WO2016164819A2 - Semences de plantes monocotylédones traitées par cyanobactéries et procédés associés - Google Patents

Semences de plantes monocotylédones traitées par cyanobactéries et procédés associés Download PDF

Info

Publication number
WO2016164819A2
WO2016164819A2 PCT/US2016/026777 US2016026777W WO2016164819A2 WO 2016164819 A2 WO2016164819 A2 WO 2016164819A2 US 2016026777 W US2016026777 W US 2016026777W WO 2016164819 A2 WO2016164819 A2 WO 2016164819A2
Authority
WO
WIPO (PCT)
Prior art keywords
seed
seq
composition
treated
monocot plant
Prior art date
Application number
PCT/US2016/026777
Other languages
English (en)
Other versions
WO2016164819A3 (fr
Inventor
Michael Ott
Lawrence E. Page
Original Assignee
Terra Biologics Llc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Terra Biologics Llc filed Critical Terra Biologics Llc
Publication of WO2016164819A2 publication Critical patent/WO2016164819A2/fr
Publication of WO2016164819A3 publication Critical patent/WO2016164819A3/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
    • A01N63/20—Bacteria; Substances produced thereby or obtained therefrom

Definitions

  • Cyanobacteria are photosynthetic prokaryotes of the phylum Cyanobacteria. Although Cyanobacteria have been referred to as “blue-green algae,” it is now recognized that Cyanobacteria should not be considered “algae” as they are prokaryotes rather than eukaryotes.
  • the monocot plant seed is selected from the group consisting of a rice seed, a corn seed, a sorghum seed, a turfgrass seed, a wheat seed, a biofuel crop seed, a forage crop seed, and a millet seed.
  • the turfgrass seed is a bentgrass, bermudagrass, bluegrass, buffalograss, fescue, or ryegrass seed.
  • the forage crop seed is a hay, ryegrass, or oat seed.
  • the biofuel crop seed is a Miscanthus or switchgrass seed.
  • the cyanobacterium species are characterized by having a gene encoding a 16S PvNA that has at least 95%, 97%, 98%, 99%, 99.5%, 99.7%, 99.9%, or 100% sequence identity across the entire length of SEQ ID NO: l, SEQ ID NO:2, SEQ ID NO:3, and/or SEQ ID NO:4.
  • the cyanobacterium species are characterized by having a gene encoding a 16S RNA that has at least 95%, 97%, 98%, 99%, 99.5%, 99.7%, 99.9%, or 100% sequence identity across the entire length of SEQ ID NO: l and/or SEQ ID NO:4.
  • the cyanobacterium species is or are of the order Nostocales.
  • the composition comprises one, two, three, or four cyanobacterium species that are members of the family Nostocaceae and/or at least one cyanobacterium species that is a member of the family Microchaetaceae.
  • the member or members of the family Nostocaceae are selected from the group consisting of a Nostoc sp., an Aulosira sp., an Anabaena sp., and wherein the member the family Microchaetaceae is a Tolypothrix sp.
  • the member or members of the family Nostocaceae are selected from the group consisting of a Nostoc commune UTEX B 1621 culture, an Aulosira bohemensis UTEX B 2947 culture, an Anabaena cylindrica UTEX B 1611 culture, isolate(s) therefrom, and a variant thereof and wherein the member or members of the family Microchaetaceae are selected from the group consisting of a Tolypothrix distorta UTEX 424 culture, isolate(s) therefrom, and a variant thereof.
  • the member or members of the family Nostocaceae are characterized by having a gene encoding a 16S RNA that has at least 95%, 97%, 98%, 99%, 99.5%, 99.7%, 99.9%, or 100% sequence identity across the entire length of SEQ ID NO: l, SEQ ID NO:2, or SEQ ID NO:3, and wherein the member or members of the family Microchaetaceae are characterized by having a gene encoding a 16S RNA that has at least 95%, 97%, 98%, 99%, 99.5%, 99.7%, 99.9%, or 100% sequence identity across the entire length of SEQ ID NO:4.
  • the member or members of the family Nostocaceae are characterized by having a gene encoding a 16S RNA that has at least 95%, 97%, 98%, 99%, 99.5%, 99.7%, 99.9%, or 100% sequence identity across the entire length of SEQ ID NO: l and wherein the member or members of the family Microchaetaceae are characterized by having a gene encoding a 16S RNA that has at least 95%, 97%, 98%, 99%, 99.5%, 99.7%, 99.9%, or 100% sequence identity across the entire length of SEQ ID NO:4.
  • the cyanobacteria are any one of: (i) Aulosira sp.
  • the cyanobacteria are characterized by having a gene encoding a 16S RNA that has at least 95%, 97%, 98%, 99%, 99.5%, 99.7%, 99.9%, or 100% sequence identity across the entire length of: (i) SEQ ID NO: l; (ii) SEQ ID NO: l and SEQ ID NO:2; (iii) SEQ ID NO: l and SEQ ID NO:4; or (iv) SEQ ID NO:3 and SEQ ID NO:4.
  • the seed is a corn seed and wherein lateral root hair growth in a seedling obtained from the treated corn seed is increased in comparison to lateral root hair growth in a seedling obtained from an untreated control corn seed.
  • the seed is a rice seed and wherein biomass, grain yield, and/or nitrogen uptake of a plant obtained from the treated rice seed is increased in comparison to biomass, grain yield, and/or nitrogen uptake of a plant obtained from an untreated control rice seed.
  • the agriculturally acceptable adjuvant comprises an insecticide, a fungicide, a safener, and combinations thereof.
  • the insecticide is selected from the group consisting of a carbamate, an organophosphate, a neonicotinoid, a pyrethroid, and combinations thereof.
  • neonicotinoid insecticide is selected from the group consisting of thiamethoxam, imidacloprid, clothianidin, nitenpyram, nithiazine, thiacloprid, and combinations thereof.
  • exogenous tackifier content is reduced in comparison to exogenous tackifier content of a standard microbial seed inoculant.
  • the composition contains at least one element selected from the group consisting of iron, boron, manganese, zinc, molybdenum, copper, cobalt, salts thereof, and combinations thereof.
  • the cyanobacterium is not associated with the plant seed in nature; (ii) the composition comprises at least two cyanobacterium species that are not associated with the plant seed in nature; (iii) the composition comprises at least two cyanobacterium species that are not associated with one another in nature; or (iv) the composition comprises an exopolysaccharide (EPS).
  • EPS exopolysaccharide
  • the composition has been lyophilized or has been dried upon the surface of the seed.
  • the composition comprises about 1 milligram to about 500 milligrams per seed of the cyanobacterium species.
  • the seed is dorman
  • Also provided are methods of improving lateral root hair growth in a corn seedling comprising exposing a corn seed to an effective amount of a composition comprising: (i) at least one cyanobacterium species; and (ii) an agriculturally acceptable adjuvant or an agriculturally acceptable excipient and allowing the seed to germinate, wherein lateral root hair growth in a seedling obtained from the corn seed exposed to the composition is increased in comparison to lateral root hair growth a seedling obtained from a control corn seed that was not exposed to the composition.
  • the exposing comprises applying the composition to the seed by an either in furrow application or by a soil drench application.
  • the exposing comprises applying the composition to a surface of the seed to obtain a seed that is at least partially coated with the composition, by an in furrow application, by a soil drench application, or any combination thereof.
