WO2016043414A1 - Atg7+/--ob/ob 형질을 나타내는 당뇨병 동물모델 및 이를 이용한 당뇨병 치료제의 스크리닝 방법 - Google Patents

Atg7+/--ob/ob 형질을 나타내는 당뇨병 동물모델 및 이를 이용한 당뇨병 치료제의 스크리닝 방법 Download PDF

Info

Publication number
WO2016043414A1
WO2016043414A1 PCT/KR2015/007079 KR2015007079W WO2016043414A1 WO 2016043414 A1 WO2016043414 A1 WO 2016043414A1 KR 2015007079 W KR2015007079 W KR 2015007079W WO 2016043414 A1 WO2016043414 A1 WO 2016043414A1
Authority
WO
WIPO (PCT)
Prior art keywords
atg7
mice
diabetes
animal
autophagy
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2015/007079
Other languages
English (en)
French (fr)
Inventor
이명식
임유미
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Samsung Life Public Welfare Foundation
Original Assignee
Samsung Life Public Welfare Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020150061829A external-priority patent/KR101744158B1/ko
Application filed by Samsung Life Public Welfare Foundation filed Critical Samsung Life Public Welfare Foundation
Publication of WO2016043414A1 publication Critical patent/WO2016043414A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027New or modified breeds of vertebrates
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing

