Classifications

• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/775—Apolipopeptides
• • A—HUMAN NECESSITIES
  • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
  • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
  • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
  • A01K67/027—New or modified breeds of vertebrates
  • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K39/00—Medicinal preparations containing antigens or antibodies
  • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K49/00—Preparations for testing in vivo
  • A61K49/0004—Screening or testing of compounds for diagnosis of disorders, assessment of conditions, e.g. renal clearance, gastric emptying, testing for diabetes, allergy, rheuma, pancreas functions
  • A61K49/0008—Screening agents using (non-human) animal models or transgenic animal models or chimeric hosts, e.g. Alzheimer disease animal model, transgenic model for heart failure
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P13/00—Drugs for disorders of the urinary system
  • A61P13/12—Drugs for disorders of the urinary system of the kidneys
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
  • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
  • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
  • C07K16/2875—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the NGF/TNF superfamily, e.g. CD70, CD95L, CD153, CD154
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
  • C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
  • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
  • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
  • G01N33/92—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving lipids, e.g. cholesterol, lipoproteins, or their receptors
• • A—HUMAN NECESSITIES
  • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
  • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
  • A01K2217/00—Genetically modified animals
  • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
  • A01K2217/052—Animals comprising random inserted nucleic acids (transgenic) inducing gain of function
• • A—HUMAN NECESSITIES
  • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
  • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
  • A01K2227/00—Animals characterised by species
  • A01K2227/10—Mammal
  • A01K2227/105—Murine
• • A—HUMAN NECESSITIES
  • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
  • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
  • A01K2267/00—Animals characterised by purpose
  • A01K2267/03—Animal model, e.g. for test or diseases
  • A01K2267/035—Animal model for multifactorial diseases
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
  • C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
  • C12N2015/8527—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic for producing animal models, e.g. for tests or diseases
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N2800/00—Detection or diagnosis of diseases
  • G01N2800/34—Genitourinary disorders
  • G01N2800/347—Renal failures; Glomerular diseases; Tubulointerstitial diseases, e.g. nephritic syndrome, glomerulonephritis; Renovascular diseases, e.g. renal artery occlusion, nephropathy

