WO2016043414A1 - Diabetes animal model having atg7+/--ob/ob character, and screening method for diabetes therapeutic agent using same - Google Patents

Abstract

The present invention provides a diabetes animal model, a screening method for a diabetes therapeutic agent using the model, and a method for analyzing the effect of a diabetes therapeutic agent. The animal model of the present invention shows diverse glycometabolic abnormalities such as an increase of a diabetes-related component in blood, an increase of a glucose level in blood, an aggravation of insulin resistance, an increase of a triglyceride level in liver, an increase of serum Alt/AST, an increase of accumulation of fatty liver, and an increase of inflammatory reaction, and is an animal model appropriate for understanding the development process from obesity to diabetes and for screening a diabetes therapeutic agent. The animal model of the present invention can be effectively used in the study of the development process from obesity to diabetes, and in the development of a therapeutic agent for diabetes related to obesity and inflammatory reaction.

Description

Diabetes animal model showing ATG7 + /-OB / OB trait and screening method for diabetes treatment using same

The present invention relates to a diabetic animal model showing Atg7 ^+/- -ob / ob trait and a method for screening a diabetic therapeutic agent using the same.

Type 2 diabetes is the result of a combination of insulin resistance and relative insulin deficiency. Autophagy is a series of sequestered cytoplasmic wastes, endogenous or denatured organelles that are degraded by biphasic autophagosomes in cells, which are combined with lysosomes and degraded by digestive enzymes in the lysosomes. It is a process. Downstream (lower) molecules of insulin such as insulin and mTOR are well known as inhibitors of autophagy ¹ . Self predators are important in controlling the quality of organelles such as mitochondria and decisive ER (endoplasmic reticulum) on the survival / function and insulin sensitivity of the cells within the cell energy homeostasis and β- ^2-4. Therefore, autophagy plays an important role in metabolism by regulating hormonal action and organelle function, and diabetes can occur when autophagy is impaired. On the other hand, who is the paper's reporting on predation and diabetes, but the thesis that a particular organization only Self and things been studied in organisms is not at all a predatory expression and worse and articles ^{7, 9,} diabetes and that metabolism is improved in accordance with each organization ⁸ is reported. However, if a predator who is not expressed in the whole organization did not go because he died before you were born a broad study of the self-predator role in diabetes and metabolism ^12-14. Therefore, in this paper, the autophagy genes were developed using mice in which only 50% of all tissues were expressed.

Throughout this specification, many papers and patent documents are referenced and their citations are indicated. The disclosures of cited papers and patent documents are incorporated herein by reference in their entirety, and the level of the technical field to which the present invention belongs and the contents of the present invention are more clearly explained.

[Preceding technical literature]

Kanazawa, T. et al. J. Biol. Chem. 279, 8452459 (2004).

2. Chang, I. et al. J. Immunol. 172, 7008014 (2004).

3. Ozcan, U. et al. Science 306, 45761 (2004).

Petersen, K. F. et al. Science 300, 1140 142 (2003).

5. Ebato, C. et al. Cell Metab. 8, 32532 (2008).

6. Jung, H. S. et al. Cell Metab. 8, 31824 (2008).

7. Singh, R. et al. J. Clin. Invest. 119, 3329339 (2009).

8. Yang, L., Li, P., Fu, S., Calay, E. S. & Hotamisligil, G. S. Cell Metab. 11, 46778 (2010).

9. Zhang, Y. et al. Proc. Natl Acad. Sci. USA 106, 198609865 (2009).

10. Komatsu, M. et al. J. Cell Biol. 169, 42534 (2005).

11.Kim, K. H. et al. Nat. Med. 19, 832 (2013).

