgene expression levels and expression patterns can be used to infiltrate transgenes into other genetic backgrounds by sexual heterotypic hybridization using conventional breeding methods. The progeny produced by this hybridization maintain the transgene expression characteristics of the original transformants. The application of this strategy model ensures reliable gene expression in many varieties, and these varieties are well adapted to local growth conditions.

Being able to detect the presence of a particular event to determine whether a progeny of sexual crosses contains the gene of interest will be benefit. In addition, methods for detecting specific events will also help to comply with regulations, such as foods derived from recombinant crops that require formal approval and labeling prior to being placed on the market. It is possible to detect the presence of a transgene by any well-known polynucleotide detection method, such as polymerase chain reaction (PCR) or DNA hybridization using a polynucleotide probe. These assays typically focus on commonly used genetic elements such as promoters, terminators, marker genes, and the like. Therefore, unless the sequence of the chromosomal DNA ("flanking DNA") adjacent to the inserted transgenic DNA is known, the above method cannot be used to distinguish different events, especially those produced using the same DNA construct. event. Therefore, transgene-specific events are currently identified by PCR using a pair of primers spanning the junction of the inserted transgene and flanking DNA, specifically a first primer comprising a flanking sequence and a second primer comprising an inserted sequence.

Summary of the invention

The object of the present invention is to provide a nucleic acid sequence for detecting herbicide-tolerant corn plant DBN9888 and a detection method thereof, and the transgenic corn event DBN9888 has good tolerance to glyphosate herbicide and glufosinate herbicide. And the detection method can accurately and quickly identify whether the biological sample contains the DNA molecule of the specific transgenic corn event DBN9888.

To achieve the above object, the present invention provides a nucleic acid sequence comprising at least 11 contiguous nucleotides of SEQ ID NO: 3 or its complement, and/or at least 11 of SEQ ID NO: 4 or its complement Continuous nucleotides.

Preferably, the nucleic acid sequence comprises SEQ ID NO: 1 or its complement, and/or SEQ ID NO: 2 or its complement.

Further, the nucleic acid sequence comprises SEQ ID NO: 3 or its complement, and/or SEQ ID NO: 4 or its complement.

Further, the nucleic acid sequence comprises SEQ ID NO: 5 or its complement.

The SEQ ID NO: 1 or its complement is a 22 nucleotide sequence in the transgenic maize event DBN9888 located at the 5' end of the inserted sequence near the insertion junction, SEQ ID NO: 1 or The complementary sequence spans the flanking genomic DNA sequence of the maize insertion site and the DNA sequence at the 5' end of the inserted sequence, and the SEQ ID NO: 1 or its complement can be identified as the presence of the transgenic maize event DBN9888. The SEQ ID NO: 2 or its complement is a transgene Gene maize event DBN9888 is a 22-nucleotide sequence located near the insertion junction at the 3' end of the inserted sequence, the SEQ ID NO: 2 or its complement spanning the DNA of the 3' end of the inserted sequence The flanking genomic DNA sequence of the sequence and the maize insertion site, comprising the SEQ ID NO: 2 or its complement, can be identified as the presence of the transgenic maize event DBN9888.

In the present invention, the nucleic acid sequence may be at least 11 or more contiguous polynucleotides (first nucleic acid sequence) of any part of the transgene insertion sequence of SEQ ID NO: 3 or its complement, or At least 11 or more contiguous polynucleotides (second nucleic acid sequence) of any portion of the 5' flanking maize genomic DNA region of SEQ ID NO: 3 or its complement. The nucleic acid sequence may further be homologous or complementary to a portion of the SEQ ID NO: 3 comprising the entire SEQ ID NO: 1. When the first nucleic acid sequence is used together with the second nucleic acid sequence, these nucleic acid sequences can be used as a DNA primer pair in a DNA amplification method for producing an amplification product. When the amplification product produced in the DNA amplification method using the DNA primer pair is an amplification product comprising SEQ ID NO: 1, the presence of the transgenic maize event DBN9888 or its progeny can be diagnosed. As is well known to those skilled in the art, the first and second nucleic acid sequences need not be composed solely of DNA, but may also comprise a mixture of RNA, DNA and RNA, or DNA, RNA or other nucleosides that are not templated as one or more polymerases. A combination of an acid or an analog thereof. Furthermore, the probe or primer of the present invention should be at least about 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 contiguous nucleotides, which may be selected from Nucleotides as set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5. When selected from the nucleotides set forth in SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5, the probe and primer may be continuous from at least about 21 to about 50 or more in length. Nucleotide. The SEQ ID NO: 3 or its complement is a 960 nucleotide sequence in the transgenic maize event DBN9888 located at the 5' end of the inserted sequence near the insertion junction, SEQ ID NO: 3 or The complementary sequence consists of a 693 nucleotide maize flanking genomic DNA sequence (nucleotides 1-693 of SEQ ID NO: 3), a 77 nucleotide DBN10006 construct DNA sequence (nucleotide of SEQ ID NO: 3) 694-770) and a 190 nucleotide pr35S promoter sequence 5' end DNA sequence (nucleotides 771-960 of SEQ ID NO: 3), comprising the SEQ ID NO: 3 or its complementary sequence Identification of the presence of the transgenic maize event DBN9888.

The nucleic acid sequence may be at least 11 or more contiguous polynucleotides (third nucleic acid sequence) of any portion of the transgene insertion sequence of SEQ ID NO: 4 or its complement, or At least 11 or more contiguous polynucleotides (fourth nucleic acid sequence) of any portion of the 3' flanking maize genomic DNA region of SEQ ID NO: 4 or its complement. The nucleic acid sequence may further be homologous or complementary to a portion of the SEQ ID NO: 4 comprising the entire SEQ ID NO: 2. When the third nucleic acid sequence is used together with the fourth nucleic acid sequence, these nucleic acid sequences can be used as a DNA primer pair in a DNA amplification method for producing an amplification product. When the amplification product produced in the DNA amplification method using the DNA primer pair is an amplification product comprising SEQ ID NO: 2, the presence of the transgenic maize event DBN9888 or its progeny can be diagnosed. The SEQ ID NO: 4 or its complement is a 753 nucleotide sequence in the transgenic maize event DBN9888 located at the 3' end of the inserted sequence near the insertion junction, SEQ ID NO: 4 or The complementary sequence consists of a 159 nucleotide tNos terminator sequence (nucleotides 1-159 of SEQ ID NO: 4), a 113 nucleotide DBN10006 construct DNA sequence (nucleotide 160 of SEQ ID NO: 4) -272) consisting of a 481 nucleotide maize integration site flanking genomic DNA sequence (273-753 of SEQ ID NO: 4) comprising the SEQ ID NO: 4 or its complement which can be identified as a transgenic maize event The existence of DBN9888.

The SEQ ID NO: 5 or its complement is a sequence of 5952 nucleotides in length that characterizes the transgenic maize event DBN9888, and the genomic and genetic elements specifically included are shown in Table 1. The presence of the SEQ ID NO: 5 or its complement can be identified as the presence of the transgenic maize event DBN9888.

Table 1, genomic and genetic elements contained in SEQ ID NO: 5

The nucleic acid sequence or its complement may be used in a DNA amplification method to generate an amplicon that detects the presence of a transgenic maize event DBN9888 or a progeny thereof in a biological sample; the nucleic acid sequence or its complement It can be used in nucleotide assays to detect the presence of the transgenic maize event DBN9888 or its progeny in a biological sample.

To achieve the above object, the present invention also provides a method for detecting the presence of DNA in a transgenic maize event DBN9888 in a sample, comprising:

Contacting the sample to be detected with at least two primers in a nucleic acid amplification reaction;

Performing a nucleic acid amplification reaction;

Detecting the presence of amplification products;

The amplification product comprises at least 11 contiguous nucleotides of SEQ ID NO: 3 or its complement, or at least 11 contiguous nucleotides of SEQ ID NO: 4 or its complement.

Further, the amplification product comprises contiguous nucleotides 1 to 11 or 12 to 22 in SEQ ID NO: 1 or its complement, or 1 to 11 in SEQ ID NO: 2 or its complement Bit or contiguous nucleotides from positions 12-22.

Further, the amplification product comprises SEQ ID NO: 1 or its complement, SEQ ID NO: 2 or its complement, SEQ ID NO: 6 or its complement, or SEQ ID NO: 7 or its complement .

In the above technical solution, the primer comprises at least one of the nucleic acid sequences.

Specifically, the primer comprises a first primer selected from the group consisting of SEQ ID NO: 8 and SEQ ID NO: 10; and a second primer selected from the group consisting of SEQ ID NO: 9 and SEQ ID NO: :11.

To achieve the above object, the present invention also provides a method for detecting the presence of DNA in a transgenic maize event DBN9888 in a sample, comprising:

The sample to be detected is contacted with a probe comprising at least 11 contiguous nucleotides of SEQ ID NO: 3 or its complement, or at least 11 contiguous nucleuses of SEQ ID NO: 4 or its complement Glucoside

The sample to be detected and the probe are hybridized under stringent hybridization conditions;

The hybridization of the sample to be detected and the probe is detected.

The stringent conditions can be 6 x SSC (sodium citrate), 0.5% SDS (sodium lauryl sulfate) In the solution, hybridization was carried out at 65 ° C, and then the membrane was washed once with 2 x SSC, 0.1% SDS and 1 x SSC, 0.1% SDS.

Further, the probe comprises contiguous nucleotides 1 to 11 or 12 to 22 in SEQ ID NO: 1 or its complement, or 1 to 11 in SEQ ID NO: 2 or its complement Or consecutive nucleotides 12-22.

Further, the probe has SEQ ID NO: 1 or its complement, SEQ ID NO: 2 or its complement, SEQ ID NO: 6 or its complement, or SEQ ID NO: 7 or its complement.

Optionally, at least one of the probes is labeled with at least one fluorophore.

To achieve the above object, the present invention also provides a method for detecting the presence of DNA in a transgenic maize event DBN9888 in a sample, comprising:

The sample to be detected is contacted with a marker nucleic acid molecule comprising at least 11 contiguous nucleotides of SEQ ID NO: 3 or its complement, or at least 11 of SEQ ID NO: 4 or its complement Contiguous nucleotides;

The sample to be detected and the marker nucleic acid molecule are hybridized under stringent hybridization conditions;

Detecting the hybridization of the sample to be detected and the marker nucleic acid molecule, and further assisting in breeding analysis by marker-assisted breeding to determine glyphosate tolerance and/or glufosinate tolerance with the marker nucleic acid molecule genetically It is chained.

Further, the marker nucleic acid molecule comprises SEQ ID NO: 1 or its complementary sequence at positions 1-11 or 12-22 contiguous nucleotide, or SEQ ID NO: 2 or its complement 1 - 11th or 12th to 22nd consecutive nucleotides.

Further, the marker nucleic acid molecule has SEQ ID NO: 1 or its complement, SEQ ID NO: 2 or its complement, SEQ ID NO: 6 or its complement, or SEQ ID NO: 7 or its complement sequence.

To achieve the above object, the present invention also provides a DNA detection kit comprising at least one DNA molecule comprising at least 11 contiguous nucleotides of the homologous sequence of SEQ ID NO: 3 or a complement thereof Or at least 11 contiguous nucleotides of the homologous sequence of SEQ ID NO: 4 or its complement, which can serve as a DNA primer or probe specific for the transgenic maize event DBN9888 or a progeny thereof.

Further, the DNA molecule comprises SEQ ID NO: 1 or the 1st to 11th of its complement Or a contiguous nucleotide at positions 12-22, or a contiguous nucleotide at positions 1-11 or 12-22 in SEQ ID NO: 2 or its complement.

Further, the DNA molecule has the homologous sequence of SEQ ID NO: 1 or its complement, the homologous sequence of SEQ ID NO: 2 or its complement, the homologous sequence of SEQ ID NO: 6, or its complement Or the homologous sequence of SEQ ID NO: 7 or its complement.

To achieve the above object, the present invention also provides a plant cell comprising a nucleic acid sequence encoding a glyphosate-tolerant EPSPS protein, a nucleic acid sequence encoding a glufosinate-resistant PAT protein, and a nucleic acid sequence of a specific region, The nucleic acid sequence of a particular region includes the sequence set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, or SEQ ID NO: 7.