  • the seed is dormant before, during, and/or after treatment.
  • Also provided are methods of improving plant growth in a monocot plant comprising exposing a seed to an effective amount of a composition comprising: (i) at least one cyanobacterium species; and (ii) an agriculturally acceptable adjuvant, an agriculturally acceptable excipient, or combination thereof and allowing the seed to germinate, wherein growth of a monocot plant obtained from the seed exposed to the composition is increased in comparison to growth of a monocot plant obtained from a control monocot plant seed that was not exposed to the composition.
  • the monocot plant seed is selected from the group consisting of a rice seed, a corn seed, a sorghum seed, a turfgrass seed, a wheat seed, a biofuel crop seed, a forage crop seed, and a millet seed.
  • the turfgrass seed is a bentgrass, bermudagrass, bluegrass, buffalograss, fescue, or ryegrass seed.
  • the forage crop seed is a hay, ryegrass, or oat.
  • the biofuel crop seed is a Miscanthus or switchgrass seed.
  • the plant growth is improved under conditions where nitrogen is limiting.
  • the exposing comprises applying the composition to a surface of the seed to obtain a seed that is at least partially coated with the composition.
  • nitrogen fertilizer is not used.
  • a suboptimal amount nitrogen fertilizer is used. In certain embodiments, less than about 70, 100, or 200 lb/acre of nitrogen fertilizer is used.
  • the seed is dormant before, during, and/or after treatment.
  • Also provided are methods of improving biomass, grain yield, and/or nitrogen uptake in a monocot plant comprising exposing a monocot seed to an effective amount of a composition comprising: (i) at least one cyanobacterium species; and (ii) an agriculturally acceptable adjuvant, an agriculturally acceptable excipient, or combination thereof and allowing the seed to germinate, wherein biomass, grain yield, and/or nitrogen uptake in a monocot plant obtained from the monocot seed exposed to the composition is increased in comparison to biomass, grain yield, and/or nitrogen uptake in a monocot plant obtained from a control monocot seed that was not exposed to the composition.
  • the monocot plant seed is selected from the group consisting of a rice seed, a corn seed, a sorghum seed, a turfgrass seed, a wheat seed, a biofuel crop seed, a forage crop seed, and a millet seed.
  • the turfgrass seed is a bentgrass, bermudagrass, bluegrass, buffalograss, fescue, or ryegrass seed.
  • the forage crop seed is a hay, ryegrass, or oat.
  • the biofuel crop seed is a Miscanthus or switchgrass seed.
  • the seed is dormant before, during, and/or after treatment.
  • Also provided are method of improving biomass, grain yield, and/or nitrogen uptake in a rice plant comprising exposing a rice seed to an effective amount of a composition comprising: (i) at least one cyanobacterium species; and (ii) an agriculturally acceptable adjuvant, an agriculturally acceptable excipient, or combination thereof and allowing the seed to germinate, wherein biomass, grain yield, and/or nitrogen uptake in a rice plant obtained from the rice seed exposed to the composition is increased in comparison to biomass, grain yield, and/or nitrogen uptake in a rice plant obtained from a control rice seed that was not exposed to the composition.
  • the exposing comprises applying the composition to a surface of the seed to obtain a seed that is at least partially coated with the composition.
  • nitrogen fertilizer is not used. In certain embodiments, a suboptimal amount of nitrogen fertilizer is used. In certain embodiments, less than about 70, 100, or 150 lb/acre of nitrogen fertilizer is used. In certain embodiments, the seed is dormant before, during, and/or after treatment.
  • Also provided are methods of obtaining a monocot plant seed that provides for improved growth in a monocot plant obtained from the seed comprising applying a composition comprising: (i) at least one cyanobacterium species; and (ii) an agriculturally acceptable adjuvant, an agriculturally acceptable excipient, or combination thereof to at least one surface of the seed to obtain a seed that is at least partially coated with the composition, wherein growth of a monocot plant obtained from the treated monocot plant seed is increased in comparison to growth in a monocot plant obtained from an untreated control monocot plant seed.
  • the monocot plant seed is selected from the group consisting of a rice seed, a corn seed, a sorghum seed, a turfgrass seed, a wheat seed, a biofuel crop seed, a forage crop seed, and a millet seed.
  • the turfgrass seed is a bentgrass, bermudagrass, bluegrass, buffalograss, fescue, or ryegrass seed.
  • the forage crop seed is a hay, ryegrass, or oat.
  • the biofuel crop seed is a Miscanthus or switchgrass seed.
  • the seed is dormant before, during, and/or after treatment.
  • Also provided are methods of obtaining a corn seed that provides for improved lateral root hair growth in a seedling obtained from the corn seed comprising applying a composition comprising: (i) at least one cyanobacterium species; and (ii) an agriculturally acceptable adjuvant, an agriculturally acceptable excipient, or combination thereof to at least one surface of the seed to obtain a seed that is at least partially coated with the composition, wherein lateral root hair growth in a seedling obtained from the treated corn seed is increased in comparison to lateral root hair growth a seedling obtained from an untreated control corn seed.
  • the seed is dormant before, during, and/or after treatment.
  • Also provided are methods of obtaining a rice seed that provides for improved biomass, grain yield, and/or nitrogen uptake in a rice plant obtained from the rice seed comprising applying a composition comprising: (i) at least one cyanobacterium species; and (ii) an agriculturally acceptable adjuvant, an agriculturally acceptable excipient, or combination thereof to at least one surface of the seed to obtain a seed that is at least partially coated with the composition, wherein biomass, grain yield, and/or nitrogen uptake in a rice plant obtained from the treated rice seed is increased in comparison to biomass, grain yield, and/or nitrogen uptake in a rice plant obtained from an untreated control rice seed.
  • the seed is dormant before, during, and/or after treatment.
  • the composition is lyophilized. In certain aspects of any of the aforementioned methods or uses, the composition is applied as a liquid or slurry. In certain aspects of any of the aforementioned methods or uses, the composition is dried upon the surface of the seed. In certain aspects of any of the aforementioned methods or uses, the composition comprises about 1, 2, or 4 milligrams to about 50, 100, or 500 milligrams per seed of the cyanobacterium species.
  • the cyanobacterium are characterized by having a gene encoding a 16S RNA that has at least 95%, 97%, 98%, 99%, 99.5%, 99.7%, 99.9%, or 100% sequence identity across the entire length of SEQ ID NO: l, SEQ ID NO:2, SEQ ID NO:3, and/or SEQ ID NO:4.
  • the cyanobacterium are characterized by having a gene encoding a 16S RNA that has at least 95%, 97%, 98%, 99%, 99.5%, 99.7%, 99.9%, or 100% sequence identity across the entire length of SEQ ID NO: l and/or SEQ ID NO:4.
  • the cyanobacterium species is or are of the order Nostocales.