12. He, C. et al. Nature 481, 51115 (2012).

13. He, C. et al. Cell 154, 1085099 (2013).

14. Pyo, J. O. et al. Nat. Commun. 4, 2300 (2013).

15. Klionsky, D. J. et al. Autophagy 8, 44544 (2012).

16. Komatsu, M. et al. Cell 131, 1149 163 (2007).

17. Mizushima, N., Yamamoto, A., Matsui, M., Yoshimori, T. & Ohsumi, Y. Mol. Biol. Cell 15, 1101111 (2004).

18. Rubinsztein, D. C. Nature 443, 78086 (2006).

19. Ueno, T., Muno, D. & Kominami, E. J. Biol. Chem. 266, 189958999 (1991).

20. Han, M. S. et al. Diabetes 58, 32936 (2009).

21. Cai, D. et al. Nat. Med. 11, 18390 (2005).

22. Aguirre, V. et al. J. Biol. Chem. 277, 1531537 (2002).

23. Solinas, G., Naugler, W., Galimi, F., Lee, M.-S. & Karin, M. Proc. Natl Acad. Sci. USA 103, 164546459 (2006).

24. Mathew, R. et al. Cell 137, 1062075 (2009).

25. Matsumoto, N. et al. Biochem. Biophys. Res. Commun. 368, 64349 (2008).

26. Kamata, H. et al. Cell 120, 64961 (2005).

27. Minamino, T. et al. Nat. Med. 15, 1082088 (2009).

28. Yahagi, N. et al. J. Biol. Chem. 2003, 253955400 (2003).

29. Rai, P. et al. Proc. Natl Acad. Sci. USA 106, 16974 (2009).

30. Singh, R. et al. Nature 458, 1131 135 (2009).

31.Hosokawa, N., Hara, Y. & Mizushima, N. FEBS Lett. 580, 2623629 (2006).

32. Saitoh, T. et al. Nature 456, 26469 (2008).

33. Zhou, R., Yazdi, A. S., Menu, P. & Tshopp, J. Nature 469, 22126 (2011).

34. Strissel, K. J. et al. Diabetes 56, 2910918 (2010).

35. Vandanmagsar, B. et al. Nat. Med. 15, 1 (2011).

36. Wen, H. et al. Nat. Immunol. 12, 40815 (2011).

37. Schroder, K. & Tschopp, J. Cell 140, 82132 (2010).

38. Misawa, T. et al. Nat. Immunol. 14, 45460 (2013).

39. Bellodi, C. et al. J. Clin. Invest. 119, 1109 123 (2009).

40. Gupta, A. et al. Proc. Natl Acad. Sci. USA 107, 143 334 338 (2010).

41. Rodriguez-Navarro, J. A. et al. Neurobiol. Dis. 39, 42338 (2010).

42. Sarkar, S., Davies, J. E., Huang, Z., Tunnacliffe, A. & Rubinsztein, D. C. J. Biol. Chem. 282, 5641 652 (2007).

43. Koga, H., Kaushik, S. & Cuervo, A. M. FASEB J. 24, 3052065 (2010).

44. Shibata, M. et al. Biochem. Biophys. Res. Commun. 393, 27479 (2010).

45. Quan, W. et al. Diabetologia 55, 39203 (2012).

46. Ma, D. et al. Mol. Endocrinol. 27, 1643654 (2013).

47. Coupe, B. et al. Cell Metab. 15, 1 (2012).

48. Kaushik, S. et al. EMBO Rep. 13, 25865 (2012).

49. Quan, W. et al. Endocrinology 153, 1817826 (2012).

50. Druker, B. J. et al. Nat. Med. 2, 56166 (1996).

51. Kouroku, Y. et al. Cell Death Differ. 14, 23039 (2007).

52. Yorimitsu, T., Nair, U., Yang, Z. & Klionsky, D. J. J. Biol. Chem. 281, 302 990 304 (2006).

53. Etmer, A. et al. Leukemia. 21, 93642 (2007).

54. Imam, S. Z. et al. J. Neurosci. 31, 15763 (2011).

55. Shingu, T. et al. J. Cancer 124, 1060071 (2009).

56. Mokhtari, D. et al. Diabetologia 56, 1327338 (2013).

57. Drube, S., Schmitz, F., Gopfert, C., Weber, F. & Kamradt, T. Eur. J. Pharmacol. 675, 572 (2012).

58. Fraenkel, M. et al. Diabetes 57, 94557 (2008).

59. Kim, J. et al. J. Clin. Invest. 124, 3311324 (2014).

60. Phillips, D. I. W., Clark, P. M., Hales, C. N. & Osmond, C. Diabet. Med. 11, 28692 (1993).

61. Han, M. S. et al. J. Lipid Res. 52, 1234246 (2011).

62.Du, K., Herzig, S., Kulkarni, R. N. & Montminy, M. Science 300, 1574577

(2003).

63. Back, S. H. et al. Cell Metab. 10, 136 (2009).

64. Park, S. Y. et al. J. Biol. Chem. 275, 7512520 (2004).

65. Park, S. Y. et al. Res. Commun. 325, 1399405 (2004).

66. Shin, N.-R. et al. Gut 63, 72735 (2014).

67. Kim, Y.-H. et al. Eur. J. Immunol. 29, 45565 (1999).

68. Cinti, S. et al. J. Lipid Res. 46, 2347355 (2005).

We have tried to develop an animal model that can be used to understand the progression from obesity to diabetes and is suitable for screening therapeutics for diabetes. As a result, the present inventors have constructed a diabetic animal model that exhibits Atg7 ^+/- -ob / ob traits by crossing Atg7 ^+/- animals and ob / w animals, screening for the treatment of diabetes by using them, and treating diabetes treatment. By clarifying that the efficacy can be analyzed, the present invention has been completed.