In order to achieve the above object, the present invention also provides a method for producing a maize plant which is tolerant to a glyphosate herbicide, comprising introducing a nucleic acid encoding a glyphosate-tolerant EPSPS protein into the genome of the corn plant. a sequence and a nucleic acid sequence of a specific region, wherein the nucleic acid sequence of the specific region is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO : 6 and at least one nucleic acid sequence of the sequence of SEQ ID NO: 7.

Specifically, the method of producing a corn plant that is tolerant to a glyphosate herbicide comprises:

The first parental maize plant of the transgenic maize event DBN9888 resistant to glyphosate herbicide is sexually crossed with the second parental maize plant lacking glyphosate tolerance, thereby producing a large number of progeny plants;

Treating the progeny plants with a glyphosate herbicide;

The progeny plants that are tolerant to glyphosate are selected.

In order to achieve the above object, the present invention also provides a method for producing a maize plant which is tolerant to a glufosinate herbicide, comprising introducing a nucleic acid encoding a glufosinate-tolerant PAT protein into the genome of the corn plant. a sequence and a nucleic acid sequence of a specific region, wherein the nucleic acid sequence of the specific region is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO : 6 and at least one nucleic acid sequence of the sequence of SEQ ID NO: 7.

Specifically, the method of producing a corn plant that is tolerant to glufosinate herbicides comprises:

The first parental maize plant of the transgenic maize event DBN9888 resistant to glufosinate herbicide was sexually crossed with the second parental maize plant lacking glufosinate tolerance, thereby producing a large number of progeny plants;

Treating the progeny plants with a glufosinate herbicide;

The progeny plants that are tolerant to glyphosate are selected.

In order to achieve the above object, the present invention also provides a method for producing a maize plant which is tolerant to a glyphosate herbicide and a glufosinate herbicide, comprising introducing a glyphosate-resistant gene into the genome of the corn plant. a nucleic acid sequence encoding a glufosinate-resistant PAT protein, a nucleic acid sequence encoding a glufosinate-resistant PAT protein, and a nucleic acid sequence of a specific region selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, at least one of the sequences of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7.

Specifically, the method of producing a corn plant that is tolerant to a glyphosate herbicide and a glufosinate herbicide comprises:

Transgenic maize event DBN9888 first parent maize plant tolerant to glyphosate herbicide and glufosinate herbicide was sexually crossed with a second parental maize plant lacking glyphosate and/or glufosinate tolerance , thereby producing a large number of progeny plants;

Treating the progeny plants with a glyphosate herbicide and a glufosinate herbicide;

The progeny plants that are tolerant to glyphosate and glufosinate are selected.

To achieve the above object, the present invention also provides a method of cultivating a corn plant which is tolerant to a glyphosate herbicide, comprising:

Planting at least one corn seed comprising a nucleic acid sequence encoding a glyphosate-tolerant EPSPS and a nucleic acid sequence of a specific region in the genome of the corn seed;

Growing the corn seed into a corn plant;

Spraying the corn plant with an effective amount of a glyphosate herbicide to harvest plants having reduced plant damage compared to other plants having no nucleic acid sequence of a particular region;

The nucleic acid sequence of the specific region is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7. At least one nucleic acid sequence in the sequence shown.

To achieve the above object, the present invention also provides a method of cultivating a corn plant which is tolerant to glufosinate herbicide, comprising:

Planting at least one corn seed, the genome of the corn seed comprising a nucleic acid sequence encoding a glufosinate-tolerant PAT protein and a nucleic acid sequence of a specific region;

Growing the corn seed into a corn plant;

Spraying the corn plant with an effective amount of glufosinate herbicide to harvest plants having reduced plant damage compared to other plants having no nucleic acid sequence of a particular region;

The nucleic acid sequence of the specific region is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7. At least one nucleic acid sequence in the sequence shown.

To achieve the above object, the present invention also provides a method of cultivating a corn plant which is tolerant to a glyphosate herbicide and a glufosinate herbicide, comprising:

Planting at least one corn seed, the genome of the corn seed comprising a nucleic acid sequence encoding a glyphosate-tolerant EPSPS protein, a nucleic acid sequence encoding a glufosinate-tolerant PAT protein, and a nucleic acid sequence of a specific region;

Growing the corn seed into a corn plant;

Spraying the corn plant with an effective amount of a glyphosate herbicide and a glufosinate herbicide to harvest plants having reduced plant damage compared to other plants having no nucleic acid sequence of a particular region;

The nucleic acid sequence of the specific region is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7. At least one nucleic acid sequence in the sequence shown.

To achieve the above object, the present invention also provides a method of protecting a plant from damage caused by a herbicide, comprising applying a herbicide containing an effective amount of glyphosate and/or glufosinate to at least one transgenic corn. In the field of the plant, the transgenic maize plant comprises in its genome a cell selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO : 6 and at least one nucleic acid sequence of the sequence of SEQ ID NO: 7, the transgenic maize plant having tolerance to a glyphosate herbicide and/or a glufosinate herbicide.

To achieve the above object, the present invention also provides a method of controlling field weeds comprising applying a herbicide containing an effective amount of glyphosate and/or glufosinate to a field in which at least one transgenic corn plant is planted. The transgenic maize plant comprises in its genome a cell selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO : at least one nucleic acid sequence in the sequence of 7 which has tolerance to glyphosate herbicides and/or glufosinate herbicides.

In order to achieve the above object, the present invention also provides a method for controlling glyphosate-resistant weeds in a field of glyphosate-tolerant plants, comprising applying a herbicide containing an effective dose of glufosinate to at least one planting In the field of glyphosate-tolerant transgenic maize plants, the glyphosate-tolerant transgenic maize plant comprises in its genome a SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 At least one of the sequences of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7, the glyphosate-tolerant transgenic maize plant having both grasses Tolerance of ammonium phosphine herbicides.

In order to achieve the above object, the present invention also provides a method for delaying insect resistance, comprising planting at least one transgenic corn plant having glyphosate and/or glufosinate tolerance in a field planted with a pest-resistant corn plant. The glyphosate-tolerant transgenic maize plant comprises in its genome a cell selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: At least one nucleic acid sequence of the sequences set forth in SEQ ID NO: 6 and SEQ ID NO: 7.

To achieve the above object, the present invention also provides an agricultural product or commodity comprising the polynucleotide of SEQ ID NO: 1 or SEQ ID NO: 2, which is corn flour, corn flour, corn oil, corn starch, Corn gluten, tortillas, cosmetics or fillers.

In the nucleic acid sequences of the present invention for detecting herbicide-tolerant corn plants and methods for detecting the same, the following definitions and methods can better define the present invention and guide those skilled in the art to carry out the invention, unless otherwise stated, The terminology is used in the ordinary usage of one of ordinary skill in the art.

The term "corn" refers to Zea mays and includes all plant species that can be mated with corn, including wild corn species.

The terms "including" and "including" mean "including but not limited to".

The term "plant" includes whole plants, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant callus, plant clumps, and intact plants in plants or plant parts. Cells, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, stems, roots, root tips, anthers, and the like. It is to be understood that parts of the transgenic plants within the scope of the invention include, but are not limited to, plant cells, protoplasts, tissues, callus, embryos, and flowers, stems, fruits, leaves and roots, the above plant parts being derived from the prior invention using the invention. A transgenic plant or a progeny thereof transformed with a DNA molecule and thus at least partially composed of transgenic cells.

The term "gene" refers to a nucleic acid fragment that expresses a particular protein, including regulatory sequences preceding the coding sequence. (5' non-coding sequence) and regulatory sequence following the coding sequence (3' non-coding sequence). "Native gene" refers to a gene that is naturally found to have its own regulatory sequences. "Chimeric gene" refers to any gene that is not a native gene that contains regulatory and coding sequences that are not found in nature. "Endogenous gene" refers to a native gene that is located in its natural location in the genome of an organism. A "foreign gene" is a foreign gene that is present in the genome of an organism and does not originally exist, and also refers to a gene that is introduced into a recipient cell by a transgenic step. The foreign gene may comprise a native gene or a chimeric gene inserted into the non-native organism. A "transgene" is a gene that has been introduced into the genome by a transformation program. The site in which the recombinant DNA has been inserted in the plant genome may be referred to as an "insertion site" or a "target site."

"Flanking DNA" may comprise a genome naturally present in an organism such as a plant or an exogenous (heterologous) DNA introduced by a transformation process, such as a fragment associated with a transformation event. Thus, flanking DNA can include a combination of natural and exogenous DNA. In the present invention, "flanking region" or "flanking sequence" or "genome boundary region" or "genome boundary sequence" means at least 3, 5, 10, 11, 15, 20, 50, 100, 200, 300, 400 A sequence of 1000, 1500, 2000, 2500 or 5000 base pairs or longer located directly upstream or downstream of the original exogenous insert DNA molecule and adjacent to the original exogenously inserted DNA molecule. When the flanking region is located downstream, it may also be referred to as "left border flanking" or "3' flanking" or "3' genomic border region" or "genome 3' border sequence" and the like. When the flanking region is located upstream, it may also be referred to as "right border flanking" or "5' flanking" or "5' genomic border region" or "genome 5' border sequence" and the like.

A transformation program that causes random integration of foreign DNA results in transformants containing different flanking regions that are specifically contained by each transformant. When recombinant DNA is introduced into a plant by conventional hybridization, its flanking regions generally do not change. Transformants also contain unique junctions between heterologous insert DNA and segments of genomic DNA or between two segments of genomic DNA or between two heterologous DNAs. "Joining" is the point at which two specific DNA fragments are joined. For example, the junction is present at a position where the insert DNA joins the flanking DNA. The junction is also present in the transformed organism, where the two DNA fragments are joined together in a manner modified from that found in the native organism. "Joining DNA" and "joining region" refer to DNA containing a junction.

The present invention provides a transgenic maize event called DBN9888 and its progeny, which is a maize plant DBN9888 comprising plants and seeds of the transgenic maize event DBN9888 and plant cells thereof or a regenerable portion thereof, said transgene Corn Event DBN9888 Plant parts, including but not limited to cells, pollen, ovules, flowers, buds, roots, stems, silks, inflorescences, ear tips, leaves and products from corn plant DBN9888, such as corn flour, cornmeal, corn oil, corn syrup , corn silk, corn starch and biomass left in the corn crop field.

The transgenic maize event DBN9888 of the present invention comprises a DNA construct which, when expressed in plant cells, is rendered tolerant to glyphosate herbicides and glufosinate herbicides. The DNA construct comprises two tandem expression cassettes, the first expression cassette comprising a suitable promoter for expression in a plant and a suitable polyadenylation signal sequence, the promoter being operably linked to the coding A gene for 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) which is tolerant to glyphosate herbicides. A second expression cassette comprises a suitable promoter for expression in a plant and a suitable polyadenylation signal sequence operably linked to a phosphinothricin N-acetyltransferase (PAT) The gene, the nucleic acid sequence of the PAT protein is tolerant to glufosinate herbicides. Further, the promoter may be a suitable promoter isolated from a plant, including constitutive, inducible and/or tissue-specific promoters including, but not limited to, cauliflower mosaic virus (CaMV) 35S Promoter, Scrophularia mosaic virus (FMV) 35S promoter, Tsf1 promoter, Ubiquitin promoter, actin promoter, Agrobacterium tumefaciens nopaline synthase (NOS) Promoter, octopine synthase (OCS) promoter, Cestrum yellow leaf curling virus promoter, potato tuber storage protein (Patatin) promoter, ribulose-1,5-bisphosphate carboxylase /Oxygenase (RuBisCO) promoter, glutathione S-transferase (GST) promoter, E9 promoter, GOS promoter, alcA/alcR promoter, Agrobacterium rhizogenes RolD promoter and pseudo-South Arabidopsis Suc2 promoter. The polyadenylation signal sequence may be a suitable polyadenylation signal sequence that functions in plants, including, but not limited to, from Agrobacterium tumefaciens. Polyadenylation signal sequence of nopaline synthase (NOS) gene, derived from cauliflower mosaic virus (CaMV) 35S terminator, derived from pea ribulose-1,5-bisphosphate carboxylase/oxygenase The E9 terminator, a polyadenylation signal sequence derived from the protease inhibitor II (PIN II) gene, and a polyadenylation signal sequence derived from the α-tubulin gene.