Definitions

  • the present invention relates to a diabetic animal model showing Atg7 +/- -ob / ob trait and a method for screening a diabetic therapeutic agent using the same.
  • Type 2 diabetes is the result of a combination of insulin resistance and relative insulin deficiency.
  • Autophagy is a series of sequestered cytoplasmic wastes, endogenous or denatured organelles that are degraded by biphasic autophagosomes in cells, which are combined with lysosomes and degraded by digestive enzymes in the lysosomes. It is a process. Downstream (lower) molecules of insulin such as insulin and mTOR are well known as inhibitors of autophagy 1 .
  • Self predators are important in controlling the quality of organelles such as mitochondria and decisive ER (endoplasmic reticulum) on the survival / function and insulin sensitivity of the cells within the cell energy homeostasis and ⁇ - 2-4.
  • autophagy plays an important role in metabolism by regulating hormonal action and organelle function, and diabetes can occur when autophagy is impaired.
  • diabetes can occur when autophagy is impaired.
  • the thesis that a particular organization only Self and things been studied in organisms is not at all a predatory expression and worse and articles 7, 9, diabetes and that metabolism is improved in accordance with each organization 8 is reported.
  • a predator who is not expressed in the whole organization did not go because he died before you were born a broad study of the self-predator role in diabetes and metabolism 12-14. Therefore, in this paper, the autophagy genes were developed using mice in which only 50% of all tissues were expressed.
  • the present inventors have constructed a diabetic animal model that exhibits Atg7 +/- -ob / ob traits by crossing Atg7 +/- animals and ob / w animals, screening for the treatment of diabetes by using them, and treating diabetes treatment.
  • the efficacy can be analyzed, the present invention has been completed.
  • Another object of the present invention is to provide a method for analyzing the therapeutic efficacy of a diabetes therapeutic agent.
  • the present invention provides a method for screening a therapeutic agent for diabetes comprising the following steps:
  • the present invention provides a method for analyzing the therapeutic efficacy of a diabetes therapeutic agent comprising the following steps:
  • the present inventors have constructed a diabetic animal model that exhibits Atg7 +/- -ob / ob traits by crossing Atg7 +/- animals and ob / w animals, screening for the treatment of diabetes by using them, and treating diabetes treatment. It was found that the efficacy can be analyzed.
  • metabolic abnormalities were not found in mice whose major autophagy genes, Atg7, were haploinsufficienty ( atg7 +/- mice), whereas Atg7 +/- mice were compared with ob / ob mice.
  • Atg7 +/- mice were haploinsufficienty
  • Atg7 +/- mice were compared with ob / ob mice.
  • autophagy enhancers are administered to Atg7 +/- -ob / ob mice
  • autophagy is a major factor involved in the progression of obesity to diabetes by confirming that autophagy is increased and metabolic response is improved. It was confirmed that autophagy modulators can be used as a therapeutic agent for diabetes associated with obesity and inflammatory response.
  • Animals used in the screening method and the therapeutic efficacy analysis method of the diabetes therapeutic agent of the present invention is an Atg7 +/- animal and an Atg7 +/- -ob obtained by crossing the Atg7 +/- animal with the same ob / w animal. Animals other than humans exhibiting / ob traits.
  • the animal used in the invention is a mammal, more preferably said mammal is a mouse, rat, pig or monkey, most preferably a mouse.
  • an animal for use in the present invention showing the mouse Atg7 +/- -ob / ob plasma is Atg7 F / F to the crossing (Atg7-floxed mice) and CMV- Cre mice homozygous Atg7 Mice with deleted germ cells ( At7 +/- mice) are produced, and then Atg7 +/- mice and ob / w mice are selected by crossing.
  • mice exhibiting the Atg7 +/- -ob / ob trait is confirmed by PCR genotyping by extracting genomic DNA from the tail tissue of the mouse.
  • mice showing Atg7 +/- -ob / ob traits produced in the same manner showed significantly increased blood glucose levels compared to Atg7 + / + -ob / ob mice, which deteriorated insulin resistance and increased triglyceride levels in the liver. Diabetes was observed as glucose metabolism abnormalities occurred, such as increased serum ALT / AST and increased inflammatory response.
  • Animals exhibiting the Atg7 +/- -ob / ob trait of the present invention exhibit glycemic aberrations and thus can study the mechanisms for diabetes, particularly diabetes associated with obesity and inflammatory responses and the mechanism of progression from diabetes to diabetes. It can be usefully used as a model animal.
  • test substance refers to an unknown substance used in screening to test whether to inhibit activity leading to diabetes.
  • the test substance of step (a) may be a peptide, a protein, a non-peptidic compound, a synthetic compound, a fermentation product, a cell extract, a plant extract, an animal tissue extract or a plasma, and the compound is a novel compound.
  • a well-known compound preferably obtained from a library of synthetic or natural compounds. Methods of obtaining libraries of such compounds are known in the art. Synthetic compound libraries are commercially available from Maybridge Chemical Co. (UK), Comgenex (USA), Brandon Associates (USA), Microsource (USA), and Sigma-Aldrich (USA), and libraries of natural compounds are available from Pan Laboratories (USA). ) And MycoSearch (USA).
  • Samples can be obtained by a variety of combinatorial library methods known in the art, for example biological libraries, spatially addressable parallel solid phase or solution phase libraries, deconvolution required By a synthetic library method, a “1-bead 1-compound” library method, and a synthetic library method using affinity chromatography screening.
  • Methods of synthesizing molecular libraries are described in DeWitt et al., Proc . Natl. Acad . Sci . USA . 90, 6909, 1993; Erb et al. Proc . Natl . Acad . Sci . USA . 91, 11422, 1994; Zuckermann et al., J. Med . Chem .
  • the test substance may form a salt.
  • Salts of the test substance include salts such as physiologically acceptable acids (eg, inorganic acids) and bases (eg, organic acids, etc.), and physiologically acceptable acid addition salts are preferred, but are not limited thereto.
  • Such salts include, for example, salts of inorganic acids (e.g. hydrochloric acid, phosphoric acid, hydrobromic acid or sulfuric acid) or organic acids (e.g. acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid, tartaric acid, citric acid). Salts of malic acid, oxalic acid, benzoic acid, methanesulfonic acid or benzenesulfonic acid, and the like.
  • inorganic acids e.g. hydrochloric acid, phosphoric acid, hydrobromic acid or sulfuric acid
  • organic acids e.g. acetic acid, formic acid, propionic acid, fumaric acid, maleic
  • oral administration intravenous injection, swabbing, subcutaneous administration, intradermal administration or intraperitoneal administration may be used, but is not limited thereto. I can choose it suitably.
  • the dosage of the test substance may be appropriately selected according to the administration method, the nature of the test substance, and the like.
  • the test substance may be administered to tissues, organs or cells of the animal.
  • tissue or organ the thing extracted from the animal which shows Atg7 +/- -ob / ob trait is included.
  • cells blood cells, liver cells, fat cells and the like can be exemplified, but are not limited thereto.
  • the test substance When the test substance is to be administered to the isolated cells of a part of the animal showing Atg7 +/- -ob / ob trait of the present invention, the test substance may be administered to the culture medium of the cells.
  • the test substance is a protein
  • a vector containing DNA encoding the protein may be introduced into cells isolated from the animal.
  • the hematological or histological indicator value correlated with diabetes or glucose metabolic abnormalities is selected from the group consisting of blood diabetes related components, insulin resistance, blood glucose level and blood insulin level It is preferably at least one, and the blood-related diabetes component is preferably any one selected from the group consisting of triglycerides, cholesterol, free fatty acids, ALT, AST, HDL and LDL, but is not limited thereto.
  • screening drugs for diabetics can be screened by selecting a substance having an effect on the indicator. Analyze the therapeutic efficacy of the diabetes treatment.
  • test substance when the test substance significantly changes the hematological or histological indicator value normally, it is determined that the test substance is a diabetes treatment.
  • test substance when the test substance inhibits an increase in blood related components, deterioration of insulin resistance, an increase in blood glucose level and an increase in blood insulin level compared to an animal model in which the test substance is not administered
  • the substance is considered a diabetes treatment.
  • Diabetes therapeutic agents screened in the above manner can be very useful for preventing and treating diabetes in diabetes, particularly in obese patients.
  • the present invention provides a diabetic animal model, characterized in that the animal except humans exhibiting Atg7 + /--ob / ob trait.
  • the diabetic animal model of the present invention is an animal model used in the above-described method, the common content between the two is omitted in order to avoid excessive complexity of the specification according to the repetitive description.
  • the present invention provides a diabetic animal model, a method for screening a diabetes treatment using the model and a method for analyzing the efficacy of the diabetes treatment.
  • the animal model of the present invention has various glycemic abnormalities such as an increase in blood-related diabetes components, an increase in blood glucose levels, worsening insulin resistance, an increase in triglycerides in the liver, an increase in serum ALT / AST, an increase in fatty liver accumulation, and an increase in inflammatory response. It is an animal model that presents symptoms and is suitable for understanding the progression from obesity to diabetes and for screening treatments for diabetes.
  • the animal model of the present invention can be effectively used for the study of progression from obesity to diabetes, and for the development of therapeutics for diabetes associated with obesity and inflammatory response.
  • Atg7 +/- mice were prepared as described in the experimental method and subjected to PCR using primers for the genomic DNA and the phloxed Atg7 region. Also in Atg7 +/- mouse arrow indicates the wild-type band Atg7, Atg7 F / + mouse, the PCR size increases, so Phlox sequence is inserted, and the Atg7 +/- mouse PCR size by Cre- mediated defect reduction.
  • RT-PCR left and real-time RT-PCR (right), extracting total RNA from tissue of Atg7 +/- or control Atg7 + / + mice and using primers specific for Atg7 or ⁇ -actin sequences Conducts.
  • IPGTT will be conducted at 12 weeks of age.
  • Body weight is measured between 5 and 30 weeks of age.
  • Figure 3 shows the results of analyzing the deterioration of metabolic profile of ob / ob mice with autophagy haemostasis.
  • Atg7 + / + -ob / w, Atg7 +/- -ob / w, Atg7 + / + -ob / ob and Atg7 7 minutes after injecting 5 U kg-1 regular insulin (Ins) into the tail vein Tissues were obtained from +/- -ob / ob mice.
  • Each mouse tissue lysate was prepared and subjected to immunoblot analysis using antibodies specific for phospho-Akt S473 and Akt. Numbers below the immunoblot bands represent magnification changes normalized to the control bands.
  • Body weight is measured between 5 and 30 weeks of age.
  • IGI insulinogenic index
  • K ITT is calculated using 12-week-old ITT data. *** P ⁇ 0.001; One-way ANOVA.
  • Tissue lysates were prepared from 18-week-old mice of each genotype and subjected to immunoblot analysis using a kit for detecting carbonylated proteins.
  • Figure 6 is the result of measuring the oxidative stress in Atg7 + /--ob / ob mouse tissue.
  • Tissue lysates were prepared from liver of fasting ob / w or ob / ob mice 4 hours after leupeptin administration and immunoblotting. Numbers below the immunoblot bands represent magnification changes normalized to the control bands.
  • Atg7 Adenovirus expressing siRNA or control siRNA (Con) (MOI 50) was infected with SK-Hep1 or Hepa1c1c7 cells after 72 hours, atg7 against total RNA. Expression ( mAtg7 , murine Atg7 ; hAtg7 , human Atg7 ) was analyzed by RT-PCR.
  • Figure 10 shows the results of analyzing the immune response in Atg7 + /--ob / ob mouse tissue.
  • (b) be conducted by RT-PCR using primers specific to separate from the total mRNA of each tissue to produce a cDNA Tnf ⁇ , Il6, F4 / 80 or pro- Il1b.
  • FIG. 12 shows the results of analyzing biochemical properties after high fat diet (HFD) was provided to Atg7 +/- mice.
  • Atg7 +/- and control Atg7 + / + mice were given HFD or normal diet (NCD) and non-fasting blood glucose levels were monitored. * P ⁇ 0.05, ** P ⁇ 0.01;Student's t-test.
  • IPGTT was performed 18 weeks after the HFD equation (left) and the AUC was calculated (right). * P ⁇ 0.05; Student ’s t-test (left) and one-way ANOVA (right).
  • Figure 13 shows the results of analyzing the metabolic profile of the high-fat diet Atg7 + / -mouse .
  • Figure 14 shows the results of analyzing the effect of autophagy enhancers on the metabolic profile of Atg7 +/- mice.
  • AUC and K ITT are calculated after treatment with imatinib or trehalose in Atg7 +/- -ob / ob mice for 8 weeks. * P ⁇ 0.05, ** P ⁇ 0.01, *** P ⁇ 0.001; One-way ANOVA.
  • Atg7 + / + -ob / ob mice were treated with Ima for 8 weeks, followed by IPGTT (j) and ITT (k). ** P ⁇ 0.01; Student ' t -test. Numbers below immunoblot bands indicate magnification changes for normalized control bands.
  • IPGTT (c) and ITT (d) were performed after administration of imatinib or trehalose for 8 weeks in Atg7 +/- -ob / ob mice.
  • #P ⁇ 0.05;## P or ** P ⁇ 0.01;### P or *** P ⁇ 0.001;Student's t-test.
  • Tissue lysates were prepared from the same mice not injected with insulin and subjected to immunoblotting. Numbers below the immunoblot bands represent magnification changes normalized to the control bands. ('*' Indicates comparison of imatinib and control: '#' indicates comparison of trehalose and control).
  • FIG. 16 shows the results of measuring FGF21 levels in tissues and serum of Atg7 +/ ⁇ mice.
  • Figure 17 is a schematic diagram showing the developmental path of diabetes in autophagy obese mice.
  • lipid overload increases lipid accumulation due to incomplete lipolysis .
  • Autophagy insufficiency causes retardation of mitochondrial circulation and mitochondrial dysfunction, and inflammatory control complexes are activated by lipids that activate inflammatory control complexes.
  • the combined effect and interaction of increased lipids with activated inflammatory regulatory complexes exacerbate insulin resistance and diabetes.
  • Atg7 F / F Atg7-floxed mice
  • CMV-Cre 'deleter' mice Jackson Laboratory
  • mice showing hemizygous deletion for Atg7 were selected and crossed with C57BL / 6 mice to make mice without CMV-Cre sequence and with homozygous Atg7 deleted germ cells.
  • Atg7 +/- -ob / ob mice were crossed Atg7 +/- mice and ob / w mice (Jackson Laboratory).
  • Mouse genotyping was performed through PCR analysis of the tail DNA 6 .
  • Atg7 +/- and Atg7 + / + mice were given a high-fat diet (HFD) from 5 weeks to 21 weeks of age. Liver, muscle and epididymal adipose tissues were isolated 7 min after injection of 5 U kg -1 regular insulin into the tail vein to examine in vivo insulin signaling by western blotting 20 . Imatinib (provided by Dr. Buchdunger of Novartis Pharma) or trehalose (Sigma) was administered to mice by modifying a known protocol 20 .
  • HFD high-fat diet
  • IPGTT was performed by intraperitoneal injection of 1 g kg ⁇ 1 glucose 20 .
  • HOMA-IR was calculated according to the following formula 21 : [(fasting insulin ⁇ fasting glucose) /22.5]. Measured using ACCU-CHEK glucometer (Roche) before (0 min) glucose injection, 15, 30, 60, 120 and 180 min post injection. Serum insulin concentrations were measured using an ELISA kit (Shibayagi). Insulinogenic index (IGI) was calculated as follows: ⁇ insulin 15 minutes (pM) / ⁇ glucose 15 minutes (mM).
  • ITT insulin sensitivity index
  • GFP- LC3 + -Atg 7 +/- mice were made to cross GFP- LC3 + mice (provided by Dr. Mizushima University of Tokyo) with Atg 7 +/- mice to measure in vivo autophagy levels.
  • the GFP -LC3 + mice and ob / w were bred to make GFP -LC3 + -ob / ob.
  • GFP spots were identified by fluorescence microscopy 17 .
  • autophagic flux was assessed by administering 30 mg kg ⁇ 1 leupeptin to the mice and analyzing LC3 conversion in the liver 4 hours 19 .
  • GFP cleavage in GFP-LC3 + mouse tissues representing the lysosomal stage of autophagy was confirmed by immunoblot analysis using anti-GFP antibody (Santa Cruz Biotechnology sc-9996, 1: 1,000 dilution).
  • SK-Hep1 and Hepa1c1c7 cells were cultured using DMEM additionally containing 10% fetal calf serum (FCS) and penicillin-streptomycin (Lonza).
  • MEFs were obtained from 13.5 day-old embryos. Cells were treated with PA and OA for 24-48 hours and the amount of intracellular TG was measured. Lipids were treated for 24 hours to detect insulin signaling, followed by immunoblot analysis by treating 100 nM insulin with cells for 10 minutes.
  • Hepatocytes were isolated from C57BL / 6 mice using the retrograde two-step collagenase perfusion technique 61 .
  • liver perfusion buffer (Gibco # 17701), followed by a secondary buffer (66.7 mM NaCl, 6.7 mM KCl) containing 700 mg l- 1 collagenase (Sigma C5138). , 4.8 mM CaCl 2 and 0.1 M HEPES, pH 7.6) for 6 minutes at a rate of 5 ml / min. Then, hepatocytes were obtained by penetrating the liver with a filter gauge and then centrifuging Percoll gradient.
  • Peritoneal macrophages were isolated from Atg7 + / + and Atg7 +/ ⁇ mice using 3.85% thioglycolate medium and treated with or without 500 ng ml ⁇ 1 LPS (Sigma). After 24 hours, the amount of IL-1 ⁇ in the culture supernatant was measured using a mouse ELISA kit (R & D Systems).
  • Serum ALT / AST, TG and total cholesterol levels were measured using a blood chemistry analyzer 20 .
  • Serum FFA was measured using LabAssay NEFA kit (Wako).
  • Atg7 siRNA was cloned into the pAd-Track transfer vector. Homologous recombination was performed by transfecting pre-modified pluripotent pAdEasy-AD-293 cells with a linear recombinant pAd-Track comprising Atg7 shRNA oligonucleotides regulated by a mouse U6 promoter with an adenovirus gene carrier vector 62 . Atg7 shRNA oligonucleotides targeted the common sequence and murine Atg7 (5'-TGGCTGCTACTTCTGCAATGA-3 ') for humans. Adenovirus was amplified in 293AD cells and isolated via CsCl density gradient centrifugation. Cells were infected with adenovirus expressing Atg7 or control siRNA at moi (multiplicity of infection) 50.
  • Tissue lysates were isolated on 8-15% SDS-PAGE, then transferred to Hybond ECL nitrocellulose membrane (Amersham), anti-JNK (# 9252), -phospho-JNK Thr183 / Tyr185 (# 9251), -IRS- 1 (# 2382), -Akt (# 9272), -phospho-Akt S473 (# 9271) (Cell Signaling, 1: 1,000 Dilution), -phospho-IRS-1 Ser307 (Upstate Biotechnology # 07-247, 1: 1,000 Dilution), -LC3 (Novus NB100-2331, 1: 1,000 dilution), -p62 (Progen GP62-C, 1: 1,000 dilution), -nitrotyrosine (Millipore # 06-284, 1: 1,000 dilution), -p53 (Calbiochem # OP03, 1: 1,000 dilution), -phospho p53 (Cell Signaling # 9284, 1: 1,000 dilution), -IL-1
  • Detection of nitrate proteins that affect ROS damage of proteins in vivo was performed by immunohistochemistry using anti-nitrotyrosine antibodies 63 . Carbonylated protein was detected through immunoblot analysis using Kit (Millipore). To detect in vivo ROS, frozen tissue sections were immersed in 10 mM DHE solution (Invitrogen) and incubated at 37 ° C. for 30 minutes 64 . After washing with PBS, sections were observed under a fluorescence microscope. To measure SA- ⁇ -gal activity, the tissues were placed in a staining solution containing 1 mg ml -1 of X-gal dissolved in 5 mM K-ferrocyanide and N, N-dimethylformamide and incubated overnight at 37 ° C. 65 . The tissue was then observed by light microscopy.
  • Formalin fixed cells or tissue sections were stained with 3 mg ml -1 ORO solution for 30 minutes, then the dye was removed with isopropanol and measured at A 540 .
  • Lipids were isolated from homogenized tissue using a chloroform / methanol mixture (2: 1) to determine the TG amount. After evaporation, the fat was dissolved in 100% ethanol in 1% Triton X-100 dissolved and mixed with preglycerol reagent (Sigma) containing lipase. After incubation at 37 ° C. for 5 min, A 540 was measured and TG concentration was calculated using a standard curve 61 .
  • Visceral adipose tissue was cut into small pieces of 2 mm or less to separate SVF. Soaked in 2 mg ml -1 collagenase solution (collagenase type 2, Worthington) and incubated for 45 minutes in a 37 °C water bath, then the cut tissue was centrifuged at 1,000 g for 8 minutes. The suspended pellets were passed through a 70- ⁇ m mesh, followed by RBC lysis, and SVF was added to 100 mM NaCl, 10 mM TrisCl, pH 7.6, 1 mM EDTA, 1% NP-40, 1 mM PMSF for immunoblotting. , 1 mM NaF, 1 mM Na 3 VO 4 and a protease inhibitor (Roche) were suspended in a buffer 66 .
  • Degradation of long-lived proteins was measured by modifying a method 45 known in the art. Briefly, cells were plated on collagen coated plates and incubated for 24 hours. Cells were then labeled with 0.5 ⁇ Ci ml ⁇ 1 C 14 -leucine (Perkin Elmer) for 16 hours. 2 hours of incubation with medium replacement with medium that degrades short-lived proteins, 2 mM of unlabeled leucine and with or without 10 ⁇ g ml ⁇ 1 and 20 mM NH 4 Cl for each of E64d / pepstatin A and The cells were incubated at 37 ° C. for 3-6 hours after replacement with serum-free medium containing lipids (PA or OA).
  • PA or OA serum-free medium containing lipids
  • Lysosomal protein degradation was defined as protein decomposition rate differences under E64d / pepstatin A / NH 4 Cl member under protein decomposition rate and E64d / pepstatin A / NH 4 Cl present.
  • Insulin immunohistochemical staining was performed on three or more parallel pancreatic sections of different sites, and counted after morphology analysis to measure ⁇ -cell amount 6 .
  • Killed cells were detected in vivo by staining deparaffinized sections with TUNEL reagent (Roche Applied Science) and diaminobenzidine (Invitrogen) as color substrate 67 .
  • Macrophage aggregates consist of up to 15 macrophages stained with F4 / 80 antibody (Abcam) and surround each adipocyte. This set of macrophages was considered CLS and the number of CLS per 100 adipocytes was counted 68 .
  • Serum FGF21 levels were measured using a mouse FGF21 ELISA kit (R & D Systems). FGF21 expression in insulin target tissues was measured via RT-PCR using specific primers 11 .
  • NAD + / NADH ratios were measured using the measurement kit (BioVision) according to the manufacturer's instructions.
  • Peritoneal macrophages were stained for 25 minutes at 37 ° C. with 1 mM of mitotracker green and mitotracker red (Invitrogen) to measure mitochondrial potential. Stained cells were suspended in PBS containing 1% FCS and measured by FACSVerse (BD Biosciences), and data were analyzed using FlowJo software (TreeStar). In order to measure the amount of mitochondrial ROS, cells were incubated at 37 ° C. for 5 minutes with 5 mM MitoSOX (Invitrogen), and flow cytometry was performed by the above-described method.
  • Atg7 F / F (Atg7-floxed mice) and CMV- Cre mice were crossed to produce mice with homozygous Atg7 deleted germ cells ( At7 +/ ⁇ mice). Atg7 +/ ⁇ mice are difficult to distinguish from Atg7 + / + mouse litters.
  • PCR with tail DNA showed deletion of a copy of the floxed Atg7 sequence 1 in Atg7 +/ ⁇ mice (FIG. 1A).
  • RT-PCR and real-time RT-PCR results showed that Atg7 mRNA expression was significantly lower in liver, muscle and white adipose tissue (WAT) of Atg7 +/ ⁇ mice compared to Atg7 + / + mice (FIG. 1B).
  • LC3-I to -II conversion 15 was lower in the tissues of Atg7 +/ ⁇ mice compared to fasting Atg7 + / + mice (FIG. 1C).
  • level 16 of p62 a specific substrate of autophagy, was increased in tissues of Atg7 +/ ⁇ mice compared to fasting Atg7 + / + mice (FIG. 1C), and these results were compared to Atg7 + / + mice. This means that the autophagic flux is reduced.
  • Atg7 +/- MEF mouse embryonic fibroblasts
  • the p62 level in Atg7 +/ ⁇ MEF was also shown to be the median level of Atg7 + / + and Atg7 ⁇ / ⁇ MEF (FIG. 1D).
  • Atg7 +/- mice were self-crossed, transgenic mice (-LC3 GFP + mice) expressing GFP -LC3 Atg7 +/- mice and to determine a decrease in phagocytic 17.
  • the number of self-GFP -LC3 spots indicating predation body is -LC3 GFP + - significantly less in the tissue of Atg7 +/- mice (Fig. 1e) - GFP -LC3 + Atg7 as compared to + / + mice.
  • the "clamp" the woman was treated with leupeptin predators process and measures a predation flux 18,19.
  • Flow LC3-II levels in the liver of treated peptin fasting Atg7 +/- mice was lower compared to the Atg7 + / + mice (FIG. 1f), which in Atg7 +/- tissue as compared to Atg7 + / + tissue The autophagy flux is reduced.
  • Atg7 +/- mice were found to have moderate autophagy levels and activity, and then the metabolic profiles of these mice were examined. Unfastened blood glucose levels did not differ between Atg7 +/ ⁇ and Atg7 + / + mice by 8 months of age (FIG. 2A). Intraperitoneal glucose tolerance test (IPGTT) was not different between the two groups (FIG. 2B). There was no difference in blood chemistry and body weight (FIG. 2C-G). To determine whether autophagy haploinsufficiency adapts to metabolic overload without affecting basal metabolism, Atg7 +/ ⁇ mice were crossed with ob / w mice to produce Atg7 +/ ⁇ ⁇ ob / ob mice.
  • IPGTT Intraperitoneal glucose tolerance test
  • Atg7 +/ ⁇ ⁇ ob / ob mice were significantly increased compared to Atg7 + / + ⁇ ob / ob mice to reach the diabetic range (FIG. 3A).
  • IPGTT showed severe glucose intolerance with significantly increased area under the curve (AUC) in Atg7 +/- -ob / ob mice compared to Atg7 + / + -ob / ob mice. Appeared (FIG. 3B).
  • the weights of Atg7 +/- -ob / ob mice and Atg7 + / + -ob / ob mice were not statistically significant (FIG.
  • Atg7 + / + -ob / w and Atg7 +/- -ob / w mice were not different from Atg7 + / + and Atg7 +/- mice, respectively ( Figure 2ag).
  • Atg7 + / + and +/- mice instead Atg7 Atg7 + / + -ob / w and tg7 +/- -ob / w mice were conducted a follow-up experiment. Next, diabetic mechanisms were examined in Atg7 +/- -ob / ob mice.
  • Insulinogenic index (IGI) 20 which represents insulin secretion from pancreatic ⁇ -cells in response to increased glucose levels, was significantly higher in Atg7 +/- -ob / ob mice compared to Atg7 + / + -ob / ob mice ( 3b), which means that ⁇ -cell failure is not the primary cause of diabetes.
  • ⁇ -cell structure and amount of Atg7 +/- -ob / ob and Atg7 +/- -ob / w mice were not different from Atg7 + / + -ob / ob and Atg7 + / + -ob / w mice, respectively (Fig. 4c, d).
  • HOMA-IR insulin resistance index
  • Insulin sensitivity index K ITT was further reduced in Atg7 +/- -ob / ob mice compared to Atg7 + / + -ob / ob mice and showed decreased K ITT values compared to non-diabetic mice (FIG. 4E). .
  • In vivo insulin signaling was examined to confirm aggravated insulin resistance in Atg7 +/- -ob / ob mice.
  • p53 phosphorylation and its downstream of p21 expression was found to be Atg7 + / + -ob / ob or Atg7 +/- compared with -ob / w +/- mouse Atg7 -ob / ob further increase in mouse tissues (Fig. 5d).
  • the aging-like phenotype index reflecting ROS damage, SA- ⁇ -gal activity 27 , 29 was more pronounced in WAT in Atg7 +/- -ob / ob mice compared to the modest increase in Atg7 + / + -ob / ob mice. Markedly increased (FIG. 6B).
  • Triglyceride levels in Atg7 +/- -ob / w mice were measured by ORO (Oil Red O) staining and lipid extraction or biochemical methods, and the results were significantly different from those in Atg7 + / + -ob / w mice. None (FIGS. 7A-B). However, the amount of TG between Atg7 +/- -ob / ob mice was significantly higher compared to Atg7 + / + ob / ob mice ( Figures 7a-b), which was insufficient 'lipids in Atg7 +/- -ob / ob mice.
  • GFP- LC3 + -ob / ob mice were constructed to investigate the relationship between obesity and autophagy. LC3 spots were rarely found in GFP -LC3 + -ob / w mice, while well observed in GFP -LC3 + -ob / ob mouse tissues (FIG. 8A). LC3 spot number was significantly increased in GFP- LC3 + -ob / ob mouse tissues compared to GFP -LC3 + -ob / w mice (FIG. 8A), indicating an increase in autophagy levels in obese mice.
  • LC3 conversion after autophagy 'clamping' at the lysosomal stage by in vivo leupeptin administration was investigated 19 .
  • LC3 conversion was increased in liver of ob / ob mice treated with leupeptin (FIG. 8D), indicating that increased autophagy levels in ob / ob mouse tissue are due to increased autophagy flux.
  • p62 levels in ob / ob mice liver were increased compared to ob / w mice under leupeptin treatment conditions (FIG. 8D), which is inconsistent with the increase in autophagy activity 15 .
  • proteolytic assays showing final degradation of autophagy protein substrates were performed using SK-Hep1 cells 15 .
  • Lysosomal degradation of longevity proteins is markedly inhibited by palmitic acid (PA) or oleic acid (OA) (FIG. 8E), which is increased by lipids whose autophagy activity enables intracellular lipid processing, but proteolysis In spite of increased predation activity, this means a reduction in autophagy organ sequestration for 'lipid lysis'. In addition, this result means that lipid overload increases the need for autophagy that is not met in Atg7 +/- -ob / ob mice.
  • insulin resistance by PA and OA mixtures was exacerbated by adenovirus expression in lipid-loaded cells compared to control siRNA expression (FIG. 9C), with autophagy insufficiency with lipid overload resulting in increased lipid accumulation and insulin resistance. It means to cause.
  • 11ac show expression of inflammatory cytokines such as Tnf ⁇ or Il6 , F4 / 80 showing macrophage infiltration compared to Atg7 + / + -ob / ob mice Increased in Atg7 +/- -ob / ob mouse tissue.
  • inflammatory cytokines such as Tnf ⁇ or Il6 , F4 / 80 showing macrophage infiltration compared to Atg7 + / + -ob / ob mice Increased in Atg7 +/- -ob / ob mouse tissue.
  • RT-PCR Fig. 5b
  • Fig. 11d real-time RT-PCR results, pro- Il1b expression Atg7 + / + -ob / w as compared to the mouse Atg7 + / + -ob / ob mouse WAT of the SVF (stromal vascular fraction).
  • Atg7 +/- -ob / ob mouse in the tissue pro- Il1b expression was not increased as compared with Atg7 + / + -ob / ob mice (Fig. 10b and 11d).
  • the antibody -IL-1 ⁇ to mature IL-1 ⁇ in a pro-IL-1 ⁇ by measuring the immune blotting using compares and Atg7 + / + -ob / ob mouse Atg7 +/- -ob / ob mice There was a marked increase in SVF (FIG. 10C).
  • the mitochondrial ROS amount measured by MitoSox staining was less effective when LPS alone treatment, but the mitochondrial ROS amount was significantly increased when PA and LPS were treated together in wild-type macrophages (Fig. 10g).
  • Increasing mitochondrial ROS levels by simultaneous treatment with PA and LPS resulted in larger Atg7 +/- macrophages (FIG. 10g), suggesting that autophagy failure increased mitochondrial ROS production and inflammatory regulatory complex activation by lipid damage. 33 , 38 .
  • Flow cytometry after staining with mitotracker green and mitotracker red resulted in a decrease in the fraction of cells stained by mitotracker red after PA and LPS treatment, thus reducing mitochondrial translocation, compared to control macrophages.
  • the fraction of cells stained with mitotracker red in Atg7 +/ ⁇ macrophages was increased (FIG. 10H). This means that the increased inflammatory regulatory complex activation observed in Atg7 +/- macrophages plays an important role in mitochondrial
  • the ob / ob mice lacked all of leptin signaling and provided a high-fat diet (HFD) to impose more severe physiological metabolic stress.
  • HFD high-fat diet
  • Atg7 +/- provided by the 21 weeks HFD - mouse is a Atg7 + / + HFD provides - compared to the mice showed the non-fasting blood glucose level high (Fig. 12a).
  • Two-way ANOVA showed no significant difference in the blood glucose profiles of Atg7 +/- and Atg7 + / + mice over the entire period of HFD presentation , whereas in each t-test, between 16-18 weeks of HFD presentation.
  • the fasting blood glucose levels of Atg7 +/- mice were significantly increased (FIG. 12A).
  • HFD diet after 18 weeks in the fasting blood glucose level Atg7 +/- mice were significantly increased as compared to the Atg7 + / + mice (FIG. 12b). HFD diet were impaired glucose tolerance is significantly deteriorated in Atg7 +/- mice as compared to Atg7 + / + mouse showing the results, the increased AUC subjected to IPGTT after 18 weeks (Fig. 12c). In addition, HOMA-IR index representing insulin resistance was increased from Atg7 +/- mice as compared to Atg7 + / + mice ( Figure 12d).
  • ITT was performed in Atg7 +/ ⁇ mice after 18 weeks of HFD diet, showing a decreased K ITT value compared to HFD-diet Atg7 + / + mice, indicating a decrease in insulin sensitivity (FIG. 12E).
  • Body weight did not differ between Atg7 +/ ⁇ and Atg7 + / + mice in either normal or HFD diets (FIG. 13A).
  • IGI was increased in Atg7 +/ ⁇ mice compared to Atg7 + / + mice, indicating a change in ⁇ -cells with increased insulin resistance (FIG. 13B).
  • HFD diet were 18-21 weeks of the results of measuring the amount of liver TG through the ORO stain, Atg7 + / + mice as compared to the significant increase in serum FFA and ALT / AST levels in Atg7 +/- mice ( Figure 13ce).
  • FIG. 15C, d which are associated with decreased AUC and increased K ITT values, respectively.
  • FIG. 14E Liver TG amount and serum ALT / AST levels were markedly decreased by administration of imatinib to Atg7 +/- -ob / ob mice (FIG. 14F, g).
  • Akt S473 phosphorylation induced by insulin in liver and muscle is markedly enhanced by imatinib, which means that imatinib improves glucose profile by enhancing insulin sensitivity (FIG. 15E).
  • JNK and IRS-1 S307 phosphorylation is reduced by imatinib in the liver and muscle (FIG. 15F).
  • imatinib improves the metabolic profile of Atg7 + / + ⁇ ob / ob mice and enhances glucose tolerance and insulin sensitivity in IPGTT and ITT without weight change (FIG. 14H-K). This is similar to previous studies with db / db mice, meaning that the effects of imatinib are not limited to genetic autophagy-deficient mice.
  • Atg7 +/- -ob / ob improve the metabolic profile in mice by administration of trehalose was converted into the LC3 -II in-I appeared after the administration of leupeptin to Atg7 +/- -ob / ob mice treated with 8 weeks trehalose It is accompanied by an increase in in vivo autophagy fluxes demonstrated by increase (FIG. 14C). Liver TG amount and serum ASL / ALT levels in Atg7 +/ ⁇ ⁇ ob / ob mice were markedly reduced by 8 weeks of trehalose administration (FIG. 14F, g).