Definitions

• This invention relates to a non-human transgenic animal model for nephropathy and methods for identifying therapeutic agents.
• Apolipoprotein LI (ApoLl) is the only member in a 6-gene family that includes a signal peptide, and with apolipoprotein Al, is secreted into a particularly dense subspecies (HDL 3 ) of high-density lipoprotein (HDL) particles (Duchateau et al., 1997).
• ApoLl is a major component of the human innate immune response against African trypanosomes, Trypanosoma brucei brucei, that cause of African sleeping sickness.
• rhodesiense is resistant to wild-type ApoLl (also referred to as GO).
• ApoLl also referred to as GO
• Gl and G2 two distinct alleles of ApoLl which are common in African chromosomes but absent in European chromosomes, confer protection against infection with T.b. rhodesiense
• the Gl and G2 alleles also increase the risk for developing nephropathy and variants are associated for example with focal segmental glomerulosclerosis (FSGS), Hypertension associated nephropathy (HTN) and HIV associated nephropathy
• FGS focal segmental glomerulosclerosis
• HTN Hypertension associated nephropathy
• HIV HIV associated nephropathy
• HAVAN African Americans FSGS occurs earlier and progresses 4-5 times more rapidly to end-stage renal disease (ESRD) as compared with Caucasians (Hsu et al., 2003; Kopp et al., 2011; Parsa et al., 2013).
• ApoLl variants are associated with seven-fold higher odds for "hypertension-attributed" ESRD, regardless of diabetes status (Freedman et al., 2010; Freedman et al., 2011; Parsa et al., 2013), 17-fold higher odds for idiopathic FSGS (Kopp et al, 2011), and 29-fold higher odds for HIV-associated nephropathy (Kopp et al., 2011).
• the genetic association is one of the strongest ever reported for a common disease and provides an explanation for the higher rates of nephropathy in African- Americans relative to Caucasians. These diseases account for much suffering and lead to expenditures in the tens of billions of dollars in the United States. No targeted therapies to protect filter barrier function and prevent nephropathy are presently available.
• the invention provides a non-human transgenic animal expressing ApoLl as well as a method for generating the same. Also provided is a method for identifying an agent capable of reducing the progression of an ApoLl mediated nephropathy. Furthermore, an isolated antibody is provided which binds to the human variants of ApoLl .
• the invention provides a non-human transgenic animal expressing human ApoLl .
• the non-human transgenic animal expresses i) GO variant of ApoLl (SEQ ID NO:01), ii) Gl variant of ApoLl (SEQ ID NO:02), iii) G2 variant of ApoLl (SEQ ID NO:03), iv) GO variant of ApoLl and Gl variant of ApoLl , v) GO variant of ApoLl and G2 variant of ApoLl, vi) Gl variant of ApoLl and G2 variant of ApoLl, or vii) GO variant of ApoLl, Gl variant of ApoLl and G2 variant of ApoLl .
• the animal is a rodent.
• the rodent is a mouse.
• the non-human transgenic animal has a nephropathy.
• the nephropathy is a HIV- associated nephropathy.
• the nephropathy is a doxorubicin-induced nephropathy.
• the invention provides a cell or a tissue derived from the non-human transgenic animal as described herein.
• the invention provides a method of determining whether an agent is capable of reducing the serum concentration of human ApoLl the method comprising the steps of measuring the serum concentration of human ApoLl in a non-human transgenic animal, administering the agent to the non-human transgenic animal, and measuring the serum concentration of human ApoLl in the non-human transgenic animal, wherein a reduction in the serum concentration of human ApoLl in the non-human transgenic animal indicates that the agent is capable of reducing the serum concentration of human ApoLl .
• the non-human transgenic animal is a non-human transgenic animal expressing human ApoLl .
• the non-human transgenic animal expresses i) GO variant of ApoLl (SEQ ID NO:01), ii) Gl variant of ApoLl (SEQ ID NO:02), iii) G2 variant of ApoLl (SEQ ID NO:03), iv) GO variant of ApoLl and Gl variant of ApoLl, v) GO variant of ApoLl and G2 variant of ApoLl, vi) Gl variant of ApoLl and G2 variant of ApoLl, or vii) GO variant of ApoLl, Gl variant of ApoLl and G2 variant of ApoLl .
• the animal is a rodent.
• the rodent is a mouse.
• the non-human transgenic animal has a nephropathy.
• the nephropathy is a HIV- associated nephropathy.
• the nephropathy is a doxorubicin-induced nephropathy.
• the invention provides a method of identifying an agent capable of reducing the progression of nephropathy the method comprising the steps of inducing a nephropathy in a non-human transgenic animal, administering the agent to the non-human transgenic animal, and assessing the progression of nephropathy based on the pathological phenotype of the kidneys of the non-human transgenic animal (as described in the Examples), wherein a less advanced nephropathy as compared to non-human transgenic animals not administered with the agent identifies the agent to be capable of reducing the progression of nephropathy.
• the non-human transgenic animal is a non-human transgenic animal expressing human ApoLl .
• the non-human transgenic animal expresses i) GO variant of ApoLl (SEQ ID NO:01), ii) Gl variant of ApoLl (SEQ ID NO: 02), iii) G2 variant of ApoLl (SEQ ID NO: 03), iv) GO variant of ApoLl and Gl variant of ApoLl, v) GO variant of ApoLl and G2 variant of ApoLl, vi) Gl variant of ApoLl and G2 variant of ApoLl, or vii) GO variant of ApoLl, Gl variant of ApoLl and G2 variant of ApoLl .
• the animal is a rodent.
• the rodent is a mouse.
• the nephropathy is induced by administration of doxorubicin.
• the nephropathy is induced by expressing a transgene containing a portion of the human immunodeficiency virus in the non-human transgenic animal.
• the agent binds to i) human GO variant of ApoLl (SEQ ID NO:01), ii) human GO variant of ApoLl and human Gl variant of ApoLl (SEQ ID NO:02), iii) human GO variant of ApoLl and human G2 variant of ApoLl (SEQ ID NO:03), or iv) human GO variant of ApoLl, human Gl variant of ApoLl and human G2 variant of ApoLl .
• the agent is an antibody.
• the invention provides a method of generating an animal model for nephropathy, the method comprising inducing a nephropathy in a non-human transgenic animal expressing human ApoLl .
• the nephropathy is induced by expressing a transgene containing a portion of the human immunodeficiency virus in the non-human animal.
• the nephropathy is induced by administration of doxorubicin.
• doxorubicin is administered at a concentration from 15 mg/kg to 40 mg/kg.
• doxorubicin is administered at a concentration from 20 mg/kg to 30 mg/kg.
• doxorubicin is administered at a concentration from 24 mg/kg to 26 mg/kg. In some embodiments, doxorubicin is administered at a concentration of 25 mg/kg. In some embodiments, doxorubicin is administered in a single dose. In some embodiments, doxorubicin is administered into the tail vein. In some embodiments, the non-human animal is treated daily with subcutaneous fluids to prevent dehydration.
• the non- human transgenic animal expresses i) GO variant of ApoLl (SEQ ID NO:01), ii) Gl variant of ApoLl (SEQ ID NO:02), iii) G2 variant of ApoLl (SEQ ID NO:03), iv) GO variant of ApoLl and Gl variant of ApoLl, v) GO variant of ApoLl and G2 variant of ApoLl, vi) Gl variant of ApoLl and G2 variant of ApoLl, or vii) GO variant of ApoLl, Gl variant of ApoLl and G2 variant of ApoLl.
• the animal is a rodent.
• the rodent is a mouse.
• the invention provides an isolated antibody which binds to the human GO variant of ApoLl (SEQ ID NO:01) and to one or both of the human Gl variant of ApoLl (SEQ ID NO:02) and the human G2 variant of ApoLl (SEQ ID NO:03).
• the antibody is a monoclonal antibody.
• the antibody is a human, humanized, or chimeric antibody.
• the antibody is a full length IgGl antibody.
• the antibody is capable of blocking multimerization of ApoLl variants.
• the antibody is capable of reducing the serum concentration of human ApoLl .
• the antibody is capable of reducing the progression of a nephropathy.
• the nephropathy is an ApoLl mediated nephropathy.
• the ApoLl mediated nephropathy is selected from the group consisting of HIV-associated nephropathy, focal segmental glomerular sclerosis associated nephropathy, sickle cell nephropathy, nephropathy associated with allograft loss following transplantation, and lupus nephritis associated nephropathy.
• the ApoLl mediated nephropathy is hypertension associated nephropathy.
• the ApoLl mediated nephropathy is diabetic nephropathy.
• the invention provides an isolated nucleic acid encoding the antibody described herein.
• the invention provides a host cell comprising the nucleic acid mentioned above.
• the invention provides a method of producing an antibody comprising culturing the host cell mentioned above so that the antibody is produced.
• the invention provides a pharmaceutical formulation comprising the antibody as described herein and a pharmaceutically acceptable carrier.
• the invention provides the antibody as described herein for use as a medicament.
• the invention provides the use of the antibody described herein in the manufacture of a medicament.
• the invention provides a method for treating an individual having a nephropathy by administering to the individual the antibody described herein.
• the invention provides a method of reducing the progression of a nephropathy in a subject comprising administering to the subject an effective amount of the antibody described herein.
• Figure 1 shows schematic drawings of the transgenes for GO variant of ApoLl (Fig. 1A), Gl variant of ApoLl (Fig. IB) and G2 variant of ApoLl (Fig. 1C).
• FIG. 1 shows that the detection of serological ApoLl in transgenic mice can be detected in HDL3 and VHDL fractions of major lipoprotein classes using ultracentrifugal density gradients.
• VLDL is very low density lipoprotein
• IF is Intermediate Fractions
• HDL is high density lipoprotein
• VHDL is very high density lipoprotein.
• Figure 3 illustrates the serological ApoLl concentrations in transgenic mice and human donors determined by ELISA using serum from either GO variant of ApoLl (wt) (Fig. 3 A) or the G2 variant of ApoLl (Fig. 3B) for the standard curve.
• Figure 4 shows the expression of ApoLl in kidney, liver, and lung as determined by
• FIG. 4A Western blots were performed using a polyclonal antibody to ApoLl on homogenates of liver and lung from PBS perfused mice (Fig. 4B). Western blots were performed using a rabbit polyclonal antibody using lysates of ApoLl, ApoL2, or control transient transfections in CHO-1K cells (Fig. 4C).
• Figure 5 shows the urinary protein values in untreated transgenic negative mice and mice expressing mice the GO variant of ApoLl (wt) and the G2 variant of ApoLl .
• P- values refer to a two-tailed t test with equal variance).
• Figure 9 shows proteinuria in mice expressing G2 variant of ApoLl treated with doxorubicin.
• P-values refer to a two-tailed t test with equal variance).
• Figure 10 shows transmission electron microscopy images at 5000x of podocytes in PBS- treated mice (Fig. 10A), doxorubicin-treated transgenic negative mice (Fig. 10B), mice expressing GO variant of ApoLl (Fig. IOC) and mice G2 variant of ApoLl (Fig. 10D). Further depicted are multiple foot processes (FP) and intervening slit diaphragms (arrowhead).
• Fig. 10A shows transmission electron microscopy images at 5000x of podocytes in PBS- treated mice (Fig. 10A), doxorubicin-treated transgenic negative mice (Fig. 10B), mice expressing GO variant of ApoLl (Fig. IOC) and mice G2 variant of ApoLl (Fig. 10D).
• FP multiple foot processes
• intervening slit diaphragms arrowhead
• Figure 11 shows progression in kidney damage in different magnifications (5x, 20x) and different stainings (H&E, PAS, Masson's Trichrome stain) in transgenic animals treated with doxorubicin or PBS, respectively.
• HPR haptoglobin related protein
• Figure 14 shows a schematic representation of the APOLl constructs.
• PFD Pore forming domain
• MAD Membrane addressing domain
• SRA-ID Serum resistance associated protein- Interacting domain
• GPI Glycosylphosphatidylinositol anchor
• gD herpes simplex virus glycoprotein D anchor.
• Figure 15 depicts cross reactivity of anti-ApoLl antibodies analyzed by FACS on CHO cells expressing GO variant of APOLl (Black), Gl variant of APOLl (Grey) or G2 variant of APOLl (hatched). Antibodies were used at 1 ⁇ g/ml concentration. As a positive control, a commercially available polyclonal antibody was used which binds non-specifically to more than one member of the apolipoprotein L family. Mean Fluorescence intensities (MFI) are plotted on the y axis.
• MFI Mean Fluorescence intensities
• Figure 16 shows the results of the in vitro blocking of Trypanolytic activity.
• Monoclonal anti- APOL1 antibodies generated in mice were added to Trpanosoma brucei brucei in the presence of 1% normal human serum (NHS) for 20 hr.
• Number of alive trypanosomes was measured in terms of fluorescent activity due to the presence of a resazurin based dye (Alamar blue).
• Blocking activity is normalized to the no-antibody control and plotted as % of alive
• ApoLl or "human ApoLl” refers to human apolipoprotein LI, a polypeptide that is the only member in a 6-gene family including a signal peptide.
• Three different variants are present in the population, namely the GO variant of ApoLl, the Gl variant of ApoLl and the G2 variant of ApoLl .
• the GO variant of ApoLl refers to the wild-type human ApoLl protein (herein also referred to as "wt") having the amino acid sequence of SEQ ID
• the Gl variant of ApoLl refers to a variant of human ApoLl protein that has two amino acid substitutions (S342G, I384M), having the amino acid sequence of SEQ ID NO:02.
• the G2 variant of ApoLl refers to a variant of human ApoLl protein that has a two amino acid deletion (N388 and Y389), having the amino acid sequence of SEQ ID NO:03.
• detecting is used herein in the broadest sense to include both qualitative and/or quantitative measurements of a target molecule, i.e. detecting includes identifying the mere presence of the target molecule in a sample as well as determining the levels of the target molecule in the sample.
• doxorubicin refers to the chemical compound with the CAS number 23214-92-8. Doxorubicin is herein also referred to as Adriamycin® or ADR.
• nephropathy refers to a physiological condition wherein damage of the kidney occurs that disrupts its ability to properly regulate solute concentrations in the blood and urine. This can be assessed by a number of methods that commonly include: serum creatinine concentration, urinary protein concentration, urinary protein to creatinine ratio or through the use of tracer compounds such as phthalates. Nephropathy is often classified into apparently distinct clinical conditions, for example focal segmental glomerular sclerosis, HIV- Infection, sickle cell anemia, allograft loss following transplantation, hypertension, lupus nephritis, diabetes, and non diabetic chronic kidney disease.
• a nephropathy can also be classified histologically as characterized by pathological changes selected from one or more of: glomerular size, lobulation or adhesions, fibrosis of the tufts, fibrosis of Bowman's capsule, dilatation, narrowing of capillaries, thickening of basement membranes, protein in Bowman's space, increased cellularity (mesangial or endothelial), infiltration by leukocytes, capillary thrombi, tubules- atrophy, necrosis, vacuolar and hyaline droplet changes, basement membrane thickening, dilatation, inflammatory cells and casts in the lumen, interstitium- fibrosis, edema, acute and chronic leukocyte infiltration, arterioles- fibrosis, thrombosis, hyaline change and narrowing.
• pathological changes selected from one or more of: glomerular size, lobulation or adhesions, fibrosis of the tufts, fibro
• ApoLl -mediated nephropathy refers to a nephropathy as defined above, wherein the progression of the nephropathy is increased by the presence of one or more of GO variant of Apo LI , Gl variant of Apo LI and G2 variant of Apo LI .
• label refers to any chemical group or moiety that can be linked to a substance that is to be detected or quantitated, e.g., an antibody.
• a label is a detectable label that is suitable for the sensitive detection or quantification of a substance.
• detectable labels include, but are not limited to, luminescent labels, e.g., fluorescent, phosphorescent, chemiluminescent, bioluminescent and electrochemiluminescent labels, radioactive labels, enzymes, particles, magnetic substances, electroactive species and the like.
• a detectable label may signal its presence by participating in specific binding reactions. Examples of such labels include haptens, antibodies, biotin, streptavidin, his-tag, nitrilotriacetic acid, glutathione S-transferase, glutathione and the like.
• polypeptide and protein are used interchangeably herein to refer to polymers of amino acids of any length.
• the polymer may be linear or branched, it may comprise modified amino acids, and it may be interrupted by non-amino acids.
• the terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component.
• polypeptides containing one or more analogs of an amino acid including, for example, unnatural amino acids, etc.
• polypeptide and protein as used herein specifically encompass antibodies.
• Polypeptide e.g., antibody or immunoadhesin
• Purity is a relative term and does not necessarily mean absolute purity.
• An antibody "which binds" an antigen of interest is one that binds the antigen with sufficient affinity such that the antibody is useful as a therapeutic agent or an assay reagent, e.g., as a capture antibody or as a detection antibody. Typically, such an antibody does not significantly cross-react with other antigens.
• antibody which binds to X and "anti-X antibody” shall have the same meaning (wherein X is the name of the antigen of interest, e.g. a protein). Consequently, the terms “antibody which binds to ApoLl” can be used herein interchangeably with “anti-ApoLl antibody”.
• binding means binding that is measurably different from a non-specific interaction.
• Specific binding can be measured, for example, by determining binding of a target molecule compared to binding of a control molecule, which generally is a molecule of similar structure that does not have binding activity.
