WO2016098953A1 - Genetic marker for determining pathogenicity of streptococcus iniae and kit for examining determinant markers of pathogenicity by using peptide nucleic acid - Google Patents

Genetic marker for determining pathogenicity of streptococcus iniae and kit for examining determinant markers of pathogenicity by using peptide nucleic acid Download PDF

Info

Publication number
WO2016098953A1
WO2016098953A1 PCT/KR2015/002344 KR2015002344W WO2016098953A1 WO 2016098953 A1 WO2016098953 A1 WO 2016098953A1 KR 2015002344 W KR2015002344 W KR 2015002344W WO 2016098953 A1 WO2016098953 A1 WO 2016098953A1
Authority
WO
WIPO (PCT)
Prior art keywords
iniae
probe
nucleic acid
genotype
streptococcus iniae
Prior art date
Application number
PCT/KR2015/002344
Other languages
French (fr)
Korean (ko)
Inventor
김명석
최혜승
정승희
한현자
도정완
Original Assignee
대한민국(관리부서:국립수산과학원)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 대한민국(관리부서:국립수산과학원) filed Critical 대한민국(관리부서:국립수산과학원)
Publication of WO2016098953A1 publication Critical patent/WO2016098953A1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Definitions

  • the present invention relates to a probe for genotyping of Streptococcus iniae that can hybridize under severe conditions with a sequence fragment containing a single nucleotide polymorphism of T368C or T385G in the cpsD sequence of Streptococcus iniae of SEQ ID NO: 1.
  • Streptococcus inia is Gram-positive cocci, first isolated from the Amazon River dolphin (Inia geoffrensis) in 1972, and is highly infected with tilapia, yellowtail, rainbow trout, and flounder. S. iniae can infect humans and cause cellulitis, and more than 20 cases of S. iniae infections in humans have been reported in the United States, Canada, Hong Kong, Taiwan, and Singapore. This is becoming important.
  • Streptococcus iniae vaccines were used to prevent streptococosis , a bacterial disease in fish, in the rainbow trout farms of Israel.
  • the new strain negative for Arginine dihydrolase in rainbow trout injected with the vaccine . iniae has been separated.
  • the first isolated S. iniae was named serotype I, after which the other serologically isolated S. iniae was named serotype II, and the S. iniae was divided into two serotypes.
  • Random amplified polymorphic DNA (RAPD) analysis is a method that can quickly differentiate between and between genetic species by obtaining an unspecific pattern of DNA based on PCR.
  • Two serotypes of Streptococcus iniae were divided into RAPD (Bachrach et al., Appl Environ Microbiol ., 67: 3756-3758, 2001), and 94 Streptococcus inia e isolated from Korea using this method had three genotypes. (genotypes), but studies on the pathogenicity of these genotypes are lacking (Jung YU and Heo MS, Kor J Life Sci ., 16: 345-351, 2006).
  • Streptococcal species include extracellular capsules, and capsule operons contain capsular polysaccharides (Cps) A, B, C, D, and E genes.
  • the cpsD gene encodes an autophosphorylating protein tyrosine kinase in Streptococcus pneumoniae , which is considered to be essential for the formation of capsules.
  • the ⁇ cpsD Streptococcus iniae from which the cpsD gene has been removed is encapsulated compared to wild type S. iniae . This decrease and no pathogenicity in hybrid bass, the cpsD gene was found to play an important role in inducing the formation of capsules of Streptococcal species and the death of fish.
  • peptide nucleic acid is a similar DNA in which nucleic acid bases are linked by peptide bonds rather than phosphate bonds, and was first synthesized in 1991 by Nielsen et al.
  • Peptide nucleic acids are not found in nature but are artificially synthesized by chemical methods.
  • Peptide nucleic acids form double strands through hybridization with native nucleic acids of complementary base sequences.
  • PNA / DNA double strands are more stable than DNA / DNA double strands and PNA / RNA double strands are more stable than DNA / RNA double strands.
  • peptide nucleic acids have a greater ability to detect single nucleotide polymorphisms (SNPs) than natural nucleic acids because of their high degree of double strand instability due to single base mismatch.
  • SNPs single nucleotide polymorphisms
  • Peptide nucleic acids are not only chemically stable but also biologically stable because they are not degraded by nucleases or proteases.
  • peptide nucleic acid is one of gene recognition materials, such as LNA (Locked nucleic acid), MNA (Mopholino nucleic acid), the basic skeleton is composed of polyamide.
  • Peptide nucleic acids have the advantages of very good affinity and selectivity, high physical and chemical properties, and easy storage and easy decomposition.
  • the present inventors have made efforts to develop a method for determining the pathogenicity of Streptococcus iniae in a quick and simple manner, using a genetic marker for determining the pathogenicity of S. iniae and a peptide nucleic acid (PNA) excellent in binding to the DNA.
  • PNA peptide nucleic acid
  • An object of the present invention is to provide a probe that can determine the nucleotide polymorphism and genotype of the target gene of Streptococcus iniae .
  • Another object of the present invention to provide a polymorphism kit of S. iniae containing the probe.
  • Another object of the present invention to provide a method for determining genotype of S. iniae containing the probe.
  • the present invention provides a probe for determining the genotype of Streptococcus iniae that can hybridize under severe conditions with a sequence fragment containing a single nucleotide polymorphism of T368C or T385G in the cpsD sequence of Streptococcus iniae of SEQ ID NO: 1.
  • the present invention also provides a kit for determining single nucleotide polymorphism (SNP) for determining the genotype of Streptococcus iniae comprising the probe.
  • SNP single nucleotide polymorphism
  • the present invention also provides a single nucleotide polymorphism (SNP) determination method for determining the genotype of Streptococcus iniae using the melting curve analysis of the probe.
  • SNP single nucleotide polymorphism
  • FIG. 2 is a gene position diagram for explaining a base mutation portion included in the peptide nucleic acid on the cpsD gene that determines the genotype of S. iniae .
  • Figure 3 is a schematic diagram illustrating the different degree of hybridization for each peptide nucleic acid according to the binding position in the cpsD gene and genotype of the single nucleic acid polymorphism (SNP) for determining the genotype of S. iniae .
  • SNP single nucleic acid polymorphism
  • Figure 4 is a schematic diagram for explaining the hybridization step and the step of obtaining the melting curve of the single nucleotide polymorphism (SNP) determination method for determining the genotype of S. iniae using peptide nucleic acid.
  • SNP single nucleotide polymorphism
  • FIG. 5 is a graph illustrating a step of obtaining a melting peak curve from a melting curve in a single base polymorphism (SNP) determination method for determining genotype of S. iniae using peptide nucleic acids.
  • SNP single base polymorphism
  • FIG. 6 is a conceptual diagram for explaining the technical characteristics of the peptide nucleic acid for determining the single base polymorphism (SNP) to determine the genotype of S. iniae .
  • SNP single base polymorphism
  • Figure 7 is a result of comparing the results of nucleotide sequence analysis of the same sample and the single nucleotide polymorphism (SNP) determination to determine the genotype of S. iniae .
  • SNP single nucleotide polymorphism
  • FIG. 8 is a table summarizing the melting temperature (Tm) obtained from a melting curve graph of peptide nucleic acids for genotypes of S. iniae .
  • a single nucleotide polymorphism marker that determines the genotype of S. iniae was selected for quick and easy analysis of the pathogenicity according to the genotype of Streptococcus iniae .
  • the present inventors isolated 29 S. iniae DNA from infected flounder in Korea, and these S. iniae are divided into two genotypes through repetitive sequence-based PCR (rep-PCR) and random amplified polymorphic DNA (RAPD). It was confirmed that the results were consistent with their phylogenetic results using the nucleotide sequence of the cpsD gene of S. iniae . Compare the two genotypes of S. iniae with the known functional domains of the cpsD protein and, via rep-PCR, there is a single nucleotide polymorphism (SNP) at 368 and 385 in the cpsD gene between these two genotypes In case of C or G, it was confirmed that S. iniae is pathogenic.
  • rep-PCR repetitive sequence-based PCR
  • RAPD random amplified polymorphic DNA
  • the single nucleotide polymorphism site can determine the genotype of S. iniae , and the binding strength of peptide nucleic acid to DNA is much better than that of DNA (DNA-DNA ⁇ PNA-DNA), and peptide nucleic acid is 1 nucleotide.
  • Melt temperature (Tm) differs by about 10 ⁇ 15 °C even with incomplete mismatch.
  • Tm single nucleotide polymorphism
  • SNP single nucleotide polymorphism
  • the present invention relates to a probe for genotyping of Streptococcus iniae that can hybridize under severe conditions with a sequence fragment containing a single nucleotide polymorphism of T368C or T385G in the cpsD sequence of Streptococcus iniae of SEQ ID NO: 1 .
  • peptide nucleic acid probes can be analyzed using a hybridization method different from the hydrolysis method of TaqMan probe. Probes that play a similar role include molecular beacon probes and scorpion probes.
  • the probe is preferably a PNA characterized by having a reporter and a quencher at the sock end. That is, in the peptide nucleic acid probe according to the present invention, a reporter and a quencher capable of quenching reporter fluorescence may be coupled to both ends.
  • the reporter in the group consisting of FAM (6-carboxyfluorescein), Texas red, HEX (2 ', 4', 5 ', 7', -tetrachloro-6-carboxy -4,7-dichlorofluorescein) and CY5
  • the quencher may be one or more selected from the group consisting of TAMRA (6-carboxytetramethyl-rhodamine), BHQ1, BHQ2 and Dabcyl, but is not limited thereto, preferably using Dabcyl It features.
  • the base sequence length of the peptide nucleic acid according to the present invention is not particularly limited, but may be prepared in a length of 5 to 30 mer including a single nucleotide polymorphism (SNP) that determines the genotype of Streptococcus iniae , preferably 9 to 17mer. Can be produced in length.
  • SNP single nucleotide polymorphism
  • the length of the peptide nucleic acid probe can be adjusted to produce a probe having a desired Tm value, and even a peptide nucleic acid probe of the same length can be adjusted to change the nucleotide sequence.
  • peptide nucleic acids have a higher binding force than DNA and have a higher basic Tm value
  • the peptide nucleic acid can be produced in a shorter length than DNA, so that even adjacent peptide nucleic acids can be discriminated.
  • the difference in Tm value is about 0.5 ° C., which is very small and requires additional analysis program or detailed temperature change or correction. Therefore, when two or more peptide nucleic acids appear, the analysis was difficult. According to the peptide nucleic acid probe is not affected by the probe sequence and peptide nucleic acid can be easily analyzed.
  • the peptide nucleic acid set of the present invention may include one tube including two peptide nucleic acids, and the peptide nucleic acids included in the tube may be configured with different reporters.
  • the peptide nucleic acid probe according to the present invention is designed such that the base mutation position of the target nucleic acid is in the center position of the peptide nucleic acid probe for the difference in melting temperature (Tm) of the target nucleic acid and the target nucleic acid having a base mutation It is preferable.
  • the base mutation is located in the center position of the probe to make the structural difference of the probe, the peptide nucleic acid probe is bound to form a loop (Tm) difference due to this structural difference It may appear large.
  • the peptide nucleic acid probe according to the present invention includes 13 to 17 base sequences
  • the peptide nucleic acid probe has a sequence corresponding to a single nucleotide polymorphism (SNP) site at at least one of the 6th to 9th positions. It is preferable.
  • SNP single nucleotide polymorphism
  • Such peptide nucleic acids may have structural modifications, including sequences corresponding to single nucleotide polymorphisms (SNPs) that determine the genotype of Streptococcus iniae at the center of the nucleotide sequence, thereby resulting in complete hybridization of target nucleic acids (perfect hybridization). match with the melting temperature (Tm) can be made larger.
  • SNPs single nucleotide polymorphisms
  • the peptide nucleic acid for determining the single nucleotide polymorphism (SNP) to determine the genotype of Streptococcus iniae shows a different melting temperature (Tm) depending on the binding sequence (or SNP), so that one peptide nucleic acid ( Alternatively, two or more base sequences can be detected by a probe), and two or more peptide nucleic acids can be included and used in one tube.
  • Tm melting temperature
  • Peptide nucleic acid of the present invention relates to a technique for determining genotyping of Streptococcus iniae , and hybridizes the peptide nucleic acid of the present invention with the target nucleic acid of S. iniae and analyzes the melting curve to simplify, rapid and accurate single nucleotide polymorphism of S. iniae . Can be determined.
  • the "strict conditions" used to achieve stringent specific levels vary depending on the nature of the nucleic acid being hybridized. For example, the length of the nucleic acid region to be hybridized, degree of homology, nucleotide sequence composition (eg, GC / AT composition ratio), and nucleic acid type (eg, RNA, DNA) select hybridization conditions. Is considered. Further considerations are whether the nucleic acid is immobilized, for example, in a filter or the like.
  • Examples of very stringent conditions are as follows: 2X SSC / 0.1% SDS at room temperature (hybridization conditions); 0.2X SSC / 0.1% SDS at room temperature (low stringency conditions); 0.2X SSC / 0.1% SDS at 42 ° C. (conditions with moderate stringency); 0.1X SSC at 68 ° C. conditions with high stringency.
  • the washing process can be carried out using one of these conditions, for example a condition with high stringency, or each of the above conditions, each of 10-15 minutes in the order described above, all or all of the conditions described above. Some iterations can be done. However, as described above, the optimum conditions vary with the particular hybridization reaction involved and can be determined experimentally. In general, conditions of high stringency are used for hybridization of critical probes.
  • the present invention relates to a method for determining the genotype of Streptococcus iniae by single nucleotide polymorphism (SNP) determination.
  • SNP single nucleotide polymorphism
  • SNP single nucleotide polymorphism
  • the hybridization step is to react the peptide nucleic acid according to the present invention with the target nucleic acid of S. iniae .
  • This step may include a PCR procedure, and it is possible to use a forward / reverse primer set for PCR.
  • Such hybridization steps and PCR conditions may include any of a variety of methods that are well known to those of ordinary skill in the art (hereinafter, referred to as “the skilled person”).
  • the skilled person After the PCR is completed, it is also possible to include a melting process.
  • the target nucleic acid of S. iniae contains the nucleotide polymorphism (SNP) site present in the cpsD gene of the present invention described above. Genetic variation of the cpsD gene which is expressed on the surface of S. iniae was confirmed in the present invention to affect the infectivity and virulence, it is effective to determine the infectivity and virulence of S. iniae.
  • SNP nucleotide polymorphism
  • the step of obtaining the melting curve for each temperature is to obtain the melting temperature (Tm) of S. iniae target nucleic acid.
  • Tm melting temperature
  • the hybridization method analysis method may use FMCA (Fluorescence Melting Curve Analysis), the FMCA is to analyze the difference between the binding force between the product produced after the PCR reaction and put the probe by Tm.
  • the Tm value can be obtained by measuring the intensity of fluorescence each time it is increased by 1 ° C.
  • the step of determining the single base polymorphism (SNP) for determining the genotype of the Streptococcus iniae is to determine the single base polymorphism (SNP) for determining the genotype of S. iniae from the melting temperature of the obtained melting curve. For example, a single nucleotide polymorphism (SNP) as compared to the melting temperature of the single-nucleotide polymorphism (SNP) to determine the genotype of the S. iniae the known melting temperature of the obtained melting curve for determining the genotype of the S. iniae Can be determined.
  • the melting curves of the peptide nucleic acids according to the present invention have different melting temperatures (Tm) for each single nucleotide polymorphism (SNP) that determines the genotype of S. iniae .
  • Tm melting temperatures
  • SNP single nucleotide polymorphism
  • SNP Base polymorphism
  • FIG. 5 is a graph for explaining an example of the step of obtaining the melting peak curve from the melting curve in the single base polymorphism (SNP) determination method for determining the genotype of Streptococcus iniae using the peptide nucleic acid according to the present invention, as shown here
  • the melting peak curve for each temperature can be obtained using the slope value of the melting curve, and this melting peak curve is easy to determine the melting temperature (Tm) of the single base polymorphism (SNP) that determines the genotype of S. iniae . .
  • the step of obtaining a melting curve for each temperature comprising the step of obtaining a melting peak curve for each temperature from the obtained melting curve for each temperature, to determine a single base polymorphism (SNP) to determine the genotype of the S. iniae
  • SNP single base polymorphism
  • the present invention also relates to a kit for determining single nucleotide polymorphism (SNP) for determining the genotype of Streptococcus iniae comprising a probe.
  • SNP single nucleotide polymorphism
  • the kit is a kit characterized in that for the base polymorphism analysis of multiple target DNA or a single target DNA.
  • the probe of the kit is a single nucleotide polymorphism (SNP) determination probe for determining the genotype of Streptococcus iniae , characterized in that the PNA.
  • SNP single nucleotide polymorphism
  • the kit may optionally include reagents required for conducting target amplification PCR reactions (eg, PCR reactions) such as buffers, DNA polymerase cofactors and deoxyribonucleotide-5-triphosphate, and may be used for various polynucleotide molecules, reverse transcription. It is also possible to include enzymes, various buffers and reagents, and antibodies that inhibit DNA polymerase activity.
  • reagents required for conducting target amplification PCR reactions such as buffers, DNA polymerase cofactors and deoxyribonucleotide-5-triphosphate
  • enzymes eg, various buffers and reagents, and antibodies that inhibit DNA polymerase activity.
  • single nucleotide variations of target nucleic acids and mutations caused by deletions or insertions of base nucleic acids can be effectively detected through dissolution curve analysis by peptide nucleic acid probes, and thus single nucleotide polymorphisms that determine the genotype of Streptococcus iniae . (SNP) can be determined and pathogenicity can be determined.
  • SNP single nucleotide polymorphisms that determine the genotype of Streptococcus iniae .
  • Rep-RCR (repetitive sequence-based PCR) was performed on 29 known strains of Streptococcus iniae (ATCC 29178) and cultured flounder in Korea to identify two genotypes.
  • the genotypes 1 and 2 were named as genotype 1 (86.2%).
  • BoxA primer of SEQ ID NO: 2 targets the cpsD gene of S. iniae, and the base sequence and rep-RCR condition of the BoxA primer used are as follows.
  • Streptococcus iniae genotype 1 and genotype 2 a single nucleotide polymorphism (SNP) was found. Specifically, 368bp and 385bp base sequence of the cpsD gene (NCBI database: JF795257.1) of S. iniae strain DGX07 was found to be different between the two genotypes. Streptococcus iniae genotype 1 was C (368bp), G (385bp) And genotype 2 is T (368 bp), T (385 bp) (FIG. 2).
  • PBS sterile saline
  • 0.1 mL of normal saline was intraperitoneally injected.
  • the mortality was examined for 7 days at 23.1 °C, and the dead meat was dissected and the Streptococcus iniae was re-isolated.
  • Hemi-bacterial bacterial counts (LD50) were calculated using Finney's probit method, and hemi-accumulated concentrations (LD50) for flounder of S.
  • iniae genotype 1 ranged from 7.0 to 7.2 ⁇ 10 5 cfu / fish and half of flounder for genotype 2
  • the lethal concentration ranged from 3.4 to 3.6 ⁇ 10 8 cfu / fish, indicating that genotype 1 was about 2000 times more pathogenic for flounder than two.
  • the gene-specific nucleotide sequence involved in each genotype was selected based on the single nucleotide polymorphism (SNP).
  • SNP single nucleotide polymorphism
  • the single nucleotide polymorphism (SNP) that determines the genotype of Streptococcus iniae is 368 (C / T), and thus the nucleotide sequence (SEQ ID NO: 3) centering the position is the nucleotide sequence of the peptide nucleic acid according to the present invention. It consisted of.
  • nucleotide sequence of the peptide nucleic acid according to the present invention was determined and shown in Table 1 below.
  • O means a linker and K means lysine.
  • Peptide nucleic acid probes according to the present invention were prepared with the nucleotide sequences, reporters and quencher as shown in Table 1 above. Peptide nucleic acid probes were designed using Peptide Nucleic Acid Probe Designer (Appliedbiosystems, USA). All peptide nucleic acid probes used in the present invention were synthesized by HPLC purification method in Panagene (Panagene, Korea), and the purity of all synthesized probes was confirmed by mass spectrometry. Unnecessary secondary structures were avoided.
  • Figure 3 is a gene position map for explaining an example of the base mutant portion contained in the peptide nucleic acid on the S. iniae cpsD gene according to the present invention, the number represents a single nucleotide polymorphism site according to the present invention.
  • a dissolution curve was derived for each DNA having two genotypes of Streptococcus iniae , and analyzed to determine the single nucleotide polymorphism to determine the genotype of S. iniae . (SNP) was determined.
  • PCR was performed using a CFX96 TM Real-Time system (BIO-RAD, USA), and all experimental conditions used asymmetric PCR (asymmetric PCR) to generate a single stranded target nucleic acid.
  • the conditions of asymmetric PCR are as follows; 1X EyeBio Real-Time FMCA TM Buffer (SeaSunBio Real-Time FMCA TM Buffer, Eye Bio, Korea), 2.5mM MgCl 2 , 200 ⁇ M dNTPs, 1.0 U Taq polymerase, 0.05 ⁇ M forward primer (SEQ ID NO: 4) and 0.5 ⁇ M reverse primer (SEQ ID NO: 5, asymmetric PCR, Table 2) were added 0.5 ⁇ l probe (peptide nucleic acid prepared in Example 2), 0.5 ⁇ l S. iniae DNA followed by real-time PCR Was carried out.
  • the real-time PCR process was denatured at 95 ° C. for 5 minutes, and then reacted at 95 ° C. for 30 seconds, 58 ° C. for 45 seconds, and 74 ° C. for 45 seconds. This was repeated 38 cycles, and fluorescence was measured in real time.
  • the melting curve analysis was performed for 1 minute at 95 ° C, followed by hybridization at 35 ° C for 5 minutes, and then the melting curve analysis was performed by increasing the fluorescence by increasing the temperature from 35 ° C to 85 ° C in 1 ° C increments. The suspension was held for 10 seconds between each step (FIG. 4).
  • Figure 6 is a conceptual diagram for explaining the technical characteristics of the peptide mononucleotide polymorphism (SNP) for determining the genotype of Streptococcus iniae genotype according to an embodiment of the present invention, as shown here, the peptide according to the present invention
  • the nucleic acid may generate a fluorescent signal after hybridization with the target nucleic acid, and rapidly melts from the target nucleic acid at an appropriate melting temperature (Tm) of the peptide nucleic acid as the temperature increases, thereby extinguishing the fluorescent signal.
  • Tm melting temperature
  • the present invention is to detect the presence or absence of the base mutation of the target nucleic acid through a high-resolution fluorescence melting curve analysis (FMCA) obtained from the fluorescence signal according to the temperature change.
  • FMCA fluorescence melting curve analysis
  • Peptide nucleic acid according to the present invention shows the expected melting temperature (Tm) value when the complete hybridization (perfect match) with the target nucleic acid sequence, but incomplete hybridization (mismatch) with the target nucleic acid in which the base mutation is present than expected It may be characterized by showing a low melting temperature (Tm) value.
  • the base polymorphism in the case of using the peptide nucleic acid according to the present invention, can be analyzed in the same manner as in the sequencing analysis. Through this, the peptide base nucleic acid according to the present invention determines the genotype of S. iniae . SNP) can be discriminated.
  • the Tm value obtained by performing the melting curve analysis was designated as a perfect match for the peak of 60 °C or more, and the peak below 55 °C as an incomplete mismatch (mismatch), Using the analysis result, genotype 1 was assigned a perfect match and genotype 2 was mismatched so that each genotype had a unique value (FIG. 8).
  • a single base polymorphism that determines the genotype of S. iniae by using a peptide nucleic acid (PNA) having excellent binding ability to DNA has a different melting temperature (Tm) for each species having a genotype of Streptococcus iniae .
  • SNP can be used to determine the pathogenicity of S. iniae simply, quickly and accurately.