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Hematology (AREA)
  • Environmental Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Urology & Nephrology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Food Science & Technology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Microbiology (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Zoology (AREA)
  • Animal Husbandry (AREA)
  • Cell Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

본 발명은 당뇨병 동물모델, 상기 모델을 이용한 당뇨병 치료제의 스크리닝 방법 및 당뇨병 치료제의 효능 분석 방법을 제공한다. 본 발명의 동물모델은 혈중 당뇨관련 성분 증가, 혈중 포도당 수준의 증가, 인슐린 저항성 악화, 간에서 트리글리세리드 양 증가, 혈청 ALT/AST 증가, 지방간 축적 증간, 염증 반응 증가 등의 다양한 당대사 이상 증상을 나타내며, 비만에서 당뇨병으로의 진행 과정을 이해하는데 그리고 당뇨병에 대한 치료제를 스크리닝 하는데 적합한 동물모델이다. 본 발명의 동물모델은 비만에서 당뇨병으로의 진행에 대한 연구, 및 비만 및 염증반응과 연관된 당뇨병에 대한 치료제 개발에 효과적으로 이용가능하다.

Description

ATG7+/--OB/OB 형질을 나타내는 당뇨병 동물모델 및 이를 이용한 당뇨병 치료제의 스크리닝 방법
본 발명은 Atg7 +/- -ob/ob 형질을 나타내는 당뇨병 동물모델 및 이를 이용한 당뇨병 치료제의 스크리닝 방법에 관한 것이다.
제2형 당뇨병은 인슐린 저항성 및 상대적인 인슐린 결핍이 조합되어 그 결과로서 나타난다. 자가포식은 세포질의 노폐물, 수명이 다되거나 변성되어 기능이 저하된 세포소기관들을 세포안에서 이중막으로 된 자기포식체(autophagosome)로 격리하고 리소좀과 결합하여 리소좀 내에 있는 소화효소에 의해 분해되는 일련의 과정이다. 인슐린 및 mTOR과 같은 인슐린의 다운스트림(하위) 분자는 자가포식의 억제제로 잘 알려져 있다1. 자가포식은 세포 내 에너지 항상성 유지 및 β-세포의 생존/기능 및 인슐린 감수성에 결정적인 미토콘드리아 및 ER(endoplasmic reticulum)과 같은 세포 소기관의 질을 조절하는데 있어 중요하다2 - 4. 따라서 자가포식은 호르몬 작용 및 세포 소기관 기능을 조절하여 대사작용에 있어 중요한 역할을 하며, 자가포식 조절장애가 있는 경우 당뇨병이 발병할 수 있다. 한편, 자가포식과 당뇨병에 대한 논문은 보고가 되어 있지만 특정 조직에서만 자가포식이 전혀 발현되지 않는 유기체에서 연구되어진 것들이며, 각 조직에 따라 당뇨병이나 대사가 개선된다는 논문7 ,9과 더 악화된다는 논문8이 보고되어 있다. 그러나 자가 포식이 조직 전체에서 발현되지 않을 경우에는 태어나기 전에 죽기 때문에 당뇨병이나 대사에서 자가포식 역할에 대한 연구가 폭넓게 진행되지 않았다12 - 14. 따라서 본 논문에서는 자가포식 유전자가 전체 조직에서 50% 정도만 발현이 떨어져 있는 마우스를 사용하여 진행된 결과이다.
본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
[선행기술문헌]
1. Kanazawa, T. et al. J. Biol. Chem. 279, 8452459 (2004).
2. Chang, I. et al. J. Immunol. 172, 7008014 (2004).
3. Ozcan, U. et al. Science 306, 45761 (2004).
4. Petersen, K. F. et al. Science 300, 1140142 (2003).
5. Ebato, C. et al. Cell Metab. 8, 32532 (2008).
6. Jung, H. S. et al. Cell Metab. 8, 31824 (2008).
7. Singh, R. et al. J. Clin. Invest. 119, 3329339 (2009).
8. Yang, L., Li, P., Fu, S., Calay, E. S. & Hotamisligil, G. S. Cell Metab. 11, 46778 (2010).
9. Zhang, Y. et al. Proc. Natl Acad. Sci. USA 106, 198609865 (2009).
10. Komatsu, M. et al. J. Cell Biol. 169, 42534 (2005).
11. Kim, K. H. et al. Nat. Med. 19, 832 (2013).
12. He, C. et al. Nature 481, 51115 (2012).
13. He, C. et al. Cell 154, 1085099 (2013).
14. Pyo, J. O. et al. Nat. Commun. 4, 2300 (2013).
15. Klionsky, D. J. et al. Autophagy 8, 44544 (2012).
16. Komatsu, M. et al. Cell 131, 1149163 (2007).
17. Mizushima, N., Yamamoto, A., Matsui, M., Yoshimori, T. & Ohsumi, Y. Mol. Biol. Cell 15, 1101111 (2004).
18. Rubinsztein, D. C. Nature 443, 78086 (2006).
19. Ueno, T., Muno, D. & Kominami, E. J. Biol. Chem. 266, 189958999 (1991).
20. Han, M. S. et al. Diabetes 58, 32936 (2009).
21. Cai, D. et al. Nat. Med. 11, 18390 (2005).
22. Aguirre, V. et al. J. Biol. Chem. 277, 1531537 (2002).
23. Solinas, G., Naugler, W., Galimi, F., Lee, M.-S. & Karin, M. Proc. Natl Acad. Sci. USA 103, 164546459 (2006).
24. Mathew, R. et al. Cell 137, 1062075 (2009).
25. Matsumoto, N. et al. Biochem. Biophys. Res. Commun. 368, 64349 (2008).
26. Kamata, H. et al. Cell 120, 64961 (2005).
27. Minamino, T. et al. Nat. Med. 15, 1082088 (2009).
28. Yahagi, N. et al. J. Biol. Chem. 2003, 253955400 (2003).
29. Rai, P. et al. Proc. Natl Acad. Sci. USA 106, 16974 (2009).
30. Singh, R. et al. Nature 458, 1131135 (2009).
31. Hosokawa, N., Hara, Y. & Mizushima, N. FEBS Lett. 580, 2623629 (2006).
32. Saitoh, T. et al. Nature 456, 26469 (2008).
33. Zhou, R., Yazdi, A. S., Menu, P. & Tshopp, J. Nature 469, 22126 (2011).
34. Strissel, K. J. et al. Diabetes 56, 2910918 (2010).
35. Vandanmagsar, B. et al. Nat. Med. 15, 1 (2011).
36. Wen, H. et al. Nat. Immunol. 12, 40815 (2011).
37. Schroder, K. & Tschopp, J. Cell 140, 82132 (2010).
38. Misawa, T. et al. Nat. Immunol. 14, 45460 (2013).
39. Bellodi, C. et al. J. Clin. Invest. 119, 1109123 (2009).
40. Gupta, A. et al. Proc. Natl Acad. Sci. USA 107, 143334338 (2010).
41. Rodriguez-Navarro, J. A. et al. Neurobiol. Dis. 39, 42338 (2010).
42. Sarkar, S., Davies, J. E., Huang, Z., Tunnacliffe, A. & Rubinsztein, D. C. J. Biol. Chem. 282, 5641652 (2007).
43. Koga, H., Kaushik, S. & Cuervo, A. M. FASEB J. 24, 3052065 (2010).
44. Shibata, M. et al. Biochem. Biophys. Res. Commun. 393, 27479 (2010).
45. Quan, W. et al. Diabetologia 55, 39203 (2012).
46. Ma, D. et al. Mol. Endocrinol. 27, 1643654 (2013).
47. Coupe, B. et al. Cell Metab. 15, 1 (2012).
48. Kaushik, S. et al. EMBO Rep. 13, 25865 (2012).
49. Quan, W. et al. Endocrinology 153, 1817826 (2012).
50. Druker, B. J. et al. Nat. Med. 2, 56166 (1996).
51. Kouroku, Y. et al. Cell Death Differ. 14, 23039 (2007).
52. Yorimitsu, T., Nair, U., Yang, Z. & Klionsky, D. J. J. Biol. Chem. 281, 302990304 (2006).
53. Etmer, A. et al. Leukemia. 21, 93642 (2007).
54. Imam, S. Z. et al. J. Neurosci. 31, 15763 (2011).
55. Shingu, T. et al. J. Cancer 124, 1060071 (2009).
56. Mokhtari, D. et al. Diabetologia 56, 1327338 (2013).
57. Drube, S., Schmitz, F., Gopfert, C., Weber, F. & Kamradt, T. Eur. J. Pharmacol. 675, 572 (2012).
58. Fraenkel, M. et al. Diabetes 57, 94557 (2008).
59. Kim, J. et al. J. Clin. Invest. 124, 3311324 (2014).
60. Phillips, D. I. W., Clark, P. M., Hales, C. N. & Osmond, C. Diabet. Med. 11, 28692 (1993).
61. Han, M. S. et al. J. Lipid Res. 52, 1234246 (2011).
62. Du, K., Herzig, S., Kulkarni, R. N. & Montminy, M. Science 300, 1574577
(2003).
63. Back, S. H. et al. Cell Metab. 10, 136 (2009).
64. Park, S. Y. et al. J. Biol. Chem. 275, 7512520 (2004).
65. Park, S. Y. et al. Res. Commun. 325, 1399405 (2004).
66. Shin, N.-R. et al. Gut 63, 72735 (2014).
67. Kim, Y.-H. et al. Eur. J. Immunol. 29, 45565 (1999).
68. Cinti, S. et al. J. Lipid Res. 46, 2347355 (2005).
본 발명자들은 비만에서 당뇨병으로의 진행 과정을 이해하는데 이용할 수 있으며 당뇨병에 대한 치료제를 스크리닝 하는데 적합한 동물모델을 개발하고자 노력하였다. 그 결과, 본 발명자들은 Atg7 +/- 동물과 ob/w 동물을 교배하여 Atg7 +/--ob/ob 형질을 나타내는 당뇨병 동물모델을 구축하고, 이를 이용하여 당뇨병 치료제를 스크리닝하고, 당뇨병 치료제의 치료 효능을 분석할 수 있음을 규명함으로써, 본 발명을 완성하였다.
따라서, 본 발명의 목적은 당뇨병 치료제의 스크리닝 방법을 제공하는데 있다.
본 발명의 다른 목적은 당뇨병 치료제의 치료 효능을 분석하는 방법을 제공하는데 있다.
본 발명의 또 다른 목적은 당뇨병 동물모델을 제공하는데 있다.
본 발명의 다른 목적 및 이점은 하기의 발명의 상세한 설명 및 청구범위에 의해 보다 명확하게 된다.
본 발명의 일 양태에 따르면, 본 발명은 다음 단계를 포함하는 당뇨병 치료제의 스크리닝 방법을 제공한다:
(a) Atg7 +/--ob/ob 형질을 나타내는 인간을 제외한 동물에 시험물질을 투여하는 단계; 및
(b) 상기 동물로부터 당뇨병 또는 당대사 이상 증상과 상관관계가 있는 혈액학적 또는 조직학적 지표 값을 측정하는 단계로서 시험물질이 상기 혈액학적 또는 조직학적 지표 값을 유의하게 정상적으로 변화시키는 경우 상기 시험물질은 당뇨병 치료제로 판단된다.
본 발명의 다른 일 양태에 따르면, 본 발명은 다음 단계를 포함하는 당뇨병 치료제의 치료 효능을 분석하는 방법을 제공한다:
(a) Atg7 +/--ob/ob 형질을 나타내는 인간을 제외한 동물에 당뇨병 치료제를 투여하는 단계; 및
(b) 상기 동물로부터 당뇨병 또는 당대사 이상 증상과 상관 관계가 있는 혈액학적 또는 조직학적 지표 값을 측정하여 당뇨병 치료제의 치료 효능을 결정하는 단계.
본 발명자들은 비만에서 당뇨병으로의 진행 과정을 이해하는데 이용할 수 있으며 당뇨병에 대한 치료제를 스크리닝 하는데 적합한 동물모델을 개발하고자 노력하였다. 그 결과, 본 발명자들은 Atg7 +/- 동물과 ob/w 동물을 교배하여 Atg7 +/--ob/ob 형질을 나타내는 당뇨병 동물모델을 구축하고, 이를 이용하여 당뇨병 치료제를 스크리닝하고, 당뇨병 치료제의 치료 효능을 분석할 수 있음을 규명하였다.
본 발명에 따르면, 주요 자가포식 유전자인 Atg7이 반수부전(haploinsufficienty)인 마우스(Atg7 +/- 마우스)에서 대사 이상(metabolic abnormalities)이 발견되지 않은 반면, Atg7 +/- 마우스를 ob/ob 마우스와 교배한 경우 인슐린 저항성이 악화되고 체내 지질 양 및 염증반응이 증가한다는 것을 발견하였고, 이를 통해 자가포식 부전이 대사 스트레스에 따른 적응 반응을 손상시킨다는 것을 실험적으로 규명하였다. 또한, 자가포식 증진제를 Atg7 +/--ob/ob 마우스에 투여한 경우, 자가포식이 증가하고 이를 통해 대사 반응이 개선되는 것을 확인함으로써 자가포식 부전이 비만에서 당뇨병으로의 진행에 관여하는 주요 인자임을 밝혔으며, 자가포식 조절자가 비만 및 염증반응과 연관된 당뇨병 치료제로 이용될 수 있다는 것을 확인하였다.
본 발명의 당뇨병 치료제의 스크리닝 방법 및 치료 효능 분석 방법에 있어서 사용되는 동물은 Atg7 +/- 동물 및 상기 Atg7 +/- 동물과 동종의 ob/w 동물을 교배하여 얻는 동물로서 Atg7 +/--ob/ob 형질을 나타내는 인간을 제외한 동물이다.
본 발명에 따르면, 본 발명에서 사용되는 동물은 포유동물이고, 보다 바람직하게는 상기 포유동물은 마우스, 랫트, 돼지 또는 원숭이이며, 가장 바람직하게는 마우스이다.
본 발명의 일 구현예에 따르면, 본 발명에서 사용되는 동물로서 Atg7 +/--ob/ob 형질을 나타내는 마우스는 Atg7 F /F(Atg7-floxed 마우스)와 CMV-Cre 마우스를 교배시켜 동형접합 Atg7 결실 생식세포를 갖는 마우스(Atg7 +/- 마우스)를 생산한 다음, Atg7 +/- 마우스와 ob/w 마우스를 교배하여 선별한다.
상기 Atg7 +/--ob/ob 형질을 나타내는 마우스의 선별은 마우스의 꼬리 조직으로부터 게놈 DNA를 추출하여 PCR 지노타이핑(genotyping)으로 확인한다.
상기와 같은 방법으로 제조된 Atg7 +/--ob/ob 형질을 나타내는 마우스는 Atg7 +/+-ob/ob 마우스와 비교하여 현저히 증가된 혈당치를 나타냈으며, 인슐린 저항성이 악화되고 간에서 트리글리세리드 양이 증가하였고, 혈청 ALT/AST가 증가하였으며 염증반응이 증가되는 등 당대사 이상이 형성됨에 따라 당뇨병 현상이 발견되었다.
본 발명의 Atg7 +/--ob/ob 형질을 나타내는 동물은 당대사 이상 증상을 나타내므로, 당뇨병, 특히 비만 및 염증반응과 연관된 당뇨병 및 비만에서 당뇨병으로의 진행에 대한 메커니즘을 연구할 수 있는 당뇨병 모델동물로서 유용하게 이용될 수 있다.
본 발명의 스크리닝 방법을 언급하면서 사용되는 용어 “시험물질”은 당뇨병으로 진행되는 활성을 억제하는지 여부를 검사하기 위하여 스크리닝에서 이용되는 미지의 물질을 의미한다.
상기 스크리닝 방법에 있어서, 단계 (a)의 시험물질로는 펩티드, 단백질, 비펩티드성 화합물, 합성 화합물, 발효 생산물, 세포 추출액, 식물 추출액, 동물 조직 추출액 또는 혈장 등이 있고, 상기 화합물은 신규 화합물 또는 널리 알려진 화합물일 수 있으며 바람직하게는 합성 또는 천연 화합물의 라이브러리로부터 얻을 수 있다. 이러한 화합물의 라이브러리를 얻는 방법은 당업계에 공지되어 있다. 합성 화합물 라이브러리는 Maybridge Chemical Co.(UK), Comgenex(USA), Brandon Associates(USA), Microsource(USA) 및 Sigma-Aldrich(USA)에서 상업적으로 구입 가능하며, 천연 화합물의 라이브러리는 Pan Laboratories(USA) 및 MycoSearch(USA)에서 상업적으로 구입 가능하다. 시료는 당업계에 공지된 다양한 조합 라이브러리 방법에 의해 얻을 수 있으며, 예를 들어, 생물학적 라이브러리, 공간 어드레서블 패러럴 고상 또는 액상 라이브러리(spatially addressable parallel solid phase or solution phase libraries), 디컨볼루션이 요구되는 합성 라이브러리 방법, “1-비드 1-화합물” 라이브러리 방법, 그리고 친화성 크로마토그래피 선별을 이용하는 합성 라이브러리 방법에 의해 얻을 수 있다. 분자 라이브러리의 합성 방법은, DeWitt et al., Proc . Natl. Acad . Sci . U.S.A . 90, 6909, 1993; Erb et al. Proc . Natl . Acad . Sci . U.S.A . 91, 11422, 1994; Zuckermann et al., J. Med . Chem . 37, 2678, 1994; Cho et al., Science 261, 1303, 1993; Carell et al., Angew . Chem . Int . Ed. Engl . 33, 2059, 1994; Carell et al., Angew . Chem . Int . Ed. Engl. 33, 2061; Gallop et al., J. Med. Chem. 37, 1233, 1994 등에 개시되어 있다.
상기 시험물질은 염을 형성하고 있어도 된다. 상기 시험물질의 염으로는 생리학적으로 허용되는 산(예, 무기산 등)이나 염기(예, 유기산 등) 등의 염이 있고 이 중에서 생리학적으로 허용되는 산첨가염이 바람직하나 이에 한정되지 않는다. 이와 같은 염으로는 예를 들면, 무기산(예를 들면, 염산, 인산, 취화수소산 또는 황산 등)의 염 또는 유기산(예를 들면, 초산, 포름산, 프로피온산, 푸마르산, 말레산, 숙신산, 타르타르산, 시트르산, 말산, 옥살산, 안식향산, 메탄술폰산 또는 벤젠술폰산 등)의 염 등이 이용될 수 있다.
상기 시험물질을 투여하는 방법으로는 경구투여, 정맥주사, 스와빙(swabbing), 피하투여, 피내투여 또는 복강 투여 등이 이용될 수 있으나 이에 한정되지 않으며, 실험 동물의 증상 또는 시험물질의 성질 등에 맞추어 적당히 선택할 수 있다. 또한, 시험물질의 투여량은 투여 방법, 시험물질의 성질 등에 맞추어 적당히 선택할 수 있다.
상기 스크리닝 방법에 있어서, 시험물질은 상기 동물의 조직, 장기 또는 세포에 투여할 수도 있다. 상기 조직 또는 장기의 경우는 Atg7 +/--ob/ob 형질을 나타내는 동물에서 적출한 것도 포함한다. 세포의 경우에는 혈액 세포, 간 세포 또는 지방 세포 등을 예시할 수 있지만, 이에 한정되지 않는다.