• Bind refers to the strength of the sum total of noncovalent interactions between a single binding site of a molecule (e.g., an antibody) and its binding partner (e.g., an antigen). Unless indicated otherwise, as used herein, "binding affinity” refers to intrinsic binding affinity which reflects a 1 : 1 interaction between members of a binding pair (e.g., antibody and antigen).
• the affinity of a molecule X for its partner Y can generally be represented by the dissociation constant (Kd). Affinity can be measured by common methods known in the art, including those described herein.
• antibody herein is used in the broadest sense and encompasses various antibody structures, including but not limited to monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), and antibody fragments so long as they exhibit the desired antigen-binding activity.
• Antibodies are naturally occurring immunoglobulin molecules which have varying structures, all based upon the immunoglobulin fold.
• IgG antibodies have two "heavy” chains and two "light” chains that are disulphide-bonded to form a functional antibody.
• Each heavy and light chain itself comprises a “constant” (C) and a “variable” (V) region.
• the V regions determine the antigen binding specificity of the antibody, and the C regions provide structural support and function in non-antigen-specific interactions with immune effectors.
• the antigen binding specificity of an antibody or antigen-binding fragment of an antibody is the ability of an antibody to specifically bind to a particular antigen.
• variable refers to the fact that certain portions of the variable domains differ extensively in sequence among antibodies and are used in the binding and specificity of each particular antibody for its particular antigen. However, the variability is not evenly distributed throughout the variable domains of antibodies. It is concentrated in three segments called hypervariable regions both in the light chain and the heavy chain variable domains. The more highly conserved portions of variable domains are called the framework regions (FRs).
• the variable domains of native heavy and light chains each comprise four FRs, largely adopting a ⁇ -sheet configuration, connected by three hypervariable regions, which form loops connecting, and in some cases forming part of, the ⁇ -sheet structure.
• the hypervariable regions in each chain are held together in close proximity by the FRs and, with the hypervariable regions from the other chain, contribute to the formation of the antigen-binding site of antibodies (see Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD. (1991)).
• the constant domains are not involved directly in binding an antibody to an antigen, but exhibit various effector functions, such as participation of the antibody in antibody dependent cellular cytotoxicity (ADCC).
• hypervariable region when used herein refers to the amino acid residues of an antibody that are responsible for antigen binding.
• the hypervariable region may comprise amino acid residues from a "complementarity determining region" or "CDR" (e.g., around about residues 24-34 (LI), 50-56 (L2) and 89-97 (L3) in the V L , and around about 31-35B (HI), 50-65 (H2) and 95-102 (H3) in the V H (Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. (1991)) and/or those residues from a "hypervariable loop" (e.g.
• Framework or "FR” residues are those variable domain residues other than the hypervariable region residues as herein defined.
• Antibody fragments comprise a portion of an intact antibody, preferably comprising the antigen binding region thereof.
• antibody fragments include Fab, Fab', F(ab') 2 , and Fv fragments; diabodies; tandem diabodies (taDb), linear antibodies(e.g., U.S. Patent No. 5,641,870, Example 2; Zapata et al, Protein Eng. 8(10): 1057-1062 (1995)); one-armed antibodies, single variable domain antibodies, minibodies, single-chain antibody molecules; multispecific antibodies formed from antibody fragments (e.g., including but not limited to, Db-
• T-cell engagers (BiTEs). Papain digestion of antibodies produces two identical antigen-binding fragments, called “Fab” fragments, each with a single antigen-binding site, and a residual "Fc” fragment, whose name reflects its ability to crystallize readily. Pepsin treatment yields an F(ab') 2 fragment that has two antigen-binding sites and is still capable of cross-linking antigen.
• Fv is the minimum antibody fragment that contains a complete antigen-recognition and antigen-binding site. This region consists of a dimer of one heavy chain and one light chain variable domain in tight, non-covalent association. It is in this configuration that the three hypervariable regions of each variable domain interact to define an antigen-binding site on the surface of the V H -V L dimer. Collectively, the six hypervariable regions confer antigen-binding specificity to the antibody. However, even a single variable domain (or half of an Fv comprising only three hypervariable regions specific for an antigen) has the ability to recognize and bind antigen, although at a lower affinity than the entire binding site.
• the Fab fragment also contains the constant domain of the light chain and the first constant domain (CHI) of the heavy chain.
• Fab' fragments differ from Fab fragments by the addition of a few residues at the carboxy terminus of the heavy chain CHI domain including one or more cysteines from the antibody hinge region.
• Fab'-SH is the designation herein for Fab' in which the cysteine residue(s) of the constant domains bear at least one free thiol group.
• F(ab') 2 antibody fragments originally were produced as pairs of Fab' fragments that have hinge cysteines between them. Other chemical couplings of antibody fragments are also known.
• the "light chains" of antibodies (immunoglobulins) from any vertebrate species can be assigned to one of two clearly distinct types, called kappa ( ⁇ ) and lambda ( ⁇ ), based on the amino acid sequences of their constant domains.
• antibodies can be assigned to different classes. There are five major classes of intact antibodies: IgA, IgD, IgE, IgG, and IgM, and several of these may be further divided into subclasses
• immunoglobulins are well known.
• immunoglobulins e.g., IgGl, IgG2, IgG3, IgG4, IgA, and IgA2.
• the heavy chain constant domains that correspond to the different classes of antibodies are called ⁇ , ⁇ , ⁇ , ⁇ , and ⁇ , respectively.
• the subunit structures and three-dimensional configurations of different classes of immunoglobulins are well known.
• Single-chain Fv or “scFv” antibody fragments comprise the V H and V L domains of antibody, wherein these domains are present in a single polypeptide chain.
• the Fv polypeptide further comprises a polypeptide linker between the V H and V L domains that enables the scFv to form the desired structure for antigen binding.
• a polypeptide linker between the V H and V L domains that enables the scFv to form the desired structure for antigen binding.
• diabodies refers to small antibody fragments with two antigen-binding sites, which fragments comprise a heavy chain variable domain (V H ) connected to a light chain variable domain (V L ) in the same polypeptide chain (V H - V L ).
• V H heavy chain variable domain
• V L light chain variable domain
• the domains are forced to pair with the complementary domains of another chain and create two antigen-binding sites.
• Diabodies are described more fully in, for example, EP 404,097; WO 93/11161; and Hollinger et ah, Proc. Natl. Acad. Sci. USA, 90:6444-6448 (1993).
• multispecific antibody is used in the broadest sense and specifically covers an antibody that has polyepitopic specificity.
• Such multispecific antibodies include, but are not limited to, an antibody comprising a heavy chain variable domain (V H ) and a light chain variable domain (V L ), where the V H V L unit has polyepitopic specificity, antibodies having two or more V L and V H domains with each V H V L unit binding to a different epitope, antibodies having two or more single variable domains with each single variable domain binding to a different epitope, full length antibodies, antibody fragments such as Fab, Fv, dsFv, scFv, diabodies, bispecific diabodies, triabodies, tri-functional antibodies, antibody fragments that have been linked covalently or non-covalently.
• Polyepitopic specificity refers to the ability to specifically bind to two or more different epitopes on the same or different target(s).
• “Monospecific” refers to the ability to bind only one epitope.
• the multispecific antibody is an IgG antibody which binds to each epitope with an affinity of 5 ⁇ to 0.001 pM, 3 ⁇ to 0.001 pM, 1 ⁇ to 0.001 pM, 0.5 ⁇ to 0.001 pM, or 0.1 ⁇ to 0.001 pM.
• single domain antibodies or “single variable domain (SVD) antibodies” generally refers to antibodies in which a single variable domain (VH or VL) can confer antigen binding. In other words, the single variable domain does not need to interact with another variable domain in order to recognize the target antigen.
• single domain antibodies include those derived from camelids (lamas and camels) and cartilaginous fish ⁇ e.g., nurse sharks) and those derived from recombinant methods from humans and mouse antibodies (Nature (1989) 341 :544-546; Dev Comp Immunol (2006) 30:43-56; Trend Biochem Sci (2001) 26:230-235; Trends Biotechnol (2003):21 :484-490; WO 2005/035572; WO 03/035694; Febs Lett (1994) 339:285-290; WO00/29004; WO 02/051870).
• the term "monoclonal antibody” as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical and/or bind the same epitope, except for possible variants that may arise during production of the monoclonal antibody, such variants generally being present in minor amounts.
• each monoclonal antibody is directed against a single determinant on the antigen.
• the monoclonal antibodies are advantageous in that they are uncontaminated by other
• the modifier "monoclonal" indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method.
• the monoclonal antibodies to be used in accordance with the methods provided herein may be made by the hybridoma method first described by Kohler et ah, Nature 256:495 (1975), or may be made by recombinant DNA methods (see, e.g., U.S. Patent No. 4,816,567).
• the "monoclonal antibodies” may also be isolated from phage antibody libraries using the techniques described in Clackson et al, Nature 352:624-628 (1991) and Marks et al, J. Mol. Biol. 222:581-597 (1991), for example.
• the monoclonal antibodies herein specifically include “chimeric” antibodies
• immunoglobulins in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity (U.S. Patent No. 4,816,567; Morrison et al, Proc. Natl. Acad. Sci. USA 81 :6851-6855 (1984)).
• Chimeric antibodies of interest herein include "primatized" antibodies comprising variable domain antigen-binding sequences derived from a non-human primate (e.g. Old World Monkey, such as baboon, rhesus or cynomolgus monkey) and human constant region sequences (US Pat No. 5,693,780).
• a non-human primate e.g. Old World Monkey, such as baboon, rhesus or cynomolgus monkey
• human constant region sequences US Pat No. 5,693,780
• an “intact antibody” is one comprising heavy and light variable domains as well as an Fc region.
• the constant domains may be native sequence constant domains (e.g. human native sequence constant domains) or amino acid sequence variant thereof.
• the intact antibody has one or more effector functions.
• “Native antibodies” are usually heterotetrameric glycoproteins of about 150,000 daltons, composed of two identical light (L) chains and two identical heavy (H) chains. Each light chain is linked to a heavy chain by one covalent disulfide bond, while the number of disulfide linkages varies among the heavy chains of different immunoglobulin isotypes. Each heavy and light chain also has regularly spaced intrachain disulfide bridges. Each heavy chain has at one end a variable domain (V H ) followed by a number of constant domains.
• V H variable domain
• Each light chain has a variable domain at one end (V L ) and a constant domain at its other end; the constant domain of the light chain is aligned with the first constant domain of the heavy chain, and the light chain variable domain is aligned with the variable domain of the heavy chain. Particular amino acid residues are believed to form an interface between the light chain and heavy chain variable domains.
• naked antibody is an antibody (as herein defined) that is not conjugated to a heterologous molecule, such as a detection moiety or label.
• host cell refers to cells into which exogenous nucleic acid has been introduced, including the progeny of such cells.
• Host cells include “transformants” and “transformed cells,” which include the primary transformed cell and progeny derived therefrom without regard to the number of passages. Progeny may not be completely identical in nucleic acid content to a parent cell, but may contain mutations. Mutant progeny that have the same function or biological activity as screened or selected for in the originally transformed cell are included herein.
• nucleic acid refers to a nucleic acid molecule that has been separated from a component of its natural environment.
• An isolated nucleic acid includes a nucleic acid molecule contained in cells that ordinarily contain the nucleic acid molecule, but the nucleic acid molecule is present extrachromosomally or at a chromosomal location that is different from its natural chromosomal location.
• variable region refers to the domain of an antibody heavy or light chain that is involved in binding the antibody to antigen.
• the variable domains of the heavy chain and light chain (VH and VL, respectively) of a native antibody generally have similar structures, with each domain comprising four conserved framework regions (FRs) and three hypervariable regions (HVRs).
• FRs conserved framework regions
• HVRs hypervariable regions
• VH or VL domain may be sufficient to confer antigen-binding specificity.
• antibodies that bind a particular antigen may be isolated using a VH or VL domain from an antibody which binds the antigen to screen a library of complementary VL or VH domains, respectively. See, e.g., Portolano et al., J. Immunol. 150:880-887 (1993); Clarkson et al, Nature 352:624-628 (1991).
• vector refers to a nucleic acid molecule capable of propagating another nucleic acid to which it is linked.
• the term includes the vector as a self- replicating nucleic acid structure as well as the vector incorporated into the genome of a host cell into which it has been introduced.
• Certain vectors are capable of directing the expression of nucleic acids to which they are operatively linked. Such vectors are referred to herein as "expression vectors”.
• references to "about” a value or parameter herein includes (and describes) variations that are directed to that value or parameter per se. For example, description referring to "about X” includes description of "X”.
• an animal model for nephropathy As ApoLl is only present in humans, African green monkeys and gorillas, we established an animal model on the basis of a transgenic animal. Upon generation, the non-human animals only express either of GO, Gl or G2. However, by crossing the animals it is possible to generate transgenic animals expressing a combination of the three variants. Thus, in one aspect, a non-human transgenic animal expressing human ApoLl is provided herein.
• the non-human transgenic animal expresses i) GO variant of ApoLl (SEQ ID NO:01), ii) Gl variant of ApoLl (SEQ ID NO:02), iii) G2 variant of ApoLl (SEQ ID NO:03), iv) GO variant of ApoLl and Gl variant of ApoLl, v) GO variant of ApoLl and G2 variant of ApoLl, vi) Gl variant of ApoLl and G2 variant of ApoLl, or vii) GO variant of ApoLl, Gl variant of ApoLl and G2 variant of ApoLl .
• the non-human transgenic animal is a rodent.
• the non-human transgenic animal is selected from the group consisting of mouse, rat, hamster, guinea pig, rabbit, dog, cat, pig, cow and goat.
• the non- human transgenic animal is a mouse.
• the animal expresses ApoLl and nephropathy is induced in the non-human transgenic animal. Therefore, in certain embodiments, the human transgenic animal has a nephropathy. There are different ways of inducing a nephropathy in the non-human transgenic animal.
• One possibility is to express in the non-human transgenic animal in addition to ApoLl a transgene containing a portion of the human immunodeficiency virus (HIV). Expressing the HIV transgene leads to the development of an acute nephropathy. In a certain embodiment, the nephropathy is therefore an HIV- associated nephropathy. Another possibility to induce a nephropathy in the non-human transgenic animal is by chemical exposure. Doxorubicin is usually used in humans as a drug in chemotherapy. However, the substance is also known to induce nephropathy in animals.
• HIV human immunodeficiency virus
• the nephropathy described herein is a doxorubicin-induced nephropathy.
• the present description refers to a cell or a tissue derived from the non- human transgenic animal described above.
• circulating ApoLl can mediate the progression of nephropathy. Therefore, one possibility to reduce the progression of an ApoLl -mediated nephropathy is to remove circulating ApoLl .
• the clearance of ApoLl can be increased leading to a reduced serum concentration of ApoLl and thus to an attenuated effect on the progression of an ApoLl -mediated nephropathy.
• a method of determining whether an agent is capable of reducing the serum concentration of human ApoLl comprising the steps of measuring the serum concentration of human ApoLl in the non-human transgenic animal described herein, administering the agent to the non- human transgenic animal, and measuring the serum concentration of human ApoLl in the non- human transgenic animal, wherein a reduction in the serum concentration of human ApoLl in the non-human transgenic animal indicates that the agent is capable of reducing the serum concentration of human ApoLl .
• the binding of an agent can lead to a deactivation of ApoLl, i.e. the antibody- ApoLl -complex can not have the same physiological effect as compared to ApoLl alone, thereby attenuating the effect on the progression of an ApoLl -mediated nephropathy.
• the bound antibody can prevent multimerization of ApoLl and attenuate the effect on the progression of an ApoLl -mediated nephropathy.
• identifying an agent capable of reducing the progression of an ApoLl mediated nephropathy would be advantageous by assessing the effect of the agent on the progression on the ApoLl mediated nephropathy based on the pathological phenotype of the kidneys of the non-human transgenic animal.