  • the composition comprises one, two, three, or four cyanobacterium species that are members of the family Nostocaceae and/or at least one cyanobacterium species that is a member of the family Microchaetaceae.
  • the member or members of the family Nostocaceae are characterized by having a gene encoding a 16S RNA that has at least 95%, 97%, 98%, 99%, 99.5%, 99.7%, 99.9%, or 100% sequence identity across the entire length of SEQ ID NO: l, SEQ ID NO:2, or SEQ ID NO:3, and wherein the member or members of the family Microchaetaceae are characterized by having a gene encoding a 16S RNA that has at least 95%, 97%, 98%, 99%, 99.5%, 99.7%, 99.9%, or 100% sequence identity across the entire length of SEQ ID NO:4.
  • the member or members of the family Nostocaceae are characterized by having a gene encoding a 16S RNA that has at least 95%, 97%, 98%, 99%, 99.5%, 99.7%, 99.9%, or 100% sequence identity across the entire length of SEQ ID NO: l and wherein the member or members of the family Microchaetaceae are characterized by having a gene encoding a 16S RNA that has at least 95%, 97%, 98%, 99%, 99.5%, 99.7%, 99.9%, or 100% sequence identity across the entire length of SEQ ID NO:4.
  • the member or members of the family Nostocaceae are selected from the group consisting of a Nostoc sp., an Aulosira sp., an Anabaena sp., and wherein the member of the family Microchaetaceae is a Tolypothrix sp.
  • the member or members of the family Nostocaceae are selected from the group consisting of a Nostoc commune UTEX B 1621 culture, an Aulosira bohemensis UTEX B 2947 culture, an Anabaena cylindrica UTEX B 1611 culture, isolate(s) therefrom, and a variant thereof and wherein the member or members of the family Microchaetaceae are selected from the group consisting of a Tolypothrix distorta UTEX 424 culture, isolate(s) therefrom, and a variant thereof.
  • the cyanobacteria any one of: (i) Aulosira sp.
  • the cyanobacteria are characterized by having a gene encoding a 16S RNA that has at least 95%, 97%, 98%, 99%, 99.5%, 99.7%, 99.9%, or 100% sequence identity across the entire length of: (i) SEQ ID NO: l; (ii) SEQ ID NO: l and SEQ ID NO:2; (iii) SEQ ID NO: l and SEQ ID NO:4; (iv) SEQ ID NO: l, SEQ ID NO:2, and SEQ ID NO:3; or (v) SEQ ID NO:4.
  • the cyanobacteria are any one of: (i) Aulosira bohemensis sp.; and a Tolypothrix distorta.; (ii) Aulosira bohemensis; (iii) Aulosira bohemensis.; and Anabaena cylindrica; (iv) Aulosira bohemensis; Anabaena cylindrica; and Tolypothrix distorta; or (v) Nostoc commune.
  • the agriculturally acceptable adjuvant comprises an insecticide, a fungicide, a safener, and combinations thereof.
  • insecticide is selected from the group consisting of a carbamate, an organophosphate, a neonicotinoid, a pyrethroid, and combinations thereof.
  • the neonicotinoid insecticide is selected from the group consisting of thiamethoxam, imidacloprid, clothianidin, nitenpyram, nithiazine, thiacloprid, and combinations thereof.
  • the cyanobacterium is not associated with the plant seed in nature; (ii) the composition comprises at least two cyanobacterium species that are not associated with the plant seed in nature; (iii) the composition comprises at least two cyanobacterium species that are not associated with one another in nature; or (iv) the composition comprises an exopolysaccharide (EPS).
  • the seed is dormant before, during, and/or after treatment.
  • Figure 1 shows the effects of treating corn seeds with cyanobacteria. Root hair formation was visualized using digital photography. Seeds on the left were not treated with cyanobacteria, while seeds on the right were treated with 4 mg of cyanobacteria. An increase in lateral root and lateral root hair formation was observed in the cyanobacteria- treated seeds. Images were taken on day 6 of the germination test.
  • FIG. 2 shows the effects of a topical application of cyanobacteria on rice biomass accumulation at half-heading.
  • Statistically significant biomass accumulation (Y- axis) was observed across all fertilizer levels (X-axis) tested.
  • the cyanobacteria application rate (BSC) is represented by the bar shading and accumulation rate improvement over control (OX) is listed on the graph over each bar as a percentage. No statistical significance was observed between the cyanobacteria application rates, meaning both rates were equally effective in improving accumulation.
  • Figure 3 shows the response of two corn varieties (hybrid germplasms) to three cyanobacteria treatments (A, B, C) under four fertilizer levels is depicted. Statistically significant improvements relative to the control that are positive are above the baseline and shown as open bars. Statistically significant negative effects relative to the control are below the baseline and shown as black bars. Effects relative to the control that were not statistically significant are shown with grey bars Biomass increased in week 3 and week 4 of growth in multiple treatments and multiple fertilizer levels.
  • Figure 4 shows the response of corn germplasms Gl and G2 to three cyanobacteria treatments under two fertilizer levels. Statistically significant improvements relative to the control that are positive are denoted by open (white) squares. Statistically significant negative effects relative to the control are denoted by black squares. All grey squares showed no statistically significant effect over control. Germplasm 2 (G2) showed 27 positive responses compared to 13 negative responses. DETAILED DESCRIPTION
  • monocot plant seeds treated with various cyanobacterial compositions that deliver improved monocot plant growth characteristics, methods of making the treated seeds, and methods of using the seeds.
  • improved growth characteristics conferred by the seed treatments include, but are not limited to, improved nitrogen uptake, increased lateral root hair growth, and increased yield under nitrogen limiting growth conditions.
  • monocot plant seeds, methods of making, and methods of use where the seeds are treated with combinations of cyanobacterium species that can effect more pronounced improvements in the aforementioned growth characteristics when compared to untreated seeds or seeds treated with other combinations of cyanobacterium species.
  • Cyanobacteria used in the compositions provided herein include, but are not limited to, cyanobacteria in the order Nostocales.
  • the composition comprises at least one, two, three, or four cyanobacterium species that are members of the family Nostocaceae and/or at least one cyanobacterium species that is a member of the family Microchaetaceae.
  • the member or members of the family Nostocaceae are selected from the group consisting of a Nostoc sp., an Aulosira sp., an Anabaena sp., and the member the family Microchaetaceae is a Tolypothrix sp.
  • Non-limiting examples of a Nostoc sp., an Aulosira sp., an Anabaena sp., and a Tolypothrix sp. and cultures comprising the same that can be used in certain embodiments of the compositions are provided in the following Table 1.
  • Cyanobacterium that can be used in the compositions used to treat the seeds and related methods of making or use can also be identified by the sequence of the gene encoding the 16S RNA.
  • the cyanobacteria that are used are characterized by having a gene encoding a 16S RNA that has at least about 95%, 97%, 98%, 99%, 99.5%, 99.7%, 99.9%, or 100% sequence identity across the entire length of SEQ ID NO: l, SEQ ID NO:2, SEQ ID NO:3, and/or SEQ ID NO:4.