상기 시험물질을 본 발명의 Atg7 +/--ob/ob 형질을 나타내는 동물의 일부 중, 분리한 세포에 투여하고자 할 경우에는 세포의 배양액에 시험물질을 투여할 수 있다. 해당 시험물질이 단백질인 경우에는 예를 들면, 해당 단백질을 코딩하는 DNA를 포함한 벡터를 상기 동물로부터 분리된 세포로 도입하는 것도 가능하다.
상기 스크리닝 방법 및 치료 효능 분석 방법에 있어서, 당뇨병 또는 당대사 이상 증상과 상관관계가 있는 혈액학적 또는 조직학적 지표 값은 혈중 당뇨관련 성분, 인슐린 저항성, 혈중 글루코오스 수준 및 혈중 인슐린 수준으로 구성된 군으로부터 선택된 어느 하나 이상인 것이 바람직하고, 상기 혈중 당뇨관련 성분은 트리글리세리드, 콜레스테롤, 유리지방산, ALT, AST, HDL 및 LDL로 구성된 군으로부터 선택된 어느 하나인 것이 바람직하나 이에 한정되지 않는다.
상기와 같은 지표 값을 시험물질을 투여한 동물모델 및 시험물질을 투여하지 않은 대조군에서 각각 측정하여 비교한 결과, 지표에 대하여 효과를 보이는 물질을 선별함으로써 당뇨병 치료제를 스크리닝 할 수 있으며, 상기 지표 값을 분석하여 당뇨병 치료제의 치료 효능을 분석할 수 있다.
본 발명에 따르면, 시험물질이 상기 혈액학적 또는 조직학적 지표 값을 유의하게 정상적으로 변화시키는 경우 상기 시험물질은 당뇨병 치료제로 판단된다.
본 발명의 일 구현예에 따르면, 시험물질이 시험물질을 투여하지 않은 동물모델과 비교하여 혈중 당뇨관련 성분의 증가, 인슐린 저항성의 악화, 혈중 글루코오스 수준 증가 및 혈중 인슐린 수준 증가를 억제하는 경우, 시험물질은 당뇨병 치료제로 판단된다.
상기와 같은 방법으로 스크리닝된 당뇨병 치료제는 당뇨병, 특히 비만 환자에서의 당뇨병 예방 및 치료에 매우 유용하게 이용될 수 있다.
본 발명의 다른 일 양태에 따르면, 본 발명은 Atg7 +/--ob/ob 형질을 나타내는 인간을 제외한 동물인 것을 특징으로 하는 당뇨병 동물모델을 제공한다.
본 발명의 당뇨병 동물모델은 상술한 방법에서 이용한 동물모델이기 때문에, 이 둘 사이에 공통된 내용은 반복 기재에 따른 명세서의 과도한 복잡성을 피하기 위하여, 그 기재를 생략한다.
본 발명의 특징 및 이점을 요약하면 다음과 같다:
(a) 본 발명은 당뇨병 동물모델, 상기 모델을 이용한 당뇨병 치료제의 스크리닝 방법 및 당뇨병 치료제의 효능 분석 방법을 제공한다.
(b) 본 발명의 동물모델은 혈중 당뇨관련 성분 증가, 혈중 포도당 수준의 증가, 인슐린 저항성 악화, 간에서 트리글리세리드 양 증가, 혈청 ALT/AST 증가, 지방간 축적 증간, 염증 반응 증가 등의 다양한 당대사 이상 증상을 나타내며, 비만에서 당뇨병으로의 진행 과정을 이해하는데 그리고 당뇨병에 대한 치료제를 스크리닝 하는데 적합한 동물모델이다.
(c) 본 발명의 동물모델은 비만에서 당뇨병으로의 진행에 대한 연구, 및 비만 및 염증반응과 연관된 당뇨병에 대한 치료제 개발에 효과적으로 이용가능하다.
도 1은 제작한 Atg7 마우스에 대하여 생화학적 특성을 분석한 결과이다.
(a) 실험방법에 기재된 바와 같이 Atg7 +/- 마우스를 제작하고 지노믹 DNA 및 플록싱된 Atg7 영역에 대한 프라이머를 이용하여 PCR을 실시함. Atg7 +/- 마우스에서 화살표는 야생형 Atg7 밴드를 나타내며, Atg7 F/+ 마우스에는 플록스 서열이 삽입되므로 PCR 사이즈가 증가하고 Atg7 +/- 마우스에서는 Cre-매개 결손에 의해 PCR 사이즈가 감소함.
(b) Atg7 +/- 또는 대조군 Atg7 +/+ 마우스의 조직으로부터 총 RNA를 추출하고 Atg7 또는 β-액틴 서열에 대해 특이적인 프라이머를 이용하여 RT-PCR(좌측) 및 실시간 RT-PCR(우측)을 실시함. RT-PCR 밴드 강도의 배율 변화(fold change)는 좌측 패널에 나타냄. *P<0.05, **P<0.01, ***P<0.001; Student’s t-test, n=3.
(c) 항-LC3 또는 -p62 항체를 이용하여 공복 상태의 12주령 Atg7 +/- 또는 대조군 Atg7 +/+ 마우스 조직 용해물에 대하여 면역블롯 분석을 실시함. 면역블롯 밴드 강도의 배율 변화는 가운데 및 우측 패널에 나타냄. **P<0.01, ***P<0.001; Student’s t-test, n=3.
(d) 라파마이신(Rap) 또는 대조군 용매(DMSO)를 3시간 처리한 후 LC3 및 p62에 특이적인 항체를 이용하여 Atg7 +/+, Atg7 +/-Atg7 -/-/MEFs의 세포 용해물에 대하여 면역블롯 분석을 실시함. 면역블롯 밴드 강도의 배율 변화는 가운데 및 우측 패널에 나타냄. **P<0.01, ***P<0.001; Student’s t-test, n=3.
(e) (e) 공복 상태의 12주령 GFP-LC3 +-Atg7 +/+ 또는 GFP-LC3 +-Atg7 +/- 마우스의 간 및 근육 조직 섹션에 대하여 형광 현미경을 이용하여 GFP-LC3 반점(좌측)을 측정함. GFP-LC3 반점 수를 카운팅함(우측). 스케일바, 10 mm. *P<0.05; Student’s t-test, n=5.
(f) 류펩틴 투여 4시간 후 공복상태의 Atg7 +/+ 또는 대조군 Atg7 +/- 마우스의 간을 분리하여 조직 용해물을 준비한 후 면역블롯팅을 실시함. 면역블롯 밴드 강도의 배율 변화는 우측 패널에 나타냄. *P<0.05; Student’s t-test, n=3.
도 2는 Atg7 +/+ Atg7 +/- 마우스의 대사 프로파일을 분석한 결과이다.
(a) 비공복 혈당치를 매주 모니터링함.
(b) 12주령 시 IPGTT를 실시함.
(c-e) 혈액 화학 프로파일은 자동분석기를 이용하여 측정함.
(f) 혈청 FFA 레벨은 키트를 이용하여 측정함.
(g) 체중은 5주령 및 30주령 사이에 측정함.
도 3은 자가포식 반수부전을 갖는 ob/ob 마우스의 대사 프로파일 악화를 분석한 결과이다.
(a) Atg7 +/+, Atg7 +/-, Atg7 +/+-ob/ob 및 Atg7 +/--ob/ob 마우스의 비공복 혈당치를 매주 모니터링함. ***P<0.001; 이원분산분석.
(b) 실험방법에 기재한 바와 같이 16주령 마우스에 글루코오스를 주사하여 IPGTT를 실시하고(좌측), AUC를 계산함(우측). *P<0.05, **P<0.01, ***P<0.001; Student’s t-test(좌측) 및 일원분산분석(우측).
(c) HOMA-IR 인덱스는 실험방법에 기재한 바와 같이 계산함. *P<0.05; 일원분산분석.
(d) 실험방법에 기재한 바와 같이 16주령 마우스에 인슐린을 주사하여 ITT를 실시함. *P<0.05, **P<0.01, ***P<0.001; Student’s t-test.
(e) 꼬리 정맥으로 5 U kg-1 레귤러 인슐린(Ins)을 주사하고 7분 후 Atg7 +/+-ob/w, Atg7 +/--ob/w, Atg7 +/+-ob/ob 및 Atg7 +/--ob/ob 마우스로부터 조직을 얻음. 각각의 마우스 조직 용해물을 준비하고 phospho-Akt S473 및 Akt에 특이적인 항체를 이용하여 면역블롯 분석을 실시함. 면역블롯 밴드 아래의 숫자는 대조군 밴드로 표준화한 배율 변화를 나타냄.
도 4는 Atg7 +/+-ob/ob 마우스의 대사 프로파일을 분석한 결과이다.
(a) 체중은 5주령 및 30주령 사이에 측정함.
(b) IGI(insulinogenic index)는 실험방법에 기술한 내용과 같이 계산함. *P < 0.05; 일원분산분석.
(c) 각 실험군으로부터 수득한 췌장 섹션을 H&E 염색한 후 광학현미경으로 관찰함. 스케일 바: 50 μm.
(d) 상대적 β-세포양은 인슐린 면역조직화학염색 후 포인트 카운팅으로 결정함. (-), 일원분산분석, n = 5.
(e) KITT는 12주령 ITT 데이터를 이용하여 계산함. ***P < 0.001; 일원분산분석.
도 5는 Atg7 +/--ob/ob 마우스에서 인슐린 저항성 및 산화 스트레스를 측정한 결과이다.
(a) JNK, phospho-JNK, IRS-1 및 phospho-IRS-1 S307에 특이적인 항체를 이용하여 각 마우스의 조직 용해물에 대하여 면역블롯 분석을 실시함.
(b) 항-니트로타이로신 항체를 이용하여 각 마우스 간 섹션에 대하여 면역화학염색을 실시함. 스케일 바, 100 mm.
(c) 각 유전형질의 18주령 마우스로부터 조직 용해물을 준비하고 카르보닐화 단백질을 검출하는 키트를 이용하여 면역블롯 분석을 실시함.
(d) 항 phospho-53 및 -53 항체를 이용하여 면역블롯 분석을 실시함. p21 및 β-액틴 mRNA 발현은 RT-PCR로 측정함. 면역블롯 밴드 아래의 숫자는 대조군 밴드로 표준화한 배율 변화를 나타냄.
도 6은 Atg7 +/--ob/ob 마우스 조직에서 산화 스트레스를 측정한 결과이다.
(a) 각 실험군으로부터 수득한 간 섹션의 DHE 염색은 실험방법에 기술한 내용과 같이 실시함. 스케일 바: 50 μm.
(b) 16주령 마우스의 WAT에 대한 SA-β-gal 염색은 실험방법에 기술한 내용과 같이 실시함.
도 7은 Atg7 +/--ob/ob 마우스에서 지질 축적을 측정한 결과이다.
(a) 각 실험군으로부터 수득한 간 조직에서 TG 레벨은 지질 추출 후 ORO 염색을 실시하고 540 nm(우측)에서 흡광도를 측정하여 평가함. 대표적인 ORO 염색 결과는 좌측 패널에 나타냄. 스케일 바: 50 μm. ***P < 0.001; 일원분산분석, n = 5.
(b) 각 실험군으로부터 수득한 간 조직에서 TG 레벨은 실험방법에 기술한 생화학적 방법을 통해 평가함. ***P < 0.001; 일원분산분석.
(c) 각 실험군의 간 조직은 EM을 통해 관찰함. 스케일 바: 200 nm.
(d, e) 간 효소의 혈청 레벨(d) 및 FFA(e)는 각각 혈액 화학 분석기 및 상업적 키트를 이용하여 측정함. *P < 0.05, **P < 0.01; 일원분산분석.
(f) 각 실험군의 파라핀-매립 간 섹션에 대하여 TUNEL 염색을 실시함. 스케일 바: 20 μm. 화살표, TUNEL+ 세포사멸 간세포.
도 8은 자가포식에 있어서 비만 및 지질이 나타내는 효과를 분석한 결과이다.
(a) GFP-LC3 반점은 공복상태의 각 마우스 조직을 형광현미경으로 관찰하고, 그 수를 카운팅함. 스케일 바, 20 mm. *P<0.05, **P<0.01; Student’s t-test.
(b) ob/w 및 ob/ob 마우스 조직을 전자현미경으로 관찰하고 자가포식소체 수를 카운팅함. ***P<0.001; Student’s t-test.
(c) 항-GFP 또는 -p62 항체를 이용하여 면역블롯팅을 실시함.
(d) 류펩틴 투여 4시간 후 공복상태의 ob/w 또는 ob/ob 마우스의 간으로부터 조직 용해물을 준비하고 면역블롯팅을 실시함. 면역블롯 밴드 아래의 숫자는 대조군 밴드로 표준화한 배율 변화를 나타냄.
(e) C14-류신으로 SK-Hep1 세포를 라벨링한 후, 세포에 FFA(600 mM PA 또는 1,200 mM OA)를 처리함. 실험방법에 기재한 바와 같이 3-6시간 동안 방사능 방출율을 측정함. E64d/펩스타틴 A/NH4Cl의 처리 또는 미처리에 따른 단백질 용해율 차이는 리소좀 단백질 용해로 간주함. *P<0.05, **P<0.01; 일원분산분석, n=3.
(f) Atg7 +/+Atg7 +/- MEFs에 48시간 동안 표시된 농도의 PA 및 OA 혼합물을 로딩하고 ORO 염색을 통해 TG 양을 측정함. **P<0.01, ***P<0.001; 이원분산분석, n=4. 면역블롯 밴드 아래의 숫자는 대조군 밴드로 표준화한 배율 변화를 나타냄.
도 9는 자가포식 및 인슐린 민감성에 대한 비만 및 지질 로딩의 효과를 측정한 결과이다.
(a) Atg7 siRNA 또는 대조군 siRNA(Con)을 발현하는 아데노바이러스(MOI 50)를 SK-Hep1 또는 Hepa1c1c7 세포에 감염시키고 72시간 후, 총 RNA에 대하여 Atg7 발현(mAtg7, murine Atg7 ; hAtg7, human Atg7)을 RT-PCR로 분석함.
(b) Atg7 siRNA를 발현하는 아데노바이러스로 48시간 동안 감염시킨 SK-Hep1 또는 Hepa1c1c7 세포에 지시된 농도의 PA 및 OA 혼합물을 처리하여 24시간 동안 배양함. TG 양은 ORO 염색, 이소프로파놀 추출 및 540 nm에서의 흡광도를 통해 평가함. **P < 0.01, ***P < 0.001; 일원분산분석, n = 3.
(c) Atg7 siRNA 또는 대조군 siRNA를 발현하는 아데노바이러스로 48시간 동안 감염시킨 후, 세포에 600 μM PA 및 1,200 μM OA 혼합물을 처리하여 24시간 배양함. 100 nM 인슐린(Ins)을 7분 동안 처리한 후, 세포 용해물에 대하여 phospho-Akt S473 및 총 Akt에 특이적인 항체를 이용하여 면역블롯 분석을 실시함.
(d) 인슐린을 처리하지 않은 세포 용해물에 대하여 JNK, pJNK, IRS-1 및pIRS-1 S307에 특이적인 항체를 이용하여 면역블롯팅을 실시함. 면역블롯 및 RT-PCR 밴드 아래 숫자는 표준화된 대조군 밴드에 대한 배율 변화(fold changes)를 나타냄.
도 10은 Atg7 +/--ob/ob 마우스 조직에서 면역반응을 분석한 결과이다.
(a) 실험방법에서 기재한 바와 같이 각 마우스의 WAT에서 CLS 수를 카운팅함. *P<0.05; 일원분산분석, n=3.
(b) 각 조직으로부터 총 mRNA를 분리하여 cDNA를 만들어 Tnfα , Il6 , F4/ 80 또는 pro- Il1b에 특이적인 프라이머를 이용하여 RT-PCR을 실시함. WAT 조직은 SVF를 분리하여 pro-Il1b 발현을 분석함.
(c, d) 항-IL-1β(c) 또는 항-caspase-1 항체(d)를 이용하여 SVF 용해물에 대하여 면역블롯 분석을 실시함.
(e) 복강에서 분리한 대식세포에 LPS가 존재 또는 존재하지 않는 조건 하에서 표시된 농도의 PA를 처리함. IL-1β 농도를 측정하기 위해 배양 상등액에 대하여 ELISA를 실시함(BSA, bovine serum albumin). ***P<0.001; 이원분산분석, n=4.
(f) LPS를 처리 또는 미처리 하는 조건에서 표시된 농도의 PA를 복강에서 분리한 대식세포에 16시간 동안 처리하고, 키트를 이용하여 NAD+/-NADH 비율을 측정함. *P<0.05, **P<0.01, ***P<0.001; 이원분산분석, n=5.
(g) (f)와 동일한 방법으로 복강 대식세포를 처리한 다음, MitoSOX로 염색하여 유세포분석을 통해 미토콘드리아 ROS를 측정함.
(h) (f)와 동일한 방법으로 복강 대식세포를 처리한 다음, 미토트래커 레드 및 미토트래커 그린으로 세포를 염색하고 유세포분석을 통해 미토콘드리아 전위를 측정함. g, h에서 숫자는 지정된 게이트에서의 세포 백분율을 나타냄. 면역블롯 밴드 아래의 숫자는 대조군 밴드로 표준화한 배율 변화를 나타냄.
도 11은 Atg7 +/--ob/ob 마우스 조직에서 면역반응을 측정한 결과이다.
(a-d) 각 조직으로부터 총 mRNA를 추출하고, Tnfa (a), Il6 (b), F4/80 (c) 또는 pro-Il1b (d)에 대해 특이적인 프라이머를 이용하여 실시간 RT-PCR을 수행함. pro-Il1b 발현은 WAT 조직의 SVF를 이용하여 측정함. (-), *P < 0.05, ***P < 0.001; 일원분산분석, n = 9.
도 12는 Atg7 +/- 마우스에 고지방식이(HFD)를 제공한 후 생화학적 특성을 분석한 결과이다.
(a) Atg7 +/- 및 대조군 Atg7 +/+ 마우스에 HFD 또는 정상 식이(NCD)를 제공하고, 비공복 혈당치를 모니터링함. *P<0.05, **P<0.01; Student’s t-test.
(b) HFD 식이 18주 후 공복 혈당치를 측정함. *P<0.05; 일원분산분석.
(c) HFD 식이 18주 후 IPGTT를 실시하고(좌측), AUC를 계산함(우측). *P<0.05; Student’s t-test(좌측) 및 일원분산분석(우측).
(d) HFD 식이 18주 후 HOMA-IR을 계산함. ***P<0.001; 일원분산분석.
(e) HFD 식이 18주 후 ITT를 실시하고(좌측), KITT를 계산함(우측). *P<0.05; Student’s t-test(좌측) 및 일원분산분석(우측).
도 13은 고지방식이 Atg7 +/- 마우스의 대사 프로파일을 분석한 결과이다.
(a) HFD 또는 NCD를 제공한 Atg7 +/- 및 대조군 Atg7 +/+ 마우스의 체중을 모니터링함.
(b) IGI는 18주간 HFD를 식이한 마우스에서 계산함. *P < 0.05; 일원분산분석.
(c) 21주간 HFD를 식이한 마우스 간 조직에서의 TG 레벨은 ORO 염색 후 540 nm에서 흡광도를 측정하여 평가함. **P < 0.01; 일원분산분석, n = 10.
(d) 18주간 HFD를 식이한 후 혈청 FFA 레벨은 키트를 이용하여 측정함. ***P < 0.001; 일원분산분석.
(e) 18주간 HFD를 식이한 후 혈액 화학 프로파일은 자동 분석기를 이용하여 측정함. *P < 0.05; 일원분산분석.
도 14는 Atg7 +/- 마우스의 대사 프로파일에 대한 자가포식 증진제의 효과를 분석한 결과이다.
(a) C57BL/6 마우스의 1차 간세포에 E64d/펩스타틴 A(pep)가 존재 또는 부재하는 조건 하에서 이마티닙(Ima) 또는 트레할로스(Tre)를 3시간 동안 처리함. 세포 용해물을 이용하여 면역블롯 분석을 실시함.
(b) GFP -LC3+ 마우스에 이마티닙 20 mg/kg-1을 복강 내 주사하고 4시간 후, 간 및 근육의 조직 용해물을 준비한 다음 면역블롯팅을 실시함.
(c) 이마티닙 또는 트레할로스를 8주간 처리한 Atg7 +/--ob/ob 마우스에 류펩틴 30 mg/kg-1을 투여하고 4시간 후 간 조직을 수득함. 간 용해물을 이용하여 면역블롯 분석을 실시함.
(d) 12주령 Atg7 +/--ob/ob 마우스에 8주간 이마티닙(25 mg/kg-1) 또는 트레할로스(2 g/kg-1)를 복강주사하고, 체중을 모니터링함.
(e) AUC 및 KITT는 8주간 Atg7 +/--ob/ob 마우스에 이마티닙 또는 트레할로스를 처리한 후 계산함. *P < 0.05, **P < 0.01, ***P < 0.001; 일원분산분석.
(f) 8주간 이마티닙 또는 트레할로스를 처리한 Atg7 +/--ob/ob 마우스의 간에서 TG 양은 실험방법에 기재된 방법에 따라 생화학적으로 분석함. ***P < 0.001; 일원분산분석.
(g) 8주간 이마티닙 또는 트레할로스를 처리한 Atg7 +/--ob/ob 마우스에서 혈청 ALT/AST 레벨은 화학 분석기를 이용하여 측정함. *P < 0.05, ***P < 0.001; 일원분산분석.
(h-k) 자가포식-컴피턴트 Atg7 +/+-ob/ob 마우스에 도 15b와 같이 Ima를 처리함. 비공복 혈당치(h) 및 체중(i)을 모니터링함. **P < 0.01; 이원분산분석.
8주간 Atg7 +/+-ob/ob 마우스에 Ima를 처리한 후, IPGTT(j) 및 ITT(k)를 실시함. **P < 0.01; Student’ t-test. 면역블롯 밴드 아래 숫자는 표준화된 대조군 밴드에 대한 배율 변화를 나타냄.
도 15는 Atg7 +/- -ob/ob 마우스의 당뇨병에 대하여 자가포식 증진제가 나타내는 효과를 분석한 결과이다.
(a) C57BL/6 마우스에 30 mg kg-1 류펩틴을 복강 내 주사하고 1시간 후, 25 mg kg-1 이마티닙(imatinib, Ima)를 복강 주사함. 3시간 후 간 조직 용해물을 이용하여 면역블롯 분석을 실시함.
(b) 이마티닙(25 mg kg-1), 트레할로스(2 g kg-1) 또는 PBS를 12주령 당뇨병 Atg7 +/- -ob/ob 마우스에 일주일에 3회 복강 내 주사하고, 혈당치를 모니터링함. ***P<0.001, ###P<0.001; 이원분산분석.
(c, d) IPGTT(c) 및 ITT(d)는 Atg7 +/- -ob/ob 마우스에 이마티닙 또는 트레할로스를 8주간 투여한 후 실시함. #P<0.05; ##P 또는 **P<0.01; ###P 또는 ***P<0.001; Student’s t-test.
(e) 이마티닙 또는 트레할로스를 8주간 투여한 Atg7 +/- -ob/ob 마우스의 꼬리 정맥으로 레귤러 인슐린(Ins)을 주사함. 7분 후 조직 용해물을 준비하여 면역블롯팅을 실시함.
(f) 인슐린을 주사하지 않은 동일 마우스로부터 조직 용해물을 준비하고 면역블롯팅을 실시함. 면역블롯 밴드 아래의 숫자는 대조군 밴드로 표준화한 배율 변화를 나타냄. (‘*’는 이마티닙과 대조군의 비교를 나타냄: ‘#’은 트레할로스와 대조군의 비교를 나타냄).
도 16은 Atg7 +/--마우스의 조직 및 혈청 내 FGF21 레벨을 측정한 결과이다.
(a) 인슐린 타겟 조직에서 Fgf21 mRNA 발현은 RT-PCR로 측정함.
(b) 혈청 FGF21 레벨은 ELISA 키트를 이용하여 측정함. (-), 일원분산분석. RT-PCR 밴드 아래 숫자는 표준화된 대조군 밴드에 대한 배율 변화를 나타냄.