Furthermore, the expression cassette may also include other genetic elements including, but not limited to, enhancers and signal peptides/transport peptides. The enhancer can enhance the expression level of the gene, and the increase Hadron includes, but is not limited to, Tobacco Etch Virus (TEV) Translational Activating Factor, CaMV35S Enhancer, and FMV35S Enhancer. The signal peptide/transport peptide can direct the transport of EPSPS proteins and/or PAT proteins to extracellular or specific organelles or compartments within the cell, for example, by targeting chloroplasts encoding chloroplast transit peptide sequences, or by using 'KDEL' retention sequence targets To the endoplasmic network.

The 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene may be isolated from Agrobacterium tumefaciens sp. CP4 strain and may be optimized by codon or otherwise Polynucleotides encoding EPSPS for the purpose of increasing the stability and availability of transcripts in transformed cells. The 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene can also be used as a selectable marker gene.

The "glyphosate" refers to N-phosphonomethylglycine and its salts, and treatment with "glyphosate herbicide" means treatment with any herbicide preparation containing glyphosate. The choice of the use rate of a certain glyphosate formulation in order to achieve an effective biological dose does not exceed the skill of a general agronomic technician. Treatment of plants containing plant material derived from herbicide-tolerant corn plant DBN9888 using any of the glyphosate-containing herbicide formulations will control weed growth in the field without affecting herbicide tolerance Growth or yield of plant material for corn plant DBN9888.

The phosphinothricin N-acetyltransferase (PAT) gene isolated from Streptomyces viridochromogenes is converted to its inactive form by acetylation to catalyze the conversion of L-phosphinothricin to the plant Tolerance of glufosinate herbicides. Phosphinothricin (PTC, 2-amino-4-methylphosphonobutyrate) is an inhibitor of glutamine synthetase. PTC is the structural unit of the antibiotic 2-amino-4-methylphosphono-alanyl-alanine. This tripeptide (PTT) has anti-gram-positive and Gram-negative bacteria and antifungal Botrytis cinerea (Botrytis). Activity of cinerea). The phosphinothricin N-acetyltransferase (PAT) gene can also be used as a selectable marker gene.

The "glufosinate", also known as glufosinate, refers to ammonium 2-amino-4-[hydroxy(methyl)phosphono]butanoate, and treatment with "glufosinate herbicide" means using any one of The herbicide formulation of glufosinate is treated. In order to achieve an effective biological dose, the choice of the use rate of a certain glufosinate formulation does not exceed the skill of a general agronomic technician. Treatment of plants containing plant material derived from herbicide-tolerant corn plant DBN9888 using any herbicide formulation containing glufosinate will control weed growth in the field without affecting herbicide resistance Growth or yield of plant material of the recipient maize plant DBN9888.

The DNA construct is introduced into a plant using a transformation method including, but not limited to, Agrobacterium-mediated transformation, gene gun transformation, and pollen tube pathway transformation.

The Agrobacterium-mediated transformation method is a common method for plant transformation. The foreign DNA to be introduced into the plant is cloned between the left and right border consensus sequences of the vector, i.e., the T-DNA region. The vector is transformed into Agrobacterium cells, and subsequently, the Agrobacterium cells are used to infect plant tissues, and the T-DNA region of the vector containing the foreign DNA is inserted into the plant genome.

The gene gun transformation method is to bombard plant cells (particle-mediated biological bombardment transformation) with a vector containing foreign DNA.

The pollen tube channel transformation method utilizes a natural pollen tube channel (also known as a pollen tube-guided tissue) formed after pollination of a plant, and carries the foreign DNA into the embryo sac via the nucellus channel.

After transformation, the transgenic plants must be regenerated from the transformed plant tissue and the progeny with the exogenous DNA selected using appropriate markers.

A DNA construct is a combination of DNA molecules interconnected that provides one or more expression cassettes. The DNA construct is preferably a plasmid capable of self-replication in bacterial cells and containing different restriction enzyme sites, and the restriction enzyme sites contained therein are introduced for providing functional gene elements, ie, promoters. , introns, leader sequences, coding sequences, 3' terminator regions, and other sequences of DNA molecules. The expression cassette contained in the DNA construct includes genetic elements necessary for providing transcription of messenger RNA, which can be designed to be expressed in prokaryotic or eukaryotic cells. The expression cassettes of the invention are designed to be most preferably expressed in plant cells.

A transgenic "event" is obtained by transforming a plant cell with a heterologous DNA construct, comprising a nucleic acid expression cassette containing the gene of interest, inserted into the plant genome by a transgenic method to produce a plant population, and regenerating the plant population And selecting a particular plant with the characteristics of insertion into a particular genomic locus. The term "event" refers to an original transformant comprising a heterologous DNA and progeny of the transformant. The term "event" also refers to progeny obtained by sexual crossing between a transformant and another variety of individuals containing heterologous DNA, even after repeated backcrossing with the backcross parent, insert DNA and flanking from the transformant parent. Genomic DNA is also present at the same chromosomal location in the progeny of the cross. The term "event" also refers to a DNA sequence from an original transformant comprising an insert DNA and a flanking genomic sequence immediately adjacent to the inserted DNA, the DNA sequence being expected to be transferred to a progeny comprising A parental line in which the inserted DNA (for example, the original transformant and its progeny produced by selfing) is sexually hybridized with a parental line that does not contain the inserted DNA, and the progeny receives the inserted DNA containing the target gene.

"Recombinant" in the context of the invention refers to the form of DNA and/or proteins and/or organisms that are normally not found in nature and are thus produced by human intervention. Such manual intervention can produce recombinant DNA molecules and/or recombinant plants. The "recombinant DNA molecule" is obtained by artificially combining two sequence segments which are otherwise isolated, for example by chemical synthesis or by manipulation of isolated nucleic acid segments by genetic engineering techniques. Techniques for performing nucleic acid manipulation are well known.

The term "transgene" includes any cell, cell line, callus, tissue, plant part or plant, and the above genotypes are altered by the presence of a heterologous nucleic acid, including the transgene that was originally altered as such and by The original transgenic body is a progeny individual that is produced by sexual or asexual reproduction. In the present invention, the term "transgene" does not include genomic (chromosomal or extrachromosomal) alterations by conventional plant breeding methods or naturally occurring events, such as random allogeneic fertilization, non-recombinant viral infection, non-recombination. Bacterial transformation, non-recombinant transposition or spontaneous mutation.

"Heterologous" in the context of the invention means that the first molecule in nature is generally not found in combination with the second molecule. For example, a molecule can be derived from a first species and inserted into the genome of a second species. Thus the molecule is heterologous to the host and is artificially introduced into the genome of the host cell.

The transgenic maize event DBN9888, which is tolerant to the glyphosate herbicide and the glufosinate herbicide, is cultured by first sexually crossing the first parent corn plant with the second parent corn plant, thereby producing a variety of A generation of progeny plants consisting of maize plants grown from the transgenic maize event DBN9888 and its progeny, the transgenic maize event DBN9888 and its progeny by utilizing the glyphosate herbicide and grass of the invention The ammonium phosphine herbicide is obtained by transforming a tolerant expression cassette, and the second parent corn plant lacks tolerance to the glyphosate herbicide and/or glufosinate herbicide; then the glyphosate herbicide is selected And/or glufosinate herbicides are applied to tolerant progeny plants which can produce corn plants that are tolerant to glyphosate herbicides and glufosinate herbicides. These steps may further comprise backcrossing the progeny plants tolerant to the application of the glyphosate herbicide and/or the glufosinate herbicide to the second parent corn plant or the third parent corn plant, and then applying the grass Glyphosate herbicide, glufosinate herbicide or identification by molecular markers associated with traits (eg 5' and 3' ends of the inserted sequence in the transgenic maize event DBN9888) Identification of the DNA molecules of the ligated sites to select progeny, thereby producing corn plants that are tolerant to glyphosate herbicides and glufosinate herbicides.

It will also be appreciated that two different transgenic plants can also be crossed to produce progeny containing two separate, separately added exogenous genes. Selfing of appropriate offspring can result in progeny plants that are homozygous for both added exogenous genes. Backcrossing of parental plants and outcrossing with non-transgenic plants as previously described are also contemplated, as are asexual reproduction.

Corn transgenic Bt can kill insects/pests such as Lepidoptera and Coleoptera, but there are also a small number of surviving insects/pests that may produce resistant insects/pests against Bt after several generations of reproduction. In order to solve the problem of insect/pest resistance, the US Environmental Protection Agency has given the following guidance on the use of GM crops, and needs to provide a certain percentage of shelter corn (about 5%, 10% of the requirements for shelter corn). 20%, etc. and may be non-anti-insect transgenic maize (such as herbicide-tolerant transgenic maize), or corn against non-target pests, not necessarily non-GM corn). When most of the insects/pests are killed on the corresponding transgenic insect-resistant corn, some insects/pests are not dead on the shelter corn, ensuring that the unresistant insect/pest population dominates. Thus, even with a small number of surviving resistant insects/pests, the resistance gene is significantly diluted after mating with a dominant number of non-resistant insects/pests.

The term "probe" is an isolated nucleic acid molecule to which is incorporated a conventional detectable label or reporter molecule, for example, a radioisotope, a ligand, a chemiluminescent agent, or an enzyme. The probe is complementary to a strand of the target nucleic acid, and in the present invention, the probe is complementary to a DNA strand from the genome of the transgenic maize event DBN9888, whether the genomic DNA is derived from the transgenic maize event DBN9888 or from the seed or from the transgene Plant or seed or extract of corn event DBN9888. The probe of the present invention includes not only deoxyribonucleic acid or ribonucleic acid, but also polyamide and other probe materials that specifically bind to a target DNA sequence and can be used to detect the presence of the target DNA sequence.

The term "primer" is an isolated nucleic acid molecule that hybridizes to a complementary target DNA strand by nucleic acid hybridization, forms a hybrid between the primer and the target DNA strand, and then acts as a polymerase (eg, DNA polymerase). Next, extending along the target DNA strand. Primer pairs of the invention are directed to their use in amplification of a target nucleic acid sequence, for example, by polymerase chain reaction (PCR) or other conventional nucleic acid amplification methods.

The length of the probe and primer is generally 11 polynucleotides or more, preferably 18 polynucleotides or more, more preferably 24 polynucleotides or more, and most preferably 30 polynucleosides. Sour or more. Such probes and primers specifically hybridize to the target sequence under highly stringent hybridization conditions. Although a probe different from the target DNA sequence and capable of maintaining hybridization ability to the target DNA sequence can be designed by a conventional method, preferably, the probe and the primer of the present invention have a complete DNA sequence with the contiguous nucleic acid of the target sequence. Identity.

Primers and probes based on the flanking genomic DNA and insert sequences of the present invention can be determined by conventional methods, for example, by isolating a corresponding DNA molecule from a plant material derived from the transgenic maize event DBN9888, and determining the nucleic acid sequence of the DNA molecule. The DNA molecule comprises a transgene insert and a maize genome flanking region, and a fragment of the DNA molecule can be used as a primer or probe.