  • Useful 16S RNA sequences for identifying cyanobacteria that can be used in the compositions are provided in Table 2. Table 2. Cyanobacterium 16S RNA sequences
  • Tolypothrix 4 CGAAAGCCTGACGGAGCAATACCGCGTGAGGGAGGAAGGCTCTTGGGTTG
  • 16S consensus sequences were generated by harvesting liquid cyanobacterial cultures, amplifying the 16S ribosomal region by PCR, gel-purifying the 16S band, and sequencing the resulting PCR product. Sequences are made up of many reads that were combined to generate a consensus sequence. Lower-case letters in the published sequences denote locations where variation was found in the base at that position such that it reduced confidence to below the set threshold.
  • a cyanobacterium useful in certain compositions and methods provided herein can also be obtained by isolation from terrestrial sources including, but not limited to soil and plants, as well as aquatic sources.
  • One useful method for isolating cyanobacteria that can be used involves nutrient saturated glass fiber filters in combination with a broad spectrum beta-lactam antibiotic to isolate cyanobacteria (Ferris and Hirsch, Appl. Environ.
  • the isolates are obtained from a non-axenic Nostoc commune UTEX B 1621 culture, a non-axenic Aulosira bohemensis UTEX B 2947 culture, a non-axenic Anabaena cylindrica UTEX B 1611 culture, and a non-axenic Tolypothrix distorta UTEX 424 culture.
  • the cyanobacteria variants are variants that have been induced by mutagenesis and selected for one or more useful traits. Mutagenesis techniques include, but are not limited to use of alkylating agents, intercalating agents, transposons, and the like. Cyanobacteria variants can be screened and then selected for useful traits that include, but are not limited to, increased phototaxis, changes in genome copy number, increased protein production, or altered pigment expression. Variants can also be obtained where the cyanobacteria have been genetically transformed with a heterologous transgene. Methods for transforming cyanobacteria that have been disclosed (Chaurasia, et al., J Microbiol Methods. 73(2): 133- 41, 2008) can be used to obtain such variants.
  • Seeds treated with compositions provided herein can be used to improve a variety of monocot plant growth characteristics including, but not limited to, plant biomass, grain yield, lateral root growth, lateral root hair growth, growth under nitrogen limiting conditions, and/or nitrogen uptake.
  • the improvement in the monocot plant growth characteristic is in comparison to the growth characteristic of a monocot plant obtained from an untreated monocot plant seed.
  • the improvement in the monocot plant growth characteristic is in comparison to the growth characteristic of a monocot plant that has been treated with a topical application of cyanobacteria.
  • the improvement in the monocot plant growth characteristic is in comparison to the growth characteristic of a monocot plant that has been treated with a topical application of a cyanobacterial mixture of a Nostoc commune UTEX B 1621 culture, a Aulosira bohemensis UTEX B 2947 culture, a Anabaena cylindrica UTEX B 1611 culture, and a Tolypothrix distorta UTEX 424 culture.
  • the improvement in the monocot plant growth characteristic is in comparison to the growth characteristic of a monocot plant obtained from a monocot plant seed treated with a cyanobacterial mixture of a Nostoc commune UTEX B 1621 culture, a Aulosira bohemensis UTEX B 2947 culture, a Anabaena cylindrica UTEX B 1611 culture, and a Tolypothrix distorta UTEX 424 culture.
  • monocot seeds are treated with a composition having: (i) Aulosira sp. and Anabaena sp.; (ii) Aulosira sp.; or (iii) Aulosira sp.
  • monocot seeds are treated with a composition having: (i) Aulosira sp., Anabaena sp., and Tolypothrix sp., or (ii) Nostoc sp.
  • monocot seeds are treated with a composition having Aulosira sp., Anabaena sp., Tolypothrix sp., and Nostoc sp.
  • monocot seeds are treated with a composition having: (i) an Aulosira bohemensis sp. and a Tolypothrix distorta sp.; (ii) an Aulosira bohemensis sp.; (iii) an Aulosira bohemensis sp.
  • the cyanobacteria used in the composition can be characterized by having at least about 95%, 97%, 98%, 99%, 99.5%, 99.7%, 99.9%, or 100% sequence identity across the entire length of SEQ ID NO: l, SEQ ID NO:2, SEQ ID NO:3, and/or SEQ ID NO:4.
  • cyanobacteria that can be used in the compositions and methods provided herein that are characterized by having at least about 95%, sequence identity across the entire length of SEQ ID NO: l, SEQ ID NO:2, SEQ ID NO:3, and/or SEQ ID NO:4 include, but are not limited to, one or more of the cyanobacteria provided in Table 3.
  • Representative examples of cyanobacteria that can be used in the compositions and methods provided herein also include, but are not limited to, combinations of the cyanobacteria provided in Tables 1 and 3.
  • the monocot plant or monocot seed can be a rice, a corn, a sorghum, a turfgrass, a biofuel crop seed, a forage crop, a wheat, a hay, or a millet plant seed.
  • the turfgrass seed is a bentgrass, bermudagrass, bluegrass, buffalograss, fescue, ryegrass, or other turfgrass seed.
  • the forage crop seed is a hay, ryegrass, oat, or other forage crop seed.
  • the biofuel crop seed is a Miscanthus, switchgrass, or other biofuel crop seed.
  • NCBI National Center Biotechnology Information National Center for Biotechnology Information
  • ATCC American Type Culture Collection isolates can be accessed via the internet at the World Wide Web site "atcc.org.” The address for the ATCC is 10801 University Boulevard Manassas, VA 20110 USA.
  • any method of measuring the growth characteristic can be employed.
  • the biomass, grain yield, and the like can be assessed by determining the mass of plant material obtained, the mass of seeds obtained, or the number of seeds and a per plant or per unit area (e.g., per acre or hectare) basis.
  • Lateral root growth and lateral root hair growth can be determined by methods that include, but are not limited to, direct counts of lateral roots and lateral root hairs, by image analysis of root systems, and/or by determining wet or dry weights of the lateral roots and lateral root hairs.
  • the phrase "lateral root” refers to a root that originates from a primary or nodal root.
  • the phrase “lateral root hair” refers to a root hair that originates from a lateral root.
  • compositions provided herein can be used to improve monocot plant growth under nitrogen limiting conditions and/or to improve nitrogen uptake by monocot plants.
  • nitrogen limiting conditions or “a suboptimal amount of nitrogen fertilizer is used” refer to conditions where plant growth or yield can be increased upon supplementing the plant growth medium (e.g., soil, synthetic rooting mixes, hydroponic liquids, flooded fields, and the like) with exogenous nitrogen or by improving the availability of nitrogen already present in the plant growth medium.
  • the plant growth medium e.g., soil, synthetic rooting mixes, hydroponic liquids, flooded fields, and the like
  • compositions having: (i) Aulosira sp.
  • the Aulosira sp., Anabaena sp., Nostoc sp., and/or Tolypothrix sp. used in the composition can be characterized by having at least about 95%, 97%, 98%, 99%, 99.5%, 99.7%, 99.9%, or 100% sequence identity across the entire length of SEQ ID NO: l, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4, respectively.