Accordingly, it is an object of the present invention to provide a method for screening a diabetes therapeutic agent.

Another object of the present invention is to provide a method for analyzing the therapeutic efficacy of a diabetes therapeutic agent.

It is another object of the present invention to provide a diabetic animal model.

Other objects and advantages of the present invention will become apparent from the following detailed description and claims.

According to one aspect of the present invention, the present invention provides a method for screening a therapeutic agent for diabetes comprising the following steps:

(a) administering a test substance to an animal other than a human showing Atg7 ^+/- -ob / ob trait; And

(b) measuring a hematological or histological indicator value correlated with diabetes or glucose metabolic abnormalities from the animal, wherein the test substance changes the hematological or histological indicator value significantly normally. Is considered a diabetes treatment.

According to another aspect of the present invention, the present invention provides a method for analyzing the therapeutic efficacy of a diabetes therapeutic agent comprising the following steps:

(a) administering an antidiabetic agent to an animal other than a human showing Atg7 ^+/- -ob / ob trait; And

(b) determining the therapeutic efficacy of the diabetes therapeutic agent by measuring a hematological or histological indicator value correlated with diabetes or glucose metabolic abnormalities from the animal.

We have tried to develop an animal model that can be used to understand the progression from obesity to diabetes and is suitable for screening therapeutics for diabetes. As a result, the present inventors have constructed a diabetic animal model that exhibits Atg7 ^+/- -ob / ob traits by crossing Atg7 ^+/- animals and ob / w animals, screening for the treatment of diabetes by using them, and treating diabetes treatment. It was found that the efficacy can be analyzed.

According to the present invention, metabolic abnormalities were not found in mice whose major autophagy genes, Atg7, were haploinsufficienty ( atg7 ^+/- mice), whereas Atg7 ^+/- mice were compared with ob / ob mice. When mated, they found that insulin resistance deteriorated and the amount of lipids and inflammatory responses in the body increased, and it was experimentally found that autophagy impairs adaptive responses due to metabolic stress. In addition, when autophagy enhancers are administered to Atg7 ^+/- -ob / ob mice, autophagy is a major factor involved in the progression of obesity to diabetes by confirming that autophagy is increased and metabolic response is improved. It was confirmed that autophagy modulators can be used as a therapeutic agent for diabetes associated with obesity and inflammatory response.

Animals used in the screening method and the therapeutic efficacy analysis method of the diabetes therapeutic agent of the present invention is an Atg7 ^+/- animal and an Atg7 ^+/- -ob obtained by crossing the Atg7 ^+/- animal with the same ob / w animal. Animals other than humans exhibiting / ob traits.

According to the invention, the animal used in the invention is a mammal, more preferably said mammal is a mouse, rat, pig or monkey, most preferably a mouse.

According to one embodiment of the present invention, there is provided an animal for use in the present invention showing the mouse Atg7 ^+/- -ob / ob plasma is Atg7 ^{F / F} to the crossing (Atg7-floxed mice) and CMV- Cre mice homozygous Atg7 Mice with deleted germ cells ( At7 ^+/- mice) are produced, and then Atg7 ^+/- mice and ob / w mice are selected by crossing.

Selection of mice exhibiting the Atg7 ^+/- -ob / ob trait is confirmed by PCR genotyping by extracting genomic DNA from the tail tissue of the mouse.

Mice showing Atg7 ^+/- -ob / ob traits produced in the same manner showed significantly increased blood glucose levels compared to Atg7 ^{+ / +} -ob / ob mice, which deteriorated insulin resistance and increased triglyceride levels in the liver. Diabetes was observed as glucose metabolism abnormalities occurred, such as increased serum ALT / AST and increased inflammatory response.

Animals exhibiting the Atg7 ^+/- -ob / ob trait of the present invention exhibit glycemic aberrations and thus can study the mechanisms for diabetes, particularly diabetes associated with obesity and inflammatory responses and the mechanism of progression from diabetes to diabetes. It can be usefully used as a model animal.

As used to refer to the screening method of the present invention, the term “test substance” refers to an unknown substance used in screening to test whether to inhibit activity leading to diabetes.