• a method of identifying an agent capable of reducing the progression of an ApoLl mediated nephropathy comprising the steps of inducing a nephropathy in a non-human transgenic animal as disclosed herein, administering the agent to the non-human transgenic animal, and assessing the progression of the ApoLl mediated nephropathy based on the pathological phenotype of the kidneys of the non-human transgenic animal, wherein a less advanced ApoLl mediated nephropathy as compared to non-human transgenic animals not administered with the agent identifies the agent to be capable of reducing the progression of the ApoLl mediated
• the nephropathy is induced by administration of doxorubicin.
• the nephropathy is induced by expressing a transgene containing a portion of the human immunodeficiency virus in the non-human transgenic animal.
• the ability of the agent to reduce the progression of an ApoLl mediated nephropathy may be based on its binding to one or more variants of human ApoLl .
• the agent binds to i) human GO variant of ApoLl (SEQ ID NO:01), ii) human GO variant of ApoLl and human Gl variant of ApoLl (SEQ ID NO:02), iii) human GO variant of ApoLl and human G2 variant of ApoLl (SEQ ID NO:03), or iv) human GO variant of ApoLl, human Gl variant of ApoLl and human G2 variant of ApoLl .
• the agent is an antibody.
• the antibody is a monoclonal antibody.
• the antibody is a human, humanized, or chimeric antibody.
• the antibody is a full length IgGl antibody.
• a method for generation of an animal model for nephropathy comprising inducing a nephropathy in a non-human transgenic animal expressing human ApoLl .
• the non-human animal is the non-human transgenic animal as described herein above.
• the nephropathy is induced by expressing a transgene containing a portion of the human immunodeficiency virus in the non-human animal.
• the nephropathy is induced by administration of doxorubicin.
• doxorubicin is administered at a concentration from 10 mg/kg to 50 mg/kg. In a certain embodiment, doxorubicin is administered at a concentration from 15 mg/kg to 40 mg/kg. In a certain embodiment, doxorubicin is administered at a concentration from 20 mg/kg to 30 mg/kg. In a certain embodiment, doxorubicin is administered at a concentration from 24 mg/kg to 26 mg/kg. In a certain embodiment, doxorubicin is administered at a concentration of at least 25 mg/kg. In a certain embodiment, doxorubicin is administered at a concentration of 25 mg/kg.
• the measurement mg/kg refers to the mass of administered doxorubicin in mg per mass of bodyweight of the animal in kg.
• doxorubicin is administered in multiple doses.
• doxorubicin is administered in a single dose.
• doxorubicin is
• doxorubicin is administered into the tail vein.
• the non-human animal is treated daily with subcutaneous fluids to prevent dehydration.
• the subcutaneous fluid is administered at a volume of 0.5 to 5 ml.
• the subcutaneous fluid is administered at a volume of 1 to 4 ml.
• the subcutaneous fluid is administered at a volume of 1.5 to 3 ml.
• the subcutaneous fluid is administered at a volume of 2 ml.
• the subcutaneous fluid is lactated ringer's solution.
• an antibody which binds ApoLl .
• an isolated antibody which binds to the human GO variant of ApoLl (SEQ ID NO:01) and to one or both of the human Gl variant of ApoLl (SEQ ID NO:02) and the human G2 variant of ApoLl (SEQ ID NO:03).
• the antibody is a monoclonal antibody.
• the antibody is a human, humanized, or chimeric antibody.
• the antibody is a full length IgGl antibody.
• the antibody is capable of blocking
• the antibody is capable of reducing the serum concentration of human ApoLl . In a certain embodiment, the antibody is capable of reducing the progression of a nephropathy. In a certain embodiment, the nephropathy is an ApoLl mediated nephropathy. In a certain embodiment, the ApoLl mediated nephropathy is selected from the group consisting of HIV-associated nephropathy, focal segmental glomerular sclerosis associated nephropathy, sickle cell nephropathy, nephropathy associated with allograft loss following transplantation, and lupus nephritis associated nephropathy. In some embodiment, HIV-associated nephropathy, focal segmental glomerular sclerosis associated nephropathy, sickle cell nephropathy, nephropathy associated with allograft loss following transplantation, and lupus nephritis associated nephropathy. In some
• the ApoLl mediated nephropathy is hypertension associated nephropathy. In some embodiments, the ApoLl mediated nephropathy is diabetic nephropathy.
• a host cell comprising the nucleic acid as described above.
• a method of producing an antibody comprising culturing the host cell described above so that the antibody is produced.
• pharmaceutical formulation comprising the antibody as described herein and a pharmaceutically acceptable carrier.
• a method of reducing the progression of a nephropathy in a subject comprising administering to the subject an effective amount of the antibody as described herein.
• an anti- ApoLl antibody is a monoclonal antibody, including a chimeric, humanized or human antibody.
• an anti-ApoLl antibody is an antibody fragment, e.g., a Fv, Fab, Fab', scFv, diabody, or F(ab') 2 fragment.
• the antibody is a full length antibody, e.g., an intact IgGl antibody or other antibody class or isotype as defined herein.
• an anti-ApoLl antibody may incorporate any of the features, singly or in combination, as described in Sections 1-7 below:
• an antibody provided herein has a dissociation constant (Kd) of ⁇ ⁇ , ⁇ ⁇ ⁇ , ⁇ ⁇ ⁇ , ⁇ 1 nM, ⁇ 0.1 nM, ⁇ 0.01 nM, or ⁇ 0.001 nM (e.g. 10 "8 M or less, e.g. from 10 "8 M to 10 "13 M, e.g., from 10 "9 M to 10 "13 M).
• Kd dissociation constant
• Kd is measured by a radiolabeled antigen binding assay (RIA).
• RIA radiolabeled antigen binding assay
• an RIA is performed with the Fab version of an antibody of interest and its antigen.
• solution binding affinity of Fabs for antigen is measured by equilibrating
• Fab with a minimal concentration of ( 125 I)-labeled antigen in the presence of a titration series of unlabeled antigen, then capturing bound antigen with an anti-Fab antibody-coated plate (see, e.g., Chen et al, J. Mol. Biol. 293:865-881(1999)).
• MICROTITER ® multi-well plates (Thermo Scientific) are coated overnight with 5 ⁇ g/ml of a capturing anti-Fab antibody (Cappel Labs) in 50 mM sodium carbonate (pH 9.6), and subsequently blocked with 2% (w/v) bovine serum albumin in PBS for two to 5 h at room temperature (approximately 23°C).
• a non-adsorbent plate (Nunc #269620) 100 pM or 26 pM
• [ 125 I]-antigen are mixed with serial dilutions of a Fab of interest (e.g., consistent with assessment of the anti-VEGF antibody, Fab-12, in Presta et al, Cancer Res. 57:4593-4599 (1997)).
• the Fab of interest is then incubated overnight; however, the incubation may continue for a longer period (e.g., about 65 h) to ensure that equilibrium is reached. Thereafter, the mixtures are transferred to the capture plate for incubation at room temperature (e.g., for 1 h).
• the solution is then removed and the plate washed eight times with 0.1% polysorbate 20 (TWEEN-20 ® ) in PBS. When the plates have dried, 150 ⁇ /well of scintillant (MICROSCINT-20TM; Packard) is added, and the plates are counted on a TOPCOUNTTM gamma counter (Packard) for ten minutes.
• MICROSCINT-20TM MICROSCINT-20TM; Pack
• Concentrations of each Fab that give less than or equal to 20% of maximal binding are chosen for use in competitive binding assays.
• Kd is measured using a BIACORE ® surface plasmon resonance assay.
• a BIACORE ® surface plasmon resonance assay For example, an assay using a BIACORE ® -2000 or a BIACORE ® -3000 (BIAcore, Inc., Piscataway, NJ) is performed at 25°C with immobilized antigen CM5 chips at -10 response units (RU).
• CM5 chips carboxymethylated dextran biosensor chips
• EDC N-ethyl-N'- (3-dimethylaminopropyl)-carbodiimide hydrochloride
• NHS N-hydroxysuccinimide
• Antigen is diluted with 10 mM sodium acetate, pH 4.8, to 5 ⁇ g/ml (-0.2 ⁇ ) before injection at a flow rate of 5 ⁇ /minute to achieve approximately 10 response units (RU) of coupled protein. Following the injection of antigen, 1 M ethanolamine is injected to block unreacted groups. For kinetics measurements, two-fold serial dilutions of Fab (0.78 nM to 500 nM) are injected in PBS with 0.05% polysorbate 20 (TWEEN-20TM) surfactant (PBST) at 25°C at a flow rate of approximately 25 ⁇ /min.
• TWEEN-20TM polysorbate 20
• association rates (k on ) and dissociation rates (k 0 ff) are calculated using a simple one-to-one Langmuir binding model (BIACORE ® Evaluation Software version 3.2) by simultaneously fitting the association and dissociation sensorgrams.
• the equilibrium dissociation constant (Kd) is calculated as the ratio k 0 f k on See, e.g., Chen et al, J. Mol. Biol.
• an antibody provided herein is an antibody fragment.
• Antibody fragments include, but are not limited to, Fab, Fab', Fab'-SH, F(ab') 2 , Fv, and scFv fragments, and other fragments described below.
• Fab fragment antigen
• Fab' fragment antigen binding domain
• Fab'-SH fragment antigen binding domain antigen binding domain antigen binding domain antigen binding domain antigen binding domain antigen binding domains
• Fv fragment antigen binding domain antigen binding
• scFv fragments see, e.g., Pluckthun, in The Pharmacology of Monoclonal Antibodies, vol. 113, Rosenburg and Moore eds., (Springer-
• Diabodies are antibody fragments with two antigen-binding sites that may be bivalent or bispecific. See, for example, EP 404,097; WO 1993/01161; Hudson et al, Nat. Med. 9: 129-134 (2003); and Hollinger et al, Proc. Natl. Acad. Sci. USA 90: 6444-6448 (1993). Triabodies and tetrabodies are also described in Hudson et al, Nat. Med. 9: 129-134 (2003).
• Single-domain antibodies are antibody fragments comprising all or a portion of the heavy chain variable domain or all or a portion of the light chain variable domain of an antibody.
• a single-domain antibody is a human single-domain antibody (Domantis, Inc., Waltham, MA; see, e.g., U.S. Patent No. 6,248,516 Bl).
• Antibody fragments can be made by various techniques, including but not limited to proteolytic digestion of an intact antibody as well as production by recombinant host cells (e.g. E. coli or phage), as described herein.
• recombinant host cells e.g. E. coli or phage
• an antibody provided herein is a chimeric antibody.
• Certain chimeric antibodies are described, e.g., in U.S. Patent No. 4,816,567; and Morrison et al, Proc. Natl. Acad. Sci. USA, 81 :6851-6855 (1984)).
• a chimeric antibody comprises a non-human variable region (e.g., a variable region derived from a mouse, rat, hamster, rabbit, or non-human primate, such as a monkey) and a human constant region.
• a chimeric antibody is a "class switched" antibody in which the class or subclass has been changed from that of the parent antibody. Chimeric antibodies include antigen-binding fragments thereof.
• a chimeric antibody is a humanized antibody.
• a non- human antibody is humanized to reduce immunogenicity to humans, while retaining the specificity and affinity of the parental non-human antibody.
• a humanized antibody comprises one or more variable domains in which HVRs, e.g., CDRs, (or portions thereof) are derived from a non-human antibody, and FRs (or portions thereof) are derived from human antibody sequences.
• HVRs e.g., CDRs, (or portions thereof) are derived from a non-human antibody
• FRs or portions thereof
• a humanized antibody optionally will also comprise at least a portion of a human constant region.
• some FR residues in a humanized antibody are substituted with corresponding residues from a non-human antibody (e.g., the antibody from which the HVR residues are derived), e.g., to restore or improve antibody specificity or affinity.
• a non-human antibody e.g., the antibody from which the HVR residues are derived
• Human framework regions that may be used for humanization include but are not limited to: framework regions selected using the "best-fit” method (see, e.g., Sims et al. J. Immunol.
• framework regions derived from the consensus sequence of human antibodies of a particular subgroup of light or heavy chain variable regions see, e.g., Carter et al. Proc. Natl. Acad. Sci. USA, 89:4285 (1992); and Presta et al. J. Immunol, 151 :2623 (1993)); human mature (somatically mutated) framework regions or human germline framework regions (see, e.g., Almagro and Fransson, Front. Biosci. 13: 1619-1633 (2008)); and framework regions derived from screening FR libraries (see, e.g., Baca et al, J. Biol. Chem. 272: 10678-10684 (1997) and Rosok et al, J. Biol. Chem. 271 :22611-22618 (1996)).
• an antibody provided herein is a human antibody.
• Human antibodies can be produced using various techniques known in the art. Human antibodies are described generally in van Dijk and van de Winkel, Curr. Opin. Pharmacol. 5: 368-74 (2001) and Lonberg, Curr. Opin. Immunol. 20:450-459 (2008).
• Human antibodies may be prepared by administering an immunogen to a transgenic animal that has been modified to produce intact human antibodies or intact antibodies with human variable regions in response to antigenic challenge.
• Such animals typically contain all or a portion of the human immunoglobulin loci, which replace the endogenous immunoglobulin loci, or which are present extrachromosomally or integrated randomly into the animal's
• Human variable regions from intact antibodies generated by such animals may be further modified, e.g., by combining with a different human constant region.
• Human antibodies can also be made by hybridoma-based methods. Human myeloma and mouse-human heteromyeloma cell lines for the production of human monoclonal antibodies have been described. (See, e.g., Kozbor J. Immunol, 133: 3001 (1984); Brodeur et al,
• Human antibodies generated via human B-cell hybridoma technology are also described in Li et al., Proc. Natl. Acad. Sci. USA, 103:3557-3562 (2006). Additional methods include those described, for example, in U.S. Patent No. 7,189,826 (describing production of monoclonal human IgM antibodies from hybridoma cell lines) and Ni, Xiandai Mianyixue, 26(4):265-268 (2006) (describing human-human hybridomas).
• Human hybridoma technology (Trioma technology) is also described in Vollmers and Brandlein, Histology and Histopathology, 20(3):927-937 (2005) and Vollmers and Brandlein, Methods and Findings in Experimental and Clinical
• Human antibodies may also be generated by isolating Fv clone variable domain sequences selected from human-derived phage display libraries. Such variable domain sequences may then be combined with a desired human constant domain. Techniques for selecting human antibodies from antibody libraries are described below.
• Antibodies of the invention may be isolated by screening combinatorial libraries for antibodies with the desired activity or activities. For example, a variety of methods are known in the art for generating phage display libraries and screening such libraries for antibodies possessing the desired binding characteristics. Such methods are reviewed, e.g., in
• repertoires of VH and VL genes are separately cloned by polymerase chain reaction (PCR) and recombined randomly in phage libraries, which can then be screened for antigen-binding phage as described in Winter et al., Ann. Rev. Immunol., 12: 433-455 (1994).
• Phage typically display antibody fragments, either as single-chain Fv (scFv) fragments or as Fab fragments.
• scFv single-chain Fv
• Libraries from immunized sources provide high-affinity antibodies to the immunogen without the requirement of constructing hybridomas.
• naive repertoire can be cloned (e.g., from human) to provide a single source of antibodies to a wide range of non-self and also self antigens without any immunization as described by Griffiths et al., EMBO J 12: 725-734 (1993).
• naive libraries can also be made synthetically by cloning unrearranged V-gene segments from stem cells, and using PCR primers containing random sequence to encode the highly variable CDR3 regions and to accomplish rearrangement in vitro, as described by Hoogenboom and Winter, J. Mol. Biol, 227: 381-388 (1992).
• Patent publications describing human antibody phage libraries include, for example: US Patent No. 5,750,373, and US Patent Publication Nos. 2005/0079574,
• Antibodies or antibody fragments isolated from human antibody libraries are considered human antibodies or human antibody fragments herein. 6. Multispecific Antibodies
• an antibody provided herein is a multispecific antibody, e.g. a bispecific antibody.
• Multispecific antibodies are monoclonal antibodies that have binding specificities for at least two different sites.
• one of the binding specificities is for ApoLl and the other is for any other antigen.
• one of the binding specificities is for ApoLl and the second binding specificity triggers endocytosis of ApoLl containing HDL particles.
• bispecific antibodies may bind to two different epitopes of ApoLl .
• Bispecific antibodies can be prepared as full length antibodies or antibody fragments.
• Techniques for making multispecific antibodies include, but are not limited to, recombinant co-expression of two immunoglobulin heavy chain-light chain pairs having different
• Multi-specific antibodies may also be made by engineering electrostatic steering effects for making antibody Fc-heterodimeric molecules (WO 2009/089004A1); cross-linking two or more antibodies or fragments (see, e.g., US Patent No.
• Engineered antibodies with three or more functional antigen binding sites including
• Optus antibodies are also included herein (see, e.g. US 2006/0025576A1).
• the antibody or fragment herein also includes a "Dual Acting FAb” or “DAF” comprising an antigen binding site which binds to ApoLl as well as another, different antigen (see, US 2008/0069820, for example).
• amino acid sequence variants of the antibodies provided herein are contemplated.
• Amino acid sequence variants of an antibody may be prepared by introducing appropriate modifications into the nucleotide sequence encoding the antibody, or by peptide synthesis. Such modifications include, for example, deletions from, and/or insertions into and/or substitutions of residues within the amino acid sequences of the antibody. Any combination of deletion, insertion, and substitution can be made to arrive at the final construct, provided that the final construct possesses the desired characteristics, e.g., antigen-binding. a) Substitution, Insertion, and Deletion Variants