  • rice seeds are treated with a composition having: (i) an Aulosira sp., and a Tolypothrix sp.; (ii) an Aulosira sp; (iii) an Aulosira sp.
  • corn seeds are treated with a composition having: (i) Aulosira bohemensis and Tolypothrix distorta; (ii) Aulosira bohemensis; (iii) Aulosira bohemensis and Anabaena cylindrica; (iv) an Aulosira bohemensis, an Anabaena cylindrica sp., and a Tolypothrix distorta sp.; or (v) a Nostoc commune sp.
  • wheat seeds are treated with a composition having: (i) Aulosira bohemensis and Tolypothrix distorta; (ii) Aulosira bohemensis; (iii) Aulosira bohemensis and Anabaena cylindrica; (iv) an Aulosira bohemensis, an Anabaena cylindrica sp., and a Tolypothrix distorta sp.; or (v) a Nostoc commune sp.
  • improvements in monocot plant growth or monocot plant yield obtained by seed treatments with cyanobacterial compositions provided herein under any of the aforementioned nitrogen limiting conditions can be at least about 3%, 4%, 9%, 10%, 15%, or 20% in comparison to an untreated control monocot plant or can be about 3%, 4%, 5%, 10%), to about 15%), 18%, 20%, 30%>, or 40% in comparison to an untreated control monocot plant.
  • improvements in monocot plant growth or monocot plant yield under any of the aforementioned nitrogen limiting conditions with a cyanobacterial seed treatment provided herein can be at least about 3%, 4%, 9%, or 10% in comparison to an untreated control monocot plant or can be about 3%, 4%, 5%, to about 10%, 15%, 18%, or 25% in comparison to a monocot plant subjected to a topical treatment of the cyanobacteria.
  • Nitrogen uptake by plants obtained from seeds treated with the cyanobacterial compositions provided herein can be improved under nitrogen limiting conditions and under conditions where nitrogen is not limiting. Nitrogen uptake can be determined by a variety of methods that include, but are not limited to, isotopic and non-isotopic methods that have been described (Sandrock et a. Hort. Sci. 40(3):665, 2005; Norman et al. Soil Sci. Soc. Am. J. 56: 1521-1527. 1992).
  • improvements in nitrogen uptake by monocot plants obtained by seed treatments with cyanobacterial compositions provided herein under any of the aforementioned nitrogen limiting conditions can be at least about 3%, 4%, 5%, 10%, 20%, 40%, 50% or 60% in comparison to an untreated control monocot plant or can be about 3%, 4%, 5%, 10%, to about 15%, 18%, 20%, 40%, 60%, or 70% in comparison to an untreated control monocot plant.
  • improvements in nitrogen uptake under any of the aforementioned nitrogen limiting conditions with a cyanobacterial seed treatment provided herein can be at least about 3%, 4%, 9%, or 10% in comparison to an untreated control monocot plant or can be about 3%), 4%), 5%), to about 10%, 15%, 20%, 30%, or 40% in comparison to a monocot plant subjected to a topical treatment of the cyanobacteria.
  • the monocot plant or monocot seed can be a rice, a corn, a sorghum, a turfgrass, a biofuel crop, a forage crop, a wheat, a hay, or a millet plant or seed.
  • the turfgrass seed is a bentgrass, bermudagrass, bluegrass, buffalograss, fescue, ryegrass, or other turfgrass seed.
  • the forage crop seed is a hay, ryegrass, oat, or other forage crop seed.
  • the biofuel crop seed is a Miscanthus, switchgrass, or other biofuel crop seed.
  • compositions used to treat monocot plant seeds can comprise (i) at least one cyanobacterium species; and (ii) an agriculturally acceptable adjuvant, an agriculturally acceptable excipient, or a combination thereof.
  • the composition will provide about 1, 2, 4, or 5 milligrams to about 50, 100, 200, 300, 400, or 500 milligrams per seed of the cyanobacterium species.
  • a total of about 1, 2, 4, or 5 milligrams to about 50, 100, 200, 300, 400, or 500 milligrams per seed of the collected group of cyanobacterium species is provided. Ratios of the cyanobacteria within the composition can be varied.
  • each cyanobacterium species can be provided in the composition.
  • a 3: 1 : 1 : 1 mixture by mass of Nostoc sp., Aulosira sp., Anabaena sp., and Tolypothrix sp., respectively, can be used.
  • ratios of about 1 : 1 : 1 of an Aulosira sp., an Anabaena sp., and a Tolypothrix sp. can be used. In certain embodiments, any of the aforementioned ratios are used to provide a total of about 1, 2, 4, or 5 milligrams to about 50, 100, 200, 300, 400, or 500 milligrams per seed of the collected group of cyanobacterium species.
  • Agriculturally acceptable adjuvants used in the compositions can include, but are not limited to, one or more insecticides, fungicides, safeners, and combinations thereof. Such adjuvants can be selected for an absence of bacteriocidal, bacteriostatic, or bacterio-inhibitory activities that would reduce the effectiveness of the cyanobacteria provided in the composition.
  • the adjuvants can include one or more of a carbamate, an organophosphate, a neonicotinoid, or a pyrethroid insecticide.
  • the fungicide can include one or more of an azole, strobilurin, or metalaxyl compounds.
  • Useful azole fungicides include, but are not limited to, difenoconazole, prothioconazole, and tebuconazole compounds.
  • Useful strobilurin fungicides include, but are not limited to, kresoxim-methyl, azoxystrobin, trifloxystrobin, fluoxastrobin, picoxystrobin, pyraclostrobin, dimoxystrobin, pyribencarb, metominostrobin, orysastrobin, enestrobin, pyraoxystrobin and pyrametostrobin compounds.
  • Useful metalaxyl fungicides include, but are not limited to, metalaxyl and mefenoxam.
  • Agriculturally acceptable excipients used in the compositions can include, but are not limited to, one or more bulking agents, binding agents, colorants, emulsifiers, oils, tackifiers, trace elements, and /or extending agents.
  • Useful bulking agents include, but are not limited to, peat, wood flour, calcium carbonate, lime, diatomaceous earth, forms of clay such as bentonite and kaolin, and combinations thereof.
  • Useful binding agents can be water soluble polymers and/or waxes.
  • Binding agents that are used can include, but are not limited to, polyvinyl acetate, polyvinyl alcohol, polyvinyl pyrrolidone, polyurethane, methyl cellulose, carboxymethyl cellulose, hydroxylpropyl cellulose, sodium alginate, polyurethane, polyacrylate, casein, gelatin, pullulan, polyacrylamide, polyethylene oxide, polystyrene, styrene acrylic copolymers, styrene butadiene polymers, poly(N- vinylacetamide), and combinations thereof.
  • Waxes used as binders can include, but are not limited to, waxes such as carnauba wax, paraffin wax, polyethylene wax, bees wax, and polypropylene wax.
  • Emulsifiers can be either ionic or non-ionic agents.
  • Emulsifiers that can be used include, but are not limited to, lecithin, polysorbates, polyethylene glycols, derivatives thereof, and the like.
  • Oils that can be used include, but are not limited to, silicon, animal, plant, or mineral oils and mixtures thereof.
  • an exogenous tackifier can be added to the composition. However, content of an exogenous tackifier can be reduced in certain embodiments and in comparison to exogenous tackifier content of a standard microbial seed inoculant.
  • the composition can also contains at least one element selected from the group consisting of iron, boron, manganese, zinc, molybdenum, copper, cobalt, salts thereof, and combinations thereof.