도 17은 자가포식 부전 비만 마우스에서 당뇨병의 발달 경로를 나타내는 모식도이다.
자가포식 불충분 상태(Atg7 +/-)에서 지질 과부하는 불완전한 지질용해에 의해 지질 축적이 증가됨. 자가포식 부전은 미토콘드리아 순환의 지체 및 미토콘드리아 기능장애의 원인이 되며, 염증조절복합체를 활성화 시키는 지질에 의해 염증조절복합체가 활성화 됨. 증가된 지질과 활성화된 염증조절복합체의 결합효과와 상호작용은 인슐린 저항성 및 당뇨병을 악화시킴.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
실시예
재료 및 방법
마우스
Atg7+/- 마우스를 만들기 위해 C57BL/6 계통의 Atg7F/F(Atg7-floxed 마우스)를 CMV-Cre 'deleter' 마우스(Jackson Laboratory)와 교배하였다. 1세대 마우스 가운데 Atg7에 대하여 동형접합성결실(hemizygous deletion)을 나타내는 마우스를 선정하고, CMV-Cre 서열을 갖지 않으며 동형접합 Atg7 결실 생식세포를 갖는 마우스를 만들기 위해 C57BL/6 마우스와 교배하였다. Atg7 +/--ob/ob 마우스를 만들기 위해 Atg7 +/- 마우스와 ob/w 마우스(Jackson Laboratory)를 교배하였다. 테일 DNA의 PCR 분석을 통해 마우스 지노타이핑을 실시하였다6. 5주령부터 21주령이 될 때까지 Atg7 +/- Atg7 +/+ 마우스에 고지방식이(high-fat diet, HFD)를 제공하였다. 웨스턴 블롯팅으로 인 비보 인슐린 시그널링을 알아보기 위해여 꼬리정맥으로 5 U kg-1 레귤러 인슐린을 주사하고 7분 후에 간, 근육 및 부고환 지방 조직을 분리하였다20. 이마티닙(Novartis Pharma의 Dr. Buchdunger로부터 제공받음) 또는 트레할로스(Sigma)는 종래에 알려진 프로토콜을 수정하여 마우스에 투여하였다20. 25 mg kg-1 이마티닙 또는 2 g kg-1 트레할로스를 PBS에 녹인 후, Atg7 +/--ob/ob 마우스에 8-10주령부터 8주 동안 일주일에 3회 복강 주사하였다. 모든 동물 실험은 PHS 방침(Public Health Service Policy on Humane Care and Use of Laboratory Animals)에 따라 실시하였으며, 삼성서울병원 기관윤리심의위원회에 의해 허가되었다.
당 부하 및 인슐린 부하 검사
16시간 공복 후 1 g kg-1 글루코오스를 복강 내로 주사하여 IPGTT를 실시하였다20. HOMA-IR은 다음 공식에 따라 계산하였다21: [(공복 인슐린 × 공복 글루코오스)/22.5]. 글루코오스 주사 전(0 분), 주사 후 15, 30, 60, 120 및 180분 시점에 ACCU-CHEK glucometer(Roche)를 이용하여 측정하였다. 혈청 인슐린 농도는 ELISA 키트(Shibayagi)를 이용하여 측정하였다. IGI(insulinogenic index)는 다음과 같이 계산하였다: △인슐린15분(pM)/△글루코오스15분(mM). ITT는 6시간 이상 공복 마우스에 레귤러 인슐린 0.75 U kg-1을 복강 내 주사하여 실시하였으며, 0, 15, 30, 60 및 120분 시점에 혈당 레벨을 측정하였다. 인슐린 감수성 인덱스인 KITT는 다음과 같이 계산하였다: 0.693/t1/2×100 (% per min)60.
인 비보 자가포식(autophagy)
GFP -LC3 +-Atg7+/- 마우스를 제작하여 인 비보 자가포식 레벨을 측정하기 위해 GFP -LC3 + 마우스(도쿄대학교 Dr. Mizushima로부터 제공받음)를 Atg7+/- 마우스와 교배하였다. 또한, GFP -LC3 +-ob/ob를 만들기 위해 GFP -LC3 + 마우스와 ob/w를 교배하였다. GFP 반점은 형광 현미경으로 확인하였다17. 마우스에 30 mg kg-1 류펩틴을 투여하고 4시간 후 간에서 LC3 변환을 분석하여 인 비보 자가포식 플럭스(autophagic flux)를 평가하였다19. 자가포식 과정의 리소좀 단계를 나타내는 GFP-LC3 + 마우스 조직에서의 GFP 절단은 항-GFP 항체(Santa Cruz Biotechnology sc-9996, 1:1,000 희석)를 이용한 면역블롯 분석을 통해 확인하였다.
세포
SK-Hep1 및 Hepa1c1c7 세포는 10% FCS(fetal calf serum) 및 페니실린-스트렙토마이신(Lonza)을 추가적으로 포함하는 DMEM을 이용하여 배양하였다. MEF는 13.5일령 배아로부터 수득하였다. 24-48시간 동안 세포에 PA 및 OA를 처리하고, 세포 내 TG 양을 측정하였다. 인슐린 시그널링을 알아보기 위해 지질을 24시간 동안 처리한 다음, 100 nM 인슐린을 세포에 10분간 처리하여 면역블롯 분석을 실시하였다. 역행 2단계 콜라게나아제 관류 기술(retrograde two-step collagenase perfusion technique)61을 이용하여 C57BL/6 마우스로부터 간세포를 분리하였다.
간단히 설명하면, 1 × 간 관류 버퍼(Gibco #17701) 10 ml을 이용하여 간에 관류시킨 다음, 700 mg l-1 콜라게나아제(Sigma C5138)를 포함하는 2차 버퍼(66.7 mM NaCl, 6.7 mM KCl, 4.8 mM CaCl2 및 0.1 M HEPES, pH 7.6)로 6분 동안 분당 5 ml 속도로 관류하였다. 그 다음, 필터 게이지로 간을 관통시킨 다음 Percoll 농도구배 원심분리를 통해 간세포를 수득하였다. 복강 대식세포는 3.85% 티오글리콜레이트 배지를 이용하여 Atg7+/+ 및 Atg7+/- 마우스로부터 분리하였고, 500 ng ml-1 LPS(Sigma) 존재 또는 부재하에서 PA를 처리하였다. 24시간 후, 마우스 ELISA 키트(R&D Systems)를 이용하여 배양 상등액에서 IL-1β 양을 측정하였다.
혈액 케미스트리
혈청 ALT/AST, TG 및 총 콜레스테롤 레벨 측정은 혈액 케미스트리 분석기를 이용하여 실시하였다20. 혈청 FFA는 LabAssay NEFA 키트(Wako)를 이용하여 측정하였다.
아데노바이러스
Atg7 siRNA를 코딩하는 cDNA를 pAd-Track 트랜스퍼 벡터에 클로닝하였다. 아데노바이러스 유전자 캐리어 벡터와 함께 마우스 U6 프로모터에 의해 조절되는 Atg7 shRNA 올리고뉴클레오타이드를 포함하는 선형 재조합 pAd-Track을 사전 변형된 만능 pAdEasy-AD-293 세포에 형질감염시켜 상동 재조합을 실시하였다62. Atg7 shRNA 올리고뉴클레오타이드는 인간에 대한 공통서열 및 쥣과 Atg7(5’-TGGCTGCTACTTCTGCAATGA-3’)을 타겟으로 하였다. 아데노바이러스는 293AD 세포에서 증폭시켰으며, CsCl 밀도 구배 원심분리를 통해 분리하였다. 세포는 m.o.i.(multiplicity of infection) 50에서 Atg7 또는 대조군 siRNA를 발현하는 아데노바이러스로 감염시켰다.
EM
세포 소기관 수준에서 세포 초미세기관의 변화는 EM6를 통해 측정하였다. 스캔된 영역에서 이중막-유사 구조를 갖는 자가포식소체의 수는 소프트웨어 프로그램(ImagePro)을 이용하여 측정하였다.
면역블롯팅
8-15% SDS-PAGE에서 조직 용해물을 분리한 다음, Hybond ECL 니트로셀룰로오스 멤브레인(Amersham)으로 트랜스퍼 하고 항-JNK(#9252), -phospho-JNK Thr183/Tyr185(#9251), -IRS-1(#2382), -Akt(#9272), -phospho-Akt S473(#9271) (Cell Signaling, 1:1,000 희석), -phospho-IRS-1 Ser307 (Upstate Biotechnology #07-247, 1:1,000 희석), -LC3 (Novus NB100-2331, 1:1,000 dilution), -p62 (Progen GP62-C, 1:1,000 희석), -nitrotyrosine(Millipore #06-284, 1:1,000 희석), -p53(Calbiochem #OP03, 1:1,000 희석), -phospho p53(Cell Signaling #9284, 1:1,000 희석), -IL-1b(R&D Systems AF-401-NA, 1:1,000 희석), -caspase-1(Santa Cruz sc-514, 1:1,000 희석) 및 -β-액틴(Santa Cruz sc-47778, 1:5,000 희석) 항체를 이용하여 면역블롯 분석을 실시하였다. 면역블롯 밴드는 농도계(Bio-Rad)를 이용하여 정량하였고, 각 도면은 대조군 밴드에 표준화시켜 표현하였다.
ROS 손상
인 비보에서 단백질의 ROS 손상에 영향을 미치는 질산염 단백질의 검출은 항-니트로타이로신 항체를 이용한 면역조직화학법을 통해 실시하였다63. 카르보닐화 단백질은 키트(Millipore)를 이용한 면역블롯 분석을 통해 검출하였다. 인 비보 ROS를 검출하기 위해, 동결 조직 섹션을 10 mM DHE 용액(Invitrogen)에 담가 37℃에서 30분간 배양하였다64. PBS로 세척한 다음, 섹션을 형광 현미경으로 관찰하였다. SA-β-gal 활성을 측정하기 위해 조직을 5 mM K-페로시안화합물 및 N, N-디메틸포름아마이드에 녹인 X-gal 1 mg ml-1을 포함하는 염색 용액에 넣어 37℃에서 하룻밤동안 배양하였다65. 그 다음 조직을 광학현미경으로 관찰하였다.
ORO 염색 및 TG 측정
포르말린 고정된 세포 또는 조직 섹션을 3 mg ml-1 ORO 용액으로 30분간 염색한 후, 이소프로파놀로 염료를 제거한 다음 A540에서 측정하였다. TG 양을 측정하기 위해 클로로포름/메탄올 혼합물(2:1)을 이용하여 균질화된 조직에서 지방질을 분리하였다. 증발시킨 다음, 지방질을 1% Triton X-100이 녹아져 있는 100% 에탄올에 녹이고, 리파아제를 포함하는 프리 글리세롤 시약(Sigma)과 혼합하였다. 37℃에서 5분간 배양한 다음, A540을 측정하고 표준곡선을 이용하여 TG 농도를 계산하였다61.
SVF
SVF를 분리하기 위해 내장 지방 조직을 2 mm 이하의 작은 조각으로 잘랐다. 2 mg ml-1 콜라게나아제 용액(콜라게나아제 타입 2, Worthington)에 담가 37℃ 수조에서 45분간 배양시킨 다음, 절단된 조직을 1,000 g에서 8분간 원심분리하였다. 부유시킨 펠렛은 70-μm 메쉬를 통과시킨 다음, RBC 용해를 실시하고, 면역 블롯팅을 위해 SVF를 100 mM NaCl, 10 mM TrisCl, pH 7.6, 1 mM EDTA, 1% NP-40, 1 mM PMSF, 1 mM NaF, 1 mM Na3VO4 및 프로테아제 억제제(Roche)가 포함된 버퍼에 부유시켰다66.
단백질 분해 어세이
장수(long-lived) 단백질의 분해는 종래에 알려진 방법45을 수정하여 측정하였다. 간단히 설명하면, 세포를 콜라겐이 코팅된 플레이트에 플레이팅하여 24시간 동안 배양하였다. 그 다음, 세포를 0.5 μCi ml-1 C14-루신(Perkin Elmer)으로 16시간 동안 라벨링하였다. 단명(short-lived) 단백질을 분해시키는 배지로 배지를 교환하여 2시간 배양하고, E64d/펩스타틴 A 각 10 μg ml-1 및 20 mM NH4Cl의 존재 또는 부재하에서 라벨링되지 않은 루신 2 mM 및 지질(PA 또는 OA)을 포함하는 무혈청 배지로 교체한 다음 37℃에서 3-6시간 동안 세포를 배양하였다. 배양 분액(aliquot)은 트리클로로아세트산으로 침전시키고, 단백질 분해는 초기 세포 방사능에 상대적인 방출된 방사능의 비율로 계산하였다. 리소좀 단백질 분해는 E64d/펩스타틴 A/NH4Cl 부재 하의 단백질 분해율 및 E64d/펩스타틴 A/NH4Cl 존재 하의 단백질 분해율 차이로 정의하였다.
사멸 세포의 검출
서로 다른 부위의 3개 이상의 평행 췌장 섹션에 대해 인슐린 면역조직화학염색을 실시하고, 형태 분석 후 카운팅하여 β-세포 양을 측정하였다6. 색상 기질로서 TUNEL 시약(Roche Applied Science) 및 디아미노벤지딘(Invitrogen)을 이용하여 탈파라핀화된 섹션을 염색하여 인 비보에서 사멸 세포를 검출하였다67. 대식세포 집합체는 F4/80 항체(Abcam)에 의해 염색된 대식세포가 최대 15개로 이루어져 각각의 지방세포를 둘러싸고 있다. 이러한 대식세포 집합을 CLS로 간주하였으며, 100개 지방세포 당 CLS의 수를 계수하였다68.
FGF21 레벨 측정
혈청 FGF21 레벨은 마우스 FGF21 ELISA 키트(R&D Systems)를 이용하여 측정하였다. 인슐린 타겟 조직에서 FGF21 발현은 특이적 프라이머를 이용하여 RT-PCR을 통해 측정하였다11.
RT- PCR 및 실시간 RT- PCR
RNA는 TRIzol 시약(Invitrogen)을 이용하여 준비하였다. cDNA는 Superscript II(Promega) 및 올리고 (dT)12-18 프라이머를 이용하여 합성하였다. Tnfa , Il6 , F4/80, p21, pro- Il1b, 인간 및 쥣과 Atg7의 발현은 특이적인 프라이머 세트(표 1)를 이용한 PCR 결과로 평가하였다. RT-PCR 밴드는 농도계(Bio-Rad)를 이용하여 정량하였고, 각 도면에서 RT-PCR 밴드는 대조군 밴드에 표준화시켜 표현하였다. 실시간 RT-PCR은 ABI Prism 7000(Applied Biosystems)에서 SYBR Green I(Takara)을 이용하여 실시하였다.
프라이머 서열
이름 서열(5’→3’)
Tnfa (F): CCTGTAGCCCACGTCGTAG (R): TTGACCTCAGCGCTGAGTTG
Il6 (F): TTGCCTTCTTGGGACTGATGC (R): GTATCTCTCTGAAGGACTCTGG
F4/80 (F): CTTTGGCTATGGGCTTCCAGTC (R): GCAAGGAGGACAGAGTTTATCG
p21 (F): CGAGAACGGTGGAACTTTGAC (R): TCCCAGACGAAGTTGCCCT
pro- Il1b (F): GAATGACCTGTTCTTTGAAGT (R): TTTGTTGTTCATCTCGGAGCC
hAtg7 (F): ACCTTGGGTTGCAATGTAGC (R): CTCCTTGCTGCTTTGGTTTC
mAtg7 (F): TGTGGAGCTGATGGTCTCTG (R): TGATGGAGCAGGGTAAGA
Actin (F): GAGGCACTCTTCCAGCCTTC (R): TAGAAGCATTTGCGGTGGAC
Fgf21 (F): TACACAGATGACGACCAAGA (R): GGCTTCAGACTGGTACACAT
미토콘드리아 변화
NAD+/NADH 비율은 측정 키트(BioVision)를 이용하여 제조사의 지시에 따라 측정하였다. 미토콘드리아 전위를 측정하기 위해 복강 대식세포를 각 1 mM의 미토트래커 그린 및 미토트래커 레드(Invitrogen)로 37℃에서 25분간 염색하였다. 염색된 세포를 1% FCS가 들어간 PBS에 부유시켜 FACSVerse(BD Biosciences)로 측정하였으며, FlowJo software(TreeStar)를 이용하여 데이터를 분석하였다. 미토콘드리아 ROS 양을 측정하기 위해 세포를 5 mM MitoSOX(Invitrogen)로 37℃에서 5분간 배양하고, 상술한 방법으로 유세포분석을 실시하였다.
통계학적 분석
모든 결과값은 독립적인 3회 이상의 실험을 통해 얻은 평균±표준오차로 나타냈다. 양측 스튜던트 t-검정은 2개 그룹 간의 측정값을 비교하기 위해 사용되었다. Tukey 검정과 일원분산분석은 다수 그룹 간의 측정값을 비교하기 위해 사용되었다. 반복측정 분산분석과 본페로니 사후 검정은 그룹 간의 반복된 다수의 측정값을 비교하기 위해 사용되었다. 누락된 값이 존재할 경우, LMM(linear mixed model)을 이용한 이원분산분석을 사용하였다. P값 <0.05는 통계학적으로 유의한 차이를 나타내는 것으로 간주된다.
실험결과
Atg7 +/- -ob/ob 마우스에서 당뇨 및 인슐린 저항성 측정
Atg7 F /F(Atg7-floxed 마우스)와 CMV-Cre 마우스를 교배시켜 동형접합 Atg7 결실 생식세포를 갖는 마우스(Atg7 +/- 마우스)를 생산하였다. Atg7 +/- 마우스는 Atg7 +/+ 마우스 한배 새끼와 구별하기 어렵다. 테일 DNA를 이용한 PCR 결과, Atg7 +/- 마우스에서 플록싱된(floxed) Atg7 서열 1 카피가 결실된 것으로 나타났다(도 1a). RT-PCR 및 실시간 RT-PCR 결과, Atg7 mRNA 발현은 Atg7 +/+ 마우스와 비교하여 Atg7 +/- 마우스의 간, 근육 및 백색지방 조직(white adipose tissue, WAT)에서 현저히 낮았다(도 1b). 자가포식의 중요한 단계인 LC3-I에서 -Ⅱ로의 전환15은 공복상태인 Atg7 +/+ 마우스와 비교하여 Atg7 +/- 마우스의 조직에서 낮게 나타났다(도 1c). 또한, 자가포식의 특이적인 기질인 p62의 레벨16은 공복상태인 Atg7 +/+ 마우스와 비교하여 Atg7 +/- 마우스의 조직에서 증가되었으며(도 1c), 이러한 결과는 Atg7 +/+ 마우스와 비교하여 자가포식 플럭스(autophagic flux)가 감소된 것을 의미한다. Atg7 +/- MEF(mouse embryonic fibroblasts)에서 자가포식 유도제인 라파마이신15에 의한 LC3-I에서 -Ⅱ로의 전환은 Atg7 +/+Atg7 -/-MEF의 중간 수준으로 나타났다(도 1d). Atg7 +/- MEF에서 p62 레벨 또한 Atg7 +/+Atg7 -/-MEF의 중간 수준으로 나타났다(도 1d). Atg7 +/- 마우스에서 자가포식 감소를 확인하기 위해, Atg7 +/- 마우스와 GFP -LC3를 발현하는 형질전환 마우스(GFP -LC3 + mice)를 교배하였다17. 공복 6시간 후, 자가포식소체를 나타내는 GFP -LC3 반점의 수는 GFP -LC3 +-Atg7 +/+ 마우스와 비교하여 GFP -LC3 +-Atg7 +/- 마우스의 조직에서 현저히 적었다(도 1e). 마지막으로 ‘클램프’ 자가포식 과정에 류펩틴을 처리하고 자가포식 플럭스를 측정하였다18 , 19. 류펩틴을 처리한 공복 Atg7 +/- 마우스의 간에서 LC3-Ⅱ 레벨은 Atg7 +/+ 마우스와 비교하여 낮았으며(도 1f), 이는 Atg7 +/+ 조직과 비교하여 Atg7 +/- 조직에서의 자가포식 플럭스가 감소되었음을 나타낸다.
Atg7 +/- 마우스가 중간 수준의 자가포식 레벨 및 활성을 가진다는 것을 밝혔고, 그 다음으로 이 마우스의 대사 프로파일을 조사하였다. 비공복시 혈당치는 8개월령까지 Atg7 +/-Atg7 +/+ 마우스 사이에서 차이가 없었다(도 2a). IPGTT(Intraperitoneal glucose tolerance test)는 두 그룹간 차이가 없었다(도 2b). 혈액 케미스트리 및 체중도 차이가 없었다(도 2c-g). 자가포식 반수부전(haploinsufficiency)이 기초대사에 영향을 미치지 않고 대사 과부하에 적응하는지를 확인하기 위해 Atg7 +/- 마우스를 ob/w 마우스와 교배하여 Atg7 +/--ob/ob 마우스를 생산하였다. 흥미롭게도 Atg7 +/--ob/ob 마우스의 혈당치는 Atg7 +/+-ob/ob 마우스와 비교하여 현저히 증가되어 당뇨병 범위에 도달하였다(도 3a). 또한, IPGTT 결과, Atg7 +/+-ob/ob 마우스와 비교하여 Atg7 +/--ob/ob 마우스에서 현저히 증가된 곡선하면적(area under the curve, AUC)과 함께 심한 당불내성(glucose intolerance)이 나타났다(도 3b). 한편, Atg7 +/--ob/ob 마우스와 Atg7 +/+-ob/ob 마우스의 체중은 통계적으로 유의한 차이가 없었으며(도 4a), 이는 자가포식 반수부전이 동일한 비만 정도에 의해 부과된 대사 스트레스를 악화시킨다는 것을 의미한다. Atg7 +/+-ob/w 및 Atg7 +/--ob/w 마우스의 글루코오스 내성 및 체중은 각각 Atg7 +/+Atg7 +/- 마우스와 차이가 없었다(도 2ag). 이에 Atg7 +/+Atg7 +/- 마우스 대신 Atg7 +/+-ob/w 및 tg7 +/--ob/w 마우스를 이용하여 후속 실험을 진행하였다. 그 다음으로 Atg7 +/--ob/ob 마우스에서 당뇨병 메카니즘을 조사하였다. 글루코오스 레벨 증가에 대한 반응인 췌장 β-세포로부터의 인슐린 분비를 나타내는 IGI(insulinogenic index)20Atg7 +/+-ob/ob 마우스와 비교하여 Atg7 +/--ob/ob 마우스에서 현저히 높았으며(도 3b), 이는 β-세포 부전(failure)이 당뇨병의 1차 원인이 아니라는 것을 의미한다. Atg7 +/--ob/ob 및 Atg7 +/--ob/w 마우스의 β-세포 구조 및 양은 각각 Atg7 +/+-ob/ob 및 Atg7 +/+-ob/w 마우스와 차이가 없었다(도 4c, d). 그 다음으로 인슐린 저항성을 나타내는 HOMA-IR(homeostatic model assessment of insulin resistance) 인덱스를 계산하였다21. HOMA-IR은 Atg7 +/+-ob/ob 마우스와 비교하여 Atg7 +/--ob/ob 마우스에서 현저히 증가되었으며(도 3c), 이는 Atg7 +/--ob/ob 마우스에서 인슐린 저항성이 악화되었다는 것을 나타낸다. 또한, 인슐린 저항성 검사 ITT(Insulin tolerance test) 결과, Atg7 +/+-ob/ob 마우스와 비교하여 Atg7 +/--ob/ob 마우스에서 인슐린에 대한 손상된 반응이 나타났다(도 3d). 인슐린 감수성 인덱스인 KITTAtg7 +/+-ob/ob 마우스와 비교하여 Atg7 +/--ob/ob 마우스에서 더욱 감소되었으며, 비당뇨 마우스와 비교하여 감소된 KITT값을 나타냈다(도 4e). Atg7 +/--ob/ob 마우스에서 악화된 인슐린 저항성을 확인하기 위해 인 비브 인슐린 시그널링을 조사하였다. Atg7 +/+-ob/ob 마우스와 비교하여 Atg7 +/--ob/ob 마우스 조직에서 인슐린-유도 Akt S473 인산화는 더욱 손상되었으며, Atg7 +/+-ob/w 마우스와 비교하여 인슐린-유도 Akt 인산화도 감소되었다(도 4e).