• antibody variants having one or more amino acid substitutions are provided.
• Sites of interest for substitutional mutagenesis include the HVRs and FRs.
• amino acid side chain classes Amino acid substitutions may be introduced into an antibody of interest and the products screened for a desired activity, e.g., retained/improved antigen binding, decreased
• Amino acids may be grouped according to common side-chain properties:
• Non-conservative substitutions will entail exchanging a member of one of these classes for another class.
• substitutional variant involves substituting one or more hypervariable region residues of a parent antibody (e.g. a humanized or human antibody).
• a parent antibody e.g. a humanized or human antibody
• the resulting variant(s) selected for further study will have modifications (e.g., improvements) in certain biological properties (e.g., increased affinity, reduced immunogenicity) relative to the parent antibody and/or will have substantially retained certain biological properties of the parent antibody.
• An exemplary substitutional variant is an affinity matured antibody, which may be conveniently generated, e.g., using phage display-based affinity maturation techniques such as those described herein. Briefly, one or more HVR residues are mutated and the variant antibodies displayed on phage and screened for a particular biological activity (e.g. binding affinity).
• Alterations may be made in HVRs, e.g., to improve antibody affinity. Such alterations may be made in HVR "hotspots," i.e., residues encoded by codons that undergo mutation at high frequency during the somatic maturation process (see, e.g., Chowdhury,
• Affinity maturation by constructing and reselecting from secondary libraries has been described, e.g., in Hoogenboom et al. in Methods in Molecular Biology 178: 1-37 (O'Brien et al., ed., Human Press, Totowa, NJ, (2001).)
• affinity maturation diversity is introduced into the variable genes chosen for maturation by any of a variety of methods (e.g., error-prone PCR, chain shuffling, or oligonucleotide-directed mutagenesis).
• a secondary library is then created.
• the library is then screened to identify any antibody variants with the desired affinity.
• Another method to introduce diversity involves HVR-directed approaches, in which several HVR residues (e.g., 4-6 residues at a time) are randomized. HVR residues involved in antigen binding may be specifically identified, e.g., using alanine scanning mutagenesis or modeling. CDR-H3 and CDR-L3 in particular are often targeted.
• substitutions, insertions, or deletions may occur within one or more HVRs so long as such alterations do not substantially reduce the ability of the antibody to bind antigen.
• conservative alterations e.g., conservative substitutions as provided herein
• Such alterations may, for example, be outside of antigen contacting residues in the HVRs.
• each HVR either is unaltered, or contains no more than one, two or three amino acid substitutions.
• a useful method for identification of residues or regions of an antibody that may be targeted for mutagenesis is called "alanine scanning mutagenesis" as described by Cunningham and Wells (1989) Science, 244: 1081-1085.
• a residue or group of target residues e.g., charged residues such as arg, asp, his, lys, and glu
• a neutral or negatively charged amino acid e.g., alanine or polyalanine
• a crystal structure of an antigen-antibody complex to identify contact points between the antibody and antigen.
• Such contact residues and neighboring residues may be targeted or eliminated as candidates for substitution.
• Variants may be screened to determine whether they contain the desired properties.
• Amino acid sequence insertions include amino- and/or carboxyl-terminal fusions ranging in length from one residue to polypeptides containing a hundred or more residues, as well as intrasequence insertions of single or multiple amino acid residues.
• terminal insertions include an antibody with an N-terminal methionyl residue.
• Other insertional variants of the antibody molecule include the fusion to the N- or C-terminus of the antibody to an enzyme (e.g. for ADEPT) or a polypeptide which increases the serum half-life of the antibody.
• ADEPT enzyme
• an antibody provided herein is altered to increase or decrease the extent to which the antibody is glycosylated.
• Addition or deletion of glycosylation sites to an antibody may be conveniently accomplished by altering the amino acid sequence such that one or more glycosylation sites is created or removed.
• the carbohydrate attached thereto may be altered.
• Native antibodies produced by mammalian cells typically comprise a branched, biantennary oligosaccharide that is generally attached by an N-linkage to Asn297 of the CH2 domain of the Fc region. See, e.g., Wright et al. TIBTECH 15:26-32 (1997).
• oligosaccharide may include various carbohydrates, e.g., mannose, N-acetyl glucosamine (GlcNAc), galactose, and sialic acid, as well as a fucose attached to a GlcNAc in the "stem" of the biantennary oligosaccharide structure.
• modifications of the oligosaccharide in an antibody of the invention may be made in order to create antibody variants with certain improved properties.
• antibody variants having a carbohydrate structure that lacks fucose attached (directly or indirectly) to an Fc region.
• the amount of fucose in such antibody may be from 1% to 80%, from 1% to 65%, from 5% to 65% or from 20% to 40%.
• the amount of fucose is determined by calculating the average amount of fucose within the sugar chain at Asn297, relative to the sum of all glycostructures attached to Asn 297 (e. g. complex, hybrid and high mannose structures) as measured by MALDI-TOF mass spectrometry, as described in WO 2008/077546, for example.
• Asn297 refers to the asparagine residue located at about position 297 in the Fc region (Eu numbering of Fc region residues); however, Asn297 may also be located about ⁇ 3 amino acids upstream or downstream of position 297, i.e., between positions 294 and 300, due to minor sequence variations in antibodies.
• Such fucosylation variants may have improved ADCC function. See, e.g., US Patent Publication Nos. US 2003/0157108 (Presta, L.); US 2004/0093621 (Kyowa Hakko Kogyo Co., Ltd). Examples of publications related to "defucosylated" or "fucose-deficient" antibody variants include: US
• Examples of cell lines capable of producing defucosylated antibodies include Led 3 CHO cells deficient in protein fucosylation (Ripka et al. Arch.
• Antibodies variants are further provided with bisected oligosaccharides, e.g., in which a biantennary oligosaccharide attached to the Fc region of the antibody is bisected by GlcNAc.
• Such antibody variants may have reduced fucosylation and/or improved ADCC function.
• Antibody variants with at least one galactose residue in the oligosaccharide attached to the Fc region are also provided. Such antibody variants may have improved CDC function. Such antibody variants are described, e.g., in WO 1997/30087 (Patel et al); WO 1998/58964 (Raju, S.); and
• one or more amino acid modifications may be introduced into the amino acid
• the Fc region variant may comprise a human Fc region sequence ⁇ e.g., a human IgGl, IgG2, IgG3 or IgG4 Fc region) comprising an amino acid modification ⁇ e.g. a substitution) at one or more amino acid positions.
• the invention contemplates an antibody variant that possesses some but not all effector functions, which make it a desirable candidate for applications in which the half life of the antibody in vivo is important yet certain effector functions (such as complement and ADCC) are unnecessary or deleterious.
• In vitro and/or in vivo cytotoxicity assays can be conducted to confirm the reduction/depletion of CDC and/or ADCC activities.
• Fc receptor (FcR) binding assays can be conducted to ensure that the antibody lacks FcyR binding (hence likely lacking ADCC activity), but retains FcRn binding ability.
• NK cells express FcyRIII only, whereas monocytes express FcyRI, FcyRII and FcyRIII.
• FcR expression on hematopoietic cells is summarized in Table 3 on page 464 of Ravetch and Kinet, Annu. Rev. Immunol. 9:457-492 (1991).
• Non-limiting examples of in vitro assays to assess ADCC activity of a molecule of interest is described in U.S. Patent No.
• non-radioactive assays methods may be employed (see, for example, ACTITM non-radioactive cytotoxicity assay for flow cytometry (CellTechnology, Inc. Mountain View, CA; and CytoTox 96 ® nonradioactive cytotoxicity assay (Promega, Madison, WI).
• Useful effector cells for such assays include peripheral blood mononuclear cells (PBMC) and Natural Killer (NK) cells.
• ADCC activity of the molecule of interest may be assessed in vivo, e.g., in a animal model such as that disclosed in Clynes et al. Proc. Nat'l Acad. Sci. USA 95:652-656 (1998).
• Clq binding assays may also be carried out to confirm that the antibody is unable to bind Clq and hence lacks CDC activity. See, e.g., Clq and C3c binding ELISA in WO 2006/029879 and WO 2005/100402.
• a CDC assay may be performed (see, for example, Gazzano-Santoro et al., J. Immunol. Methods 202: 163 (1996); Cragg, M.S. et al, Blood 101 : 1045-1052 (2003); and Cragg, M.S. and M.J. Glennie, Blood
• FcRn binding and in vivo clearance/half life determinations can also be performed using methods known in the art (see, e.g., Petkova, S.B. et al, Int 'l. Immunol.
• Antibodies with reduced effector function include those with substitution of one or more of Fc region residues 238, 265, 269, 270, 297, 327 and 329 (U.S. Patent No. 6,737,056).
• Fc mutants include Fc mutants with substitutions at two or more of amino acid positions 265, 269, 270, 297 and 327, including the so-called "DANA" Fc mutant with substitution of residues 265 and 297 to alanine (US Patent No. 7,332,581).
• an antibody variant comprises an Fc region with one or more amino acid substitutions which improve ADCC, e.g., substitutions at positions 298, 333, and/or 334 of the Fc region (EU numbering of residues).
• alterations are made in the Fc region that result in altered (i.e., either improved or diminished) Clq binding and/or Complement Dependent Cytotoxicity (CDC), e.g., as described in US Patent No. 6,194,551, WO 99/51642, and ldusogie et al. J. Immunol. 164: 4178-4184 (2000).
• Those antibodies comprise an Fc region with one or more substitutions therein which improve binding of the Fc region to FcRn.
• Fc variants include those with substitutions at one or more of Fc region residues: 238, 256, 265, 272, 286, 303, 305, 307, 311, 312, 317, 340, 356, 360, 362, 376, 378, 380, 382, 413, 424 or 434, e.g., substitution of Fc region residue 434 (US Patent No. 7,371,826).
• cysteine engineered antibodies e.g., "thioMAbs”
• one or more residues of an antibody are substituted with cysteine residues.
• the substituted residues occur at accessible sites of the antibody.
• reactive thiol groups are thereby positioned at accessible sites of the antibody and may be used to conjugate the antibody to other moieties, such as drug moieties or linker-drug moieties, to create an immunoconjugate, as described further herein.
• any one or more of the following residues may be substituted with cysteine: V205 (Kabat numbering) of the light chain; Al 18 (EU numbering) of the heavy chain; and S400 (EU numbering) of the heavy chain Fc region.
• Cysteine engineered antibodies may be generated as described, e.g., in U.S. Patent No.
• an antibody provided herein may be further modified to contain additional nonproteinaceous moieties that are known in the art and readily available.
• the moieties suitable for derivatization of the antibody include but are not limited to water soluble polymers.
• water soluble polymers include, but are not limited to, polyethylene glycol (PEG), copolymers of ethylene glycol/propylene glycol, carboxymethylcellulose, dextran, polyvinyl alcohol, polyvinyl pyrrolidone, poly-1, 3-dioxolane, poly-1, 3, 6-trioxane, ethylene/maleic anhydride copolymer, polyaminoacids (either
• polyethylene glycol propionaldehyde may have advantages in manufacturing due to its stability in water.
• the polymer may be of any molecular weight, and may be branched or unbranched.
• the number of polymers attached to the antibody may vary, and if more than one polymer are attached, they can be the same or different molecules. In general, the number and/or type of polymers used for derivatization can be determined based on considerations including, but not limited to, the particular properties or functions of the antibody to be improved, whether the antibody derivative will be used in a therapy under defined conditions, etc.
• conjugates of an antibody and nonproteinaceous moiety that may be selectively heated by exposure to radiation are provided.
• the amino acids may be selectively heated by exposure to radiation.
• nonproteinaceous moiety is a carbon nanotube (Kam et al., Proc. Natl. Acad. Sci. USA 102:
• the radiation may be of any wavelength, and includes, but is not limited to, wavelengths that do not harm ordinary cells, but which heat the nonproteinaceous moiety to a temperature at which cells proximal to the antibody-nonproteinaceous moiety are killed.
• Antibodies may be produced using recombinant methods and compositions, e.g., as described in U.S. Patent No. 4,816,567.
• isolated nucleic acid encoding an anti-ApoLl antibody described herein is provided.
• Such nucleic acid may encode an amino acid sequence comprising the VL and/or an amino acid sequence comprising the VH of the antibody (e.g., the light and/or heavy chains of the antibody).
• one or more vectors e.g., expression vectors
• a host cell comprising such nucleic acid is provided.
• a host cell comprises (e.g., has been transformed with): (1) a vector comprising a nucleic acid that encodes an amino acid sequence comprising the VL of the antibody and an amino acid sequence comprising the VH of the antibody, or (2) a first vector comprising a nucleic acid that encodes an amino acid sequence comprising the VL of the antibody and a second vector comprising a nucleic acid that encodes an amino acid sequence comprising the VH of the antibody.
• the host cell is eukaryotic, e.g. a Chinese Hamster Ovary (CHO) cell or lymphoid cell (e.g., Y0, NS0, Sp20 cell).
• a method of making an anti-ApoLl antibody comprises culturing a host cell comprising a nucleic acid encoding the antibody, as provided above, under conditions suitable for expression of the antibody, and optionally recovering the antibody from the host cell (or host cell culture medium).
• nucleic acid encoding an antibody is isolated and inserted into one or more vectors for further cloning and/or expression in a host cell.
• nucleic acid may be readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of the antibody).
• Suitable host cells for cloning or expression of antibody-encoding vectors include prokaryotic or eukaryotic cells described herein.
• prokaryotic or eukaryotic cells described herein.
• antibodies may be produced in bacteria, in particular when glycosylation and Fc effector function are not needed.
• Fc effector function are not needed.
• expression of antibody fragments and polypeptides in bacteria see, e.g., U.S. Patent Nos.
• the antibody may be isolated from the bacterial cell paste in a soluble fraction and can be further purified.
• eukaryotic microbes such as filamentous fungi or yeast are suitable cloning or expression hosts for antibody-encoding vectors, including fungi and yeast strains whose glycosylation pathways have been "humanized,” resulting in the production of an antibody with a partially or fully human glycosylation pattern. See Gerngross, Nat. Biotech. 22: 1409-1414 (2004), and Li et al, Nat. Biotech. 24:210-215 (2006).
• Suitable host cells for the expression of glycosylated antibody are also derived from multicellular organisms (invertebrates and vertebrates). Examples of invertebrate cells include plant and insect cells. Numerous baculoviral strains have been identified which may be used in conjunction with insect cells, particularly for trans fection of Spodoptera frugiperda cells.
• Plant cell cultures can also be utilized as hosts. See, e.g., US Patent Nos. 5,959,177, 6,040,498, 6,420,548, 7,125,978, and 6,417,429 (describing PLANTIBODIESTM technology for producing antibodies in transgenic plants).
• Vertebrate cells may also be used as hosts.
• mammalian cell lines that are adapted to grow in suspension may be useful.
• useful mammalian host cell lines are monkey kidney CVl line transformed by SV40 (COS-7); human embryonic kidney line (293 or 293 cells as described, e.g., in Graham et al, J. Gen Virol. 36:59 (1977)); baby hamster kidney cells (BHK); mouse Sertoli cells (TM4 cells as described, e.g., in Mather, Biol. Reprod.
• monkey kidney cells (CV1); African green monkey kidney cells (VERO- 76); human cervical carcinoma cells (HELA); canine kidney cells (MDCK; buffalo rat liver cells (BRL 3A); human lung cells (W138); human liver cells (Hep G2); mouse mammary tumor (MMT 060562); TRI cells, as described, e.g., in Mather et al., Annals N. Y. Acad. Sci. 383:44-68 (1982); MRC 5 cells; and FS4 cells.
• Other useful mammalian host cell lines include Chinese hamster ovary (CHO) cells, including DHFR " CHO cells (Urlaub et al, Proc. Natl. Acad. Sci.
• Anti-ApoLl antibodies provided herein may be identified, screened for, or characterized for their physical/chemical properties and/or biological activities by various assays known in the art.
• an antibody of the invention is tested for its antigen binding activity, e.g., by known methods such as ELISA, Western blot, etc., or competition with trypanosome Serum Resistance Antigen (SRA) binding.
• competition assays may be used to identify an antibody that competes with an antibody as described herein for binding to ApoLl .
• such a competing antibody binds to the same epitope (e.g., a linear or a conformational epitope) that is bound by an antibody as described herein.
• epitope e.g., a linear or a conformational epitope
• immobilized ApoLl is incubated in a solution comprising a first labeled antibody which binds to ApoLl (e.g., an antibody as described herein) and a second unlabeled antibody that is being tested for its ability to compete with the first antibody for binding to ApoLl .
• the second antibody may be present in a hybridoma