  • Extenders are materials that provide for improvements in the viability of cyanobacteria on the seed either pre or post planting.
  • Useful extenders include, but are not limited to, compounds such as trehalose, sucrose, glycerol, sorbitol, and combinations thereof.
  • Liquid seed treatment inoculums containing various microorganisms and extenders comprising one or more of trehalose, sucrose, glycerol or sorbitol at about 5% to about 50% by weight/volume and related methods where a partially desiccated liquid inoculant product for application to seeds is prepared are described in US Patent No. 8,020,343 and can be adapted to use with the cyanobacteria compositions provided herein. US Patent No. 8,020,343 is incorporated herein by reference in its entirety.
  • liquid seed treatment compositions that can be adapted for use with the cyanobacteria compositions provide herein can comprise sucrose, sorbitol, or a combination thereof at about 5% to 60% weight/volume, mineral oil or silicon oil at about 0.15% to about 3% weight, and an emulsifying agent selected from the group consisting of lecithin and polysorbate and are described in US Patent No. 8,551,913. US Patent No. 8,551,913 is incorporated herein by reference in its entirety.
  • Exopolysaccharides (EPS) produced by the cyanobacteria or by other bacteria can also be used as agriculturally acceptable excipients in the compositions provided herein.
  • EPS Exopolysaccharides
  • the EPS can be provided in the composition by simply adding fermentation broths, filtrates, supematants, purified fractions, partially purified fractions, and the like that are obtained from cyanobacterial or other bacterial cultures.
  • such EPS can improve water retention and/or desiccation tolerance of cyanobacteria in the compositions provided herein by slowing the desiccation process. It has been reported that bacterial EPS can help bacteria adapt to variable hydration conditions (Or et al. Advances in Water Resources, 30 (2007), pp. 1505-1527; Redmile-Gordon et al., Soil Biology & Biochemistry 72 (2014) 163el71).
  • exopolysaccharides obtained from sources other than cyanobacterial or other bacterial cultures that include, but are not limited to, fungal or yeast sources can be used either alone or in combination with the aforementioned cyanobacterial or bacterial cultures as agriculturally acceptable excipients in the compositions provided herein.
  • the aforementioned reductions in content of exogenous tackifier can be achieved in certain embodiments by using such EPS in the as agriculturally acceptable excipients in the compositions provided herein.
  • Seed coating equipment and associated techniques used to coat the seeds include, but are not limited to, drum coaters, fluidized beds, rotary coaters, side vended pan, tumble mixers, and spouted beds.
  • Nostoc commune UTEX B 1621, Anabaena cylindrica UTEX B 1611, Aulosira bohemensis UTEX B 2947, and Tolypothrix distorta UTEX 424 were maintained under constant 105 microMol photons*m "2 *sec _1 shaded cool white fluorescent light on sterile BG11 plates.
  • BG11 media has been described (Rippka Archiv fur Mikrobiologie 87, Issue 1, pp 93-98, 1972) and is commercially available (Sigma- Aldrich, St. Louis, MO). Plates were re-streaked onto fresh plates as colonies appeared using a microbiological loop under sterile conditions.
  • biomass from plates was transferred into several autoclaved 250 ml Erlenmeyer flasks containing 100 ml sterile BG11 by swishing a sterile microbiological loop containing microbial biomass (obtained from the plates) in the liquid media.
  • the Erlenmeyer flasks were stoppered with autoclaved foam stoppers.
  • a filter made of autoclaved cotton fibers was placed in the tubing line to maintain sterility.
  • An autoclaved foam stopper with a hole for the air- in port was used to seal the 4 L flasks.
  • the culture was supplied with constant 45 microMol photons*m " 2 *sec " 1 cool white fluorescent light at 22 O C.
  • biomass pellets were combined into a sterilized beaker.
  • Total wet weight biomass was determined by measuring the weight of the beaker before and after the addition of biomass.
  • Biomass cyanobacterial mixtures were prepared by mixing biomass paste of each monoculture by weight with the other members of the cyanobacterial mixture to give the prescribed ratio. Biomass paste was then diluted to a working volume with sterile Millipore water, giving a known working biomass concentration.
  • Cyanobacterial biomass was prepared by harvesting excess liquid Nostoc cyanobacterial monoculture, centrifuging, and removing the supernatant. The culture was centrifuged in twelve 50 ml Falcon tubes for 10 min at 6000 x g. The biomass pellets were then diluted with a small amount of NanopureTM water (Thermo Fischer Scientific, Inc. USA), harvested and combined into one tube. The cyanobacterial culture was then homogenized by blending on a pulse setting in a kitchen blender for less than five seconds. As little blending as possible was used to prevent unnecessary cell damage.
  • DKC 59-43 and DKC 63-43 Two corn varieties, DKC 59-43 and DKC 63-43 (DeKalb varieties from Monsanto, St. Louis, MO. USA) were coated with 1 and 4 mg per seed of Nostoc commune cyanobacteria (prepared as above) using HegeTM 1 1 liquid seed treater. All seeds received a mixture of 0.064 mg per seed of the fungicide MaximTM and 0.046 mg per seed of the binder Flo RiteTM 1 197 with inert colorant Color Coat Red. Each cyanobacterial treatment was performed in duplicate, with one subset receiving CruiserTM seed-applied insecticide and one subset receiving no insecticide.
  • the chemicals were added to the FalconTM tubes (Thermo Fisher Scientific Inc, Waltham, MA, USA) containing the cyanobacteria (previous paragraph) and diluted to a volume of 12 ml with NanopureTM water before coating. Coating was performed in 3 applications of 4 ml per application. Between coatings, seeds were allowed to dry on a cookie sheet at room temperature for four hours. Drying between applications was done to prevent early germination.
  • Table 1 Seed coating subgroups for corn trials
  • each subset of corn seeds two hundred seeds were coated in batch with a given cyanobacterial amount (0, 1, and 4 mg per seed), laid out onto a single layer onto cookie sheets, and allowed to dry at room temperature in a well-ventilated area overnight between the second and third applications. In total 2,400 seeds were coated, 800 of which were controls.
  • DKC 59-43 and DKC 63-43 were successfully coated with Nostoc commune UTEX B 1621.
  • Cyanobacterium Mixture A, Mixture B, and Mixture C were prepared essentially as described in Example 1.
  • Mixture A comprises: Nostoc commune UTEX B1621 alone.
  • Mixture B was a 3: 1 :1 : 1 mixture of Nostoc commune UTEX B 1621, Anabaena cylindrica UTEX B 1611, Aulosira bohemensis UTEX B 2947, and Tolypothrix distorta UTEX 424.
  • Mixture C was a 1 : 1 : 1 mixture of Aulosira bohemensis UTEX B 2947, Anabaena cylindrica UTEX B 1611, and Tolypothrix distorta UTEX 424. About 4 mg of each cyanobacterial mixture was applied per seed. A control was also created with no cyanobacteria applied. Cyanobacterial biomass was prepared by harvesting excess liquid Nostoc commune UTEX B 1621, Aulosira bohemensis UTEX B 2947, Anabaena cylindrica UTEX B 1611, and Tolypothrix distorta UTEX 424 cyanobacterial monocultures, centrifuging, and removing the supernatant.