In the screening method, the test substance of step (a) may be a peptide, a protein, a non-peptidic compound, a synthetic compound, a fermentation product, a cell extract, a plant extract, an animal tissue extract or a plasma, and the compound is a novel compound. Or a well-known compound, preferably obtained from a library of synthetic or natural compounds. Methods of obtaining libraries of such compounds are known in the art. Synthetic compound libraries are commercially available from Maybridge Chemical Co. (UK), Comgenex (USA), Brandon Associates (USA), Microsource (USA), and Sigma-Aldrich (USA), and libraries of natural compounds are available from Pan Laboratories (USA). ) And MycoSearch (USA). Samples can be obtained by a variety of combinatorial library methods known in the art, for example biological libraries, spatially addressable parallel solid phase or solution phase libraries, deconvolution required By a synthetic library method, a “1-bead 1-compound” library method, and a synthetic library method using affinity chromatography screening. Methods of synthesizing molecular libraries are described in DeWitt et al., Proc . Natl. Acad . Sci . USA . 90, 6909, 1993; Erb et al. Proc . Natl . Acad . Sci . USA . 91, 11422, 1994; Zuckermann et al., J. Med . Chem . 37, 2678, 1994; Cho et al., Science 261, 1303, 1993; Carell et al., Angew . Chem . Int . Ed. Engl . 33, 2059, 1994; Carell et al., Angew . Chem . Int . Ed. Engl. 33, 2061; Gallop et al., J. Med. Chem. 37, 1233, 1994 and the like.

The test substance may form a salt. Salts of the test substance include salts such as physiologically acceptable acids (eg, inorganic acids) and bases (eg, organic acids, etc.), and physiologically acceptable acid addition salts are preferred, but are not limited thereto. Such salts include, for example, salts of inorganic acids (e.g. hydrochloric acid, phosphoric acid, hydrobromic acid or sulfuric acid) or organic acids (e.g. acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid, tartaric acid, citric acid). Salts of malic acid, oxalic acid, benzoic acid, methanesulfonic acid or benzenesulfonic acid, and the like.

As the method for administering the test substance, oral administration, intravenous injection, swabbing, subcutaneous administration, intradermal administration or intraperitoneal administration may be used, but is not limited thereto. I can choose it suitably. The dosage of the test substance may be appropriately selected according to the administration method, the nature of the test substance, and the like.

In the screening method, the test substance may be administered to tissues, organs or cells of the animal. In the case of the said tissue or organ, the thing extracted from the animal which shows Atg7 ^+/- -ob / ob trait is included. In the case of cells, blood cells, liver cells, fat cells and the like can be exemplified, but are not limited thereto.

When the test substance is to be administered to the isolated cells of a part of the animal showing Atg7 ^+/- -ob / ob trait of the present invention, the test substance may be administered to the culture medium of the cells. When the test substance is a protein, for example, a vector containing DNA encoding the protein may be introduced into cells isolated from the animal.

In the screening method and the therapeutic efficacy analysis method, the hematological or histological indicator value correlated with diabetes or glucose metabolic abnormalities is selected from the group consisting of blood diabetes related components, insulin resistance, blood glucose level and blood insulin level It is preferably at least one, and the blood-related diabetes component is preferably any one selected from the group consisting of triglycerides, cholesterol, free fatty acids, ALT, AST, HDL and LDL, but is not limited thereto.

As a result of measuring and comparing the above-mentioned indicator values in the animal model to which the test substance was administered and the control group not to which the test substance was administered, as a result, screening drugs for diabetics can be screened by selecting a substance having an effect on the indicator. Analyze the therapeutic efficacy of the diabetes treatment.

According to the present invention, when the test substance significantly changes the hematological or histological indicator value normally, it is determined that the test substance is a diabetes treatment.

According to one embodiment of the present invention, when the test substance inhibits an increase in blood related components, deterioration of insulin resistance, an increase in blood glucose level and an increase in blood insulin level compared to an animal model in which the test substance is not administered The substance is considered a diabetes treatment.

Diabetes therapeutic agents screened in the above manner can be very useful for preventing and treating diabetes in diabetes, particularly in obese patients.

According to another aspect of the present invention, the present invention provides a diabetic animal model, characterized in that the animal except humans exhibiting Atg7 ⁺ /--ob / ob trait.

Since the diabetic animal model of the present invention is an animal model used in the above-described method, the common content between the two is omitted in order to avoid excessive complexity of the specification according to the repetitive description.

The features and advantages of the present invention are summarized as follows:

(A) The present invention provides a diabetic animal model, a method for screening a diabetes treatment using the model and a method for analyzing the efficacy of the diabetes treatment.