• immobilized ApoLl is incubated in a solution comprising the first labeled antibody but not the second unlabeled antibody. After incubation under conditions permissive for binding of the first antibody to ApoLl, excess unbound antibody is removed, and the amount of label associated with immobilized ApoLl is measured. If the amount of label associated with immobilized ApoLl is substantially reduced in the test sample relative to the control sample, then that indicates that the second antibody is competing with the first antibody for binding to ApoLl . See Harlow and Lane (1988) Antibodies: A Laboratory Manual ch.14 (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY). 2. Activity assays
• assays are provided for identifying anti-ApoLl antibodies thereof having biological activity.
• Biological activity may include, e.g., binding to ApoLl thereby reducing the serum concentration of ApoLl and/or reducing the progression of an ApoLl mediated nephropathy.
• Antibodies having such biological activity in vivo and/or in vitro are also provided.
• an antibody of the invention is tested for such biological activity.
• screening for antibodies is performed that reduce the trypanolytic activity of ApoLl .
• screening for antibodies is performed that reduce toxicity of ApoLl in an in vitro model of podocyte toxicity.
• assays are used as described in the Examples.
• compositions of an anti-ApoLl antibody as described herein are prepared by mixing such antibody having the desired degree of purity with one or more optional pharmaceutically acceptable carriers ⁇ Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980)), in the form of lyophilized formulations or aqueous solutions.
• Pharmaceutically acceptable carriers are generally nontoxic to recipients at the dosages and concentrations employed, and include, but are not limited to: buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride; benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arg
• sHASEGP soluble neutral-active hyaluronidase glycoproteins
• rHuPH20 HYLENEX ® , Baxter International, Inc.
• Certain exemplary sHASEGPs and methods of use, including rHuPH20, are described in US Patent Publication Nos. 2005/0260186 and 2006/0104968.
• a sHASEGP is combined with one or more additional glycosaminoglycanases such as chondroitinases.
• Exemplary lyophilized antibody formulations are described in US Patent No. 6,267,958.
• Aqueous antibody formulations include those described in US Patent No. 6,171,586 and WO2006/044908, the latter formulations including a histidine-acetate buffer.
• the formulation herein may also contain more than one active ingredients as necessary for the particular indication being treated, preferably those with complementary activities that do not adversely affect each other. For example, it may be desirable to further provide standard of care. Such active ingredients are suitably present in combination in amounts that are effective for the purpose intended.
• Active ingredients may be entrapped in microcapsules prepared, for example, by coacervation techniques or by interfacial polymerization, for example, hydroxymethylcellulose or gelatin-microcapsules and poly-(methylmethacylate) microcapsules, respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano- particles and nanocapsules) or in macroemulsions.
• colloidal drug delivery systems for example, liposomes, albumin microspheres, microemulsions, nano- particles and nanocapsules
• Sustained-release preparations may be prepared. Suitable examples of sustained-release preparations include semipermeable matrices of solid hydrophobic polymers containing the antibody, which matrices are in the form of shaped articles, e.g. films, or microcapsules.
• the formulations to be used for in vivo administration are generally sterile. Sterility may be readily accomplished, e.g., by filtration through sterile filtration membranes.
• anti-ApoLl antibodies Any of the anti-ApoLl antibodies provided herein may be used in therapeutic methods.
• an anti-ApoLl antibody for use as a medicament is provided.
• an anti-ApoLl antibody for use in treating nephropathy is provided.
• an anti-ApoLl antibody for use in a method of treatment is provided.
• the invention provides an anti-ApoLl antibody for use in a method of treating an individual having a nephropathy comprising administering to the individual an effective amount of the anti-ApoLl antibody.
• the method further comprises administering to the individual an effective amount of at least one additional therapeutic agent, e.g., as described below.
• the invention provides an anti-ApoLl antibody for use in reducing the serum concentration of ApoLl and/or reducing the progression of an ApoLl mediated nephropathy.
• the invention provides an anti- ApoLl antibody for use in a method of reducing the serum concentration of ApoLl and/or reducing the progression of an ApoLl mediated nephropathy in an individual comprising administering to the individual an effective amount of the anti-ApoLl antibody to reduce the serum concentration of ApoLl and/or reduce the progression of an ApoLl mediated
• An "individual” according to any of the above embodiments is preferably a human.
• the invention provides for the use of an anti- ApoLl antibody in the manufacture or preparation of a medicament.
• the medicament is for treatment of a nephropathy.
• the medicament is for use in a method of treating nephropathy comprising administering to an individual having a nephropathy an effective amount of the medicament.
• the method further comprises administering to the individual an effective amount of at least one additional therapeutic agent, e.g., as described below.
• the medicament is for reducing the serum concentration of ApoLl and/or reducing the progression of an ApoLl mediated nephropathy.
• the medicament is for use in a method of reducing the serum
• An "individual" according to any of the above embodiments may be a human.
• the invention provides a method for treating a nephropathy.
• the method comprises administering to an individual having a nephropathy an effective amount of an anti- ApoLl antibody.
• the method further comprises administering to the individual an effective amount of at least one additional therapeutic agent, as described below.
• An "individual" according to any of the above embodiments may be a human.
• the invention provides a method for reducing the serum concentration of ApoLl and/or reducing the progression of an ApoLl mediated nephropathy in an individual.
• the method comprises administering to the individual an effective amount of an anti- ApoLl antibody to reduce the serum concentration of ApoLl and/or reduce the progression of an ApoLl mediated nephropathy.
• an "individual" is a human.
• the invention provides pharmaceutical formulations comprising any of the anti-ApoLl antibodies provided herein, e.g., for use in any of the above therapeutic methods.
• a pharmaceutical formulation comprises any of the anti-ApoLl antibodies provided herein and a pharmaceutically acceptable carrier.
• a pharmaceutical formulation comprises any of the anti-ApoLl antibodies provided herein and at least one additional therapeutic agent, e.g., as described below.
• Antibodies of the invention can be used either alone or in combination with other agents in a therapy.
• an antibody of the invention may be co-administered with at least one additional therapeutic agent.
• Such combination therapies noted above encompass combined administration (where two or more therapeutic agents are included in the same or separate formulations), and separate administration, in which case, administration of the antibody of the invention can occur prior to, simultaneously, and/or following, administration of the additional therapeutic agent or agents.
• administration of the anti-ApoLl antibody and administration of an additional therapeutic agent occur within about one month, or within about one, two or three weeks, or within about one, two, three, four, five, or six days, of each other.
• An antibody of the invention can be administered by any suitable means, including parenteral, intrapulmonary, and intranasal, and, if desired for local treatment, intralesional administration.
• Parenteral infusions include intramuscular, intravenous, intraarterial, intraperitoneal, or subcutaneous administration. Dosing can be by any suitable route, e.g. by injections, such as intravenous or subcutaneous injections, depending in part on whether the administration is brief or chronic.
• Various dosing schedules including but not limited to single or multiple administrations over various time-points, bolus administration, and pulse infusion are contemplated herein.
• Antibodies of the invention would be formulated, dosed, and administered in a fashion consistent with good medical practice.
• Factors for consideration in this context include the particular disorder being treated, the particular mammal being treated, the clinical condition of the individual patient, the cause of the disorder, the site of delivery of the agent, the method of administration, the scheduling of administration, and other factors known to medical
• the antibody need not be, but is optionally formulated with one or more agents currently used to prevent or treat the disorder in question.
• the effective amount of such other agents depends on the amount of antibody present in the formulation, the type of disorder or treatment, and other factors discussed above. These are generally used in the same dosages and with administration routes as described herein, or about from 1 to 99% of the dosages described herein, or in any dosage and by any route that is empirically/clinically determined to be appropriate.
• an antibody of the invention when used alone or in combination with one or more other additional therapeutic agents, will depend on the type of disease to be treated, the type of antibody, the severity and course of the disease, whether the antibody is administered for preventive or therapeutic purposes, previous therapy, the patient's clinical history and response to the antibody, and the discretion of the attending physician.
• the antibody is suitably administered to the patient at one time or over a series of treatments.
• about 1 ⁇ g/kg to 15 mg/kg (e.g. O. lmg/kg-lOmg/kg) of antibody can be an initial candidate dosage for administration to the patient, whether, for example, by one or more separate administrations, or by continuous infusion.
• One typical daily dosage might range from about 1 ⁇ g/kg to 100 mg/kg or more, depending on the factors mentioned above. For repeated administrations over several days or longer, depending on the condition, the treatment would generally be sustained until a desired suppression of disease symptoms occurs.
• One exemplary dosage of the antibody would be in the range from about 0.05 mg/kg to about 10 mg/kg.
• one or more doses of about 0.5 mg/kg, 2.0 mg/kg, 4.0 mg/kg or 10 mg/kg (or any combination thereof) may be administered to the patient.
• Such doses may be administered intermittently, e.g. every week or every three weeks (e.g. such that the patient receives from about two to about twenty, or e.g. about six doses of the antibody).
• An initial higher loading dose, followed by one or more lower doses may be administered. The progress of this therapy is easily monitored by conventional techniques and assays.
• an article of manufacture containing materials useful for the treatment, prevention and/or diagnosis of the disorders described above comprises a container and a label or package insert on or associated with the container.
• Suitable containers include, for example, bottles, vials, syringes, intravenous solution bags, etc.
• the containers may be formed from a variety of materials such as glass or plastic.
• the container holds a composition which is by itself or combined with another composition effective for treating, preventing and/or diagnosing the condition and may have a sterile access port (for example the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle).
• At least one active agent in the composition is an antibody of the invention.
• the label or package insert indicates that the composition is used for treating the condition of choice.
• the article of manufacture may comprise (a) a first container with a composition contained therein, wherein the
• composition comprises an antibody of the invention; and (b) a second container with a composition contained therein, wherein the composition comprises a further cytotoxic or otherwise therapeutic agent.
• the article of manufacture in this embodiment of the invention may further comprise a package insert indicating that the compositions can be used to treat a particular condition.
• the article of manufacture may further comprise a second (or third) container comprising a pharmaceutically-acceptable buffer, such as bacteriostatic water for injection (BWFI), phosphate-buffered saline, lactated ringer's solution and dextrose solution. It may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, and syringes.
• any of the above articles of manufacture may include an immunoconjugate of the invention in place of or in addition to an anti- ApoLl antibody.
• EXAMPLE 1 Generation and genotyping of APOL1 transgenic mice
• apolipoprotein LI Apolipoprotein LI
• BAC Bacterial Artificial Chromosome
• a BAC Bacterial Artificial Chromosome containing the human APOLl gene (RPl 1-
• the cassettes were designed to allow for insertion of the galK selection marker using EcoRI and Spel/BamHI sites to generate the positive selection cassettes for BAC modification and for subsequent seamless removal of galK using BfuAI Type lis restriction followed by self-ligation, to generate the counter-selection cassettes for BAC modification.
• the targeting cassettes were released from the pUC vector backbone by Notl digestion.
• the G2 mutation is a deletion of amino acids N388 and Y389 (base pairs AATTAT).
• the Gl mutation consists of two substitutions, S342G and I384M (AGC to GGC and ATT to ATG, respectively).
• S342G and I384M ATC to GGC and ATT to ATG, respectively.
• the modified genomic region of the APOLl BAC was retrieved (subcloned) into pBR322 using recombineering, giving rise to a 44 kb transgene.
• a control transgene (wt) was generated by retrieval from the unmodified APOLl BAC.
• the transgenes were linearized by Notl digestion, purified and microinjected into zygotes from the C57BL/6N mouse strain, to generate transgenic animals, using established methods. Schematic drawings of the transgenes for ApoLl wt, Gl and G2, respectively, are depicted in Fig. 1, A-C. Mice were maintained on a C57BL/6 background.
• Genotyping of ApoLl transgenic mice was performed by standard PCR or Taqman analysis. Genotyping for the GO variant of ApoLl and G2 variant of ApoLl uses standard PCR and primers directed against ApoLl (Forward 5'- TTTCTTGTGCTGGATGTAG -3' (SEQ ID No:08) and Reverse 5' - ATATCTCTCCTGGTGGCT -3 '(SEQ ID No:09)) as well as an internal control to Taci (Forward 5'- TGGGTGTCAGGTTCTTGCTTCAGC -3 '(SEQ ID
• reaction conditions are 94°C, 4 min followed by 30 cycles at 94°C, 60 s (denaturing), 55°C, 30 s
• a tagman assay is used for the Gl variant of ApoLl using Type-it Fast SNP PCR master mix (Qiagen PN 206042), 0.5 ⁇ of each primer and 0.15 ⁇ of probe (Applied Biosystems).
• ApoLl uses forward primer 5 '- TGAGCAGAGGAGTCAAG -3 '(SEQ ID No: 12), reverse primer 5' - TGTGGTCACAGTTCTTG -3 '(SEQ ID No: 13)), and probe 5'-6FAM-
• a positive control to Apo uses forward primer 5'- CACGTGGGCTCCAGCATT-3 ' (SEQ ID No: 15), reverse primer
• KBr/NaCl solutions with densities at 1.006, 1.019, 1.063, and 1.24 g/ml were prepared according to McPherson, et al (McPherson et al., 2007). All salt solutions contained 0.1% NaN 3 and 0.04% EDTA. Densities were confirmed at 25°C with a Densito 30PX density meter (Mettler Toledo). Diluted serum solution with a density of 1.21 g/ml was prepared by the addition of 0.923 g KBr to 0.284 ml serum and 2.556 ml H 2 0 to a final volume of 3 ml.
• the gradient column was prepared and packed according to Chapman MJ, et al using a peristaltic pump (Chapman et al., 1981). Centrifugation was performed on a Beckman SW41Ti rotor at 40,000 rpm for > 48 h at 15°C. Fractions were collected in 1ml volumes with a peristaltic pump and then dialyzed against Tris buffer (0.04% EDTA, 5 mM Tris and 50 mM NaCl, pH 7.4) overnight at 4°C.
• Tris buffer 0.04% EDTA, 5 mM Tris and 50 mM NaCl, pH 7.4
• An ApoLl sandwich ELISA was developed as follows: 0.5 ⁇ g/ml of anti-ApoLl polyclonal antibody (Proteintech 11486-2-AP) was coated onto a Maxisorp® plate (Thermo Fisher Scientific, 464718) in carbonate/bicarbonate buffer (1.59 g Na 2 C0 3 , 2.93 g NaHC0 3 , in water qc to 1L) at 4°C overnight. The coated plate was blocked with 5% milk in Tris-buffered saline containing 0.05%> Tween20.
• the pre-coated and pre-b locked plate was sequentially incubated with either the standard curve or the experimental samples, 0.5 ⁇ g/ml of a biotinylated antibody directed against GO variant of ApoLl raised in rabbit using a recombinant fusion protein containing amino acids 61 to 398 of human APOL1 isoform l(generated and purified at Genentech), and 1 : 10,000 of a peroxide conjugated streptavidin (GE, RPN4401 V).
• the plate was washed between each incubation step on a 405TM microplate washer (Biotek) using phosphate buffered saline containing 0.05%> Tween 20.
• ApoLl was detected using the colorimetric BioFX® TMB substrate (Surmodics, TMBS 1000-01), stopped with 1M phosphoric acid and read on a SpectraMax250 spectrophotometer (Molecular Devices).
• HDL3 in Band IV and IF-c fractions 7, 8 and 9
• lower levels are present as HDL2 in Band III (fraction 6); significant quantities are found in IF-d as VHDL (fraction 9 and 10); and ApoAl is pelleted with free protein such as IgG (fractions 11 and 12) (Fig. 2C, D).
• ApoLl in human serum is present in a subset of the fractions where ApoAl is present.
• a small amount is present as HDL3 in Band IV and IF-c (fractions 8 and 9) while the majority is present as VHDL in IF-d and Band V (fractions 9 and 10) as well as with free protein in BandV and the pellet (fractions 11, 12) (Fig. 2B, D).
• ApoAl from serum of transgenic mice is present as HDL2 and HDL3 in Bands III and IV (fractions 6, 7, 8, and 9), while relatively smaller amounts are present as VHDL in IF- d (fraction 10) and with unbound protein such as IgG (fraction 12) (Fig. 2G, H).
• ApoLl in transgenic mice is primarily present as HDL3 in Band IV (fractions 8 and 9) and VHDL (IF-d, fraction 10), while a relatively smaller amount is in Band V with un-lipidated proteins (fraction 11) in both GO variant of ApoLl and G2 variant of ApoLl alike (Fig. 2F). ApoLl and ApoAl from both transgenic lines fractionate similarly.