Atg7 +/- -ob/ob 마우스에서 산화 스트레스 및 지질 손상
Atg7 +/--ob/ob 마우스의 악화된 인슐린 저항성에 대한 메커니즘을 조사하였다. 인슐린 저항성의 주요 매개자인 JNK 인산화22 , 23Atg7 +/+-ob/ob 마우스와 비교하여 Atg7 +/--ob/ob 마우스 조직에서 더욱 잘 나타났다(도 5a). IRS-1 S307 인산화는 JNK 인산화 다운스트림을 활성화시키고, IRS-1 시그널링을 억제한다22. IRS-1 S307 인산화는 Atg7 +/+-ob/ob 마우스와 비교하여 Atg7 +/--ob/ob 마우스 조직에서 더욱 두드러지게 나타났다(도 5a). 그 다음으로 활성산소종이 자가포식 결핍에서 증가될 수 있는지24 , 25 그리고 JNK를 인산화26시키는지에 대하여 실험하였다. ROS 손상을 나타내는 니트로타이로신 축적은 Atg7 +/+-ob/ob 마우스 또는 Atg7 +/--ob/w 마우스와 비교하여 Atg7 +/--ob/ob 마우스 간에서 더욱 두드러지게 나타났다(도 5b). ROS 생산을 반영하는 DHE(dihydroethidium)-염색 세포 군집은 Atg7 +/+-ob/ob 마우스에서 드문드문 있는 반면, Atg7 +/--ob/ob 마우스 간에서는 잘 관찰되었다. Atg7 +/--ob/w 또는 Atg7 +/+-ob/w 마우스의 간에서 DHE-염색 세포는 거의 관찰되지 않았다(도 6a). ROS 손상을 나타내는 단백질 카르보닐화는 Atg7 +/+-ob/ob 또는 Atg7 +/--ob/w 마우스와 비교하여 Atg7 +/--ob/ob 마우스 조직에서 증가되었다(도 5c). ROS에 의해 비만 마우스 조직에서 p53 활성이 증가될 수 있기 때문에27 , 28 자가포식-반수부전 마우스의 인슐린 타겟 조직의 p53을 측정하였다. p53 인산화 및 이의 다운스트림인 p21의 발현은 Atg7 +/+-ob/ob 또는 Atg7 +/--ob/w 마우스와 비교하여 Atg7 +/--ob/ob 마우스 조직에서 더욱 증가된 것으로 나타났다(도 5d). ROS 손상을 반영하는 노화-유사 표현형 인덱스인 SA-β-gal 활성27 , 29Atg7 +/+-ob/ob 마우스에서 완만하게 증가한 것과 비교하여 Atg7 +/--ob/ob 마우스의 WAT에서는 더욱 두드러지게 증가하였다(도 6b).
또한, 자가포식에 의해 영향 받을 수 있는 지질의 양을 측정하였다30. ORO(Oil Red O) 염색 및 지질 추출 또는 생화학적 방법을 통해 Atg7 +/--ob/w 마우스 간에서 트리글리세리드 양을 측정한 결과, Atg7 +/+-ob/w 마우스에서 나타난 결과와 큰 차이가 없었다(도 7a-b). 그러나, Atg7 +/--ob/ob 마우스 간의 TG양은 Atg7 +/+ ob/ob 마우스와 비교하여 현저히 높았으며(도 7a-b), 이는 Atg7 +/--ob/ob 마우스에서 불충분한 ‘지질용해(lipophagy)’가 일어났기 때문일 수 있다. 전자현미경 관찰 결과, 지방방울 크기는 Atg7 +/+-ob/ob 마우스와 비교하여 Atg7 +/--ob/ob 마우스의 간에서 더 크게 나타났다(도 7c). Atg7 +/+-ob/ob 마우스와 비교하여 Atg7 +/--ob/ob 마우스에서 혈청 ALT/AST(alanine aminotransferase/aspartate aminotransferase) 레벨이 현저히 높게 나타났으며, 이는 아마도 간에서의 지질 축적 증가에 의한 것으로 보인다(도 7d). 또한, 혈청 FFA(free fatty acid) 레벨도 Atg7 +/+-ob/ob 마우스와 비교하여 Atg7 +/--ob/ob 마우스에서 현저히 높게 나타났다(도 7e). 꾸준히 증가된 혈청 ALT/AST가 나타나는 간세포 사멸은 Atg7 +/+-ob/ob 마우스와 비교하여 Atg7 +/--ob/ob 마우스에서 증가되었다(도 7f).
지질과부하(lipid overload)에 의한 자가포식
Atg7 +/+-ob/ob 마우스에서의 불충분한 자가포식이 대사 스트레스에 대한 적응 변화를 완전히 뒷받침하지 못하기 때문에 GFP -LC3 +-ob/ob 마우스를 제작하여 비만 및 자가포식 관계를 조사하였다. LC3 반점이 GFP -LC3 +-ob/w 마우스에서는 거의 발견되지 않은 반면, GFP -LC3 +-ob/ob 마우스 조직에서는 잘 관찰되었다(도 8a). LC3 반점 수는 GFP -LC3 +-ob/w 마우스와 비교하여 GFP -LC3 +-ob/ob 마우스 조직에서 현저히 증가하였으며(도 8a), 이는 비만 마우스에서 자가포식 레벨이 증가된다는 것을 나타낸다. 또한, 전자 현미경 관찰결과, ob/w 마우스와 비교하여 ob/ob 마우스의 조직에서 자가포식소체의 수가 현저히 많았다(도 8b). 증가된 LC3 반점이 증가된 자가포식의 활성화 또는 자가포식의 억제15에 의한 것인지 확인하기 위해 항-GFP 항체를 이용하여 면역블롯 분석을 실시하였다. 자가포식 기질의 리소좀 분해 및 자가포식 활성을 반영하는 GFP의 절단31GFP -LC3 +-ob/w 마우스에서 관찰되지 않고, GFP -LC3 +-ob/ob 마우스 조직에서 관찰되었으며(도 8c), 이는 ob/ob 마우스에서 자가포식 플럭스가 증가되었다는 것을 나타낸다. 한편, 인 비보 류펩틴 투여에 의한 리소좀 단계에서의 자가포식 ‘클램핑’후 LC3 전환을 조사하였다19. LC3 전환은 류펩틴을 처리한 ob/ob 마우스의 간에서 증가되었으며(도 8d), 이는 ob/ob 마우스 조직에서의 자가포식 레벨 증가가 자가포식 플럭스 증가에 의한 것임을 나타낸다. 그러나, ob/ob 마우스 간에서의 p62 레벨은 류펩틴 처리 조건의 ob/w 마우스와 비교하여 증가되었으며(도 8d), 이는 자가포식 활성 증가와 일치하지 않는 것이다15. 이에, 자가포식 단백질 기질의 최종적인 분해를 나타내는 단백질 분해 어세이를 SK-Hep1 세포를 이용하여 실시하였다15. 장수 단백질의 리소좀 분해는 PA(palmitic acid) 또는 OA(oleic acid)에 의해 현저히 억제되며(도 8e), 이는 자가포식 활성이 세포 내 지질 가공을 가능하게 하는 지질에 의해 증가되나, 단백질 분해는 자가포식 활성 증가에도 불구하고 ‘지질용해’에 대한 자가포식 기관 격리의 결과로서 감소된다는 것을 의미한다. 또한, 이러한 결과는 지질 과부하가 Atg7 +/--ob/ob 마우스에서 충족되지 않는 자가포식에 대한 요구를 증가시키는 것을 의미한다.
그 다음으로 인 비트로에서 지질을 로딩한 후, 자가포식 부전이 세포 내 지질 양에 영향을 미치는지에 대하여 실험하였다. PA 및 OA 혼합물을 로딩한 다음 TG의 양은 Atg7 +/+ MEF와 비교하여 Atg7 +/- MEF에서 현저히 증가하였다(도 8f). 이어서 자가포식이 불충분한 세포에서 증가된 지질 양이 인슐린 시그널링에 영향을 미치는지에 대한 실험을 실시하였다. 인슐린 시그널링은 MEF보다 간세포와 더 관련이 있기 때문에 Atg7 +/- MEF 대신에 Atg7 siRNA를 발현하는 아데노바이러스에 의해 감염된 간세포주를 실험에 이용하였다. 아데노바이러스 Atg7 siRNA 발현은 SK-Hep1 또는 Hepa1c1c7 세포에서 ~50%까지 Atg7 mRNA 발현을 감소시켰다(도 9a). PA 및 OA 혼합물을 로딩한 다음 TG의 양은 대조군-감염 세포와 비교하여 Atg7 siRNA를 발현하는 아데노바이러스에 의해 감염된 세포에서 현저히 높았다(도 9b). 또한, PA 및 OA 혼합물에 의한 인슐린 저항성은 대조군 siRNA 발현과 비교하여 지질 로딩된 세포에서 아데노바이러스 발현에 의해 악화되었으며(도 9c), 이는 지질 과부화와 함께 자가포식 불충분이 지질 축적 증가 및 인슐린 저항성 악화를 초래한다는 것을 의미한다. 일관되게 JNK 활성화 및 IRS-1 S307 인산화는 대조군-감염 세포와 비교하여 Atg7 siRNA를 발현하는 아데노바이러스에 의해 감염된 세포에서 더욱 두드러지게 나타났다(도 9d).
자가포식 불충분 상태에서 증가된 염증반응
자가포식 결핍은 전염증반응을 일으키며32 , 33, 염증반응은 지질 손상과 연관된 인슐린 저항성의 주요 요소이기 때문에 염증반응 마커의 발현을 조사하였다. Atg7 +/--ob/ob 마우스의 WAT에서 지질 관련 염증을 나타내는 CLS(crown-like structures)34의 수는 Atg7 +/+-ob/ob 마우스와 비교하여 현저히 증가되었다(도 10a). RT-PCR(도 10b) 및 실시간 RT-PCR(도 11ac)은 Tnfα 또는 Il6와 같은 염증성 사이토카인의 발현을 나타내며, 대식세포 침투를 나타내는 F4/80은 Atg7 +/+-ob/ob 마우스와 비교하여 Atg7 +/--ob/ob 마우스 조직에서 증가되었다.
염증조절복합체(inflammasome)의 활성화는 지질-유도 인슐린 저항성에 중요한 역할을 하며35 , 36, 자가포식 결핍은 손상된 미토콘드리아의 축적에 의해33 IL-1β의 성숙을 증가시키므로32 IL-1β의 발현 및 염증조절복합체의 활성화를 조사하였다. RT-PCR(도 5b) 및 실시간 RT-PCR(도 11d) 결과, pro- Il1b 발현은 Atg7 +/+-ob/w 마우스와 비교하여 Atg7 +/+-ob/ob 마우스 WAT의 SVF(stromal vascular fraction)에서 증가되었다. 그러나, Atg7 +/--ob/ob 마우스 조직에서 pro- Il1b 발현은 Atg7 +/+-ob/ob 마우스와 비교하여 증가되지 않았다(도 10b 및 도 11d). 반면, 항-IL-1β 항체를 이용한 면역블롯팅을 통해 측정한 pro-IL-1β에서 IL-1β로의 성숙은 Atg7 +/+-ob/ob 마우스와 비교하여 Atg7 +/--ob/ob 마우스 SVF에서 뚜렷하게 증가되었다(도 10c). 염증조절복합체 활성화 및 IL-1β 성숙에 중요한 pro-caspase-1에서 caspase-1으로의 절단은 Atg7 +/+-ob/ob 마우스와 비교하여 Atg7 +/--ob/ob 마우스 SVF에서 증가되었으며(도 10d), 이는 Atg7 +/+-ob/ob 마우스와 비교하여 Atg7 +/--ob/ob 마우스에서 pro- Il1b의 유도가 염증조절복합체 활성화 증가에 기여하는 것이라기보다 자가포식 반수부전 상태에서 pro-IL-1β에서 IL-1β로의 성숙을 증가시킨다는 것을 의미한다. 이를 인 비트로에서 재확인하기 위해 자가포식 반수부전 대식세포가 지질 처리에 따른 반응으로 IL-1β를 더 분비하는지를 실험하였다. PA와 함께 LPS(lipopolysaccharide)를 Atg7 +/--대식세포에 처리하고 ELISA를 통해 IL-1β의 분비 정도를 측정한 결과, Atg7 +/+-대식세포 보다 Atg7 +/--대식세포에서 IL-1β가 현저히 많이 분비되는 것으로 나타났으며(도 10e), 이는 자가포식 불충분 조건에서 대사 스트레스에 대한 반응으로 증가된 염증조절복합체 활성화가 Atg7 +/--ob/ob 마우스의 인슐린 저항성 및 당뇨병의 원인이 된다는 것을 의미한다.
자가포식 반수부전과 연관된 염증조절복합체 활성화의 증가에 대한 메커니즘을 규명하기 위해 염증조절복합체 활성화에 중요한 요소인 미토콘드리아 이벤트에 대하여 실험을 실시하였다33 , 38. Atg7 +/+-대식세포에서 PA 또는 LPS 단독 처리에 의해 나타난 NAD+/NADH 감소 비율은 Atg7 +/--대식세포에서 더욱 감소된 것으로 나타났다(도 10f). 또한, 미토콘드리아 ROS 양이 염증조절복합체 활성화에 중요하며, 미토콘드리아 기능장애에 의해 증가될 수 있다는 것을 확인하였다37. MitoSox 염색을 통해 측정한 미토콘드리아 ROS 양은 LPS 단독 처리 시 그 효과가 적었으나, 야생형 대식세포에서 PA 및 LPS를 함께 처리한 경우에는 미토콘드리아 ROS 양이 현저히 증가되었다(도 10g). PA 및 LPS 동시 처리에 의한 미토콘드리아 ROS 양 증가는 Atg7 +/--대식세포 더 크게 나타으며(도 10g), 이는 자가포식 부전이 지질 손상에 의한 미토콘드리아 ROS 생산 및 염증조절복합체 활성화를 증가시킨다는 것을 뒷받침한다33 , 38. 미토트래커 그린 및 미토트래커 레드로 염색한 후 유세포 분석을 실시한 결과, PA 및 LPS를 처리한 후 미토트래커 레드에 의해 염색된 세포 분획이 감소되었고 따라서 미토콘드리아 전위가 감소하였으며, 한편, 대조군 대식세포와 비교하여 Atg7 +/--대식세포에서 미토트래커 레드에 의해 염색된 세포 분획은 증가하였다(도 10h). 이는 Atg7 +/--대식세포에서 관찰되는 염증조절복합체 활성화 증가가 미토콘드리아 기능장애에 중요한 역할을 한다는 것을 의미한다.
Atg7 +/- -마우스에서 대사 프로파일에 대한 고지방 식이의 효과
ob/ob 마우스는 렙틴 시그널링 전체가 결핍된 마우스로서 보다 심한 생리학적 대사 스트레스를 부과하기 위해 고지방식이(high-fat diet, HFD)를 제공하였다. 21주간 HFD를 제공한 Atg7 +/--마우스는 HFD를 제공한 Atg7 +/+-마우스와 비교하여 비공복 혈당치가 높은 것으로 나타났다(도 12a). 이원분산분석 결과, HFD를 제공한 전체 기간동안 Atg7 +/-Atg7 +/+ 마우스의 혈당 프로파일은 큰 차이를 나타내지 않은 반면, 각각의 t-검정 결과에서는 HFD를 제공한 16-18주 사이에 Atg7 +/+ 마우스와 비교하여 Atg7 +/- 마우스의 비공복 혈당치가 현저히 증가한 것으로 나타났다(도 12a). 이는 자가포식 반수부전이 대사 스트레스를 조절하는 능력을 손상시킨다는 것을 의미한다. 또한, HFD 식이 18주 후 Atg7 +/- 마우스에서 공복 혈당치는 Atg7 +/+ 마우스와 비교하여 현저히 증가하였다(도 12b). HFD 식이 18주 후 IPGTT를 실시한 결과, 증가된 AUC를 나타내는 Atg7 +/+ 마우스와 비교하여 Atg7 +/- 마우스에서 당불내성이 현저히 악화되었다(도 12c). 또한, 인슐린 저항성을 나타내는 HOMA-IR 인덱스는 Atg7 +/+ 마우스와 비교하여 Atg7 +/- 마우스에서 증가하였다(도 12d). HFD 식이 18주 후 Atg7 +/- 마우스에서 ITT를 실시한 결과, HFD-식이 Atg7 +/+ 마우스와 비교하여 감소된 KITT 값을 나타냈으며 이것은 인슐린 감수성 감소를 나타낸다(도 12e). 체중은 정상 식이 또는 HFD 식이한 Atg7 +/-Atg7 +/+ 마우스 간에 차이가 없었다(도 13a). HFD 식이 18주 후 IGI는 Atg7 +/+ 마우스와 비교하여 Atg7 +/- 마우스에서 증가되었으며, 이는 인슐린 저항성 증가에 따른 β-세포의 변화를 나타낸다(도 13b). HFD 식이 18-21주 후 ORO 염색을 통해 간 TG 양을 측정한 결과, Atg7 +/+ 마우스와 비교하여 Atg7 +/- 마우스에서 혈청 FFA 및 ALT/AST 레벨이 현저히 증가하였다(도 13ce).
자가포식 증진제의 대사 효과
상술한 결과에 따르면, 대사 과부하 상태에서 자가포식 부전은 지질 양의 증가 및 인슐린 저항성 악화를 초래하는 것으로 나타났으며 최종적으로 자가포식 증진제의 대사 효과를 규명하고자 실험을 실시하였다. 인 비트로에서 자가포식 증진 효과를 갖는 것으로 알려진 이마티닙을 실험에 사용하였다39 , 40. E64d/펩스타틴 A를 전처리한 간세포를 이용하여 이마티닙이 자가포식 플럭스를 증가시키는지를 확인하였다(도 14a). 또한, 이마티닙이 인 비보에서 자가포식 플럭스를 증가시킬 수 있는지도 확인하였다. 류펩틴과 함께 마우스에 이마티닙을 투여한 경우, 간에서 LC3-I에서 -Ⅱ로의 전환은 류펩틴을 단독 투여했을 때와 비교하여 현저히 증가하였으며(도 15a), 이는 이마티닙이 인 비보에서 자가포식 플럭스를 증가시킨다는 것을 의미한다. 또한, 이마티닙은 대조군과 비교하여 GFP-LC3 + 마우스 조직에서 GFP 절단 증가를 유도하며(도 14b), 이는 이마티닙이 인 비보에서 자가포식 활성을 증진시킨다는 것을 나타낸다. 인 비보 및 인 비트로에서 이마티닙의 자가포식-증진 효과를 확인하기 위해 Atg7 +/--ob/ob 마우스에 이마티닙을 투여하고 혈당을 모니터링하였다. 이원분산분석 결과, 이마티닙은 Atg7 +/--ob/ob 마우스에서 비공복 혈당치를 현저히 감소시켰다(도 15b). Atg7 +/--ob/ob 마우스에서 이마티닙에 의해 유도된 혈당치 감소는 이마티닙을 8주간 처리한 마우스에 류펩틴을 투여한 후 측정한 간에서의 자가포식 활성 증가와 관련되어 있다(도 14c). 체중은 이마티닙 투여에 의해 크게 영향받지 않았으며(도 14d), 이것은 이마티닙(25 mg/kg-1)이 독성 또는 식욕 감퇴 효과를 나타내지 않는다는 것을 의미한다. 또한, IPGTT 및 ITT 결과 현저한 글루코오스 내성 및 인슐린 감수성 개선 효과가 나타났으며(도 15c, d), 이것은 각각 감소된 AUC 및 증가된 KITT 값과 관련되어 있다(도 14e). 간 TG 양 및 혈청 ALT/AST 레벨은 Atg7 +/--ob/ob 마우스에 이마티닙을 투여함에 따라 현저히 감소되었다(도 14f, g). 더욱이, 간 및 근육에서 인슐린에 의해 유도된 Akt S473 인산화는 이마티닙에 의해 현저히 향상되며, 이것은 이마티닙이 인슐린 감수성을 증진시킴으로써 글루코오스 프로파일을 개선시킨다는 것을 의미한다(도 15e). 일관적으로 간 및 근육에서 JNK 및 IRS-1 S307 인산화는 이마티닙에 의해 감소된다(도 15f). 또한, 이마티닙은 Atg7 +/+-ob/ob 마우스의 대사 프로파일을 개선시키며, 체중 변화없이 IPGTT 및 ITT에서 글루코오스 내성 및 인슐린 감수성을 증진시킨다(도 14h-k). 이것은 db/db 마우스를 이용한 종래 연구와 유사한 결과이며, 이마티닙의 효과가 유전적 자가포식 결핍 마우스에 제한되지 않는다는 것을 의미한다.
이마티닙은 자가포식 외에 다른 경로를 통해 신체대사에 영향을 미칠 수 있기 때문에22 Atg7 +/+-ob/ob 마우스의 대사 프로파일에서 다른 자가포식 증진제의 효과에 대하여 실험을 실시하였다. 본 발명자들은 자가포식 활성을 증진시켜 신경퇴화를 억제시키는 것으로 보고된 트레할로스를 선택하였다41 , 42. 실험 결과, 트레할로스는 인 비트로에서 간세포의 자가포식 플럭스를 증진시켰다(도 14a). 8주간 Atg7 +/+-ob/ob 마우스에 트레할로스를 투여하여 이원분산분석을 실시한 결과, 대사 프로파일이 크게 개선되었다(도 15b). 이것은 자가포식 활성 증진이 대사 스트레스 하에서 자가포식 부전 마우스의 신체 대사에 유익한 효과를 나타낼 수 있다는 것을 보여준다. 또한, IPGTT 및 ITT에서 8주간 트레할로스를 투여한 Atg7 +/--ob/ob 마우스의 글루코오스 내성 및 인슐린 감수성이 현저히 개선된 것으로 나타났으며, 이러한 결과는 감소된 AUC 및 증가된 KITT 값을 동반한다(도 15c, d 및 도 14e). Atg7 +/--ob/ob 마우스에서 트레할로스 투여에 의한 개선된 대사 프로파일은 8주간 트레할로스를 투여한 Atg7 +/--ob/ob 마우스에 류펩틴을 투여한 후 나타난 LC3-I에서 -Ⅱ로의 전환 증가에 의해 증명된 인 비보 자가포식 플럭스 증가를 동반한다(도 14c). Atg7 +/--ob/ob 마우스의 간 TG 양 및 혈청 ASL/ALT 레벨은 8주간의 트레할로스 투여에 의해 현저히 감소한다(도 14f, g).
이상으로 본 발명의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.