  • the culture was centrifuged in twelve 50 ml Falcon tubes for 10 min at 6000 x g.
  • the biomass pellets were then diluted with a small amount of NanopureTM water, harvested and combined into one tube.
  • the cyanobacterial culture was then homogenized by blending on a pulse setting in a kitchen blender for less than five seconds. As little blending as possible was used to prevent unnecessary cell damage.
  • the biomass was spun for 10 min at 6000 x g to remove any remaining liquid. Cyanobacterial biomass was added to individual 15 ml falcon tubes as a paste. Biomass was calculated by subtracting the weight of the tube and paste from the weight of the tube only (determined at beginning of experiment).
  • a greenhouse trial will be performed with seed from two elite corn hybrids (Monsanto, St. Louis, MO, USA) with 110 day relative maturities will be coated with three different cyanobacterial mixtures.
  • Mixture A will be the same coating as one of the cyanobacterial mixtures tested above: Nostoc commune UTEX B1621 alone.
  • Mixture B will be a 3: 1 : 1 : 1 mixture of Nostoc commune UTEX B 1621, Anabaena cylindrica UTEX B 1611, Aulosira bohemensis UTEX B 2947, and Tolypothrix distorta UTEX 424.
  • Mixture C will be a 1 : 1 : 1 mixture of Aulosira bohemensis UTEX B 2947, Anabaena cylindrica UTEX B 1611, and Tolypothrix distorta UTEX 424. All cyanobacterial mixtures will be applied at a rate of 4 mg cyanobacterial mixture per seed.
  • Table 2 shows the Mixture A, B, C treatments down the left side, nitrogen dosages along the top (mM), and number of plants tested with each Mixture and at each dosage. A total of 416 plants are included in this experiment.
  • cyanobacterial mixture which consisted of a 3: 1 : 1 : 1 mixture by weight of Nostoc commune UTEX B 1621, Aulosira bohemensis UTEX B 2947, Anabaena cylindrica UTEX B 1611, and Tolypothrix distorta UTEX 424 respectively.
  • a 3: 1 : 1 : 1 mixture of Nostoc commune UTEX B 1621, Aulosira bohemensis UTEX B 2947, Anabaena cylindrica UTEX B 1611, and Tolypothrix distorta UTEX 424 respectively were maintained and harvested essentially as described in Example 1.
  • Plants were fertilized with three levels of chemical nitrogen (0, 75 and 150 lbs/acre) in the form of AgrotainTM (Koch Agronomic Services, LLC, Wichita, KS, USA) treated urea with NBPT urease inhibitor. Plants with no added cyanobacteria served as the control. Plants were harvested at half heading and dried. Total nitrogen uptake and biomass accumulation were measured.
  • a 3: 1 : 1 : 1 mixture of Nostoc commune UTEX B 1621, Aulosira bohemensis UTEX B 2947, Anabaena cylindrica UTEX B 1611, and Tolypothrix distorta UTEX 424 respectively were maintained and harvested essentially as described in Example 1.
  • Biomass was applied to rice plants at the time of permanent flood establishment by pouring 5 containers containing 1/5 of the total dose into the field with care being taken to distribute the applications as evenly as possible.
  • the plots were 16' x 5'.
  • the cyanobacterial mixture was applied evenly at ⁇ 3 foot intervals across a 16 foot plot.
  • Rice seed coating was carried out using a 3: 1 : 1 : 1 mixture of Nostoc commune UTEX B 1621, Aulosira bohemensis UTEX B 2947, Anabaena cylindrica UTEX B 1611, and Tolypothrix distorta UTEX 424 respectively, harvested as above.
  • the cyanobacterial mixture was then diluted to a working concentration of 0.2 g biomass/ml liquid.
  • Seed coating was carried out in a in a HegeTM 11 Seed Coater. A total of 1 kg of rice seed was coated with the cyanobacterial biomass mixture. Rice is planted at 100 lbs/acre, so 1 kg of rice seed covers 0.022 acres.
  • One rice cultivar (Pureline CL 152) was grown in three chemical nitrogen fertilizer rates (0, 75, and 150 lbs/acre) in 80 ft dam-blocked plots. Fertilizer was applied as AgroTainTM (Koch Agronomic Services, LLC, Wichita, KS, USA) treated urea with NBPT Urease Inhibitor. Rice was planted on April 24, 2014 at the Pinetree Research Station near Colt, AR, USA using direct-seeding, delayed flood techniques. When the permanent flood was established the topical applications of cyanobacterial mixtures were added to the 0 and 75 lbs/acre nitrogen plots.
  • cyanobacterial application rates were used (0, 50, 250, 500, and lOOOg/acre cyanobacterial mixture) for each nitrogen application rate.
  • the cyanobacteria were applied at the time of coating and were grown in 0, 75, and 150 lbs/acre nitrogen. It is estimated that the seed coating application was equivalent to a topical application rate of about 500g/acre of the cyanobacterial mixture.
  • rice was harvested and yield and total nitrogen uptake were measured. Total above ground biomass was collected from a 1 m section of the first bordered row at 50% heading to determine total N uptake based on published methods (Norman et al. Seasonal accumulation and partitioning of nitrogen- 15 in rice. Soil Sci. Soc. Am. J.
  • a greenhouse trial in rice was started in which the concentration of the individual components that comprise the cyanobacterial mixture used in the previous examples (Nostoc commune UTEX B 1621, Aulosira bohemensis UTEX B 2947, Anabaena cylindrica UTEX B 1611, and Tolypothrix distorta UTEX 424) were provided in different combinations and at various concentrations as shown in Table 4.
  • the cultivar used in the trial was CL 152, which represents one of the more commonly grown pureline cultivars grown in Arkansas. Pots planted to CL 152 were thinned to six plants per pot which would represent the standard seeding rate for this cultivar. Nitrogen rates included in the trial were an untreated control and 75 lb N/acre (suboptimal). Fertilizer was applied to a dry soil and a permanent flood was established when the rice had reached the 4-leaf growth stage. Roughly 3 days following establishment of a permanent flood, cyanobacteria were applied in rates and combinations outlined in Table 4. The experimental design used for this experiment was a randomized complete block design with a full factorial arrangement of 2 N rates x 17 cyanobacteria products replicated 5 times.
  • a greenhouse trial was performed with seed from two elite corn hybrids (Monsanto, St. Louis, MO, USA) with 110 day relative maturities. These were coated with three different cyanobacterial mixtures.
  • Mixture A was the same coating as one of the cyanobacterial mixtures tested above: Nostoc commune UTEX B1621 alone.
  • Mixture B was a 3:1 : 1 : 1 mixture of Nostoc commune UTEX B 1621 , Anabaena cylindrica UTEX B 1611, Aulosira bohemensis UTEX B 2947, and Tolypothrix distorta UTEX 424.
  • Mixture C was a 1 :1 : 1 mixture of Aulosira bohemensis UTEX B 2947, Anabaena cylindrica UTEX B 1611, and Tolypothrix distorta UTEX 424. All cyanobacterial mixtures were applied at a rate of 4 mg cyanobacterial mixture per seed
  • Table 6 shows the Mixture A, B, C treatments down the left side, nitrogen dosages along the top (mM), and number of plants tested with each Mixture and at each dosage. A total of 416 plants are included in this experiment.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Pest Control & Pesticides (AREA)
  • Biotechnology (AREA)
  • Virology (AREA)
  • Agronomy & Crop Science (AREA)
  • Dentistry (AREA)
  • Wood Science & Technology (AREA)
  • Environmental Sciences (AREA)
  • Pretreatment Of Seeds And Plants (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