(b) The animal model of the present invention has various glycemic abnormalities such as an increase in blood-related diabetes components, an increase in blood glucose levels, worsening insulin resistance, an increase in triglycerides in the liver, an increase in serum ALT / AST, an increase in fatty liver accumulation, and an increase in inflammatory response. It is an animal model that presents symptoms and is suitable for understanding the progression from obesity to diabetes and for screening treatments for diabetes.

(c) The animal model of the present invention can be effectively used for the study of progression from obesity to diabetes, and for the development of therapeutics for diabetes associated with obesity and inflammatory response.

1 is a result of analyzing the biochemical properties of the manufactured Atg7 mice.

(a) Atg7 ^+/- mice were prepared as described in the experimental method and subjected to PCR using primers for the genomic DNA and the phloxed Atg7 region. Also in Atg7 ^+/- mouse arrow indicates the wild-type band Atg7, Atg7 ^{F / +} mouse, the PCR size increases, so Phlox sequence is inserted, and the Atg7 ^+/- mouse PCR size by Cre- mediated defect reduction.

(b) RT-PCR (left) and real-time RT-PCR (right), extracting total RNA from tissue of Atg7 ^+/- or control Atg7 ^{+ / +} mice and using primers specific for Atg7 or β-actin sequences Conducts. The fold change in RT-PCR band intensity is shown in the left panel. * P <0.05, ** P <0.01, *** P <0.001;Student's t-test, n = 3.

(c) An immunoblot analysis was performed on 12-week-old Atg7 ^+/- or control Atg7 ^{+ / +} mouse tissue lysates in fasting state with anti-LC3 or -p62 antibodies. Magnification changes in immunoblot band intensities are shown in the middle and right panels. ** P <0.01, *** P <0.001;Student's t-test, n = 3.

(d) Cell lysates of Atg7 ^{+ / +} , Atg7 ^+/- and Atg7 ^-/- / MEFs using antibodies specific for LC3 and p62 after 3 hours treatment with rapamycin (Rap) or control solvent (DMSO) Immunoblot analysis was performed for. Magnification changes in immunoblot band intensities are shown in the middle and right panels. ** P <0.01, *** P <0.001;Student's t-test, n = 3.

(e) (e) GFP-LC3 spots (left) on liver and muscle tissue sections of 12-week - old GFP-LC3 ⁺ -Atg7 ^{+ / +} or GFP-LC3 ⁺ -Atg7 ^+/- mice in fasted state ) Is measured. Count GFP-LC3 spot number (right). Scale bar, 10 mm. * P <0.05;Student's t-test, n = 5.

(f) After 4 hours of leupeptin administration, livers of fasting Atg7 ^{+ / +} or control Atg7 ^+/− mice were isolated to prepare tissue lysates, followed by immunoblotting. Magnification change in immunoblot band intensity is shown in the right panel. * P <0.05;Student's t-test, n = 3.

2 shows the results of analyzing the metabolic profiles of Atg7 ^{+ / +} and Atg7 ^+/− mice.

(a) Weekly monitoring of non-fasting blood glucose levels.

(b) IPGTT will be conducted at 12 weeks of age.

(c-e) Blood chemistry profiles were measured using an automated analyzer.

(f) Serum FFA levels were measured using the kit.

(g) Body weight is measured between 5 and 30 weeks of age.

Figure 3 shows the results of analyzing the deterioration of metabolic profile of ob / ob mice with autophagy haemostasis.

(a) Weekly monitoring of non-fasting blood glucose levels of Atg7 ^{+ / +} , Atg7 ^+/- , Atg7 ^{+ / +} -ob / ob and Atg7 ^+/- -ob / ob mice. *** P <0.001; Binary ANOVA.

(b) As described in the experimental method, 16-week-old mice were injected with glucose to perform IPGTT (left), and AUC was calculated (right). * P <0.05, ** P <0.01, *** P <0.001; Student ’s t-test (left) and one-way ANOVA (right).

(c) HOMA-IR index is calculated as described in the experimental method. * P <0.05; One-way ANOVA.

(d) As described in the experimental method, ITT was performed by injecting insulin into 16-week-old mice. * P <0.05, ** P <0.01, *** P <0.001; Student ’s t-test.

(e) Atg7 ^{+ / +} -ob / w, Atg7 ^+/- -ob / w, Atg7 ^{+ / +} -ob / ob and Atg7 7 minutes after injecting 5 U kg-1 regular insulin (Ins) into the tail vein Tissues were obtained from ^+/- -ob / ob mice. Each mouse tissue lysate was prepared and subjected to immunoblot analysis using antibodies specific for phospho-Akt S473 and Akt. Numbers below the immunoblot bands represent magnification changes normalized to the control bands.