Claims (10)

  1. 다음 단계를 포함하는 당뇨병 치료제의 스크리닝 방법:
    (a) Atg7 +/--ob/ob 형질을 나타내는 인간을 제외한 동물에 시험물질을 투여하는 단계; 및
    (b) 상기 동물로부터 당뇨병 또는 당대사 이상 증상과 상관 관계가 있는 혈액학적 또는 조직학적 지표 값을 측정하는 단계로서 시험물질이 상기 혈액학적 또는 조직학적 지표 값을 유의하게 정상적으로 변화시키는 경우 상기 시험물질은 당뇨병 치료제로 판단된다.
  2. 제 1 항에 있어서, 상기 동물은 포유동물인 것을 특징으로 하는 방법.
  3. 제 2 항에 있어서, 상기 포유동물은 마우스, 랫트, 돼지 또는 원숭이인 것을 특징으로 하는 방법.
  4. 제 1 항에 있어서, 상기 혈액학적 또는 조직학적 지표 값은 혈중 당뇨관련 성분, 인슐린 저항성, 혈중 글루코오스 수준 및 혈중 인슐린 수준으로 구성된 군으로부터 선택된 어느 하나 이상인 것을 특징으로 하는 방법.
  5. 제 4 항에 있어서, 상기 혈중 당뇨관련 성분은 트리글리세리드, 콜레스테롤, 유리지방산, ALT, AST, HDL 및 LDL로 구성된 군으로부터 선택된 어느 하나인 것을 특징으로 하는 방법.
  6. 다음 단계를 포함하는 당뇨병 치료제의 치료 효능을 분석하는 방법:
    (a) Atg7 +/--ob/ob 형질을 나타내는 인간을 제외한 동물에 당뇨병 치료제를 투여하는 단계; 및
    (b) 상기 동물로부터 당뇨병 또는 당대사 이상 증상과 상관 관계가 있는 혈액학적 또는 조직학적 지표 값을 측정하여 당뇨병 치료제의 치료 효능을 결정하는 단계.
  7. Atg7 +/--ob/ob 형질을 나타내는 인간을 제외한 동물인 것을 특징으로 하는 당뇨병 동물모델.
  8. 제 7 항에 있어서, 상기 동물모델은 Atg7 +/- 동물 및 상기 Atg7 +/- 동물과 동종의 ob/w 동물을 교배하여 얻는 것을 특징으로 하는 동물모델.
  9. 제 7 항에 있어서, 상기 동물은 포유동물인 것을 특징으로 하는 동물모델.
  10. 제 9 항에 있어서, 상기 포유동물은 마우스, 랫트, 돼지 또는 원숭이인 것을 특징으로 하는 동물모델.
PCT/KR2015/007079 2014-09-17 2015-07-08 Atg7+/--ob/ob 형질을 나타내는 당뇨병 동물모델 및 이를 이용한 당뇨병 치료제의 스크리닝 방법 Ceased WO2016043414A1 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201462051902P 2014-09-17 2014-09-17
US62/051,902 2014-09-17
KR10-2015-0061829 2015-04-30
KR1020150061829A KR101744158B1 (ko) 2014-09-17 2015-04-30 Atg7+/--ob/ob 형질을 나타내는 당뇨병 동물모델 및 이를 이용한 당뇨병 치료제의 스크리닝 방법