The nucleic acid probes and primers of the invention hybridize to the target DNA sequence under stringent conditions. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of DNA derived from the transgenic maize event DBN9888 in the sample. A nucleic acid molecule or fragment thereof is capable of specifically hybridizing to other nucleic acid molecules under certain circumstances. As used in the present invention, if two nucleic acid molecules are capable of forming an anti-parallel double-stranded nucleic acid structure, it can be said that the two nucleic acid molecules are capable of specifically hybridizing to each other. If two nucleic acid molecules exhibit complete complementarity, one of the nucleic acid molecules is said to be the "complement" of the other nucleic acid molecule. As used herein, when each nucleotide of one nucleic acid molecule is complementary to a corresponding nucleotide of another nucleic acid molecule, the two nucleic acid molecules are said to exhibit "complete complementarity." Two nucleic acid molecules are said to be "minimally complementary" if they are capable of hybridizing to one another with sufficient stability such that they anneal under at least conventional "low stringency" conditions and bind to each other. Similarly, two nucleic acid molecules are said to be "complementary" if they are capable of hybridizing to one another with sufficient stability such that they anneal under conventional "highly stringent" conditions and bind to each other. Deviation from complete complementarity is permissible as long as such deviation does not completely prevent the two molecules from forming a double-stranded structure. In order for a nucleic acid molecule to function as a primer or probe, it is only necessary to ensure that it is sufficiently complementary in sequence to allow for the formation of a stable double-stranded structure at the particular solvent and salt concentration employed.

As used herein, a substantially homologous sequence is a nucleic acid molecule that is capable of specifically hybridizing to a complementary strand of another nucleic acid molecule that is matched under highly stringent conditions. Suitable stringent conditions for promoting DNA hybridization, for example, treatment with 6.0 x sodium chloride / sodium citrate (SSC) at about 45 ° C, followed by washing with 2.0 x SSC at 50 ° C, these conditions are technical The surgeon is well known. For example, the salt concentration in the washing step can be selected from about 2.0 x SSC under low stringency conditions, 50 ° C to about 0.2 x SSC, 50 ° C under highly stringent conditions. Further, the temperature conditions in the washing step can be raised from a low temperature strict room temperature of about 22 ° C to about 65 ° C under highly stringent conditions. Both the temperature conditions and the salt concentration can be changed, or one of them remains unchanged while the other variable changes. Preferably, a nucleic acid molecule of the invention can be under moderate stringency conditions, for example at about 2.0 x SSC and about 65 ° C with SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4. One or more nucleic acid molecules of SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7 or a complement thereof, or any fragment of the above sequence that specifically hybridizes. More preferably, a nucleic acid molecule of the invention is under highly stringent conditions with SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and one or more of the nucleic acid molecules of SEQ ID NO: 7 or a complement thereof, or any of the above sequences, specifically hybridize. In the present invention, a preferred marker nucleic acid molecule has SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6 or SEQ ID NO: 7 or its complement, or any fragment of the above sequence. Another preferred marker nucleic acid molecule of the invention has 80% to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6 or SEQ ID NO: 7 or a complement thereof, or any fragment of the above sequence 100% or 90% to 100% sequence identity. SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6 and SEQ ID NO: 7 can be used as markers in plant breeding methods to identify progeny of genetic crosses. Hybridization of the probe to the target DNA molecule can be detected by any method known to those skilled in the art including, but not limited to, fluorescent labeling, radioactive labeling, antibody labeling, and chemiluminescent labeling.

Regarding amplification of a target nucleic acid sequence using a specific amplification primer (for example, by PCR), "stringent conditions" refer to conditions in which only primers are allowed to hybridize to a target nucleic acid sequence in a DNA thermal amplification reaction, and A primer for the corresponding wild-type sequence (or its complement) of the target nucleic acid sequence is capable of binding to the target nucleic acid sequence, and preferably produces a unique amplification product, the amplification product, ie, the amplicon.

The term "specific binding (target sequence)" means that the probe or primer hybridizes only to the target sequence in the sample containing the target sequence under stringent hybridization conditions.

As used herein, "amplified DNA" or "amplicon" refers to a nucleic acid amplification product of a target nucleic acid sequence that is part of a nucleic acid template. For example, to determine if a corn plant contains The invention of the transgenic maize event DBN9888 was produced by sexual hybridization, or whether the corn sample collected from the field contained the transgenic maize event DBN9888, or the corn extract, such as coarse powder, flour or oil containing the transgenic corn event DBN9888, from the corn plant tissue sample Alternatively, the extracted DNA may be a diagnostic amplicon by a nucleic acid amplification method using a primer pair to generate a DNA for the transgenic maize event DBN9888. The primer pair includes a first primer derived from a flanking sequence adjacent to the inserted foreign DNA insertion site in the plant genome, and a second primer derived from the inserted foreign DNA. The amplicon has a length and sequence that is also diagnostic for the transgenic maize event DBN9888. The length of the amplicon may be the binding length of the primer pair plus one nucleotide base pair, preferably plus about fifty nucleotide base pairs, more preferably about two hundred and fifty nucleotides. Base pairs, most preferably plus about four hundred and fifty nucleotide base pairs or more.

Alternatively, the primer pair can be derived from a flanking genomic sequence inserted on both sides of the DNA to produce an amplicon comprising the entire inserted nucleotide sequence. One of the primer pairs derived from the plant genome sequence can be located at a distance from the inserted DNA sequence, which can range from one nucleotide base pair to about 20,000 nucleotide base pairs. The use of the term "amplicon" specifically excludes primer dimers formed in DNA thermal amplification reactions.

The nucleic acid amplification reaction can be carried out by any of the nucleic acid amplification reaction methods known in the art, including polymerase chain reaction (PCR). Various nucleic acid amplification methods are well known to those skilled in the art. PCR amplification methods have been developed to amplify up to 22 kb of genomic DNA and up to 42 kb of phage DNA. These methods, as well as other DNA amplification methods in the art, can be used in the present invention. The inserted exogenous DNA sequence and the flanking DNA sequence from the transgenic maize event DBN9888 can be amplified by using the provided primer sequences for the genome of the transgenic maize event DBN9888, and the PCR amplicon or cloned DNA is subjected to standardization after amplification. DNA sequencing.

A DNA detection kit based on a DNA amplification method contains DNA primer molecules which specifically hybridize to a target DNA under appropriate reaction conditions and amplify a diagnostic amplicon. The kit can provide agarose gel based detection methods or a number of methods known in the art for detecting diagnostic amplicons. Kit comprising a DNA primer homologous or complementary to any portion of the maize genomic region of SEQ ID NO: 3 or SEQ ID NO: 4, and homologous or complementary to any portion of the transgene insertion region of SEQ ID NO: 5 It is provided by the present invention. Particularly identifying primers useful in DNA amplification methods SEQ ID NO: 8 and SEQ ID NO: 9, which amplify a diagnostic amplicon homologous to a portion of the 5' transgene/genomic region of transgenic maize event DBN9888, wherein the amplicon comprises SEQ ID NO:1 . Other DNA molecules used as DNA primers may be selected from SEQ ID NO:5.

The amplicons produced by these methods can be detected by a variety of techniques. One such method is Genetic Bit Analysis, which designs a DNA oligonucleotide strand spanning the inserted DNA sequence and adjacent flanking genomic DNA sequences. The oligonucleotide strand is immobilized in the microwell of a microplate, and after PCR amplification of the target region (one primer is used in each of the inserted sequences and adjacent flanking genomic sequences), the single-stranded PCR product Hybridization can be performed with a fixed oligonucleotide strand and as a template for a single base extension reaction using a DNA polymerase and ddNTPs specifically labeled for the next expected base. The results can be obtained by fluorescence or ELISA methods. The signal represents the presence of an insert/flanking sequence indicating that amplification, hybridization and single base extension reactions were successful.

Another method is the pyrosequencing technique. This method designs an oligonucleotide chain spanning the inserted DNA sequence and the adjacent genomic DNA binding site. Hybridization of the oligonucleotide strand and the single-stranded PCR product of the target region (using one primer in each of the inserted sequences and adjacent flanking genomic sequences), followed by DNA polymerase, ATP, sulfurylase, fluorescein The enzyme, apyrase, adenosine-5'-phosphorus sulphate and luciferin are incubated together. The dNTPs were separately added and the generated optical signal was measured. The light signal represents the presence of an insertion/flanking sequence indicating that amplification, hybridization, and single base or multiple base extension reactions are successful.

The fluorescence polarization phenomenon described by Chen et al. (Genome Res. 9: 492-498, 1999) is also a method that can be used to detect the amplicons of the present invention. Using this approach requires designing an oligonucleotide strand spanning the inserted DNA sequence and the adjacent genomic DNA binding site. Hybridization of the oligonucleotide strand and the single-stranded PCR product of the target region (using one primer in each of the inserted sequences and adjacent flanking genomic sequences), followed by DNA polymerase and a fluorescently labeled ddNTP Incubation. Single base extensions result in the insertion of ddNTPs. This insertion can be used to measure changes in its polarization using a fluorometer. The change in polarization represents the presence of an insert/flanking sequence indicating that amplification, hybridization and single base extension reactions were successful.

Taqman is described as a method for detecting and quantifying the presence of DNA sequences, which is described in detail in the instructions provided by the manufacturer. Briefly exemplified, a FRET oligonucleotide probe spanning the inserted DNA sequence and the adjacent genomic flanking binding site is designed. The FRET The probe and PCR primers (one primer used in each of the inserted sequences and adjacent flanking genomic sequences) were subjected to a circular reaction in the presence of a thermostable polymerase and dNTPs. Hybridization of the FRET probe results in cleavage of the fluorescent and quenching moieties on the FRET probe and release of the fluorescent moiety. The generation of the fluorescent signal represents the presence of an insert/flanking sequence indicating that amplification and hybridization were successful.

Suitable techniques for detecting plant material derived from the herbicide tolerance transgenic maize event DBN9888 can also include Southern blot hybridization, Northern blot hybridization, and in situ hybridization based on the hybridization principle. In particular, such suitable techniques include incubating probes and samples, washing to remove unbound probes and detecting whether the probes have hybridized. The detection method depends on the type of label attached to the probe, for example, the radiolabeled probe can be detected by X-ray exposure and development, or the enzyme-labeled probe can be detected by color change by substrate conversion.

Tyangi et al. (Nat. Biotech. 14: 303-308, 1996) describe the use of molecular markers in sequence detection. Briefly described below, a FRET oligonucleotide probe spanning the inserted DNA sequence and the adjacent genomic flanking binding site was designed. The unique structure of the FRET probe results in a secondary structure that is capable of maintaining the fluorescent moiety and the quenching moiety at close distances. The FRET probe and PCR primers (using one primer in each of the inserted sequences and adjacent flanking genomic sequences) are subjected to a circular reaction in the presence of a thermostable polymerase and dNTPs. Upon successful PCR amplification, hybridization of the FRET probe to the target sequence results in loss of the secondary structure of the probe, thereby spatially separating the fluorescent moiety from the quenching moiety, producing a fluorescent signal. The generation of the fluorescent signal represents the presence of an insert/flanking sequence indicating that amplification and hybridization were successful.

Other described methods, such as microfluidics, provide methods and apparatus for isolating and amplifying DNA samples. Light dyes are used to detect and measure specific DNA molecules. A nanotube device comprising an electronic sensor for detecting a DNA molecule or a nanobead that binds to a specific DNA molecule and thus detectable is useful for detecting the DNA molecule of the present invention.

DNA detection kits can be developed using the compositions described herein and methods described or known in the art of DNA detection. The kit facilitates the identification of the presence of DNA from the transgenic maize event DBN9888 in the sample and can also be used to grow corn plants containing the DNA of the transgenic maize event DBN9888. The kit may contain a DNA primer or probe that is homologous or complementary to at least a portion of SEQ ID NO: 1, 2, 3, 4, or 5, or contains other DNA primers or probes that are homologous to or DNA complementary to DNA-transgenic genetic elements that can be used for DNA sequences DNA amplification reaction, or as a probe in DNA hybridization methods. The DNA structure contained in the maize genome and the transgenic insert sequence described in Figure 1 and Table 1 and the maize genome binding site comprises: the maize plant DBN9888 flanking genomic region located at the 5' end of the transgene insert, from the left side of the Agrobacterium A portion of the border region (LB) is inserted into the sequence, and the first expression cassette is operably linked to the glufosinate tolerance of the Streptomyces by the tandem repeat of the cauliflower mosaic virus 35S promoter (pr35S) containing the enhancer region The phosphinothricin N-acetyltransferase (cPAT) is operably linked to the cauliflower mosaic virus 35S terminator (t35S) and the second expression cassette consists of the rice actin 1 promoter (prOsAct1). Is operatively linked to the Arabidopsis EPSPS chloroplast transit peptide coding sequence (spAtCTP2), operably linked to the Agrobacterium CP4 strain of glyphosate-tolerant 5-enol-pyruvylshikimate-3- Phosphate synthase (cEPSPS), operably linked to the transcriptional terminator (tNos) of nopaline synthase, a part of the insert from the right border region (RB) of Agrobacterium, and a transgene insertion sequence The 3'-end maize plant DBN9888 flanking genomic region (SEQ ID NO: 5). In the DNA amplification method, the DNA molecule as a primer may be any part derived from a transgene insert in the maize plant DBN9888, or may be any part of the DNA region derived from the flanking maize genome in the transgenic maize event DBN9888.