Abstract

The present invention relates to a probe for determining a genotype of Steptococcus iniae, the probe being capable of hybridizing, under strict conditions, with a sequence fragment containing a single nucleotide polymorphism variation of T368C or T385G in the cpsD sequence, which is represented by SEQ ID NO: 1, of Streptococcus iniae and, more particularly, to a kit which allows each genotype influencing pathogenicity to have different melting temperature by using a peptide nucleic acid (PNA) having an excellent binding ability to DNA, thereby enabling a simple, rapid, and accurate determination of the pathogenicity of S. iniae.

Description

Streptococcus iniae의 병원성 판별용 유전자 마커 및 펩티드핵산을 이용한 병원성 결정 마커 검사키트Test marker for pathogenic determination marker using genetic marker and peptide nucleic acid for pathogenicity determination of Streptococcus iniae
본 발명은 서열번호 1의 Streptococcus iniae의 cpsD 서열에서 T368C 또는 T385G의 단일염기다형성 변이를 포함하는 서열단편과 엄격한 조건에서 혼성화할 수 있는 Streptococcus iniae의 유전형 판별용 프로브에 관한 것이다. The present invention relates to a probe for genotyping of Streptococcus iniae that can hybridize under severe conditions with a sequence fragment containing a single nucleotide polymorphism of T368C or T385G in the cpsD sequence of Streptococcus iniae of SEQ ID NO: 1.
Streptococcus inia는 그람양성 구균으로 1972년에 Amazon River dolphin (Inia geoffrensis)에서 최초로 분리되었고, 세계적으로 많이 양식되는 틸라피아, 방어, 무지개송어, 넙치에 감염되어 높은 폐사를 일으키고 있다. S. iniae는 사람에게 감염되어 세포염(cellulitis)을 일으킬 수 있고 S. iniae가 어류를 통해 사람에게 감염된 사례가 미국, 캐나다, 홍콩, 대만, 싱가폴에서 20 건 이상 보고되고 있어 감염성 및 병원성의 판별이 중요시되고 있다. Streptococcus inia is Gram-positive cocci, first isolated from the Amazon River dolphin (Inia geoffrensis) in 1972, and is highly infected with tilapia, yellowtail, rainbow trout, and flounder. S. iniae can infect humans and cause cellulitis, and more than 20 cases of S. iniae infections in humans have been reported in the United States, Canada, Hong Kong, Taiwan, and Singapore. This is becoming important.
1995년부터 1997년까지 이스라엘의 무지개송어 양식장에서 Streptococcus iniae 백신이 어류의 세균성 질병인 streptococosis를 예방하기 위해 사용되었으나 백신을 주사한 무지개송어에서 아르기닌 분해검사(Arginine dihydrolase)에서 음성인 새로운 개체의 S. iniae가 분리되었다. 먼저 분리된 S. iniae는 혈청형 I 이라고 명명되었으며, 이후에 분리된 혈청학적으로 다른 S. iniae는 혈청형 II로 명명되어 S. iniae는 2개의 혈청형(serotype)으로 구분되었다. From 1995 to 1997, Streptococcus iniae vaccines were used to prevent streptococosis , a bacterial disease in fish, in the rainbow trout farms of Israel. However, the new strain negative for Arginine dihydrolase in rainbow trout injected with the vaccine . iniae has been separated. The first isolated S. iniae was named serotype I, after which the other serologically isolated S. iniae was named serotype II, and the S. iniae was divided into two serotypes.
임의증폭 다형성 DNA(Random amplified polymorphic DNA, RAPD) 분석은 PCR을 기반으로 하여 DNA의 불특정한 패턴을 얻어내어 종간 및 종내의 유전학적 다양성을 신속하게 구분할 수 있는 방법이다. Streptococcus iniae의 2개 혈청형을 RAPD로 구분하였으며(Bachrach et al., Appl Environ Microbiol., 67:3756-3758, 2001), 이 방법을 이용하여 한국에서 분리된 94개의 Streptococcus iniae는 3개의 유전형 (genotype)으로 분류되었지만 이들 유전형 (genotype)에 대한 병원성에 대한 연구는 부족하다(Jung YU and Heo MS, Kor J Life Sci., 16:345-351, 2006). Random amplified polymorphic DNA (RAPD) analysis is a method that can quickly differentiate between and between genetic species by obtaining an unspecific pattern of DNA based on PCR. Two serotypes of Streptococcus iniae were divided into RAPD (Bachrach et al., Appl Environ Microbiol ., 67: 3756-3758, 2001), and 94 Streptococcus inia e isolated from Korea using this method had three genotypes. (genotypes), but studies on the pathogenicity of these genotypes are lacking (Jung YU and Heo MS, Kor J Life Sci ., 16: 345-351, 2006).
연쇄구균 종(Streptococcal species)들의 경우 세포 외 캡슐(extracellular capsule)이 존재하며, 캡슐 오페론(capsule operons)에는 협막다당(capsular polysaccharide, cps) A, B, C, D, E 유전자가 존재한다. 그 중에서 cpsD 유전자는 페렴구균(Streptococcus pneumoniae)에서 autophosphorylating protein tyrosine kinase를 암호화하고 있어 캡슐(capsule) 형성에 꼭 필요한 것으로 생각되며, cpsD 유전자를 제거한 ΔcpsD Streptococcus iniae는 야생형 S. iniae에 비해 캡슐(capsule)이 감소하고 잡종농어에서 병원성을 나타내지 않아, cpsD 유전자는 연쇄구균 종(Streptococcal species)들의 캡슐(capsule) 형성과 어류의 폐사를 유도하는데 중요한 역할을 하는 것으로 밝혀졌다. S. iniae의 캡슐(capsule)을 형성하는데 역할을 하는 유전자인 cps 유전자와 phosphoglucomutase 유전자의 유전적 변이는 감염력과 병원성에 영향을 미치는 것으로 알려져 있고 S. iniae의 가장 외막에 존재하는 캡슐(capsule)이 병원성을 결정하는데 중요한 역할을 한다고 알려져 있다. 따라서 S. iniae를 구분할 수 있는 혈청형을 대신할 수 있는 유전학적 수준의 좀 더 세분화된 분류가 필요하다. Streptococcal species include extracellular capsules, and capsule operons contain capsular polysaccharides (Cps) A, B, C, D, and E genes. Among them, the cpsD gene encodes an autophosphorylating protein tyrosine kinase in Streptococcus pneumoniae , which is considered to be essential for the formation of capsules.The ΔcpsD Streptococcus iniae from which the cpsD gene has been removed is encapsulated compared to wild type S. iniae . This decrease and no pathogenicity in hybrid bass, the cpsD gene was found to play an important role in inducing the formation of capsules of Streptococcal species and the death of fish. Genetic variation in gene cps genes and phosphoglucomutase gene, which serves to form a capsule (capsule) of S. iniae are known to affect the infectivity and virulence capsule (capsule) that exist in the outer membrane of S. iniae It is known to play an important role in determining pathogenicity. Therefore, a more detailed classification of genetic level is needed to replace the serotype that can distinguish S. iniae.
세균의 유전형을 분석하기 위한 다양한 방법이 개발되고 있으며, 유전자 염기서열 분석법 (sanger sequencing), random amplified polymorphic DNA (RAPD), restriction fragment length polymorphism (RFLP)법 등이 사용되고 있으나, 여전히 분석 시간이 길고 절차가 까다롭다는 문제점을 가지고 있다. 여기에 추가로, 병원성을 나타내는 유전형 및 유전체 마커의 개발을 필요로 하며, 이러한 유전형에 따른 병원성을 분석하여 상관관계를 확인하기 위해 신속하고 간편한 분석을 위한 유전형(genotype) 및 유전체 마커의 개발 및 유전체 마커를 손쉽게 판별할 수 있는 방법이 필요한 실정이다. Various methods for the analysis of bacterial genotypes have been developed, such as Sanger sequencing, random amplified polymorphic DNA (RAPD), restriction fragment length polymorphism (RFLP), etc. The problem is that it is tricky. In addition, it requires the development of genotype and genomic markers showing pathogenicity, and the development and genome of genotype and genomic markers for rapid and easy analysis to confirm the correlation by analyzing the pathogenicity of these genotypes There is a need for a method for easily identifying markers.
일반적으로, 펩티드핵산(Peptide nucleic acid, PNA)은 핵산염기가 인산 결합이 아닌 펩티드 결합으로 연결된 유사 DNA로 1991년에 Nielsen 등에 의해 처음으로 합성되었다. 펩티드핵산은 자연계에서는 발견되지 않고 인공적으로 화학적인 방법으로 합성된다. 펩티드핵산은 상보적인 염기 서열의 천연 핵산과 혼성화(hybridization) 반응을 통해 이중가닥을 형성한다. 길이가 같은 경우 PNA/DNA 이중가닥은 DNA/DNA 이중가닥보다, PNA/RNA 이중가닥은 DNA/RNA 이중가닥보다 안정하다. 또한, 펩티드핵산은 단일 염기 부정합(single base mismatch) 때문에 이중 가닥이 불안정해지는 정도가 크기 때문에 단일염기다형성(single nucleotide polymorphism, SNP)을 검출하는 능력이 천연핵산보다 더 뛰어나다. 펩티드핵산은 화학적으로 안정할 뿐만 아니라 핵산분해효소(nuclease)나 단백질분해효소(protease)에 의해 분해되지 않아 생물학적으로도 안정하다. 또한, 펩티드핵산은 LNA(Locked nucleic acid), MNA(Mopholino nucleic acid)처럼 유전자 인식 물질의 하나로서, 기본 골격이 폴리아마이드로 구성되어 있다. 펩티드핵산은 친화도(affinity)와 선택성(selectivity)이 매우 우수하고, 열/화학적으로 물성 및 안정성이 높아 보관이 용이하고 쉽게 분해되지 않는 장점이 있다. In general, peptide nucleic acid (PNA) is a similar DNA in which nucleic acid bases are linked by peptide bonds rather than phosphate bonds, and was first synthesized in 1991 by Nielsen et al. Peptide nucleic acids are not found in nature but are artificially synthesized by chemical methods. Peptide nucleic acids form double strands through hybridization with native nucleic acids of complementary base sequences. PNA / DNA double strands are more stable than DNA / DNA double strands and PNA / RNA double strands are more stable than DNA / RNA double strands. In addition, peptide nucleic acids have a greater ability to detect single nucleotide polymorphisms (SNPs) than natural nucleic acids because of their high degree of double strand instability due to single base mismatch. Peptide nucleic acids are not only chemically stable but also biologically stable because they are not degraded by nucleases or proteases. In addition, peptide nucleic acid is one of gene recognition materials, such as LNA (Locked nucleic acid), MNA (Mopholino nucleic acid), the basic skeleton is composed of polyamide. Peptide nucleic acids have the advantages of very good affinity and selectivity, high physical and chemical properties, and easy storage and easy decomposition.
이에, 본 발명자는 신속하고 간편한 방법으로 Streptococcus iniae의 병원성을 판별하는 방법을 개발하고자 예의 노력한 결과, S. iniae의 병원성을 판별하기 위한 유전자 마커 및 상기 DNA와 결합력이 우수한 펩티드핵산(PNA)을 이용하여 유전형마다 서로 다른 융해온도를 나타내게 함으로써, S. iniae의 병원성을 간단, 신속, 정확하게 판별할 수 있다는 것을 확인하고, 본 발명을 완성하게 되었다.Accordingly, the present inventors have made efforts to develop a method for determining the pathogenicity of Streptococcus iniae in a quick and simple manner, using a genetic marker for determining the pathogenicity of S. iniae and a peptide nucleic acid (PNA) excellent in binding to the DNA. By showing different melting temperatures for each genotype, it was confirmed that the pathogenicity of S. iniae can be easily, quickly and accurately determined, and the present invention was completed.
발명의 요약Summary of the Invention
본 발명의 목적은 Streptococcus iniae의 타겟 유전자의 염기다형성 및 유전형을 판별할 수 있는 프로브를 제공하는 데 있다.An object of the present invention is to provide a probe that can determine the nucleotide polymorphism and genotype of the target gene of Streptococcus iniae .
본 발명의 다른 목적은 상기 프로브를 포함하는 S. iniae의 염기다형성 키트를 제공하는 데 있다. Another object of the present invention to provide a polymorphism kit of S. iniae containing the probe.