4 shows the results of analyzing the metabolic profile of Atg7 ^{+ / +} -ob / ob mice.

(a) Body weight is measured between 5 and 30 weeks of age.

(b) IGI (insulinogenic index) is calculated as described in the experimental method. * P <0.05; One-way ANOVA.

(c) H & E staining of pancreatic sections obtained from each experimental group was observed by light microscopy. Scale bar: 50 μm.

(d) Relative β-cell amount was determined by point counting after insulin immunohistochemical staining. (-), One-way ANOVA, n = 5.

(e) K _ITT is calculated using 12-week-old ITT data. *** P <0.001; One-way ANOVA.

5 is a result of measuring insulin resistance and oxidative stress in Atg7 ^+/- -ob / ob mice.

(a) An immunoblot analysis was performed on tissue lysates of each mouse using antibodies specific for JNK, phospho-JNK, IRS-1 and phospho-IRS-1 S307.

(b) Immunohistochemical staining of each mouse liver section using an anti-nitrotyrosine antibody. Scale bar, 100 mm.

(c) Tissue lysates were prepared from 18-week-old mice of each genotype and subjected to immunoblot analysis using a kit for detecting carbonylated proteins.

(d) An immunoblot analysis was performed using anti-phospho-53 and -53 antibodies. p21 and β-actin mRNA expression measured by RT-PCR. Numbers below the immunoblot bands represent magnification changes normalized to the control bands.

Figure 6 is the result of measuring the oxidative stress in Atg7 ⁺ /--ob / ob mouse tissue.

(a) DHE staining of liver sections obtained from each experimental group was carried out as described in the experimental method. Scale bar: 50 μm.

(b) SA-β-gal staining for WAT of 16-week-old mice was carried out as described in the experimental method.

7 shows the results of lipid accumulation in Atg7 ^+/- -ob / ob mice.

(A) TG levels in liver tissue obtained from each experimental group were evaluated by performing ORO staining after lipid extraction and measuring absorbance at 540 nm (right). Representative ORO staining results are shown in the left panel. Scale bar: 50 μm. *** P <0.001; One-way ANOVA, n = 5.

(b) TG levels in liver tissue obtained from each experimental group were evaluated by the biochemical method described in the experimental method. *** P <0.001; One-way ANOVA.

(c) Liver tissue of each experimental group was observed by EM. Scale bar: 200 nm.

(d, e) Serum levels (d) and FFA (e) of liver enzymes were measured using a blood chemistry analyzer and a commercial kit, respectively. * P <0.05, ** P <0.01; One-way ANOVA.

(f) TUNEL staining of paraffin-embedded liver sections of each experimental group. Scale bar: 20 μιη. Arrow, TUNEL + apoptosis hepatocytes.

8 shows the results of analyzing the effects of obesity and lipids on autophagy.

(a) GFP-LC3 spots observed each mouse tissue in a fasted state by fluorescence microscopy and counted the number. Scale bar, 20 mm. * P <0.05, ** P <0.01; Student ’s t-test.

(b) Ob / w and ob / ob mouse tissues were observed by electron microscopy and counted autophagosome counts. *** P <0.001; Student ’s t-test.

(c) immunoblotting using anti-GFP or -p62 antibody.

(d) Tissue lysates were prepared from liver of fasting ob / w or ob / ob mice 4 hours after leupeptin administration and immunoblotting. Numbers below the immunoblot bands represent magnification changes normalized to the control bands.

(e) After labeling SK-Hep1 cells with C ¹⁴ -leucine, the cells were treated with FFA (600 mM PA or 1,200 mM OA). Radioactivity release rate was measured for 3-6 hours as described in the experimental method. The difference in protein dissolution following treatment with or without E64d / pepstatin A / NH ₄ Cl is considered to be lysosomal protein dissolution. * P <0.05, ** P <0.01; One-way ANOVA, n = 3.

(f) Atg7 ^{+ / +} and Atg7 ^+/− MEFs were loaded with a mixture of PA and OA at the indicated concentrations for 48 hours and the amount of TG was determined via ORO staining. ** P <0.01, *** P <0.001; Binary ANOVA, n = 4. Numbers below the immunoblot bands represent magnification changes normalized to the control bands.

9 shows the results of measuring the effects of obesity and lipid loading on autophagy and insulin sensitivity.