• transgenic mouse lines express concentrations of ApoLl similar to humans
• circulating ApoLl levels in transgenic mice were quantified and compared to human serological ApoLl using a specific sandwich ELISA developed in-house as described above.
• R A was extracted from organs of adult mice (R easy kit, Qiagen), and included a DNase treatment (Qiagen).
• RT-PCR was performed using an RT-PCR kit (High Capacity cDNA Reverse Transcription; Applied Biosystems) and quantitative PCR was performed for ApoLl and mGapdH using primer/probe sets purchased from Applied Biosystems.
• mice were anesthetized using 0.1-0.2 ml IP per 20-30 g body weight of a cocktail of Xylazine (1 mg/ml) and Ketamine (100 mg/ml) and perfused with 40 ml of phosphate-buffered saline through the heart. The liver and lung were removed, minced into l-mm3 pieces, homogenized in HBSS, pelleted and lysed in RIPA buffer plus protease inhibitor cocktail.
• Protein concentrations were determined using bicinchoninic acid (BCA) reagent (Pierce). 30 ⁇ g of podocyte or tissue homogenates, 15 ⁇ g of over-expressed lysates, and 0.1 ⁇ of ApoLl transgenic mouse serum or human serum were loaded per lane and separated by electrophoresis using 4-20% Tris-Glycine or 4-12% Bis-Tris sodium dodecyl sulfate-polyacrylamide gels. Proteins were transferred to nitrocellulose membranes (Invitrogen).
• BCA bicinchoninic acid
• a conditionally immortalized human SV40 tsA58 T /hTERT podocyte cell line was obtained from the University of Bristol (Bristol, UK). Undifferentiated podocytes were kept at 33°C in RPMI-1640 medium supplemented with 10% FBS (Sigma) and Insulin-Transferrin-Selenium (Invitrogen) for proliferation. Podocyte differentiation was achieved as described in Saleem et al (Saleem et al., 2002) essentially by thermoswitching the undifferentiated podocytes at 40-60% confluency to 37°C and maintaining them for an additional 14 days, with medium changes 3 times per week. Determination of ApoLl expression using quantitative PCR and western blot analysis
• ApoLl was detected in undifferentiated or differentiated human cultured podocytes and in serum from transgenic mice expressing GO variant of ApoLl using a rabbit polyclonal antibody (Sigma, HPA018885). Lysates of ApoLl , ApoL2, or control transient trans fections in CHO-1K cells indicate that both ApoLl and ApoL2 are detected with the Sigma antibody (Fig. 4C).
• Doxorubicin (resuspended in warmed PBS to 0.5 mg/ml; Sigma D1515) was injected once via the tail vein of each non-anesthetized mouse. Age-matched male mice were injected with same volume of phosphate buffered saline. All control and experimental mice were housed individually and hydrated daily with 2 ml of lactated ringer's (Baxter). Proteinuria was assessed weekly from spontaneously voided urine from each animal. Urinary albumin was measured by enzyme-linked immunosorbent assay (ELISA) using mouse albumin as a standard (Innovative Research) and normalized to creatinine measured by colorimetric assay (Enzo Life Sciences). At day 21, animals were weighed, euthanized and kidneys were harvested for histology. Immunohistochemical Analysis
• mice were sacrificed by C0 2 inhalation to effect, kidneys were immediately dissected, fixed by immersion in 4% paraformaldehyde in PBS, cut sagittally and processed for paraffin sections. Regressive Haematoxylin and Eosin (H&E) stains were performed as per standard protocols on 3 ⁇ sections.
• H&E Haematoxylin and Eosin
• the tissues were fixed in 1/2-strength Karnovsky's fixative (2% paraformaldehyde and 2.5% glutaraldehyde in 0.1 M sodium cacodylate buffer, pH 7.2), washed in the same buffer, and postfixed in 1% aqueous osmium textroxide for 1 h.
• the samples were then dehydrated through a series of ethanol followed by propylene oxide and embedded in Eponate 12 (Ted Pella). Thin sections were cut on a microtome (Ultracut E; Reichert), stained with uranyl acetate and lead citrate, and examined in a microscope (CM 12; Philips). Images were captured with a retractable digital camera (MultiScan; Gatan).
• ApoLl accelerates the progression of kidney disease in a mouse model
• ESRD end stage renal disease
• Doxorubicin induced nephropathy is a well established rodent model of chronic kidney disease that is characterized by podocyte injury followed by
• mice treated with doxorubicin have significant weight loss of 17% as compared to GO variant of ApoLl ApoLl transgenic mice (10%) or transgenic negative animals (11%) (Fig. 8).
• Urinary albumin is not significantly higher in
• TEM analysis reveals an elaboration of podocytes into regularly spaced foot processes in PBS-treated mice while animals treated with doxorubicin display podocyte foot process effacement, which is an invariable feature of proteinuric glomerular disease (Fig. 10).
• TEM analysis was performed as described above.
• H&E Haematoxylin and eosin
• PAS Periodic-acid Schiff
• doxorubicin-treated animals display some lesions, the difference between genotypes is in the severity and distribution of lesions, but not the lesions themselves, and the doxorubicin -treated transgenic mice expressing GO variant of ApoLl display an intermediate pathological phenotype to the transgenic negative and ApoLl G2 transgenic mice.
• Low magnification images of H&E stained kidneys show a graded progression in damage relative to PBS treated mice (Fig. 11 A) with the least amount of damage in non-transgenic mice (Fig. 1 IB), moderate in transgenic mice expressing GO variant of ApoLl (Fig. 11C), and most severe in transgenic mice expressing G2 variant of ApoLl (Fig.
• Fig. 1 ID in a protocol in which a single dose of doxorubicin is delivered intravenous at day 0, take down is at day 21, and subcutaneous fluids are administered daily to prevent dehydration
• Fig. 1 IE Higher magnifications of doxorubicin-treated kidneys stained with H&E (Fig. 11F-J), periodic-acid schiff stain (Fig. 1 lK-O), and Masson's Trichrome stain (Fig. 11P-S) demonstrate that compared to normal glomeruli (Fig. 1 IF, K, P), doxorubicin- treated animals present with FSGS (Fig. 11G-J, L-O, Q-S). Bowman's space is dilated and filled with proteinaceous fluid (Fig.
• 0 represents normal and 4 severe changes. At least 10 glomeruli were examined for each animal. The overall grade is based on a general impression of all the changes and takes into account the proportion of the appropriate structures affected in the entire section. Changes were graded for each component as follows:
• the elevation in urinary proteinuria was not significant in the mice expressing GO variant of ApoLl in comparison to non-transgenic animals, the pathology scores at the end of the 28-day study indicated a significant progression of disease relative to the transgenic negative that is intermediate to the transgenic negative and transgenic mice expressing G2 variant of ApoLl .
• EXAMPLE 5 ApoLl adenovirus delivery
• GO variant of ApoLl, Gl variant of ApoLl and G2 variant of ApoLl were expressed using an adenovirus.
• ApoLl variants were cloned into an adenoviral vector, produced and titerd by Vector BioLabs.
• Adenovirus delivery was achieved by tail-vein injection at D(-)2 and D14 in each mouse with 1 x 10 Pfu brought to 100 ⁇ in sterile PBS.
• Monoclonal antibodies are raised to GO, Gl and G2 variants by any standard hybridoma methodologies, including but not limited to, injection of mice or hamsters with recombinant ApoLl protein (GO, Gl and G2). Additionally mice are subjected to hydrodynamic delivery of the DNA sequence encoding ApoLl or its Gl and G2 variants in a suitable delivery vector (pCAGGS).
• pCAGGS suitable delivery vector
• Antibody screening is performed as described as follows. Standard ELISA is used to on the original antigen to select positive hybridomas. Therefore, Maxisorp® plates coated with ApoLl GO, Gl or G2 (amino acids D61-L398 with an N-terminal his or FLAG epitope tag) are blocked, bound to hybridoma supernatants and detected with HRP-conjugated anti-mouse. Then, an SRA (serum resistance associated protein) blocking ELISA is performed to identify antibodies that prevent binding of ApoLl 's SRA-interacting domain with SRA, since this leucine zipper region might also mediate binding to other yet-to-be-identified proteins to mediate kidney malfunction.
• SRA serum resistance associated protein
• an ApoAl -ApoLl sandwich ELISA of human serum is used to identify antibodies capable of recognizing ApoLl within HDL particles in serum.
• Maxisorp® plates are coated with polyclonal goat anti-ApoAl antibodies, blocked and incubated in detergent- free buffer (to maintain HDL particle integrity) with human serum to capture HDL particles.
• Anti-ApoLl monoclonals are then incubated and any bound antibodies detected with HRP anti-mouse. Positive antibodies can be further tested on human ApoLl Gl and/or G2 serum if necessary.
• epitope binning by standard cross-blocking ELISA is performed.
• any standard method can be used, such as binding of a primary antibody to recombinant ApoLl, followed by incubation with biotinylated seconday antibody and detecting with streptavidin- HRP to determine which antibodies compete for the same ApoLl epitope.
• CHO cells stably expressing inducible ApoLl, or fragments thereof, on their surface via a C-terminally engineered glycosylphosphatidylinositol anchor are incubated with hybridoma supernatants, followed by Alexa647 anti-mouse to identify which domains they bind to.
• ApoLl (with an N-terminal Herpes Simplex Virus glycoprotein D (gD) epitope tag including its signal sequence and a C-terminal glycosylphosphatidylinositol anchor to anchor it to the cell surface) lentiviruses are used to make CHO cells stably expressing ApoLl GO, Gl or G2 full length or domain fragments in a doxycycline-inducible fashion to overcome toxicity issues.
• Cell based assays for ApoLl activity include the following:
• Adenovirally expressed ApoLl disrupts lysosomal integrity of human immortalized podocytes as assessed using a pinocytic dye (Lucifer yellow CH) and an acid tracer, Lysotracker Red. Ideally conditioned media from infected podocytes is used so as to enable pre-incubation with anti-ApoLl antibodies to identify any that inhibit the effect on lysosomes.
• the potential candidate antibodies to various domains are tested in an in vivo efficacy model, namely for their ability to inhibit the ApoLl -enhanced doxorubicin-induced proteinuria in ApoLl (GO, Gl and G2) transgenic mice.
• the candidate antibodies from various epitopes preferably those that block SRA binding or one of the cell-based assays, are tested in vivo.
• Transgenic mice expressing GO variant of ApoLl, Gl variant of ApoLl and G2 variant of ApoLl are dosed with doxorubicin to induce nephropathy as described above, as assessed by proteinuria (increased albumin: creatinine ratio in urine).
• GO variant of ApoLl enhances proteinuria compared to non-transgenic mice, and G2 variant of ApoLl has an even greater effect.
• the ability of antibodies to ApoLl to reverse this ApoLl -mediated enhancement of proteinuria is monitored.
• PD marker for in vivo activity also includes monitoring serum ApoLl levels to determine if ApoLl -containing HDL particles are depleted. Therefore, using the ApoLl transgenic mouse models described herein, blood is drawn at appropriate intervals following antibody dosing for assessment of ApoLl levels by sandwich ELISA to determine if ApoLl is being depleted from the circulation. Rabbit polyclonal ApoLl is coated on the plate, blocked and incubated with mouse serum in the presence of detergent and detected with biotinylated rabbit polyclonal ApoLl to a non-competing epitope. Binding is detected with streptavidin-HRP and compared to recombinant ApoLl standards to determine relative serum levels.
• Ribi adjuvant was from Sigma (Cat# S6322), Complete Freund' Adjuvant and
• CFA/IFA Incomplete Freund's Adjuvant
• TLR Toll Like Receptor
• Invivogen (Cat#tlrl- 1826-1), R848 from Invivogen (Cat# tlrl-r848), Poly I:C from Invivogen (Cat# vac-pic) and monophosphoryl lipid A (MPL) from Sigma (Cat#L6895), ClonaCell-HY Medium B (Cat# 03802), Medium C (Cat# 03803), Medium D (Cat# 03804) and Medium E
• HTV hydrodynamic tail veil injection
• mice were immunized with either 10 or 50 ⁇ g/injection per mouse with recombinant human ApoLl GO (amino acids D61-L398) depending on the adjuvant.
• ApoLl GO amino acids D61-L398
• Ribi adjuvant Sigma
• TLR-cocktail adjuvant 10 ⁇ g CpG plus 10 ⁇ g poly I:C plus 20 ⁇ g R848 plus 50 ⁇ g MPL
• IP intraperitoneally
• SC subcutaneously
• BOT bottom of the tail
• CFA/IFA adjuvant 50 ⁇ g of antigen in 100 ⁇ adjuvant/mouse was injected intraperitoneally (IP) every two weeks for a total 7 boosts. Three days after the final pre-fusion injection, lymphocytes from mice spleens and lymph nodes were harvested.
• Isolated mouse lymphocytes were fused with PU-1 myeloma cells (American Type Culture Collection) by using the Cyto Pulse CEEF-50 apparatus (Cyto Pulse Sciences). After two washes with Cytofusion Medium C the isolated lymphocytes and PU-1 cells were mixed at a 1 : 1 ratio and then resuspended at 10 million cells/ml in Cytofusion Medium C. Electrofusion was performed according to the manufacturer's instructions. Fused cells were cultured in ClonaCell-HY Medium C overnight at 37°C in a 7% C0 2 incubator.
• ELISA assay was performed as follows. 96-well microtiter ELISA plates (Greiner, Germany) were coated with ApoLl GO, Gl or G2 at 1 ⁇ g/ml in 0.05 M carbonate buffer (pH 9.6) in a final volume of 100 ⁇ /well at 4°C overnight. After washing three times with wash buffer (0.05% Tween 20 in PBS, Sigma), plates were blocked with 200 ⁇ ELISA assay diluents containing BSA. 100 ⁇ of cultured supernatants or diluted purified mAbs were added and incubated for 1 hour at room temperature. The plates were washed three times and incubated with HRP conjugated goat anti-mouse IgG Fc for 1 hour.
• hybridoma supernatants were purified by Protein A affinity chromatography, then sterile-filtered (0.2 ⁇ pore size, Nalge Nunc International, NY, USA) and stored at 4°C in PBS. Binding of the purified mAbs to APOL1 was confirmed by ELISA prior to further testing in functional assays.
• the isotype of purified mAbs was determined by the mouse monoclonal antibody isotyping kit (Roche Diagnostics). Cell lines and constructs
• Full length APOLl protein can be subdivided into four domains (Fig. 14): the signal sequence, 1-27 aminoacids (aa), the Pore Forming Domain (PFD), 60-235 aa, the Membrane Addressing Domain (MAD), 240-303 aa, and the SRA-Interacting Domain (SRA-ID) 339-398aa (Fig. 14A). Since APOLl overexpression is often toxic, stable doxycycline-inducible APOLl expressing CHO cells were generated by viral infection. In order to mimic the physiologically secreted APOLl, CHO cells expressing and secreting either full length GO variant of APOLl (WT), or Gl variant of APOLl, or G2 variant of APOLl were generated.
• WT full length GO variant of APOLl
• Gl variant of APOLl G2 variant of APOLl
• GPI-anchored APOLl expressing cells were also generated ( Figure 14B) to ensure cell surface expression of the protein, albeit likely in a different conformation than native APOLl . Additionally, the GPI anchored constructs had the first 60 aa of APOLl (which are not present in other ApoL family members and are not essential for ApoLl activity) replaced with a gD (HSV glycoprotein D) epitope tag (and HSV signal sequence) to confirm expression and enable normalization of antibody binding.
• gD HSV glycoprotein D
• CHO cells expressing only one or two of the APOLl domains, attached to the cell surface by a GPI anchor, with a gD at the N-terminal, were also generated (Fig. 14C-E).
• APOLl constructs for the GO variant of APOLl WT, isoform a, NM 003661.3
• Gl variant of APOLl S342G, I384M
• G2 variant of APOLl ⁇ N388, Y389
• Non-GPI anchored and herpes simplex virus glycoprotein D anchor (gD)-tagged and GPI-anchored constructs were generated and subcloned into the doxycycline- inducible lentiviral expression plasmid plnducer20 using Gateway LRU recombination.
• Constructs were verified by DNA sequencing and used to generate Lentiviruses encoding full length or truncated ApoLl using the plnducer system.
• lentiviruses were inoculated onto CHO cells, cultured for 72 h and then selected using G418.
• Viral P24 protein in the culture medium was periodically estimated by ELISA until it was no longer detectable.
• Expression of ApoLl was induced with 5 ⁇ g/ml doxycycline for 48 h prior to experimental analysis. Flow cytometery
• FACS analysis was performed on cells expressing truncated versions of GO variant of APOLl .
• 12 were PFD-specific
• 1 was MAD-specific
• 5 were SRA-ID specific
• 1 was considered a confirmation-sensitive binder, i.e. it binds to a non-linear epitope.
• a trypanosome-based functional assay was generated based on the hypothesis that the mechanism of ApoLl mediated progression of kidney disease may be related to the ability of APOLl to lyse trypanosomes.
• Trypanosoma brucei brucei is a human serum sensitive species of trypanosome lysed by APOLl .
• the monoclonal anti-APOLl antibodies described herein were therefore screened for their ability to block the APOLl -mediated lysis of normal human serum (NHS). Blocking activity was measured in terms of cell viability in the presence of 1% NHS.
• the anti-ApoLl antibodies have a blocking activity ranging from 28% to 49% in this assay at a concentration of 1 ⁇ g/ml (Fig. 16).
• Trypanosome Assay was performed as described below. Trypanosoma brucei brucei (Lister 427 VSG 221) was obtained under the appropriate permit from ATCC and grown in Modified HMI-9 media (ATCC# PRA-383), passaging at least 3 times a week. Trypanosomes were never allowed to grow to full confluency to ensure they remained in the proliferative rather than stumpy form. For blocking assays approximately 0.5x10 5 Trypanosoma brucei brucei were incubated with 1% Normal Human serum (NHS) in the presence or absence of 1.0 ⁇ g/ml anti- ApoLl antibodies in a 96 well clear plate for 20 h at 37C.
• NHS Normal Human serum
• Apolipoprotein L a new human high density lipoprotein apolipoprotein expressed by the pancreas. Identification, cloning, characterization, and plasma distribution of apolipoprotein L. The Journal of biological chemistry 272, 25576-25582.
• MYH9 is associated with nondiabetic end-stage renal disease in African Americans. Nature genetics 40, 1185-1192.
• MYH9 is a major-effect risk gene for focal segmental glomerulosclerosis. Nature genetics 40, 1175-1184.
• Adriamycin nephropathy a model of focal segmental