Publications (1)

Publication Number Publication Date
WO2016043414A1 true WO2016043414A1 (ko) 2016-03-24

Family

ID=55533430

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2015/007079 Ceased WO2016043414A1 (ko) 2014-09-17 2015-07-08 Atg7+/--ob/ob 형질을 나타내는 당뇨병 동물모델 및 이를 이용한 당뇨병 치료제의 스크리닝 방법

Country Status (1)

Country Link
WO (1) WO2016043414A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116284313A (zh) * 2021-12-09 2023-06-23 中国医科大学 一种新型多肽在制备糖尿病药物中的应用

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070011755A1 (en) * 2003-08-18 2007-01-11 Betagnon Ab Diabetes type 2 animal model
US20080320609A1 (en) * 2005-01-31 2008-12-25 University Of Geneva Diabetes Model Animal
KR20110116518A (ko) * 2010-04-19 2011-10-26 강원대학교산학협력단 제1형 및 제2형의 혼합형 당뇨질환 동물모델 및 이의 제조방법

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070011755A1 (en) * 2003-08-18 2007-01-11 Betagnon Ab Diabetes type 2 animal model
US20080320609A1 (en) * 2005-01-31 2008-12-25 University Of Geneva Diabetes Model Animal
KR20110116518A (ko) * 2010-04-19 2011-10-26 강원대학교산학협력단 제1형 및 제2형의 혼합형 당뇨질환 동물모델 및 이의 제조방법

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
LIM, Y.-M. ET AL.: "Systemic autophagy insufficiency compromises adaptation to metabolic stress and facilitates progression from obesity to diabetes", NATURE COMMUNICATIONS, vol. 26, no. 5, 26 September 2014 (2014-09-26), pages 1 - 14 *
QUAN, W. ET AL.: "Autophagy deficiency in beta cells leads to compromised unfolded protein response and progression from obesity to diabetes in mice", DIABETOLOGIA, vol. 55, no. 2, February 2012 (2012-02-01), pages 392 - 403, XP019994243, DOI: doi:10.1007/s00125-011-2350-y *
QUAN, W. ET AL.: "Role of autophagy in the control of body metabolism", ENDOCRINOLOGY AND METABOLISM, vol. 28, no. 1, March 2013 (2013-03-01), Seoul, pages 6 - 11 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116284313A (zh) * 2021-12-09 2023-06-23 中国医科大学 一种新型多肽在制备糖尿病药物中的应用

Similar Documents

Publication Publication Date Title
Lim et al. Systemic autophagy insufficiency compromises adaptation to metabolic stress and facilitates progression from obesity to diabetes
Christidi et al. Regulated cell death pathways in doxorubicin-induced cardiotoxicity
Wang et al. Omentin-1 attenuates lipopolysaccharide (LPS)-induced U937 macrophages activation by inhibiting the TLR4/MyD88/NF-κB signaling
Zhou et al. Vascular inflammation, insulin resistance, and endothelial dysfunction in salt-sensitive hypertension: role of nuclear factor kappa B activation
Abedini et al. RAGE binds preamyloid IAPP intermediates and mediates pancreatic β cell proteotoxicity
Rudich et al. Cellular mechanisms of insulin resistance, lipodystrophy and atherosclerosis induced by HIV protease inhibitors
Qatanani et al. Mechanisms of obesity-associated insulin resistance: many choices on the menu
Panagaki et al. Liraglutide restores chronic ER stress, autophagy impairments and apoptotic signalling in SH-SY5Y cells
WO2018030879A1 (ko) 아모디아퀸 및 항당뇨 약물을 유효성분으로 함유하는 당뇨병의 예방 또는 치료용 약학적 조성물
WO2017078440A1 (ko) 신경세포 손실 예방 및 재생 효능을 가지는 펩티드 및 이를 포함하는 조성물
Peterson et al. Oxidized HDL is a potent inducer of adipogenesis and causes activation of the Ang-II and 20-HETE systems in human obese females
Gupta et al. β-Cell mass restoration by α7 nicotinic acetylcholine receptor activation
Khan et al. Differential expression of glucagon-like peptide-2 (GLP-2) is involved in pancreatic islet cell adaptations to stress and beta-cell survival
WO2019182370A1 (ko) Cox2 아세틸화제를 유효성분으로 포함하는 퇴행성 신경질환의 예방 또는 치료용 약학적 조성물
WO2016043414A1 (ko) Atg7+/--ob/ob 형질을 나타내는 당뇨병 동물모델 및 이를 이용한 당뇨병 치료제의 스크리닝 방법
WO2022055334A1 (ko) 폐 섬유화 질환의 예방 또는 치료용 조성물
M. Kirby et al. CYP2A5 induction and hepatocellular stress: an adaptive response to perturbations of heme homeostasis
WO2018080146A2 (ko) 단백질 탈 인산화 효소 1 억제 펩타이드를 포함하는 혈관 질환 치료용 조성물
Xu et al. Prohibitin: a prime candidate for a pleiotropic effector that mediates sex differences in obesity, insulin resistance, and metabolic dysregulation
WO2010011111A4 (ko) 뎁손을 유효성분으로 함유하는 노화조절용 및/또는 수명연장용 조성물
WO2009151304A2 (ko) 에이케이에이피일이를 함유하는 조성물 및 동물 모델로서 에이케이에이피일이 돌연변이 제브라피쉬의 용도
Gao et al. Hepassocin is required for hepatic outgrowth during zebrafish hepatogenesis
KR101744158B1 (ko) Atg7+/--ob/ob 형질을 나타내는 당뇨병 동물모델 및 이를 이용한 당뇨병 치료제의 스크리닝 방법
WO2023090971A1 (ko) 직접교차분화 유도용 조성물 및 이로 처리된 줄기세포
WO2014157965A1 (ko) P34의 발현 억제제 또는 활성 억제제를 유효성분으로 포함하는 암의 치료 또는 전이 억제용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15842958

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15842958

Country of ref document: EP

Kind code of ref document: A1