The genetically modified maize event DBN9888 can be combined with other transgenic maize varieties, such as corn for herbicide tolerance (eg 2,4-D, dicamba, etc.) or transgenic maize varieties carrying other insect-resistant genes (eg Cry1Ab, Vip3A, etc.) . Various combinations of all of these different transgenic events, bred together with the transgenic maize event DBN9888 of the present invention, can provide improved hybrid transgenic maize varieties that are resistant to a variety of pests and tolerant to a variety of herbicides. These varieties can exhibit more excellent characteristics such as yield increase than non-transgenic varieties and single-trait transgenic varieties.

The present invention provides a nucleic acid sequence for detecting a herbicide-tolerant maize plant DBN9888 and a method for detecting the same, and the transgenic maize event DBN9888 is resistant to the phytotoxic effects of an agricultural herbicide containing glyphosate and/or glufosinate. The dual-characterized maize plant expresses a glyphosate-resistant 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) protein of Agrobacterium strain CP4, which confers tolerance to glyphosate to the plant, The glufosinate-resistant phosphinothricin N-acetyltransferase (PAT) protein of Streptomyces is also expressed, which confers tolerance to glufosinate to plants. Dual-trait corn has the following advantages: 1) the ability to apply glyphosate-containing agricultural herbicides to corn crops for broad-spectrum weed control; 2) glufosinate-tolerant traits in combination with glufosinate herbicides (with grass) Glyphosate herbicide mixed or alternately used as a Non-selective means for efficient management of glyphosate-resistant weeds; 3) Herbicide-tolerant transgenic maize as non-anti-insect transgenic maize, planted in proportion to transgenic insect-resistant maize, can delay insect/pest generation Resistance; 4) Corn yield did not decrease. In addition, genes encoding glyphosate tolerance and glufosinate tolerance traits are linked to the same DNA segment and are present at a single locus in the genome of the transgenic maize event DBN9888, which provides enhanced breeding efficiency and Molecular markers are enabled to track transgenic inserts in the breeding population and its progeny. In the detection method of the present invention, SEQ ID NO: 1 or its complement, SEQ ID NO: 2 or its complement, SEQ ID NO: 6 or its complement, or SEQ ID NO: 7 or its complement may be used as DNA primers. Or probes to generate amplification products that are diagnosed as transgenic maize event DBN9888 or its progeny, and the presence of plant material derived from the transgenic maize event DBN9888 can be identified quickly, accurately, and stably.

Sequence description

SEQ ID NO: 1 insertion site of the 5' transgene fragment in transgenic maize event DBN9888 and 11 nucleotides on each side of maize genomic DNA;

SEQ ID NO: 2 insertion site of the 3' transgene fragment in the transgenic maize event DBN9888 and 11 nucleotides on each side of the maize genomic DNA;

SEQ ID NO: 3 A sequence of 960 nucleotides in length in the transgenic maize event DBN9888 located at the 5' end of the inserted sequence near the insertion junction;

SEQ ID NO: 4 A sequence of 753 nucleotides in length in the transgenic maize event DBN9888 located at the 3' end of the inserted sequence near the insertion junction;

SEQ ID NO: 5 The entire T-DNA sequence, the 5' and 3' flanking maize genomic sequences;

SEQ ID NO: 6 is a sequence internal to SEQ ID NO: 3 spanning the DBN10006 construct DNA sequence and the pr35S promoter sequence;

SEQ ID NO:7 is a sequence located within SEQ ID NO: 4 spanning the tNos terminator sequence and the DBN10006 construct DNA sequence;

SEQ ID NO: 8 amplifies the first primer of SEQ ID NO: 3;

SEQ ID NO: 9 amplifies the second primer of SEQ ID NO: 3;

SEQ ID NO: 10 amplifies the first primer of SEQ ID NO: 4;

SEQ ID NO: 11 Amplification of the second primer of SEQ ID NO: 4;

SEQ ID NO: 12 Primer on the 5' flanking genomic sequence;

SEQ ID NO: 13 is a primer paired with SEQ ID NO: 12 on the T-DNA;

SEQ ID NO: 14 a primer on the 3' flanking genomic sequence, which paired with SEQ ID NO: 12 can detect whether the transgene is homozygous or heterozygous;

SEQ ID NO: 15 is a primer paired with SEQ ID NO: 14 on the T-DNA;

SEQ ID NO: 16 Taqman detects primer 1 of EPSPS;

SEQ ID NO: 17 Taqman detects primer 2 of EPSPS;

SEQ ID NO: 18 Taqman probe 1 for detecting EPSPS;

SEQ ID NO: 19 Taqman detects primer 3 of PAT;

SEQ ID NO: 20 Taqman detects primer 4 of PAT;

SEQ ID NO: 21 Taqman probe 2 for detecting PAT;

SEQ ID NO: 22 First primer for maize endogenous gene Ubiquitin ubiquitin protein;

SEQ ID NO: 23 second primer for maize endogenous gene Ubiquitin ubiquitin protein;

SEQ ID NO: 24 probe for PAT in Southern blot hybridization assay;

SEQ ID NO: 25 probe for EPSPS in Southern blot hybridization assay;

SEQ ID NO:26 Primer on T-DNA, in the same orientation as SEQ ID NO:13;

SEQ ID NO:27 Primer on T-DNA, opposite to SEQ ID NO: 13 for use as a flanking sequence;

SEQ ID NO:28 Primer on T-DNA, opposite to SEQ ID NO: 13 for use as a flanking sequence;

SEQ ID NO:29 Primer on T-DNA, aligned with SEQ ID NO:15;

SEQ ID NO:30 Primer on T-DNA, opposite to SEQ ID NO: 15 for use as a flanking sequence;

SEQ ID NO: 31 Primer on T-DNA, opposite to SEQ ID NO: 15, used to obtain flanking sequences.

The technical solution of the present invention will be further described in detail below through the accompanying drawings and embodiments.

DRAWINGS

1 is a schematic view showing the structure of a transgenic insert sequence for detecting a nucleic acid sequence of a herbicide-tolerant maize plant DBN9888 and a method for detecting the same;

2 is a schematic view showing the structure of a recombinant expression vector DBN10006 for detecting a nucleic acid sequence of a herbicide-tolerant corn plant DBN9888 and a detection method thereof.

detailed description

The technical scheme of the present invention for detecting the nucleic acid sequence of the herbicide-tolerant maize plant DBN9888 and the detection method thereof will be further illustrated by specific examples.

First embodiment, cloning and transformation

1.1, vector cloning

The recombinant expression vector DBN10006 (shown in Figure 2) was constructed using standard gene cloning techniques. The vector DBN10006 comprises two tandem transgenic expression cassettes, the first expression cassette being ligated to the streptomyces glufosinate by a tandem repeat of the cauliflower mosaic virus 35S promoter (pr35S) containing an enhancer region Receptive phosphinothricin N-acetyltransferase (cPAT), operably linked to the cauliflower mosaic virus 35S terminator (t35S); the second expression cassette is initiated by rice actin 1 a (gOsAct1), operably linked to the Arabidopsis EPSPS chloroplast transit peptide coding sequence (spAtCTP2), operably linked to the Agrobacterium CP4 strain of glyphosate-tolerant 5-enol-pyruvylshikimate The -3-phosphate synthase (cEPSPS) is operably linked to the transcription terminator (tNos) of the nopaline synthase.

The vector DBN10006 was transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA; Cat. No: 18313-015) by liquid nitrogen method, and 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) was used. Transformed cells are screened for selection markers.

1.2, plant transformation

Transformation was carried out by a conventional Agrobacterium infection method, and the sterile cultured maize immature embryos were co-cultured with the Agrobacterium described in the present Example 1.1 to transfer the T-DNA in the constructed recombinant expression vector DBN10006 to the corn. In the genome, to generate the transgenic maize event DBN9888.

For Agrobacterium-mediated transformation of maize, briefly, immature immature embryos are isolated from maize, and the immature embryos are contacted with Agrobacterium suspension, wherein Agrobacterium can express the nucleotide sequence of EPSPS gene and the nucleotide of PAT gene. The sequence is passed to at least one cell of one of the young embryos (step 1: infection step), in which the immature embryo is preferably immersed in an Agrobacterium suspension (OD ₆₆₀ = 0.4-0.6, infecting medium (MS salt 4.3) g/L, MS vitamin, casein 300mg/L, sucrose 68.5g/L, glucose 36g/L, acetosyringone (AS) 40mg/L, 2,4-dichlorophenoxyacetic acid (2,4-D) Inoculation was initiated with 1 mg/L, pH 5.3)). The immature embryo is co-cultured with Agrobacterium for a period of time (3 days) (step 2: co-cultivation step). Preferably, the immature embryo is in solid medium after the infection step (MS salt 4.3 g/L, MS vitamin, casein 300 mg/L, sucrose 20 g/L, glucose 10 g/L, acetosyringone (AS) 100 mg/L) 2,4-Dichlorophenoxyacetic acid (2,4-D) 1 mg/L, agar 8 g/L, pH 5.8). After this co-cultivation phase, there can be an optional "recovery" step. In the "recovery" step, the medium was restored (MS salt 4.3 g / L, MS vitamin, casein 300 mg / L, sucrose 30 g / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / At least one antibiotic (cephalosporin) known to inhibit the growth of Agrobacterium is present in L, plant gel 3 g/L, pH 5.8), and no selection agent for plant transformants is added (step 3: recovery step). Preferably, the immature embryos are cultured on a solid medium with antibiotics but no selection agent to eliminate Agrobacterium and provide a recovery period for the infected cells. Next, the inoculated immature embryos are cultured on a medium containing a selective agent (glyphosate) and the grown transformed callus is selected (step 4: selection step). Preferably, the immature embryo is screened in a solid medium with a selective agent (MS salt 4.3 g/L, MS vitamin, casein 300 mg/L, sucrose 30 g/L, N-(phosphocarboxymethyl)glycine 0.25 mol/L, 2,4-Dichlorophenoxyacetic acid (2,4-D) 1 mg/L, plant gel 3 g/L, pH 5.8) was cultured, resulting in selective growth of transformed cells. Then, the callus regenerates the plant (step 5: regeneration step), preferably, the callus grown on the medium containing the selection agent is cultured on a solid medium (MS differentiation medium and MS rooting medium) Recycled plants.

The selected resistant callus was transferred to the MS differentiation medium (MS salt 4.3 g/L, MS vitamin, casein 300 mg/L, sucrose 30 g/L, 6-benzyl adenine 2 mg/L, N- (phosphonocarboxymethyl)glycine 0.125 mol/L, plant gel 3 g/L, pH 5.8), cultured and differentiated at 25 °C. The differentiated seedlings were transferred to the MS rooting medium (MS salt 2.15 g/L, MS vitamin, casein 300 mg/L, sucrose 30 g/L, indole-3-acetic acid 1 mg/L, agar 8 g/L, pH 5.8), culture at 25 ° C to a height of about 10 cm, and move to a greenhouse to grow to firmness. In the greenhouse, the cells were cultured at 28 ° C for 16 hours and then at 20 ° C for 8 hours.

1.3. Identification and screening of transgenic events

A total of 332 independent transgenic T ₀ plants were produced.

The regenerated transgenic maize plants were tested for the presence of EPSPS and PAT genes by TaqMan ^(TM) analysis (see second example) and characterize the copy number of the glyphosate-tolerant and glufosinate-tolerant lines. By screening, event DBN9888 was selected to be excellent with single copy transgene, good glyphosate herbicide tolerance, glufosinate herbicide tolerance and agronomic traits (see fifth example).