본 발명의 또 다른 목적은 상기 프로브를 포함하는 S. iniae의 유전형 판별방법을 제공하는 데 있다.Another object of the present invention to provide a method for determining genotype of S. iniae containing the probe.
상기 목적을 달성하기 위하여, 서열번호 1의 Streptococcus iniae의 cpsD 서열에서 T368C 또는 T385G의 단일염기다형성 변이를 포함하는 서열단편과 엄격한 조건에서 혼성화할 수 있는 Streptococcus iniae의 유전형 판별용 프로브를 제공한다. In order to achieve the above object, the present invention provides a probe for determining the genotype of Streptococcus iniae that can hybridize under severe conditions with a sequence fragment containing a single nucleotide polymorphism of T368C or T385G in the cpsD sequence of Streptococcus iniae of SEQ ID NO: 1.
본 발명은 또한, 상기 프로브를 포함하는 Streptococcus iniae의 유전형을 결정하는 단일염기다형성(SNP) 판별용 키트를 제공한다. The present invention also provides a kit for determining single nucleotide polymorphism (SNP) for determining the genotype of Streptococcus iniae comprising the probe.
본 발명은 또한, 상기 프로브의 융해곡선 분석법을 이용한 Streptococcus iniae의 유전형을 결정하는 단일염기다형성(SNP) 판별 방법을 제공한다.The present invention also provides a single nucleotide polymorphism (SNP) determination method for determining the genotype of Streptococcus iniae using the melting curve analysis of the probe.
도 1은 한국의 양식 넙치에서 분리한 S. iniae 균주를 대상으로 실시한 rep-RCR의 결과이다. 1 is a result of rep-RCR performed on S. iniae strain isolated from cultured flounder in Korea.
도 2는 S. iniae의 유전형을 결정하는 cpsD 유전자 상에서 펩티드핵산이 포함하고 있는 염기변이 부분을 설명하기 위한 유전자 위치도이다. FIG. 2 is a gene position diagram for explaining a base mutation portion included in the peptide nucleic acid on the cpsD gene that determines the genotype of S. iniae .
도 3은 S. iniae의 유전형을 결정하는 단일염기다형성(SNP) 판별용 펩티드핵산의 cpsD 유전자내 결합위치와 유전형에 따른 각각의 펩티드핵산에 대한 서로 다른 혼성화 정도를 설명하기 위한 모식도이다. Figure 3 is a schematic diagram illustrating the different degree of hybridization for each peptide nucleic acid according to the binding position in the cpsD gene and genotype of the single nucleic acid polymorphism (SNP) for determining the genotype of S. iniae .
도 4는 펩티드핵산을 이용한 S. iniae의 유전형을 결정하는 단일염기다형성(SNP) 판별 방법의 혼성화 단계와 융해곡선을 얻는 단계를 설명하기 위한 모식도이다.Figure 4 is a schematic diagram for explaining the hybridization step and the step of obtaining the melting curve of the single nucleotide polymorphism (SNP) determination method for determining the genotype of S. iniae using peptide nucleic acid.
도 5는 펩티드핵산을 이용한 S. iniae의 유전형을 결정하는 단일염기다형성(SNP) 판별 방법에서 융해곡선(melting curve)으로부터 융해피크곡선(melting peak)을 얻는 단계를 설명하는 그래프이다.5 is a graph illustrating a step of obtaining a melting peak curve from a melting curve in a single base polymorphism (SNP) determination method for determining genotype of S. iniae using peptide nucleic acids.
도 6는 S. iniae의 유전형을 결정하는 단일염기다형성(SNP) 판별용 펩티드핵산의 기술적 특징을 설명하기 위한 개념도이다.6 is a conceptual diagram for explaining the technical characteristics of the peptide nucleic acid for determining the single base polymorphism (SNP) to determine the genotype of S. iniae .
도 7은 S. iniae의 유전형을 결정하는 단일염기다형성(SNP) 판별 결과 및 동일 샘플의 염기서열 분석결과를 비교분석한 결과이다.Figure 7 is a result of comparing the results of nucleotide sequence analysis of the same sample and the single nucleotide polymorphism (SNP) determination to determine the genotype of S. iniae .
도 8은 S. iniae의 유전형별 펩티드핵산의 융해곡선 그래프로부터 얻은 융해온도(Tm)를 유전코드로 정리한 표이다.FIG. 8 is a table summarizing the melting temperature (Tm) obtained from a melting curve graph of peptide nucleic acids for genotypes of S. iniae .
발명의 상세한 설명 및 바람직한 구현예Detailed Description of the Invention and Preferred Embodiments
다른 식으로 정의되지 않는 한, 본 명세서에서 사용된 모든 기술적 및 과학적 용어들은 본 발명이 속하는 기술분야에서 숙련된 전문가에 의해서 통상적으로 이해되는 것과 동일한 의미를 갖는다. 일반적으로, 본 명세서에서 사용된 명명법 및 이하에 기술하는 실험 방법은 본 기술분야에서 잘 알려져 있고 통상적으로 사용되는 것이다.Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein and the experimental methods described below are well known and commonly used in the art.
본 발명에서는 Streptococcus iniae의 유전형에 따른 병원성을 신속하고 간편하게 분석하고자 S. iniae의 유전형을 결정하는 단일염기다형성 마커를 선별하였다. In the present invention, a single nucleotide polymorphism marker that determines the genotype of S. iniae was selected for quick and easy analysis of the pathogenicity according to the genotype of Streptococcus iniae .
구체적으로, 본 발명자는 감염된 한국의 넙치로부터 29개의 S. iniae DNA를 분리하여 repetitive sequence-based PCR(rep-PCR) 및 random amplified polymorphic DNA(RAPD)를 통하여 이들 S. iniae가 두 개의 유전형으로 나뉜다는 것을 확인하였고, S. iniae의 cpsD 유전자의 염기서열을 이용한 이들의 계통수 결과와 일치함을 확인하였다. S. iniae의 두 개의 유전형을 cpsD 단백질의 알려진 기능 도메인들과 비교하고, rep-PCR을 통해 이 두 유전자형 간의 cpsD 유전자 내 368번째 및 385번째에서 단일염기다형성(SNP)이 존재한다는 것과 이 부위가 C 또는 G인 경우 S. iniae가 병원성을 나타낸다는 것을 확인하였다. Specifically, the present inventors isolated 29 S. iniae DNA from infected flounder in Korea, and these S. iniae are divided into two genotypes through repetitive sequence-based PCR (rep-PCR) and random amplified polymorphic DNA (RAPD). It was confirmed that the results were consistent with their phylogenetic results using the nucleotide sequence of the cpsD gene of S. iniae . Compare the two genotypes of S. iniae with the known functional domains of the cpsD protein and, via rep-PCR, there is a single nucleotide polymorphism (SNP) at 368 and 385 in the cpsD gene between these two genotypes In case of C or G, it was confirmed that S. iniae is pathogenic.
상기의 단일염기다형성 부위는 S. iniae의 유전형을 판별할 수 있고, 펩티드핵산의 DNA에 대한 결합력이 DNA 상호간의 결합력보다 매우 우수하여(DNA-DNA< PNA-DNA), 펩티드핵산은 1개 nucleotide의 불완전한 혼성화(mismatch)에도 융해온도(Tm)가 10~15℃ 가량 차이가 난다. 결국, 펩티드핵산 프로브의 nucleotide와 이에 상보적으로 결합하는 DNA의 nucleotide 차이에 따라서도 Tm값이 변화를 나타내기 때문에, 본 발명은 이를 이용하여 S. iniae의 유전형을 결정하는 단일염기다형성(SNP)을 판별하고자 한다. The single nucleotide polymorphism site can determine the genotype of S. iniae , and the binding strength of peptide nucleic acid to DNA is much better than that of DNA (DNA-DNA <PNA-DNA), and peptide nucleic acid is 1 nucleotide. Melt temperature (Tm) differs by about 10 ~ 15 ℃ even with incomplete mismatch. As a result, since the Tm value also changes according to the nucleotide difference between the nucleotide of the peptide nucleic acid probe and the DNA binding complementarily thereto, the present invention uses the single nucleotide polymorphism (SNP) to determine the genotype of S. iniae . We want to determine
따라서, 본 발명은 일 관점에서, 서열번호 1의 Streptococcus iniae의 cpsD 서열에서 T368C 또는 T385G의 단일염기다형성 변이를 포함하는 서열단편과 엄격한 조건에서 혼성화할 수 있는 Streptococcus iniae의 유전형 판별용 프로브에 관한 것이다. Accordingly, in one aspect, the present invention relates to a probe for genotyping of Streptococcus iniae that can hybridize under severe conditions with a sequence fragment containing a single nucleotide polymorphism of T368C or T385G in the cpsD sequence of Streptococcus iniae of SEQ ID NO: 1 .
또한, 펩티드핵산 프로브는 TaqMan probe의 hydrolysis method와는 다른 hybridization method를 이용하여 분석할 수 있으며, 비슷한 역할을 하는 probe로는 molecular beacon probe, scorpion probe가 있다.In addition, peptide nucleic acid probes can be analyzed using a hybridization method different from the hydrolysis method of TaqMan probe. Probes that play a similar role include molecular beacon probes and scorpion probes.
따라서, 상기 프로브는 양말단에 리포터(reporter) 및 소광자(quencher)를 가지는 것을 특징으로 하는 PNA인 것이 바람직하다. 즉, 본 발명에 따른 펩티드핵산 프로브는 양 말단에는 리포터(reporter)와 리포터 형광을 소광(quenching)할 수 있는 소광자(quencher)가 결합될 수 있다. 상기 리포터(reporter)는 FAM(6-carboxyfluorescein), Texas red, HEX(2',4',5',7',-tetrachloro-6-carboxy -4,7-dichlorofluorescein) 및 CY5로 구성되는 군에서 선택되는 하나 이상일 수 있으며, 상기 소광자는 TAMRA(6-carboxytetramethyl-rhodamine), BHQ1, BHQ2 및 Dabcyl로 구성되는 군에서 선택되는 하나 이상일 수 있으나, 이에 한정되는 것은 아니며, 바람직하게는 Dabcyl을 사용하는 것을 특징으로 한다. Therefore, the probe is preferably a PNA characterized by having a reporter and a quencher at the sock end. That is, in the peptide nucleic acid probe according to the present invention, a reporter and a quencher capable of quenching reporter fluorescence may be coupled to both ends. The reporter (reporter) in the group consisting of FAM (6-carboxyfluorescein), Texas red, HEX (2 ', 4', 5 ', 7', -tetrachloro-6-carboxy -4,7-dichlorofluorescein) and CY5 One or more selected, the quencher may be one or more selected from the group consisting of TAMRA (6-carboxytetramethyl-rhodamine), BHQ1, BHQ2 and Dabcyl, but is not limited thereto, preferably using Dabcyl It features.
상기 본 발명에 따른 펩티드핵산의 염기서열 길이는 특별히 제한되지는 않지만, Streptococcus iniae의 유전형을 결정하는 단일염기다형성(SNP)을 포함하는 5~30 mer 길이로 제작할 수 있으며, 바람직하게는 9~17mer 길이로 제작할 수 있다. The base sequence length of the peptide nucleic acid according to the present invention is not particularly limited, but may be prepared in a length of 5 to 30 mer including a single nucleotide polymorphism (SNP) that determines the genotype of Streptococcus iniae , preferably 9 to 17mer. Can be produced in length.
펩티드핵산 프로브의 길이를 조절하여 원하는 Tm값을 가지도록 프로브를 제작할 수 있고, 같은 길이의 펩티드핵산 프로브라도 염기서열에 변화를 주어 Tm 값을 조절하는 것도 가능하다. The length of the peptide nucleic acid probe can be adjusted to produce a probe having a desired Tm value, and even a peptide nucleic acid probe of the same length can be adjusted to change the nucleotide sequence.
또한, 펩티드핵산은 DNA보다 결합력이 우수하여 기본적인 Tm값이 높기 때문에 DNA보다 짧은 길이로 제작이 가능하여 가깝게 이웃한 펩티드핵산이라도 판별이 가능하다. 기존의 HRM method에 의하면 Tm값의 차이가 약 0.5℃로 매우 적어서 추가적인 분석프로그램이나 세밀한 온도 변화 또는 보정을 필요로 하고, 이 때문에 2개 이상의 펩티드핵산이 나타날 경우에는 분석이 어려웠지만, 본 발명에 따른 펩티드핵산 프로브는 프로브서열과 펩티드핵산에 대해서 영향을 받지 않아 간편하게 분석이 가능하다.In addition, since peptide nucleic acids have a higher binding force than DNA and have a higher basic Tm value, the peptide nucleic acid can be produced in a shorter length than DNA, so that even adjacent peptide nucleic acids can be discriminated. According to the existing HRM method, the difference in Tm value is about 0.5 ° C., which is very small and requires additional analysis program or detailed temperature change or correction. Therefore, when two or more peptide nucleic acids appear, the analysis was difficult. According to the peptide nucleic acid probe is not affected by the probe sequence and peptide nucleic acid can be easily analyzed.