(a) Atg7 Adenovirus expressing siRNA or control siRNA (Con) (MOI 50) was infected with SK-Hep1 or Hepa1c1c7 cells after 72 hours, atg7 against total RNA. Expression ( mAtg7 , murine Atg7 ; hAtg7 , human Atg7 ) was analyzed by RT-PCR.

(b) Atg7 Incubate for 24 hours with treatment of PA and OA mixtures at the indicated concentrations in SK-Hep1 or Hepa1c1c7 cells infected with adenovirus expressing siRNA for 48 hours. TG amount was assessed by ORO staining, isopropanol extraction and absorbance at 540 nm. ** P <0.01, *** P <0.001; One-way ANOVA, n = 3.

(c) Atg7 After 48 hours of infection with an adenovirus expressing siRNA or control siRNA, cells were incubated for 24 hours with 600 μM PA and 1,200 μM OA mixture. After treatment with 100 nM insulin (Ins) for 7 minutes, the cell lysates were subjected to immunoblot analysis using antibodies specific for phospho-Akt S473 and total Akt.

(d) Immunoblot the cells lysates not treated with insulin using antibodies specific for JNK, pJNK, IRS-1 and pIRS-1 S307. Numbers below immunoblot and RT-PCR bands indicate fold changes for standardized control bands.

Figure 10 shows the results of analyzing the immune response in Atg7 ⁺ /--ob / ob mouse tissue.

(a) Counting CLS numbers in WAT of each mouse as described in the experimental method. * P <0.05; One-way ANOVA, n = 3.

(b) be conducted by RT-PCR using primers specific to separate from the total mRNA of each tissue to produce a cDNA Tnfα, Il6, F4 / 80 or pro- Il1b. WAT tissue isolates SVF to analyze pro-I1b expression.

(c, d) An immunoblot analysis was performed on the SVF lysates using anti-IL-1β (c) or anti-caspase-1 antibody (d).

(e) Treated PA at the indicated concentrations in the presence or absence of LPS on macrophages isolated from the abdominal cavity. ELISA was performed on the culture supernatant to measure IL-1β concentration (BSA, bovine serum albumin). *** P <0.001; Binary ANOVA, n = 4.

(f) Treated macrophages isolated from the abdominal cavity with the indicated concentrations of PA under treated or untreated LPS for 16 hours and measuring the NAD ⁺ / -NADH ratio using the kit. * P <0.05, ** P <0.01, *** P <0.001; Binary analysis, n = 5.

(g) Treated peritoneal macrophages in the same manner as in (f) and stained with MitoSOX to measure mitochondrial ROS through flow cytometry.

(h) Treated intraperitoneal macrophages in the same manner as in (f), and then staining cells with mitotracker red and mitotracker green and measuring mitochondrial potential through flow cytometry. The numbers in g and h represent the percentage of cells at the designated gate. Numbers below the immunoblot bands represent magnification changes normalized to the control bands.

11 is a result of measuring the immune response in Atg7 ⁺ /--ob / ob mouse tissue.

(ad) extracting total mRNA from each tissue, Tnfa (a), Il6 (b) , F4 / 80 (c) or pro - Il1b Real-time RT-PCR was performed using primers specific for (d). pro - Il1b Expression is measured using SVF of WAT tissue. (−), * P <0.05, *** P <0.001; One-way ANOVA, n = 9.

FIG. 12 shows the results of analyzing biochemical properties after high fat diet (HFD) was provided to Atg7 ^+/- mice.

(a) Atg7 ^+/- and control Atg7 ^{+ / +} mice were given HFD or normal diet (NCD) and non-fasting blood glucose levels were monitored. * P <0.05, ** P <0.01;Student's t-test.

(b) Fasting blood glucose levels were measured 18 weeks after the HFD diet. * P <0.05; One-way ANOVA.

(c) IPGTT was performed 18 weeks after the HFD equation (left) and the AUC was calculated (right). * P <0.05; Student ’s t-test (left) and one-way ANOVA (right).

(d) Calculate HOMA-IR after 18 weeks of HFD equation. *** P <0.001; One-way ANOVA.

(e) Perform an ITT 18 weeks after the HFD equation (left) and calculate the K _ITT (right). * P <0.05;Student's t-test (left) and one-way ANOVA (right).

Figure 13 shows the results of analyzing the metabolic profile of the high-fat diet Atg7 ^{+ /} -mouse .

(a) Monitoring body weight of Atg7 ^+/- and control Atg7 ^{+ / +} mice given HFD or NCD.