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Engineering & Computer Science (AREA)
• Genetics & Genomics (AREA)
• General Health & Medical Sciences (AREA)
• Organic Chemistry (AREA)
• Zoology (AREA)
• Biomedical Technology (AREA)
• Veterinary Medicine (AREA)
• Molecular Biology (AREA)
• Biotechnology (AREA)
• Biophysics (AREA)
• Biochemistry (AREA)
• Immunology (AREA)
• Medicinal Chemistry (AREA)
• Animal Behavior & Ethology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• General Engineering & Computer Science (AREA)
• Environmental Sciences (AREA)
• Wood Science & Technology (AREA)
• Urology & Nephrology (AREA)
• Toxicology (AREA)
• Gastroenterology & Hepatology (AREA)
• Microbiology (AREA)
• Public Health (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Pathology (AREA)
• Physics & Mathematics (AREA)
• Epidemiology (AREA)
• Endocrinology (AREA)
• Diabetes (AREA)
• Plant Pathology (AREA)
• Rheumatology (AREA)
• Biodiversity & Conservation Biology (AREA)
• Animal Husbandry (AREA)
• Pharmacology & Pharmacy (AREA)
• Hematology (AREA)
• Mycology (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)

Priority Applications (5)

Applications Claiming Priority (2)

Related Child Applications (2)

Publications (1)

Family

ID=54695853

Family Applications (1)

Country Status (5)

Cited By (1)

Families Citing this family (1)

Citations (92)

Family Cites Families (2)

• 2015
  • 2015-11-10 EP EP19152929.6A patent/EP3552488A1/en not_active Withdrawn
  • 2015-11-10 WO PCT/US2015/059987 patent/WO2016077369A1/en not_active Ceased
  • 2015-11-10 JP JP2017525041A patent/JP2018500882A/ja active Pending
  • 2015-11-10 EP EP15798303.2A patent/EP3217787B1/en not_active Not-in-force
  • 2015-11-10 CN CN201580061115.4A patent/CN107105632A/zh active Pending
• 2017
  • 2017-05-10 US US15/591,669 patent/US20170339928A1/en not_active Abandoned

Patent Citations (98)

Non-Patent Citations (115)

Also Published As

Similar Documents

Legal Events