본 발명의 상기 펩티드핵산 세트는 두개의 펩티드핵산을 포함하는 하나의 튜브를 포함할 수 있고, 상기 튜브에 포함된 펩티드핵산은 서로 다른 리포터로 구성될 수 있는 것이 특징이다. The peptide nucleic acid set of the present invention may include one tube including two peptide nucleic acids, and the peptide nucleic acids included in the tube may be configured with different reporters.
또한, 본 발명에 따른 펩티드핵산 프로브는 표적핵산과 염기변이를 가지는 표적핵산의 융해온도(Tm) 차이를 위해, 표적핵산의 염기변이 위치가 펩티드핵산 프로브의 가운데 부분(center position)에 오도록 디자인하는 것이 바람직하다. 염기변이 부분이 프로브의 가운데 부분(center position)에 위치하여 프로브의 구조적 차이를 만들게 되고, 펩티드핵산 프로브는 루프(loop)를 형성하면서 결합하게 되어, 이런 구조적 차이로 인해 융해온도(Tm)차이가 크게 나타날 수 있다. In addition, the peptide nucleic acid probe according to the present invention is designed such that the base mutation position of the target nucleic acid is in the center position of the peptide nucleic acid probe for the difference in melting temperature (Tm) of the target nucleic acid and the target nucleic acid having a base mutation It is preferable. The base mutation is located in the center position of the probe to make the structural difference of the probe, the peptide nucleic acid probe is bound to form a loop (Tm) difference due to this structural difference It may appear large.
이러한 이유로, 본 발명에 따른 펩티드핵산 프로브가 13개 내지 17개 범위 의 염기서열을 포함하는 경우에는, 6번째 내지 9번째 위치 중 하나 이상의 위치에 단일염기다형성(SNP) 부위에 상응하는 서열을 가지는 것이 바람직하다. For this reason, when the peptide nucleic acid probe according to the present invention includes 13 to 17 base sequences, the peptide nucleic acid probe has a sequence corresponding to a single nucleotide polymorphism (SNP) site at at least one of the 6th to 9th positions. It is preferable.
이러한 펩티드핵산은 염기서열의 가운데 부분에 Streptococcus iniae의 유전형을 결정하는 단일염기다형성(SNP) 판별부위에 상응하는 서열을 포함하여 구조적인 변형을 가질 수 있고, 이를 통해 완전한 혼성화를 이루는 표적핵산(perfect match)과의 융해온도(Tm) 차이를 더욱 크게 할 수 있다. Such peptide nucleic acids may have structural modifications, including sequences corresponding to single nucleotide polymorphisms (SNPs) that determine the genotype of Streptococcus iniae at the center of the nucleotide sequence, thereby resulting in complete hybridization of target nucleic acids (perfect hybridization). match with the melting temperature (Tm) can be made larger.
또한, 본 발명에 따른 Streptococcus iniae의 유전형을 결정하는 단일염기다형성(SNP) 판별용 펩티드핵산은 결합하는 염기서열(또는 SNP)에 따라 다른 융해온도(Tm)를 나타내기 때문에, 하나의 펩티드핵산(또는 프로브)으로 2개 이상의 염기서열을 검출할 수 있고, 또한 2개 이상의 펩티드핵산을 하나의 튜브에 포함시켜서 사용하는 것도 가능하다. In addition, the peptide nucleic acid for determining the single nucleotide polymorphism (SNP) to determine the genotype of Streptococcus iniae according to the present invention shows a different melting temperature (Tm) depending on the binding sequence (or SNP), so that one peptide nucleic acid ( Alternatively, two or more base sequences can be detected by a probe), and two or more peptide nucleic acids can be included and used in one tube.
본 발명의 펩티드핵산은 Streptococcus iniae의 유전형을 결정하는 기술에 관한 것으로 본 발명의 펩티드핵산을 S. iniae의 표적핵산과 혼성화시키고 융해곡선을 분석함으로써 S. iniae의 단일염기다형성을 간단, 신속, 정확하게 판별할 수 있다.Peptide nucleic acid of the present invention relates to a technique for determining genotyping of Streptococcus iniae , and hybridizes the peptide nucleic acid of the present invention with the target nucleic acid of S. iniae and analyzes the melting curve to simplify, rapid and accurate single nucleotide polymorphism of S. iniae . Can be determined.
본 발명에서 핵산 하이브리다이제이션 반응에서, 엄격한 특정 수준을 달성하기 위하여 사용되는 "엄격한 조건"은 하이브리다이즈되는 핵산의 성질에 따라 다양하다. 예를 들면, 하이브리다이제이션되는 핵산 부위의 길이, 상동성 정도, 뉴클레오티드 서열 조성(예를 들면, GC/AT 조성비) 및 핵산 타입(예를 들면, RNA, DNA)등이 하이브리다이제이션 조건을 선택하는데 고려된다. 추가적인 고려 조건은 핵산이 예를 들면, 필터 등에 고정화되어 있는지의 여부이다.In nucleic acid hybridization reactions in the present invention, the "strict conditions" used to achieve stringent specific levels vary depending on the nature of the nucleic acid being hybridized. For example, the length of the nucleic acid region to be hybridized, degree of homology, nucleotide sequence composition (eg, GC / AT composition ratio), and nucleic acid type (eg, RNA, DNA) select hybridization conditions. Is considered. Further considerations are whether the nucleic acid is immobilized, for example, in a filter or the like.
매우 엄격하게 진행되는 조건의 예를 들면 다음과 같다: 실온의 2X SSC/0.1% SDS(하이브리다이제이션 조건); 실온의 0.2X SSC/0.1% SDS(엄격성이 낮은 조건); 42℃에서의 0.2X SSC/0.1% SDS(보통의 엄격성을 가지는 조건); 68℃에서 0.1X SSC(높은 엄격성을 가지는 조건). 세척 과정은 이들 중 한가지 조건을 사용하여 수행할 수 있고, 예를 들면 높은 엄격성을 가지는 조건, 또는 상기 조건을 각각 사용할 수 있으며, 상기 기재된 순서대로 각각 10~15분씩, 상기 기재된 조건을 전부 또는 일부 반복하여 수행할 수 있다. 그러나 상기에 기술한 바와 같이, 최적 조건은 포함된 특별한 하이브리다이제이션 반응에 따라 다양하며, 실험을 통하여 결정할 수 있다. 일반적으로, 중요한 프로브의 하이브리다이제이션에는 높은 엄격성을 가지는 조건이 사용된다.Examples of very stringent conditions are as follows: 2X SSC / 0.1% SDS at room temperature (hybridization conditions); 0.2X SSC / 0.1% SDS at room temperature (low stringency conditions); 0.2X SSC / 0.1% SDS at 42 ° C. (conditions with moderate stringency); 0.1X SSC at 68 ° C. conditions with high stringency. The washing process can be carried out using one of these conditions, for example a condition with high stringency, or each of the above conditions, each of 10-15 minutes in the order described above, all or all of the conditions described above. Some iterations can be done. However, as described above, the optimum conditions vary with the particular hybridization reaction involved and can be determined experimentally. In general, conditions of high stringency are used for hybridization of critical probes.
따라서, 본 발명은 다른 관점에서, 단일염기다형성(SNP) 판별을 통한 Streptococcus iniae의 유전형의 결정방법에 관한 것이다.Therefore, in another aspect, the present invention relates to a method for determining the genotype of Streptococcus iniae by single nucleotide polymorphism (SNP) determination.
구체적으로 (a) S. iniae로부터 DNA를 분리하는 단계; 및 (b) S. iniae의 표적핵산을 본 발명의 펩티드핵산과 혼성화(hybridization)하는 단계; 및 (c) 온도를 변화시키면서 상기 혼성화된 산물을 융해시켜 융해곡선을 얻는 단계; 및 (d) 상기 얻어지는 융해곡선을 분석하는 단계를 포함하는 단일염기다형성(SNP) 판별을 통한 Streptococcus iniae의 유전형의 결정방법이다.Specifically, (a) separating the DNA from S. iniae ; And (b) hybridizing the target nucleic acid of S. iniae with the peptide nucleic acid of the present invention; And (c) melting the hybridized product while varying the temperature to obtain a melting curve; And (d) is a method of determining the genotype of Streptococcus iniae by determining the single nucleotide polymorphism (SNP) comprising the step of analyzing the resulting melting curve.
상기 혼성화하는 단계는 본 발명에 따른 펩티드핵산을 S. iniae의 표적핵산과 반응시키는 것이다. 이 단계는 PCR 과정을 포함할 수 있고, PCR을 위한 Forward / Reverse primer set를 이용하는 것이 가능하다. 이러한 혼성화 단계와 PCR 조건은 이 기술 분야에서 보통의 지식을 가진 자(이하, '당업자'라고 함)에게 널리 알려진 다양한 모든 방법을 포함할 수 있다. 또한, PCR이 끝난 후에는 melting 과정을 포함하는 것도 가능하다. The hybridization step is to react the peptide nucleic acid according to the present invention with the target nucleic acid of S. iniae . This step may include a PCR procedure, and it is possible to use a forward / reverse primer set for PCR. Such hybridization steps and PCR conditions may include any of a variety of methods that are well known to those of ordinary skill in the art (hereinafter, referred to as “the skilled person”). In addition, after the PCR is completed, it is also possible to include a melting process.
상기의 S. iniae의 표적핵산은 상기한 본 발명의 cpsD 유전자에 존재하는 염기다형성(SNP) 부위를 포함하는 것이 바람직하다. S. iniae의 표면에서 발현되는 cpsD 유전자의 유전적 변이는 감염력과 병원성에 영향을 미치는 것을 본 발명에서 확인하였으며, S. iniae의 감염력과 병원성을 판별하는데 효과적이다. It is preferable that the target nucleic acid of S. iniae contains the nucleotide polymorphism (SNP) site present in the cpsD gene of the present invention described above. Genetic variation of the cpsD gene which is expressed on the surface of S. iniae was confirmed in the present invention to affect the infectivity and virulence, it is effective to determine the infectivity and virulence of S. iniae.
또한, 상기 온도별 융해곡선을 얻는 단계는 S. iniae 표적핵산의 융해온도(Tm)를 얻기 위한 것이다. 이를 위하여, 상기 혼성화한 산물의 온도를 높이면서 형광의 세기를 측정하여, 온도에 따른 형광세기 변화를 온도별 융해곡선으로 얻을 수 있다. 즉, Hybridization method 분석 방법으로 FMCA(Fluorescence Melting Curve Analysis)를 이용할 수 있고, 상기 FMCA는 PCR 반응이 끝나고 난 후 만들어진 산물과 넣어준 프로브간의 결합력 차이를 Tm으로 구분하여 분석하는 것이다. 예를 들어, 일반적인 real-time PCR 장치를 이용하여, 1℃ 증가시킬 때마다 형광의 세기를 측정함으로서 Tm값을 얻을 수 있다. In addition, the step of obtaining the melting curve for each temperature is to obtain the melting temperature (Tm) of S. iniae target nucleic acid. To this end, by measuring the intensity of the fluorescence while increasing the temperature of the hybridized product, it is possible to obtain the fluorescence intensity change according to the temperature as the melting curve for each temperature. That is, the hybridization method analysis method may use FMCA (Fluorescence Melting Curve Analysis), the FMCA is to analyze the difference between the binding force between the product produced after the PCR reaction and put the probe by Tm. For example, using a general real-time PCR apparatus, the Tm value can be obtained by measuring the intensity of fluorescence each time it is increased by 1 ° C.