Des semences de plantes monocotylédones traitées avec diverses compositions de cyanobactéries, des procédés de préparation des semences traitées, ainsi que des méthodes d'utilisation de ces semences pour améliorer la croissance et le rendement de plantes monocotylédones sont décrits.
PCT/US2016/026777 2015-04-08 2016-04-08 Semences de plantes monocotylédones traitées par cyanobactéries et procédés associés WO2016164819A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201562144677P 2015-04-08 2015-04-08
US62/144,677 2015-04-08

Publications (2)

Publication Number Publication Date
WO2016164819A2 true WO2016164819A2 (fr) 2016-10-13
WO2016164819A3 WO2016164819A3 (fr) 2016-11-24

Family

ID=57073399

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/026777 WO2016164819A2 (fr) 2015-04-08 2016-04-08 Semences de plantes monocotylédones traitées par cyanobactéries et procédés associés

Country Status (1)

Country Link
WO (1) WO2016164819A2 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3424328A1 (fr) * 2017-07-04 2019-01-09 Newpek S.A. De C.V. Formulation d'inoculation bactérienne basée sur un consortium de microorganismes du genre calothrix sp. pour augmentation du rendement et de la qualité des cultures végétales, procédé de fabrication de la formulation et ses utilisations
FR3074801A1 (fr) * 2017-12-11 2019-06-14 Agro Innovation International Utilisation de phycobiliproteines ou d'un extrait en contenant comme engrais
WO2023137352A1 (fr) * 2022-01-13 2023-07-20 Biodel Ag Inc. Utilisation de cyanobactéries comme culture de couverture

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3424328A1 (fr) * 2017-07-04 2019-01-09 Newpek S.A. De C.V. Formulation d'inoculation bactérienne basée sur un consortium de microorganismes du genre calothrix sp. pour augmentation du rendement et de la qualité des cultures végétales, procédé de fabrication de la formulation et ses utilisations
FR3074801A1 (fr) * 2017-12-11 2019-06-14 Agro Innovation International Utilisation de phycobiliproteines ou d'un extrait en contenant comme engrais
WO2019115921A1 (fr) * 2017-12-11 2019-06-20 Agro Innovation International Utilisation de phycobiliprotéines ou d'un extrait en contenant comme engrais
US11440855B2 (en) 2017-12-11 2022-09-13 Agro Innovation International Use of phycobiliproteins or an extract containing same as fertilizer
WO2023137352A1 (fr) * 2022-01-13 2023-07-20 Biodel Ag Inc. Utilisation de cyanobactéries comme culture de couverture

Also Published As

Publication number Publication date
WO2016164819A3 (fr) 2016-11-24

Similar Documents

Publication Publication Date Title
AU2002227228B2 (en) Bacterial inoculants for enhancing plant growth
CN111356761A (zh) 用于植物病原体的生物防治的方法和组合物
CN110582205A (zh) 内生植物组合物和用于改进植株性状的方法
CN111432631A (zh) 内生植物组合物和用于改进植株性状的方法
AU2002227228A1 (en) Bacterial inoculants for enhancing plant growth
UA119885C2 (uk) Способи та композиції для контролю кукурудзяного жука
CN107548281A (zh) 植物接种方法
CN103250594B (zh) 一种防治根结线虫的可降解育苗钵及其制备方法
CN116622581B (zh) 一种贝莱斯芽孢杆菌hm-3及其应用
CN107404836A (zh) 利用微生物提高种植物产量收益
CN106305793A (zh) 一种防治棉花黄萎病的复合微生物菌肥及其制备方法
WO2016164819A2 (fr) Semences de plantes monocotylédones traitées par cyanobactéries et procédés associés
CN105994379A (zh) 基于放线菌的种子包衣剂及其制备方法和包衣方法
HUE025718T2 (en) Isoflavonoid compounds and their use
US20190090410A1 (en) Cyanobacterium treated monocot plant seeds and related methods
KR101615873B1 (ko) 신규한 알칼리지니스 피칼리스균주 및 이의 용도
CN107176855A (zh) 一种生物有机肥及其应用
US20190090411A1 (en) Cyanobacterium treated dicot plant seeds and related methods
WO2016164813A2 (fr) Graines de plantes dicotylédones traitées par la cyanobactérie et procédés associés
CN110760450A (zh) 一种长枝木霉孢子的培养方法、长枝木霉水分散粒剂及其制备方法
CN109414022B (zh) 用于改善植物发育的组合物和方法
WO2021133218A1 (fr) Agent de stimulation de la croissance de cultures agricoles
CN108401818A (zh) 一种通过轮作蚕豆防治麦田虉草危害的方法
Golembiovska et al. ANTAGONISTIC ACTION OF 26UF7 AND 35NG3 STREPTOMYCES SPECIES TO CLAVIBACTER MICHIGANENSIS SUBSP. MICHIGANENSIS 10 2.
CN115380786B (zh) 一种增加云粳37号稻米香味的种植方法

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16777422

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC (EPO FORM 1205A DATED 07/02/2018)

122 Ep: pct application non-entry in european phase

Ref document number: 16777422

Country of ref document: EP

Kind code of ref document: A2