Second embodiment, detection of transgenic corn event DBN9888 using TaqMan

Approximately 100 mg of the leaves of the transgenic maize event DBN9888 were taken as samples, and the genomic DNA was extracted with Qiagen's DNeasy Plant Maxi Kit, and the copy number of the EPSPS gene and the PAT gene was detected by Taqman probe fluorescent quantitative PCR. At the same time, the wild type corn plants were used as a control, and the detection and analysis were carried out according to the above method. The experiment was set to repeat 3 times and averaged.

The specific method is as follows:

Step 11. Take 100 mg of the leaves of the transgenic corn event DBN9888, and homogenize it with liquid nitrogen in a mortar, and take 3 replicates for each sample;

Step 12. Extract the genomic DNA of the above sample using Qiagen's DNeasy Plant Mini Kit, and refer to the product manual for the specific method;

Step 13. Determine the genomic DNA concentration of the above sample using NanoDrop 2000 (Thermo Scientific);

Step 14, adjusting the genomic DNA concentration of the above sample to the same concentration value, the concentration value ranges from 80 to 100 ng / μl;

Step 15. The Taqman probe real-time PCR method is used to identify the copy number of the sample, and the sample with the known copy number is used as a standard, and the sample of the wild type corn plant is used as a control, and each sample has 3 replicates, and the average is taken. Value; the fluorescent PCR primers and probe sequences are:

The following primers and probes were used to detect the EPSPS gene sequence:

Primer 1: CTGGAAGGCGAGGACGTCATCAATA is shown in SEQ ID NO: 16 in the Sequence Listing;

Primer 2: TGGCGGCATTGCCGAAATCGAG is shown in SEQ ID NO: 17 in the Sequence Listing;

Probe 1: ATGCAGGCGATGGGCGCCCGCATCCGTA as shown in SEQ ID NO: 18 in the Sequence Listing;

The following primers and probes were used to detect the PAT gene sequence:

Primer 3: CAGTTGAGATTAGGCCAGCTACAG is shown in SEQ ID NO: 19 in the Sequence Listing;

Primer 4: TACTACTGTAGACGTCTCAATGTAATGG as SEQ ID in the Sequence Listing NO: 20;

Probe 2: CAGCTGATATGGCCGCGGTTTGTG is shown in SEQ ID NO: 21 in the Sequence Listing;

The PCR reaction system is:

The 50× primer/probe mixture contained 45 μL of each primer at a concentration of 1 mM, 50 μL of probe at a concentration of 100 μM and 860 μl of L1×TE buffer, and stored at 4° C. in an amber tube.

The PCR reaction conditions are:

Data were analyzed using SDS2.3 software (Applied Biosystems) to obtain a single copy of the transgenic maize event DBN9888.

Third embodiment, detection of genetically modified corn event DBN9888

3.1, genomic DNA extraction

DNA extraction according to the conventionally used CTAB (cetyltrimethylammonium bromide) method: take 2 grams of young transgenic corn event DBN9888 leaves were ground into powder in liquid nitrogen, add 0.5mL at a temperature of 65 ° C pre Hot DNA extraction CTAB Buffer (20g/L CTAB, 1.4M NaCl, 100mM Tris-HCl, 20mM EDTA (ethylenediaminetetraacetic acid), adjusted to pH 8.0 with NaOH), fully mixed, and extracted at a temperature of 65 ° C 90 minutes; add 0.5 volume of phenol, 0.5 volume of chloroform, invert and mix; centrifuge at 102000 rpm (revolutions per minute) for 10 minutes; aspirate the supernatant, add 2 volumes of absolute ethanol, gently shake the centrifuge tube, The temperature was allowed to stand at 4 ° C for 30 minutes; the temperature was further centrifuged at 12,000 rpm for 10 minutes; the DNA was collected to the bottom of the tube; the supernatant was discarded, and the precipitate was washed with 1 mL of 70% ethanol; centrifuged at 12,000 rpm for 5 minutes; vacuum dried Or blow dry on a clean bench; The DNA pellet was dissolved in an appropriate amount of TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) and stored at a temperature of -20 °C.

3.2. Analysis of flanking DNA sequences

The extracted DNA sample is subjected to concentration measurement such that the concentration of the sample to be tested is between 80 and 100 ng/μL. Genomic DNA was digested with the selected restriction enzymes BamH I, Xma I, Kpn I, Sac II (5' end analysis) and Spe I, Pst I, Eco57 I (3' end analysis), respectively. 26.5 μL of genomic DNA, 0.5 μL of the above-selected restriction enzyme, and 3 μL of the restriction enzyme buffer were added to each digestion system, and the enzyme was digested for 1 hour. After the end of the digestion, 70 μL of absolute ethanol was added to the digestion system, and the mixture was ice-bathed for 30 minutes, centrifuged at 12,000 rpm for 7 minutes, the supernatant was discarded, and dried, and then 8.5 μL of double distilled water (dd H ₂ O) and 1 μL were added. 10X T ₄ Buffer and 0.5 μL of T ₄ ligase were ligated overnight at 4 °C. The 5' and 3' transgene/genomic DNA were isolated by PCR amplification using a series of nested primers. Specifically, the isolated 5' transgene/genomic DNA primer combination comprises SEQ ID NO: 13, SEQ ID NO: 26 as a first primer, SEQ ID NO: 27, SEQ ID NO: 28 as a second primer, SEQ ID NO: 13. As a sequencing primer. The isolated 3' transgene/genomic DNA primer combination comprises SEQ ID NO: 15, SEQ ID NO: 29 as the first primer, SEQ ID NO: 30, SEQ ID NO: 31 as the second primer, and SEQ ID NO: 15 as the sequencing primer The PCR reaction conditions are shown in Table 3.

The obtained amplicons were electrophoresed on a 2.0% agarose gel to separate PCR reactions, followed by separation of the fragment of interest from the agarose matrix using a QIAquick Gel extraction kit (catalog #_28704, Qiagen Inc., Valencia, CA). The purified PCR product is then sequenced (eg, ABI PrismTM 377, PE Biosystems, Foster City, CA) and analyzed (eg, DNASTAR sequence analysis software, DNASTAR Inc., Madison, WI).

The 5' and 3' flanking sequences and junction sequences were confirmed using standard PCR methods. The 5' flanking sequence and the contact sequence can be confirmed using SEQ ID NO: 8 or SEQ ID NO: 12 in combination with SEQ ID NO: 9, SEQ ID NO: 13, or SEQ ID NO: 26. The 3' flanking sequence and the contact sequence can be confirmed using SEQ ID NO: 11 or SEQ ID NO: 14, in combination with SEQ ID NO: 10, SEQ ID NO: 15 or SEQ ID NO: 29. The PCR reaction system and amplification conditions are shown in Tables 2 and 3. Those skilled in the art will appreciate that other primer sequences can also be used to confirm flanking sequences and junction sequences.

DNA sequencing of PCR products provides DNA that can be used to design other DNA molecules for use as primers and probes for maize derived from the transgenic maize event DBN9888 Identification of plants or seeds.

It was found that the maize genomic sequence at position 1-693 of SEQ ID NO: 5 is flanking the right border of the transgenic maize event DBN9888 insert (5' flanking sequence), at nucleotide 5472 of SEQ ID NO: 5. The -5952 position shows the maize genome sequence flanking the left border of the transgenic maize event DBN9888 insertion sequence (3' flanking sequence). The 5' junction sequence is set forth in SEQ ID NO: 1, and the 3' junction sequence is set forth in SEQ ID NO: 2.

3.3, PCR zygosity determination

The junction sequence is a relatively short polynucleotide molecule that is a new DNA sequence that is diagnostic for the DNA of the transgenic maize event DBN9888 when detected in a polynucleic acid detection assay. The junction sequence in SEQ ID NO: 1 and SEQ ID NO: 2 is the insertion site of the transgene fragment in the transgenic maize event DBN9888 and 11 polynucleotides on each side of the maize genomic DNA. Longer or shorter polynucleotide junction sequences can be selected from SEQ ID NO: 3 or SEQ ID NO: 4. The junction sequence (5' junction region SEQ ID NO: 1, and 3' junction region SEQ ID NO: 2) is useful as a DNA probe or as a DNA primer molecule in a DNA detection method. The ligating sequences SEQ ID NO: 6 and SEQ ID NO: 7 are also novel DNA sequences in transgenic maize event DBN9888, which can also be used as DNA probes or as DNA primer molecules to detect the presence of transgenic maize event DBN9888 DNA. The SEQ ID NO: 6 (positions 694-960 of the nucleotide of SEQ ID NO: 3) spans the DBN10006 construct DNA sequence and the pr35S promoter sequence, SEQ ID NO: 7 (SEQ ID NO: 4) Nucleotide No. 1-272) spans the tNos terminator sequence and the DBN10006 construct DNA sequence.

Furthermore, an amplicon is produced by using at least one primer from SEQ ID NO: 3 or SEQ ID NO: 4, which is used in a PCR method to generate a diagnostic amplicon of the transgenic maize event DBN9888.

Specifically, a PCR product was generated from the 5' end of the transgene insert, which is part of the genomic DNA flanked by the 5' end of the T-DNA insert in the genome of the plant material derived from the transgenic maize event DBN9888. This PCR product comprises SEQ ID NO:3. For PCR amplification, primer 5 (SEQ ID NO: 8), which hybridizes to the genomic DNA sequence flanking the 5' end of the transgene insert, and primer 6 (SEQ ID) located in the transgenic tNos terminator sequence were designed. NO: 9).

A PCR product is produced from the 3' end of the transgene insertion sequence, the PCR product comprising the derived The genome of the plant material of the genetic maize event DBN9888 is flanked by a portion of the genomic DNA at the 3' end of the T-DNA insert. This PCR product comprises SEQ ID NO:4. For PCR amplification, primer 8 (SEQ ID NO: 11), which hybridizes to the genomic DNA sequence flanking the 3' end of the transgene insert, and the paired pr35S promoter sequence at the 3' end of the insert were designed. Primer 7 (SEQ ID NO: 10).

The DNA amplification conditions illustrated in Tables 2 and 3 can be used in the PCR zygosity assay described above to generate a diagnostic amplicon of the transgenic maize event DBN9888. The detection of the amplicon can be carried out by using Stratagene Robocycler, MJ Engine, Perkin-Elmer 9700 or Eppendorf Mastercycler Gradien thermal cycler as shown in Table 3, or by methods and equipment known to those skilled in the art.

Table 2. PCR procedure and reaction mixture conditions for 5' transgene insert/genomic junction region identification of transgenic maize event DBN9888

Table 3, Perkin-Elmer 9700 Thermal Cycler Conditions

Mix gently. If there is no cap on the thermocycler, add 1-2 drops of mineral oil above each reaction. Using the above cycling parameters (Table 3) in Stratagene Robocycler (Stratagene, La Jolla, CA), MJ Engine (MJ R-Biorad, Hercules, CA), Perkin-Elmer 9700 (Perkin Elmer, Boston, MA) or Eppendorf Mastercycler Gradient ( PCR was performed on a thermocycler on Eppendorf, Hamburg, Germany. The MJ Engine or Eppendorf MastercyclerGradient thermal cycler should operate in the calculated mode. The Perkin-Elmer 9700 Thermal Cycler is programmed to set the ramp speed to its maximum value.

The results of the experiments indicated that primers 5 and 6 (SEQ ID NOS: 8 and 9), when used in the PCR reaction of the transgenic maize event DBN9888 genomic DNA, produced an amplification product of the 960 bp fragment when used in the untransformed maize genome. When PCR was used in PCR reactions with non-DBN9888 maize genomic DNA, no fragments were amplified; primers 7 and 8 (SEQ ID NOS: 10 and 11) were generated when used in the PCR reaction of the transgenic maize event DBN9888 genomic DNA. The amplified product of the 753 bp fragment, when used in the PCR reaction of untransformed maize genomic DNA and non-DBN9888 maize genomic DNA, no fragments were amplified.