상기 Streptococcus iniae의 유전형을 결정하는 단일염기다형성(SNP)을 판별하는 단계는 상기 얻은 융해곡선의 융해온도로부터 S. iniae의 유전형을 결정하는 단일염기다형성(SNP)을 판별하는 것이다. 예를 들어, 상기 얻은 융해곡선의 융해온도를 이미 알고 있는 S. iniae의 유전형을 결정하는 단일염기다형성(SNP)의 융해온도와 비교하여 S. iniae의 유전형을 결정하는 단일염기다형성(SNP)을 판별할 수 있다. S. iniae의 유전형을 결정하는 단일염기다형성(SNP)마다 본 발명에 따른 펩티드핵산을 적용한 융해곡선은 서로 다른 융해온도(Tm)를 가지며, 이러한 차이를 이용하여 S. iniae의 유전형을 결정하는 단일염기다형성(SNP) 판별이 가능하다. The step of determining the single base polymorphism (SNP) for determining the genotype of the Streptococcus iniae is to determine the single base polymorphism (SNP) for determining the genotype of S. iniae from the melting temperature of the obtained melting curve. For example, a single nucleotide polymorphism (SNP) as compared to the melting temperature of the single-nucleotide polymorphism (SNP) to determine the genotype of the S. iniae the known melting temperature of the obtained melting curve for determining the genotype of the S. iniae Can be determined. The melting curves of the peptide nucleic acids according to the present invention have different melting temperatures (Tm) for each single nucleotide polymorphism (SNP) that determines the genotype of S. iniae . Base polymorphism (SNP) determination is possible.
도 5는 본 발명에 따른 펩티드핵산을 이용한 Streptococcus iniae의 유전형을 결정하는 단일염기다형성(SNP) 판별 방법에서 융해곡선으로부터 융해피크곡선을 얻는 단계의 일례를 설명하기 위한 그래프이고, 여기에 나타난 바와 같이 상기 융해곡선의 기울기 값을 이용하여 온도별 융해피크곡선을 얻을 수 있으며, 이러한 융해피크곡선은 S. iniae의 유전형을 결정하는 단일염기다형성(SNP)의 융해온도(Tm)를 파악하기에 용이하다. 이를 위하여, 상기 온도별 융해곡선을 얻는 단계는, 상기 얻은 온도별 융해곡선으로부터 온도별 융해피크곡선을 얻는 단계를 포함하고, 상기 S. iniae의 유전형을 결정하는 단일염기다형성(SNP)을 판별하는 단계는 상기 얻은 융해피크곡선의 융해온도로부터 S. iniae의 유전형을 결정하는 단일염기다형성(SNP)을 판별하는 것이 가능하다. 5 is a graph for explaining an example of the step of obtaining the melting peak curve from the melting curve in the single base polymorphism (SNP) determination method for determining the genotype of Streptococcus iniae using the peptide nucleic acid according to the present invention, as shown here The melting peak curve for each temperature can be obtained using the slope value of the melting curve, and this melting peak curve is easy to determine the melting temperature (Tm) of the single base polymorphism (SNP) that determines the genotype of S. iniae . . To this end, the step of obtaining a melting curve for each temperature, comprising the step of obtaining a melting peak curve for each temperature from the obtained melting curve for each temperature, to determine a single base polymorphism (SNP) to determine the genotype of the S. iniae In the step, it is possible to determine a single base polymorphism (SNP) which determines the genotype of S. iniae from the melting temperature of the obtained melting peak curve.
또한, 본 발명은 다른 관점에서, 프로브를 포함하는 Streptococcus iniae의 유전형을 결정하는 단일염기다형성(SNP) 판별용 키트에 관한 것이다. In another aspect, the present invention also relates to a kit for determining single nucleotide polymorphism (SNP) for determining the genotype of Streptococcus iniae comprising a probe.
상기 키트는 다중 타겟 DNA 또는 단일 타겟 DNA의 염기 다형성 분석용인 것을 특징으로 하는 키트이다. The kit is a kit characterized in that for the base polymorphism analysis of multiple target DNA or a single target DNA.
상기 키트의 프로브는 PNA인 것을 특징으로 하는 Streptococcus iniae의 유전형을 결정하는 단일염기다형성(SNP) 판별용 프로브이다.The probe of the kit is a single nucleotide polymorphism (SNP) determination probe for determining the genotype of Streptococcus iniae , characterized in that the PNA.
상기 키트는 버퍼, DNA 중합효소 조인자 및 데옥시리보뉴클레오타이드-5-트리포스페이트와 같은 타겟 증폭 PCR 반응(예컨대, PCR 반응)을 실시하는데 필요한 시약을 선택적으로 포함할 수 있으며, 다양한 폴리뉴클레오타이드 분자, 역전사효소, 다양한 버퍼 및 시약, 및 DNA 중합효소 활성을 억제하는 항체를 포함하는 것도 가능하다. The kit may optionally include reagents required for conducting target amplification PCR reactions (eg, PCR reactions) such as buffers, DNA polymerase cofactors and deoxyribonucleotide-5-triphosphate, and may be used for various polynucleotide molecules, reverse transcription. It is also possible to include enzymes, various buffers and reagents, and antibodies that inhibit DNA polymerase activity.
이러한 키트를 이용하면, 펩티드핵산 프로브에 의한 용해곡선 분석을 통하여 표적핵산의 단일염기변이 및 염기의 결손 또는 삽입에 의한 변이를 효과적으로 검출할 수 있고, 이를 통하여 Streptococcus iniae의 유전형을 결정하는 단일염기다형성(SNP)의 판별이 가능하며 병원성을 결정할 수 있다. Using this kit, single nucleotide variations of target nucleic acids and mutations caused by deletions or insertions of base nucleic acids can be effectively detected through dissolution curve analysis by peptide nucleic acid probes, and thus single nucleotide polymorphisms that determine the genotype of Streptococcus iniae . (SNP) can be determined and pathogenicity can be determined.
이하 본 발명을 실시예에 의하여 더욱 상세하게 설명한다. 이들 실시예는 단지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 범위가 이들 실시예에 국한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention in more detail, it will be apparent to those skilled in the art that the scope of the present invention is not limited to these examples.
실시예 1 : Streptococcus iniae의 유전형 관여 단일염기다형성(SNP) 부위의 개발Example 1 Development of Genotype Involved Monobasic Polymorphism (SNP) Site of Streptococcus iniae
2000년과 2005년 사이에 한국의 부산, 거제, 울산, 제주 및 완도 등에서 양식한 넙치로부터 29종의 Streptococcus iniae를 분리하였고, Kavit 과 Colorni에 의해 정립된 박테리아 게놈 DNA 분리법에 의해 DNA를 분리하여 실시예에 사용하였다. Between 2000 and 2005, 29 species of Streptococcus iniae were isolated from flounder grown in Busan, Geoje, Ulsan, Jeju, and Wando, Korea, and DNA was isolated by bacterial genomic DNA separation method established by Kavit and Colorni. Used in the example.
기존에 알려진 Streptococcus iniae(ATCC 29178)와 한국의 양식 넙치에서 분리한 29개의 S. iniae 균주를 대상으로 rep-RCR(repetitive sequence-based PCR)을 실시하여 두 개의 유전형(genotype)으로 구분되는 것을 확인하였고, 각각 유전형 1과 2로 명명한 이들은 유전형 1(86.2%)이 유전형 2(13.8%)에 비하여 출현율이 우세하게 나타났다. 서열번호 2의 BoxA 프라이머는 S. iniae의 cpsD 유전자를 타겟으로 하며 사용한 BoxA 프라이머의 염기서열 및 rep-RCR 조건은 다음과 같다.Rep-RCR (repetitive sequence-based PCR) was performed on 29 known strains of Streptococcus iniae (ATCC 29178) and cultured flounder in Korea to identify two genotypes. The genotypes 1 and 2 were named as genotype 1 (86.2%). BoxA primer of SEQ ID NO: 2 targets the cpsD gene of S. iniae, and the base sequence and rep-RCR condition of the BoxA primer used are as follows.
서열번호 2: BoxA primer 5’-ACGTGGTTTGAAGAGATTTTTTCG-3'SEQ ID NO: BoxA primer 5'-ACGTGGTTTGAAGAGATTTTTTCG-3 '
rep-PCR 조건 : initial denaturation step : 95℃, 7 min rep-PCR condition: initial denaturation step: 95 ℃, 7 min
denaturation : 95℃ , 30s ┐                denaturation: 95 ℃, 30s ┐
annealing : 40℃, 1min │ 35 cycles                 annealing: 40 ℃, 1min│ 35 cycles
extension :65℃, 8 min ┘                 extension: 65 ℃, 8 min ┘
final extension step : 65℃, 16 min                 final extension step: 65 ℃, 16 min
약 1,000 bp 근처에서 유전형 1에서 관찰되지 않으나 유전형 2에서는 관찰되는 amplified product를 확인하였다(도 1). It was confirmed that the amplified product was not observed in genotype 1 near about 1,000 bp but observed in genotype 2 (FIG. 1).
Streptococcus iniae 유전형 1과 유전형 2의 cpsD 유전자 염기서열을 분석하여 비교한 결과, 각 유전형별로 유의성을 보이는 단일염기다형성(SNP)을 찾았다. 구체적으로 S. iniae strain DGX07의 cpsD 유전자(NCBI database: JF795257.1) 기준 368bp 및 385bp의 염기서열이 두 유전형 간에 차이가 나타나는 것을 확인하였으며, Streptococcus iniae 유전형 1은 C(368bp), G(385bp) 이고 유전형 2는 T(368bp), T(385bp)이다(도 2). As a result of analyzing the cpsD gene sequences of Streptococcus iniae genotype 1 and genotype 2, a single nucleotide polymorphism (SNP) was found. Specifically, 368bp and 385bp base sequence of the cpsD gene (NCBI database: JF795257.1) of S. iniae strain DGX07 was found to be different between the two genotypes. Streptococcus iniae genotype 1 was C (368bp), G (385bp) And genotype 2 is T (368 bp), T (385 bp) (FIG. 2).
각 유전형에 해당하는 균주의 병원성을 확인하기 위하여, 멸균된 생리식염수(PBS)로 희석한 세균을 실험어, 넙치(평균 체중 18.4g)의 복강 내로 0.1 mL씩 주사하였고, 대조구는 (n=10) 생리식염수를 0.1 mL씩 복강 주사하였다. 실험 수온은 23.1℃를 유지하여 7일 동안 폐사율을 조사하였고 실험기간 중 죽은 고기는 해부하여 Streptococcus iniae를 재분리 하였다. 반수치사균수(LD50)는 Finney의 probit method를 사용하여 계산하였고, S. iniae 유전형 1의 넙치에 대한 반수치사 농도(LD50)는 7.0~7.2 × 105 cfu/fish이고 유전형 2의 넙치에 대한 반수치사 농도는 3.4~3.6 × 108 cfu/fish로 나타나 유전형 1이 2에 비해 넙치에 대해 약 2000배 높은 병원성을 나타냈다. To confirm the pathogenicity of the strains corresponding to each genotype, bacteria diluted with sterile saline (PBS) were injected 0.1 mL into the abdominal cavity of the flounder (average weight 18.4 g), and the control (n = 10). ) 0.1 mL of normal saline was intraperitoneally injected. The mortality was examined for 7 days at 23.1 ℃, and the dead meat was dissected and the Streptococcus iniae was re-isolated. Hemi-bacterial bacterial counts (LD50) were calculated using Finney's probit method, and hemi-accumulated concentrations (LD50) for flounder of S. iniae genotype 1 ranged from 7.0 to 7.2 × 10 5 cfu / fish and half of flounder for genotype 2 The lethal concentration ranged from 3.4 to 3.6 × 10 8 cfu / fish, indicating that genotype 1 was about 2000 times more pathogenic for flounder than two.
실시예 2 : Streptococcus iniae의 단일염기다형성(SNP) 판별용 펩티드핵산의 제조Example 2 Preparation of Peptide Nucleic Acids for the Identification of Single Base Polymorphism (SNP) of Streptococcus iniae
실시예 1에서 실시한 Streptococcus iniae의 cpsD 유전자의 염기서열을 분석 결과 찾은 단일염기다형성(SNP)을 바탕으로 각 유전형에 관여하는 유전자 특이적인 염기서열을 선택하였다. Based on the nucleotide sequence of the cpsD gene of Streptococcus iniae performed in Example 1, the gene-specific nucleotide sequence involved in each genotype was selected based on the single nucleotide polymorphism (SNP).
구체적으로 Streptococcus iniae의 유전형을 결정하는 단일염기다형성(SNP)은 368번 (C/T)이며, 이에 따라 상기 위치를 가운데로 하는 염기서열(서열번호 3)을 본 발명에 따른 펩티드핵산의 염기서열로 구성하였다.Specifically, the single nucleotide polymorphism (SNP) that determines the genotype of Streptococcus iniae is 368 (C / T), and thus the nucleotide sequence (SEQ ID NO: 3) centering the position is the nucleotide sequence of the peptide nucleic acid according to the present invention. It consisted of.
이와 같이, 본 발명에 따른 펩티드핵산의 염기서열을 결정하였고, 하기 표 1에 나타내었다. As such, the nucleotide sequence of the peptide nucleic acid according to the present invention was determined and shown in Table 1 below.
표 1
Probe name Sequence(5’→3’)
서열번호 3 SSW_SIA Dabcyl-CAAGTGCCACCAAATC-O-K (FAM)
Table 1
Probe name Sequence (5 '→ 3')
SEQ ID NO: 3 SSW_SIA Dabcyl-CAAGTGCCACCAAATC-OK (FAM)
＊상기 표 1에서 O는 링커 및 K는 라이신(lysine)을 의미한다.* In Table 1, O means a linker and K means lysine.
상기 표 1에 나타난 바와 같은 염기서열과 리포터 및 소광자로 본 발명에 따른 펩티드핵산 프로브를 제작하였다. 펩티드핵산 프로브는 펩티드핵산 프로브 디자이너(Appliedbiosystems, 미국)를 이용하여 설계하였다. 본 발명에서 사용한 모든 펩티드핵산 프로브는 파나진(Panagene, 한국)에서 HPLC 정제 방법을 통해 합성하였고, 합성된 모든 프로브의 순도는 질량분석법을 이용하여 확인하였으며, 표적핵산과의 더 효과적인 결합을 위해 프로브의 불필요한 이차구조는 피하였다.Peptide nucleic acid probes according to the present invention were prepared with the nucleotide sequences, reporters and quencher as shown in Table 1 above. Peptide nucleic acid probes were designed using Peptide Nucleic Acid Probe Designer (Appliedbiosystems, USA). All peptide nucleic acid probes used in the present invention were synthesized by HPLC purification method in Panagene (Panagene, Korea), and the purity of all synthesized probes was confirmed by mass spectrometry. Unnecessary secondary structures were avoided.
도 3은 본 발명에 따른 S. iniae cpsD 유전자 상에서 펩티드핵산이 포함하고 있는 염기변이 부분의 일례를 설명하기 위한 유전자 위치도이며 숫자는 본 발명에 따른 단일염기다형성 부위를 나타낸다. Figure 3 is a gene position map for explaining an example of the base mutant portion contained in the peptide nucleic acid on the S. iniae cpsD gene according to the present invention, the number represents a single nucleotide polymorphism site according to the present invention.
실시예 3: 용해곡선의 분석Example 3: Analysis of Dissolution Curves
상기 실시예 2에 따라 제작된 본 발명의 펩티드핵산을 이용하여, Streptococcus iniae 2종의 유전형을 가지는 각각의 DNA에 대하여 용해곡선을 도출하였고, 이를 분석하여 S. iniae의 유전형을 결정하는 단일염기다형성(SNP)을 판별하였다. Using the peptide nucleic acid of the present invention prepared according to Example 2, a dissolution curve was derived for each DNA having two genotypes of Streptococcus iniae , and analyzed to determine the single nucleotide polymorphism to determine the genotype of S. iniae . (SNP) was determined.
PCR은 CFX96™ Real-Time 시스템(BIO-RAD 사, 미국)을 이용하여 수행하였으며, 모든 실험 조건은 단일가닥 표적핵산을 생성하기 위해 비대칭 PCR(asymmetric PCR)을 이용하였다. 비대칭 PCR의 조건은 다음과 같다; 총 볼륨이 20㎕ 이 되도록 1X 시선바이오 리얼타임 FMCA™ 버퍼(SeaSunBio Real-Time FMCA™ buffer, 시선바이오, 한국), 2.5mM MgCl2, 200μM dNTPs, 1.0 U Taq polymerase, 0.05μM forward primer(서열번호 4) 및 0.5μM reverse primer(서열번호 5, asymmetric PCR, 표 2)에 0.5㎕ 프로브(상기 실시예 2에서 제조된 펩티드핵산), 0.5㎕ S. iniae의 DNA를 첨가한 다음 real-time PCR을 실시하였다. PCR was performed using a CFX96 ™ Real-Time system (BIO-RAD, USA), and all experimental conditions used asymmetric PCR (asymmetric PCR) to generate a single stranded target nucleic acid. The conditions of asymmetric PCR are as follows; 1X EyeBio Real-Time FMCA ™ Buffer (SeaSunBio Real-Time FMCA ™ Buffer, Eye Bio, Korea), 2.5mM MgCl 2 , 200μM dNTPs, 1.0 U Taq polymerase, 0.05μM forward primer (SEQ ID NO: 4) and 0.5 μM reverse primer (SEQ ID NO: 5, asymmetric PCR, Table 2) were added 0.5 μl probe (peptide nucleic acid prepared in Example 2), 0.5 μl S. iniae DNA followed by real-time PCR Was carried out.
표 2
서열번호 Primer name Sequence(5’→3’)
서열번호4 SPcpsD_F AGTGGTCGTGATTACAAGGC
서열번호5 SPcpsD_R CGTAAGCGCCATAAGAACCA
TABLE 2
SEQ ID NO: Prime name Sequence (5 '→ 3')
SEQ ID NO: 4 SPcpsD_F AGTGGTCGTGATTACAAGGC
SEQ ID NO: 5 SPcpsD_R CGTAAGCGCCATAAGAACCA
real-time PCR 과정은 95℃에서 5분간 변성시킨 다음, 95℃에서 30초, 58℃에서 45초, 74℃에서 45초 동안 반응시켰다. 이를 38 cycle 반복하였고, 실시간으로 형광을 측정하였다. 융해곡선 분석은 95℃에서 1분간 변성 단계를 거친 다음, 35℃에서 5분간 혼성화한 후, 35℃에서 85℃까지 1℃씩 상승시키며 형광을 측정하는 용해곡선 분석을 수행하였다. 각 단계 사이마다 10초간 정지 상태를 유지하였다(도 4). The real-time PCR process was denatured at 95 ° C. for 5 minutes, and then reacted at 95 ° C. for 30 seconds, 58 ° C. for 45 seconds, and 74 ° C. for 45 seconds. This was repeated 38 cycles, and fluorescence was measured in real time. The melting curve analysis was performed for 1 minute at 95 ° C, followed by hybridization at 35 ° C for 5 minutes, and then the melting curve analysis was performed by increasing the fluorescence by increasing the temperature from 35 ° C to 85 ° C in 1 ° C increments. The suspension was held for 10 seconds between each step (FIG. 4).
도 6은 본 발명의 바람직한 일 실시예에 따른 Streptococcus iniae의 유전형을 결정하는 단일염기다형성(SNP) 판별용 펩티드핵산의 기술적 특징을 설명하기 위한 개념도이고, 여기에 나타난 바와 같이, 본 발명에 따른 펩티드핵산은 표적핵산과 혼성화한 후 형광 신호를 발생시킬 수 있으며, 온도가 올라감에 따라 펩티드핵산의 적정 융해온도(Tm)에서 표적핵산으로부터 빠르게 융해되어 형광신호를 소광시킨다. 본 발명은 이러한 온도 변화에 따른 상기 형광 신호로부터 얻어진 고해상도의 융해곡선 분석(fluorescence melting curve analysis; FMCA)을 통하여, 표적핵산의 염기변이 유무를 검출하는 것이다. 본 발명에 따른 펩티드핵산은 표적핵산 염기서열과 완전한 혼성화(perfect match)를 이루는 경우 예상된 융해온도(Tm) 값을 보이지만, 염기변이가 존재하는 표적핵산과는 불완전한 혼성화(mismatch)를 이루어서 예상보다 낮은 융해온도(Tm) 값을 보이는 것을 특징으로 할 수 있다. Figure 6 is a conceptual diagram for explaining the technical characteristics of the peptide mononucleotide polymorphism (SNP) for determining the genotype of Streptococcus iniae genotype according to an embodiment of the present invention, as shown here, the peptide according to the present invention The nucleic acid may generate a fluorescent signal after hybridization with the target nucleic acid, and rapidly melts from the target nucleic acid at an appropriate melting temperature (Tm) of the peptide nucleic acid as the temperature increases, thereby extinguishing the fluorescent signal. The present invention is to detect the presence or absence of the base mutation of the target nucleic acid through a high-resolution fluorescence melting curve analysis (FMCA) obtained from the fluorescence signal according to the temperature change. Peptide nucleic acid according to the present invention shows the expected melting temperature (Tm) value when the complete hybridization (perfect match) with the target nucleic acid sequence, but incomplete hybridization (mismatch) with the target nucleic acid in which the base mutation is present than expected It may be characterized by showing a low melting temperature (Tm) value.
본 발명의 펩티드핵산(표1)을 사용한 분석에서 표적핵산이 S. iniae의 유전형1인 경우에는 완전한 혼성화(perfect match) peak가 나타났으며, 표적핵산이 S. iniae의 유전형 2인 경우에는 불완전한 혼성화(mismatch) peak가 나타났다. 또한,온도별 융해곡선 그래프로부터 얻은 결과와 단일염기다형성의 표준 분석방법인 시퀀싱 결과와 비교한 결과도 다형성부위가 유전형 1은 C, 유전형 2는 T로 일치하였다(도 7). In the analysis using the peptide nucleic acid of the present invention (Table 1), when the target nucleic acid was genotype 1 of S. iniae , a perfect match peak was observed, and incomplete when the target nucleic acid was genotype 2 of S. iniae . Mismatch peaks appeared. In addition, the results obtained from the melting curve graph according to the temperature and the sequencing results of the standard analysis method of the single nucleotide polymorphism also showed that the polymorphisms were genotype 1 as C and genotype 2 as T (FIG. 7).
이에 따르면, 본 발명에 따른 펩티드핵산을 이용하는 경우 염기서열분석 결과와 동일하게 염기다형성을 분석할 수 있으며, 이를 통하여 본 발명에 따른 펩티드핵산을 이용하면 S. iniae의 유전형을 결정하는 단일염기다형성(SNP) 판별이 가능하다. According to the present invention, in the case of using the peptide nucleic acid according to the present invention, the base polymorphism can be analyzed in the same manner as in the sequencing analysis. Through this, the peptide base nucleic acid according to the present invention determines the genotype of S. iniae . SNP) can be discriminated.
본 발명에 따른 펩티드핵산을 이용하여 미지의 Streptococcus iniae DNA 에 대하여 종을 판별하고자 하는 경우, 도 8과 같은 융해온도별 typing code를 미리 부여하여, 이를 활용하는 것이 가능하다. When the species is to be determined for the unknown Streptococcus iniae DNA using the peptide nucleic acid according to the present invention, it is possible to give a typing code for each melting temperature as shown in FIG.
구체적으로, 상기 실시예 3에서와 같이 융해곡선 분석을 실시하고 얻은 Tm값이 60℃이상의 peak를 완전한 혼성화(perfect match)로 지정하고, 55℃이하의 peak를 불완전한 혼성화(mismatch)로 지정하였으며, 분석결과를 사용하여 유전형 1은 perfect match, 유전형 2는 mismatch로 code를 부여하여 각 유전형마다 고유의 값을 가지도록 하였다(도 8).Specifically, as shown in Example 3, the Tm value obtained by performing the melting curve analysis was designated as a perfect match for the peak of 60 ℃ or more, and the peak below 55 ℃ as an incomplete mismatch (mismatch), Using the analysis result, genotype 1 was assigned a perfect match and genotype 2 was mismatched so that each genotype had a unique value (FIG. 8).
본 발명에 따르면, DNA와의 결합력이 우수한 펩티드핵산(PNA)을 이용하여 Streptococcus iniae의 각 유전형을 가지는 종마다 서로 다른 융해온도(Tm)를 나타내게 함으로써, S. iniae의 유전형을 결정하는 단일염기다형성(SNP)을 이용하여 S. iniae의 병원성을 간단, 신속, 정확하게 판별할 수 있는 효과가 있다.According to the present invention, a single base polymorphism that determines the genotype of S. iniae by using a peptide nucleic acid (PNA) having excellent binding ability to DNA has a different melting temperature (Tm) for each species having a genotype of Streptococcus iniae . SNP) can be used to determine the pathogenicity of S. iniae simply, quickly and accurately.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다 The specific parts of the present invention have been described in detail above, and it is apparent to those skilled in the art that such specific descriptions are merely preferred embodiments, and thus the scope of the present invention is not limited thereto. something to do. Therefore, the substantial scope of the present invention will be defined by the appended claims and their equivalents.
전자파일 첨부하였음.Electronic file attached.