PCR zygosity assays can also be used to identify homozygous or heterozygous materials derived from the transgenic maize event DBN9888. Primer 9 (SEQ ID NO: 12), primer 10 (SEQ ID NO: 13) and primer 11 (SEQ ID NO: 14) were used in the amplification reaction to generate a diagnostic amplicon of the transgenic maize event DBN9888. The DNA amplification conditions illustrated in Tables 4 and 5 can be used in the zygosity assay described above to generate a diagnostic amplicon of the transgenic maize event DBN9888.

Table 4, zygosity determination reaction solution

Table 5. Bondability Determination Perkin-Elmer 9700 Thermal Cycler Conditions

The above cycling parameters (Table 5) were used at Stratagene Robocycler (Stratagene, La Jolla, CA), MJ Engine (MJ R-Biorad, Hercules, CA), Perkin-Elmer 9700 (Perkin Elmer, Boston, MA) or Eppendorf Mastercycler Gradient ( PCR was performed on a thermocycler on Eppendorf, Hamburg, Germany. The MJ Engine or Eppendorf Mastercycler Gradient thermal cycler should operate in the calculated mode. The Perkin-Elmer 9700 Thermal Cycler is programmed to set the ramp speed to its maximum value.

In the amplification reaction, the biological sample containing the template DNA contains DNA for diagnosing the presence of the transgenic maize event DBN9888 in the sample. Or the reaction will produce two different DNA amplicons from a biological sample containing DNA derived from the maize genome, which is heterozygous for the allele corresponding to the inserted DNA present in the transgenic maize event DBN9888. of. These two different amplicons will correspond to the first amplicon derived from the wild-type maize genomic locus and the second amplicon from the presence of the diagnostic transgenic maize event DBN9888 DNA. Produce only A maize DNA sample corresponding to a single amplicon of the second amplicon described for the hybrid genome can be diagnostically determined to determine the presence of the transgenic maize event DBN9888 in the sample, and the sample is present in relation to the transgenic maize plant DBN9888 The allele corresponding to the inserted DNA is produced by homozygous corn seed.

It should be noted that the primer pair of the transgenic maize event DBN9888 was used to generate a diagnostic amplicon for the transgenic maize event DBN9888 genomic DNA. These primer pairs include, but are not limited to, primers 5 and 6 (SEQ ID NOS: 8 and 9), and primers 7 and 8 (SEQ ID NOS: 10 and 11), which are used in the DNA amplification method described. In addition, one of the control primers 12 and 13 (SEQ ID NOS: 22 and 23) for amplifying the maize endogenous gene was included as an intrinsic standard for the reaction conditions. DNA extraction sample analysis for the transgenic maize event DBN9888 should include a positive tissue DNA extract control of the transgenic maize event DBN9888, a negative DNA extract control derived from the non-transgenic maize event DBN9888 and a DNA extraction without template DNA. Negative control of the extract. In addition to these primer pairs, any primer pair from SEQ ID NO: 3 or SEQ ID NO: 4, or its complement, can be used, which, when used in DNA amplification reactions, produces maize for transgenic events, respectively. The tissue of plant DBN9888 is a diagnostic amplicon comprising SEQ ID NO: 1 or SEQ ID NO: 2. The DNA amplification conditions illustrated in Table 2 - Table 5 can be used to generate a diagnostic amplicon of the transgenic maize event DBN9888 using a suitable primer pair. An extract derived from a maize plant or seed DNA containing the transgenic maize event DBN9888, or a product derived from the transgenic maize event DBN9888, when tested in a DNA amplification method, yielding a diagnostic amplicon for the transgenic maize event DBN9888 Can be used as a template for amplification to determine the presence of the transgenic maize event DBN9888.

Fourth Example, Detection of Transgenic Corn Event DBN9888 by Southern Blot Hybridization

4.1, DNA extraction for Southern blot hybridization

Southern blot analysis was performed using T4, T5 generation homozygous transformation events. Approximately 5 to 10 g of plant tissue is ground in liquid nitrogen using a mortar and pestle. Resuspend plant tissue in 12.5 mL of Extraction Buffer A (0.2 M Tris pH 8.0, 50 mM EDTA, 0.25 M NaCl, 0.1% v/v β-mercaptoethanol, 2.5% w/v polyethylene-pyrrolidone), centrifuge at 4000 rpm 10 minutes (2755g). After discarding the supernatant, 2.5 mL of extraction buffer B (0.2 M Tris pH 8.0, 50 mM EDTA, 0.5 M NaCl, 1% v/v β-mercaptoethanol, 2.5% w/v polyethylene-pyrrolidone, 3%) Sarcoyl, 20% ethanol) medium weight The pellet was suspended and incubated at 37 ° C for 30 minutes. The samples were mixed once with a sterile loop during incubation. After the incubation, an equal volume of chloroform/isoamyl alcohol (24:1) was added, gently mixed by inversion, and centrifuged at 4000 rpm for 20 minutes. The aqueous layer was collected, and centrifuged at 4000 rpm for 5 minutes after the addition of 0.54 volumes of isopropyl alcohol to precipitate DNA. The supernatant was discarded and the DNA pellet was resuspended in 500 μL. To degrade any RNA present, the DNA was incubated with 1 μL of 30 mg/ml LRNAase A for 30 minutes at 37 ° C, centrifuged at 4000 rpm for 5 minutes, and passed in the presence of 0.5 volume of 7.5 M ammonium acetate and 0.54 volume of isopropanol. The DNA was precipitated by centrifugation at 14,000 rpm for 10 minutes. After discarding the supernatant, the precipitate was washed with 500 μL of 70% ethanol, and dried and resuspended in 100 μL of TE buffer.

4.2, restriction enzyme digestion

The DNA concentration was quantified using a spectrophotometer or fluorometer (using 1 x TNE and Hoechst dye).

5 μg of DNA was digested each time in a 100 μL reaction system. Genomic DNA was digested with restriction enzymes Sac I and Hind III, respectively, and a partial sequence of EPSPS and PAT on T-DNA was used as a probe. For each enzyme, the overnight digest was incubated at the appropriate temperature. The sample was rotated using a vacuum centrifugal speed vacuum to reduce the volume to 30 μL.

4.3, gel electrophoresis

Bromophenol blue loading dye was added to each sample derived from this Example 4.2, and each sample was applied to a 0.7% agarose gel containing ethidium bromide and electrophoretically separated in TBE running buffer. The gel was electrophoresed overnight at 20 volts.

The gel was washed in 0.25 M HCl for 15 minutes to dissociate the DNA and then washed with water. Southern blot hybridization was set as follows: 20 sheets of thick blotted paper were placed in the pan on which 4 thin dry blotting papers were placed. One thin blotting paper was pre-wetted in 0.4 M NaOH and placed on the paper pile, followed by one Hybond-N+ transfer film (Amersham Pharmacia Biotech, #RPN303B) pre-wetted in 0.4 M NaOH. The gel is placed on top to ensure that there are no air bubbles between the gel and the membrane. Three additional pre-soaked blotting papers were placed on top of the gel and the buffer pan was filled with 0.4 M NaOH. The gel was transferred to the membrane using a wick pre-soaked in 0.4 M NaOH to connect the gel stack to the buffer pan. DNA transfer was carried out for about 4 hours at room temperature. After the transfer, the Hybond membrane was rinsed in 2 x SSC for 10 seconds, and the DNA was bound to the membrane by UV crosslinking.

4.4, hybridization

Suitable DNA sequences were amplified by PCR for probe preparation. The DNA probe is SEQ ID NO: 24 and SEQ ID NO: 25, or is homologous or complementary to the above sequence. 25 ng of probe DNA was boiled in 45 μL for 5 minutes, placed on ice for 7 minutes, and then transferred to a Rediprime II (Amersham Pharmacia Biotech, #RPN1633) tube. After adding 5 μl of ³² P-labeled dCTP to the Rediprime tube, the probe was incubated at 37 ° C for 15 minutes. The probe was purified by centrifugation on a microcentrifuge G-50 column (Amersham Pharmacia Biotech, #27-5330-01) to remove unincorporated dNTPs according to the manufacturer's instructions. Probe activity was measured using a scintillation counter.

The Hybond membrane was pre-hybridized by wetting the Hybond membrane with 20 mL of pre-warmed Church pre-hybridization solution (500 mM Na ₃ PO ₄ , 1 mM EDTA, 7% SDS, 1% BSA) for 30 minutes at 65 °C. The labeled probe was boiled for 5 minutes and placed on ice for 10 minutes. An appropriate amount of probe (1 million counts per 1 mL of pre-hybridization buffer) was added to the pre-hybridization buffer, and hybridization was carried out overnight at 65 °C. On the next day, the hybridization buffer was discarded, rinsed with 20 mL of Church Wash Solution 1 (40 mM Na ₃ PO ₄ , 1 mM EDTA, 5% SDS, 0.5% BSA), and then washed at 150 ° C in 150 mL of Church Wash Solution 1. 20 minutes. This procedure was repeated twice with Church Wash Solution 2 (40 mM Na ₃ PO ₄ , 1 mM EDTA, 1% SDS). The film is exposed to a phosphor screen or X-ray film to detect where the probe is bound.

Three control samples were included on each Southern: (1) DNA from a negative (untransformed) segregant used to identify any endogenous maize sequence that can hybridize to a component-specific probe; (2) from DNA of the negative segregant into which Hind III-digested DBN10006 was introduced, the amount of which is equivalent to a copy number based on the length of the probe to account for the sensitivity of the assay when detecting a single copy of the gene within the maize genome; and (3) A Hind III-digested DBN10006 plasmid equivalent to one copy number based on the length of the probe was used as a positive control for hybridization and used to demonstrate the sensitivity of the experiment.

Confirmatory hybridization data provide evidence to support the analysis TaqMan ^TM PCR, i.e. DBN9888 corn plants contain a single copy of EPSPS and PAT gene. Using the EPSPS probe, Sac I and Hind III digested a single band of approximately 7.8 kb and 12 kb, respectively; using the PAT probe, Sac I and Hind III enzymatically produced a single size of approximately 5.5 kb and 4.8 kb, respectively. Bands. This indicates that one copy of EPSPS and PAT is present in the maize transformation event DBN9888.

Fifth embodiment, herbicide tolerance test of events

In this test, Roundup herbicide (41% glyphosate isopropylammonium salt) and herbicide (18% glufosinate) were sprayed. A random block design was used with 3 repetitions. The area of the plot is 15m ² (5m×3m), the row spacing is 60cm, the plant spacing is 25cm, and the cultivation management is routine. There is a 1m wide isolation zone between the cells. The transgenic corn event DBN9888 was treated as follows: 1) not spraying; 2) spraying the Roundup herbicide at the V3 leaf stage at a dose of 1680 g ae/ha (ae/ha means "active ingredient equivalent acid per hectare") Then, spray the Roundup herbicide at the same dose in the V8 period; 3) Spray the Basta herbicide at the V3 leaf stage at a dose of 800g ai/ha (ai/ha means “active ingredient per hectare”). The Basta herbicide was then sprayed again at the same dose in the V8 period. It should be noted that glyphosate herbicides of different contents and dosage forms are converted into the same amount of glyphosate acid, and different concentrations of glufosinate solution are converted into the above-mentioned equivalent components of glufosinate, and the following conclusions are applicable.

The symptoms of the phytotoxicity were investigated 1 week and 2 weeks after the administration, and the corn yield of the plot was measured at the time of harvest. The classification of phytotoxicity symptoms is shown in Table 6. The herbicide victimization rate is used as an indicator for evaluating the herbicide tolerance of the transformation event, specifically, the herbicide victimization rate (%) = ∑ (number of affected plants × number of grades) / (total number of plants × highest level); The rate of damage to the agent includes glyphosate damage rate and glufosinate damage rate. The herbicide victimization rate is determined based on the results of the investigation of the phytotoxicity 2 weeks after glyphosate or glufosinate treatment. The corn yield per plot is the total yield (weight) of corn kernels in the middle 3 rows of each plot. The yield difference between different treatments is measured as the percentage of yield. The percentage of yield (%) = spray yield / no spray Yield. The results of the tolerant tolerance of the transgenic maize event DBN9888 and the results of maize yield are shown in Table 7.