Claims (10)

  1. 서열번호 1의 Streptococcus iniae의 cpsD 서열에서 T368C 또는 T385G의 단일염기다형성(SNP) 변이를 포함하는 서열단편과 엄격한 조건에서 혼성화할 수 있는 Streptococcus iniae의 유전형 판별용 프로브.A probe for genotyping of Streptococcus iniae that can hybridize under severe conditions with a sequence fragment comprising a T368C or T385G monobasic polymorphism (SNP) variant in the cpsD sequence of Streptococcus iniae of SEQ ID NO: 1.
  2. 제1항에 있어서, 상기 프로브는 양말단에 리포터(reporter) 또는 소광자(quencher)를 가지는 PNA인 것을 특징으로 하는 Streptococcus iniae의 유전형 판별용 프로브.The method of claim 1, wherein the probe is a probe for determining the genotype of a Streptococcus iniae, characterized in that PNA with a reporter (reporter) or bovine photon (quencher) at both terminals.
  3. 제1항에 있어서, Streptococcus iniae의 병원성 판별용인 것을 특징으로 하는 프로브.The probe according to claim 1, which is used for determining the pathogenicity of Streptococcus iniae .
  4. 제1항에 있어서, 상기 단편은 5~30개 염기로 구성된 프로브.The probe of claim 1, wherein the fragment consists of 5 to 30 bases.
  5. 제1항에 있어서, 상기 단일염기다형성(SNP) 부위에 상응하는 서열이 16개의 염기 중 8번째 위치하는 것을 특징으로 하는 프로브.The probe of claim 1, wherein the sequence corresponding to the single nucleotide polymorphism (SNP) site is located at 8th of 16 bases.
  6. 제5항에 있어서, 서열번호 3으로 표시되는 것을 특징으로 하는 프로브.The probe of claim 5, wherein the probe is represented by SEQ ID NO: 3. 7.
  7. 제1항 내지 제6항 중 중 어느 한 항의 프로브를 포함하는 Streptococcus iniae의 유전형 판별용 키트.A kit for determining genotype of Streptococcus iniae comprising the probe of any one of claims 1 to 6.
  8. 제7항에 있어서, 상기 키트는 다중 타겟 DNA 또는 단일 타겟 DNA의 염기 다형성 분석용인 것을 특징으로 하는 키트.8. The kit of claim 7, wherein the kit is for nucleotide polymorphism analysis of multiple target DNA or single target DNA.
  9. 다음 단계를 포함하는, 단일염기다형성(SNP) 판별을 통한 Streptococcus iniae의 유전형의 결정방법:Methods for determining genotype of Streptococcus iniae by single nucleotide polymorphism (SNP) determination, comprising :
    (a) Streptococcus iniae로부터 타겟 DNA를 분리하는 단계;(a) isolating target DNA from Streptococcus iniae ;
    (b) Streptococcus iniae의 타겟 DNA를 제1항 내지 제6항 중 어느 한 항의 프로브와 혼성화(hybridization)하는 단계; (b) hybridizing the target DNA of Streptococcus iniae with the probe of any one of claims 1 to 6;
    (c) 온도를 변화시키면서 상기 혼성화한 산물을 융해시켜 융해곡선을 얻는 단계; 및(c) melting the hybridized product while changing temperature to obtain a melting curve; And
    (d) 상기 얻어지는 융해곡선을 분석하는 단계를 포함하는 Streptococcus iniae의 타겟 DNA 유전형을 결정하는 단계.(d) determining a target DNA genotype of Streptococcus iniae comprising analyzing the resulting melting curve.
  10. 제9항에 있어서, 상기 Streptococcus iniae의 타겟 DNA는 capsular polysaccharide(cps) D 유전자의 단일염기다형성(SNP) 부위를 포함하는 것을 특징으로 하는 방법.The method of claim 9, wherein the target DNA of Streptococcus iniae comprises a single nucleotide polymorphism (SNP) region of the capsular polysaccharide (cps) D gene.
PCT/KR2015/002344 2014-12-15 2015-03-11 Genetic marker for determining pathogenicity of streptococcus iniae and kit for examining determinant markers of pathogenicity by using peptide nucleic acid WO2016098953A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2014-0180340 2014-12-15
KR1020140180340A KR101531296B1 (en) 2014-12-15 2014-12-15 Genetic markers for identifying virulence of Streptococcus iniae and identifying method using peptide nucleic acids and real-time PCR

Publications (1)

Publication Number Publication Date
WO2016098953A1 true WO2016098953A1 (en) 2016-06-23

Family

ID=53519755

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2015/002344 WO2016098953A1 (en) 2014-12-15 2015-03-11 Genetic marker for determining pathogenicity of streptococcus iniae and kit for examining determinant markers of pathogenicity by using peptide nucleic acid

Country Status (2)

Country Link
KR (1) KR101531296B1 (en)
WO (1) WO2016098953A1 (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101644773B1 (en) * 2015-12-11 2016-08-04 대한민국 Genetic Markers for Discrimination and Detection of Causative Bacteria of Edwardsiellosis and Streptococcosis, and Method of Discrimination and Detection of Causative Bacteria Using the Same
KR101677948B1 (en) * 2016-04-15 2016-11-21 대한민국 Genetic Marker for Discrimination and Detection of Streptococcus Iniae, and Method for Discrimination and Detection of Streptococcus Iniae Using the Same
KR102502129B1 (en) * 2021-03-17 2023-02-21 대한민국 Method and Kit for Identifying the serotype of Actinobacillus pleuropneumoniae causing pneumonia in Pigs using PNA probe

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050106578A1 (en) * 2003-11-18 2005-05-19 Uhl James R. Detection of group B streptococcus
US20140121287A1 (en) * 2011-04-01 2014-05-01 Janeen R. Shepard Molecular gram stain

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050106578A1 (en) * 2003-11-18 2005-05-19 Uhl James R. Detection of group B streptococcus
US20140121287A1 (en) * 2011-04-01 2014-05-01 Janeen R. Shepard Molecular gram stain

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DATABASE Genbank [O] 5 November 2012 (2012-11-05), Database accession no. JX164245 *
LOCKE, JB. ET AL.: "Streptococcus Iniae Capsule Impairs Phagocytic Clearance and Contributes to Virulence in Fish", JOURNAL OF BACTERIOLOGY, vol. 189, no. 4, February 2007 (2007-02-01), pages 1279 - 1287 *
MILLARD, C. M. ET AL.: "Evolution of the Capsular Operon of Streptococcus Iniae in Response to Vaccination", APPL. ENVIRON MICROBIOL., vol. 78, no. 23, 2012, pages 8219 - 8226 *

Also Published As

Publication number Publication date
KR101531296B1 (en) 2015-06-24

Similar Documents

Publication Publication Date Title
WO2017030322A1 (en) Probes for identifying region-specific genotypes of viral hemorrhagic septicemia virus and use of same
Chen et al. Molecular beacons: a real-time polymerase chain reaction assay for detecting Salmonella
WO2015126078A1 (en) Method for detecting nucleic acid using asymmetric isothermal amplification of nucleic acid and signal probe
WO2017099445A1 (en) Genetic marker for discriminating and detecting causative bacteria of fish edwardsiellosis and streptococcosis, and method for discriminating and detecting causative bacteria using same
KR102098772B1 (en) Adenovirus screening method associated gastrointestinal Infections and acute respiratory infections by PNA based real-timc PCR
WO2017122897A1 (en) Genetic marker for detecting causative virus of red sea bream iridoviral disease, and causative virus detection method using same
Tamura et al. Development of a highly resolved loop-mediated isothermal amplification method to detect the N526K ftsI mutation of β-lactamase-negative ampicillin-resistant Haemophilus influenzae
WO2016098953A1 (en) Genetic marker for determining pathogenicity of streptococcus iniae and kit for examining determinant markers of pathogenicity by using peptide nucleic acid
US8945850B2 (en) Detection, identification and differentiation of Staphylococcus using a hybridization assay
CN111094595A (en) Compositions and methods for detecting staphylococcus aureus
KR20130137952A (en) Compositions and kits for detection and analysis of strains of clostridium difficile, and methods using the same
WO2013009070A9 (en) Nested hybridization pna probe system having parallel binding structure
Hopkins et al. Rapid detection of gyrA and parC mutations in quinolone-resistant Salmonella enterica using Pyrosequencing® technology
US9273361B2 (en) Detection, identification and differentiation of eubacterial taxa using a hybridization assay
Khan et al. Identification of predominant human and animal anaerobic intestinal bacterial species by terminal restriction fragment patterns (TRFPs): a rapid, PCR-based method
Hookey et al. Use of fluorescent amplified fragment length polymorphism (fAFLP) to characterise methicillin-resistant Staphylococcus aureus
CN112654721A (en) Compositions and methods for detecting group B streptococcal nucleic acids
KR102388060B1 (en) Composition for distinguishing between Mycobacterium tuberculosis and Beijing family Mycobacterium tuberculosis and method for detecting Mycobacterium tuberculosis using the same
WO2018048021A1 (en) Method for analyzing snp of mitochondrial dna by using pna probe and melting curve analysis
WO2018016683A1 (en) Target nucleic acid sequence detection method using multiple amplification nested signal amplification
Rijpens et al. Unidentified Listeria‐like bacteria isolated from cheese
WO2016137031A1 (en) Dumbbell-structure oligonucleotide, nucleic acid amplification primer comprising same, and nucleic acid amplification method using same
CZ289739B6 (en) Method for identifying Escherichia coli DSM 6601 and sequences used during identification
WO2022203297A1 (en) Target nucleic acid amplification method using guide probe and clamping probe and composition for amplifying target nucleic acid comprising same
WO2023234577A1 (en) Primer set for identifying bacterial species in probiotics composition and method for identifying bacterial species using same

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15870121

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15870121

Country of ref document: EP

Kind code of ref document: A1