Table 6. Grading criteria for herbicide damage to corn

Table 7. Results of herbicide tolerance and maize yield results for the transgenic maize event DBN9888

The results showed that in terms of the herbicide (glyphosate and glufosinate) damage rate: 1) the genetically modified corn event DBN9888 was basically 0 under the glyphosate herbicide (1680 g ae/ha) treatment; the transgenic corn event DBN9888 was The damage rate of glufosinate herbicide (800 g ai/ha) was also essentially 0; thus, the transgenic maize event DBN9888 had good tolerance to herbicides (glyphosate and glufosinate).

In terms of yield: the transgenic corn event DBN9888 did not differ significantly in yields without spraying, glyphosate herbicide (1680 ga.e./ha) and glufosinate herbicide (800 g ai/ha); After the herbicide, the yield of the transgenic corn event DBN9888 was not substantially reduced, thereby further indicating that the transgenic maize event DBN9888 has good tolerance to herbicides (glyphosate and glufosinate).

Sixth embodiment

Such as agricultural products or commodities can be produced by the genetically modified corn event DBN9888. If sufficient expression levels are detected in the agricultural product or commodity, the agricultural product or commodity is expected to contain a nucleotide sequence capable of diagnosing the presence of the transgenic maize event DBN9888 material in the agricultural product or commodity. The agricultural product or commodity includes, but is not limited to, corn oil, corn meal, cornmeal, corn gluten, tortilla, corn starch, and any other food product to be consumed as a food source for the animal, or otherwise as a swelling or cosmetic composition. The ingredients are used for cosmetic purposes and the like. A nucleic acid detection method and/or kit based on a probe or primer pair can be developed to detect a transgenic maize event DBN9888 nucleotide sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2 in a biological sample, wherein the probe The sequence or primer sequence is selected from the sequences set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5 to diagnose the presence of the transgenic maize event DBN9888.

In summary, the transgenic corn event DBN9888 of the present invention has good tolerance to glyphosate herbicides and glufosinate herbicides, has no effect on the yield, and the detection method can accurately and quickly identify whether the biological sample contains the transgene. The DNA molecule of the corn event DBN9888.

The seed corresponding to the genetically modified corn event DBN9888 was deposited on December 24, 2014 at the General Microbiology Center of China Microbial Culture Collection Management Committee (CGMCC, Address: Beijing No. 3, Beichen West Road, Chaoyang District, Institute of Microbiology, Chinese Academy of Sciences, 100101), classification: Maize (Zea mays), deposit number CGMCC No.10216, and converted to Budapest according to February 17, 2016 International deposit of the treaty. The deposit will be kept at the depository for 30 years.

It should be noted that the above embodiments are merely illustrative of the technical solutions of the present invention, and are not intended to be limiting, although the present invention will be described in detail with reference to the preferred embodiments. Modifications or equivalents may be made without departing from the spirit and scope of the invention.

Claims (25)

1. A nucleic acid molecule having a nucleic acid sequence comprising at least 11 contiguous nucleotides of SEQ ID NO: 3 or its complement, and/or at least 11 of SEQ ID NO: 4 or its complement Continuous nucleotides.
2. The nucleic acid sequence according to claim 1, wherein the nucleic acid sequence comprises SEQ ID NO: 1 or its complement, and/or SEQ ID NO: 2 or its complement.
3. The nucleic acid sequence according to claim 2, wherein the nucleic acid sequence comprises SEQ ID NO: 3 or its complement, and/or SEQ ID NO: 4 or its complement.
4. The nucleic acid sequence according to claim 3, wherein the nucleic acid sequence comprises SEQ ID NO: 5 or a complement thereof.
5. A method of detecting the presence of DNA in a transgenic maize event DBN9888 in a sample, comprising:

   Passing the sample to be detected with at least two primers for amplifying the amplification product of the target in a nucleic acid amplification reaction;

   Performing a nucleic acid amplification reaction; and

   Detecting the presence of the target amplification product;

   Wherein the target amplification product comprises at least 11 contiguous nucleotides of SEQ ID NO: 3 or its complement, and/or at least 11 contiguous nucleotides of SEQ ID NO: 4 or its complement.
6. A method for detecting the presence of DNA in a transgenic maize event DBN9888 in a sample according to claim 5, wherein said target amplification product comprises SEQ ID NO: 1 or its complementary sequence at positions 1-11 or 12-22 consecutively Nucleotides, and/or contiguous nucleotides 1 to 11 or 12 to 22 in SEQ ID NO: 2 or its complement.
7. The method for detecting the presence of DNA of the transgenic maize event DBN9888 in a sample according to claim 5 or 6, wherein the target amplification product comprises at least one selected from the group consisting of SEQ ID NO: 1 or its complement, SEQ ID NO: 2 or its complement, SEQ ID NO: 6 or its complement, and SEQ ID NO: 7 or its complement.
8. A method for detecting the presence of DNA of a transgenic maize event DBN9888 in a sample according to any one of claims 5-7, wherein at least one of said primers comprises the core of any of claims 1-4 An acid sequence or a fragment thereof or a sequence complementary thereto.
9. A method for detecting the presence of DNA of transgenic maize event DBN9888 in a sample according to claim 8, wherein said primer comprises a first primer and a second primer, said first primer being selected from the group consisting of SEQ ID NO: 8 and SEQ ID NO: 10; the second primer is selected from the group consisting of SEQ ID NO: 9 and SEQ ID NO: 11.
10. A method of detecting the presence of DNA in a transgenic maize event DBN9888 in a sample, comprising:

    Contacting the sample to be detected with a probe comprising at least 11 contiguous nucleotides of SEQ ID NO: 3 or its complement, and/or at least 11 contiguous of SEQ ID NO: 4 or its complement Nucleotide

    Hybridizing the sample to be detected and the probe under stringent hybridization conditions;

    The hybridization of the sample to be detected and the probe is detected.
11. A method for detecting the presence of DNA in a transgenic maize event DBN9888 in a sample according to claim 10, wherein said probe comprises contiguous nucleosides 1 to 11 or 12 to 22 in SEQ ID NO: 1 or its complement An acid, and/or a contiguous nucleotide at positions 1-11 or 12-22 of SEQ ID NO: 2 or its complement.
12. A method for detecting the presence of DNA of a transgenic maize event DBN9888 in a sample according to claim 10 or 11, wherein the probe comprises or has at least one selected from the group consisting of SEQ ID NO: 1 or its complement, SEQ ID NO: 2 or its complement, SEQ ID NO: 6 or its complement, and SEQ ID NO: 7 or its complement.
13. Method for detecting the presence of DNA in transgenic maize event DBN9888 in a sample according to any one of claims 10-12, wherein the probe is a marker nucleic acid molecule and marker-assisted breeding analysis is used to determine glyphosate tolerance And/or glufosinate tolerance is genetically linked to the marker nucleic acid molecule.
14. A method of detecting the presence of DNA of a transgenic maize event DBN9888 in a sample according to any one of claims 10-13, wherein at least one of said probes is labeled with at least one fluorophore.
15. A DNA detection kit comprising at least one DNA molecule comprising at least 11 contiguous nucleotides of the homologous sequence of SEQ ID NO: 3 or a complement thereof, and/or SEQ ID NO: 4 At least 11 contiguous nucleotides in the homologous sequence or its complement, which may As a DNA primer or probe specific for the transgenic maize event DBN9888 or its progeny.
16. The DNA detecting kit according to claim 15, wherein said DNA molecule comprises SEQ ID NO: 1 or a complementary nucleotide of nucleotides 1 to 11 or 12 to 22, and/or SEQ ID NO : 2 or contiguous nucleotides 1 to 12 or 12 to 22 in the complement.
17. The DNA detecting kit according to claim 15 or 16, wherein the DNA molecule comprises at least one selected from the group consisting of the homologous sequence of SEQ ID NO: 1 or a complement thereof, and the homolog of SEQ ID NO: A sequence or a complement thereof, a homologous sequence of SEQ ID NO: 6 or a complement thereof, and a homologous sequence of SEQ ID NO: 7 or a complement thereof.
18. A plant cell or part comprising a nucleic acid sequence encoding a glyphosate-tolerant EPSPS protein, a nucleic acid sequence encoding a glufosinate-resistant PAT protein, and a nucleic acid sequence of a specific region, the nucleic acid sequence of the specific region comprising At least one of the following: the sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, and SEQ ID NO: 7.
19. A method of producing a corn plant that is tolerant to a glyphosate herbicide and/or a glufosinate herbicide, comprising:

    Introducing into the genome of the maize plant a nucleic acid sequence encoding a glyphosate-tolerant EPSPS protein and/or a nucleic acid sequence encoding a glufosinate-resistant PAT protein, and a nucleic acid sequence of a specific region, the nucleic acid of the specific region The sequence is selected from at least one nucleic acid sequence of the sequences set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 6 and SEQ ID NO:

    Preferably, the method comprises introducing into the genome of the maize plant the nucleic acid sequence set forth in SEQ ID NO: 5.
20. A method of producing a corn plant that is tolerant to a glyphosate herbicide and/or a glufosinate herbicide according to claim 19, comprising:

    Transgenic maize event DBN9888 first parent maize plant tolerant to glyphosate herbicide and glufosinate herbicide was sexually crossed with a second parental maize plant lacking glyphosate and/or glufosinate tolerance , thereby producing a large number of progeny plants;

    Treating the progeny plants with a glyphosate herbicide; and

    The progeny plants that are tolerant to glyphosate are selected.
21. A method of cultivating a corn plant that is tolerant to a glyphosate herbicide and/or a glufosinate herbicide, comprising:

    Planting at least one corn seed, the genome of the corn seed comprising: a nucleic acid sequence encoding a glyphosate-tolerant EPSPS protein and/or a nucleic acid sequence encoding a glufosinate-tolerant PAT protein, and a nucleic acid sequence of a specific region ;

    Growing the corn seed into a corn plant;

    Spraying the corn plant with an effective amount of a glyphosate herbicide and/or a glufosinate herbicide to harvest plants having reduced plant damage compared to other plants having no nucleic acid sequence of a particular region;

    The nucleic acid sequence of the specific region is selected from at least one of the sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 6, and SEQ ID NO: 7. Nucleic acid sequence;

    Preferably, the method comprises:

    Planting at least one corn seed, the genome of the corn seed comprising the nucleic acid sequence set forth in SEQ ID NO: 5;

    Growing the corn seed into a corn plant;

    The corn plants were sprayed with an effective dose of glyphosate herbicide to harvest plants having reduced plant damage compared to other plants not having SEQ ID NO: 5.
22. A method of protecting plants from damage caused by herbicides and/or controlling field weeds, comprising applying a herbicide comprising an effective amount of glyphosate and/or glufosinate to at least one transgenic corn plant In the field, the transgenic maize plant comprises in its genome a cell selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6. And at least one nucleic acid sequence of the sequence set forth in SEQ ID NO: 7, the transgenic maize plant having tolerance to a glyphosate herbicide and/or a glufosinate herbicide.
23. A method of controlling glyphosate-resistant weeds in a field of glyphosate-tolerant plants, comprising applying a herbicide comprising an effective amount of glufosinate to a transgenic corn planted with at least one glyphosate-tolerant In the field of the plant, the glyphosate-tolerant transgenic maize plant comprises in its genome a SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, at least one of the sequences of SEQ ID NO: 6 and SEQ ID NO: 7, wherein the glyphosate-tolerant transgenic maize plant has both tolerance to glufosinate herbicide.
24. A method for delaying insect resistance comprising planting at least one transgenic maize plant having glyphosate and/or glufosinate tolerance in a field planted with a pest-resistant corn plant, said glyphosate And/or glufosinate-tolerant transgenic maize plants comprising in their genome a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: At least one nucleic acid sequence of the sequences set forth in SEQ ID NO: 6 and SEQ ID NO: 7.
25. An agricultural product or commodity comprising the polynucleotide of SEQ ID NO: 1 or SEQ ID NO: 2, wherein the agricultural product or commodity is corn flour, corn flour, corn oil, corn starch, corn gluten, tortilla, cosmetics or Filler.

Images