(b) IGI calculated in mice fed HFD for 18 weeks. * P <0.05; One-way ANOVA.

(C) TG levels in mouse liver tissues fed with HFD for 21 weeks were evaluated by measuring absorbance at 540 nm after ORO staining. ** P <0.01; One-way ANOVA, n = 10.

(d) Serum FFA levels were measured using a kit after 18 weeks of HFD. *** P <0.001; One-way ANOVA.

(e) Blood chemistry profiles were measured using an automated analyzer after dieting HFD for 18 weeks. * P <0.05; One-way ANOVA.

Figure 14 shows the results of analyzing the effect of autophagy enhancers on the metabolic profile of Atg7 ^+/- mice.

(a) Treatment of imatinib (Ima) or trehalose (Tre) for 3 hours in the presence or absence of E64d / pepstatin A (pep) in primary hepatocytes of C57BL / 6 mice. Perform immunoblot analysis using cell lysate.

(b) 4 hours after intraperitoneal injection of imatinib 20 mg / kg ⁻¹ to GFP- LC3 + mice, the preparation of liver and muscle tissue lysates was followed by immunoblotting.

(c) Hepatic tissue was obtained 4 hours after administration of leupetin 30 mg / kg ⁻¹ to Atg7 ⁺ / −- ob / ob mice treated with imatinib or trehalose for 8 weeks. Perform immunoblot analysis using liver lysate.

(d) 12-week-old Atg7 ^+/- -ob / ob mice were intraperitoneally injected with imatinib (25 mg / kg ^-1 ) or trehalose (2 g / kg ^-1 ) for 8 weeks and body weight monitored.

(e) AUC and K _ITT are calculated after treatment with imatinib or trehalose in Atg7 ^+/- -ob / ob mice for 8 weeks. * P <0.05, ** P <0.01, *** P <0.001; One-way ANOVA.

(f) TG amount in liver of Atg7 ^+/- -ob / ob mice treated with imatinib or trehalose for 8 weeks was biochemically analyzed according to the method described in the experimental method. *** P <0.001; One-way ANOVA.

(g) Serum ALT / AST levels in Atg7 ^+/- -ob / ob mice treated with imatinib or trehalose for 8 weeks were measured using a chemistry analyzer. * P <0.05, *** P <0.001; One-way ANOVA.

(hk) Autophagy -Competency Atg7 ^{+ / +} -ob / ob mice were treated with Ima as shown in Figure 15b. Unfastened blood glucose level (h) and body weight (i) were monitored. ** P <0.01; Binary ANOVA.

Atg7 ^{+ / +} -ob / ob mice were treated with Ima for 8 weeks, followed by IPGTT (j) and ITT (k). ** P <0.01; Student ' t -test. Numbers below immunoblot bands indicate magnification changes for normalized control bands.

15 shows the results of analyzing the effects of autophagy enhancers on diabetes in Atg7 ^+/- -ob / ob mice.

(a) C57BL / 6 mice were intraperitoneally injected with 30 mg kg ⁻¹ leupeptin 1 hour, followed by intraperitoneal injection with 25 mg kg ⁻¹ imatinib (Ima). After 3 hours, immunoblot analysis was performed using liver tissue lysate.

(b) Imatinib (25 mg kg ⁻¹ ), trehalose (2 g kg ⁻¹ ) or PBS was injected intraperitoneally three times a week into 12-week-old diabetic Atg7 ⁺ / −- ob / ob mice and blood glucose levels were monitored. *** P <0.001, ### P <0.001; Binary ANOVA.

(c, d) IPGTT (c) and ITT (d) were performed after administration of imatinib or trehalose for 8 weeks in Atg7 ^+/- -ob / ob mice. #P <0.05;## P or ** P <0.01;### P or *** P <0.001;Student's t-test.

(e) Injecting regular insulin (Ins) into the tail vein of Atg7 ^+/- -ob / ob mice receiving imatinib or trehalose for 8 weeks. After 7 minutes, tissue lysates were prepared and subjected to immunoblotting.

(f) Tissue lysates were prepared from the same mice not injected with insulin and subjected to immunoblotting. Numbers below the immunoblot bands represent magnification changes normalized to the control bands. ('*' Indicates comparison of imatinib and control: '#' indicates comparison of trehalose and control).

FIG. 16 shows the results of measuring FGF21 levels in tissues and serum of Atg7 ^+/− mice.

(a) Fgf21 mRNA expression in insulin target tissue was measured by RT-PCR.

(b) Serum FGF21 levels were measured using an ELISA kit. (-), One-way ANOVA. The numbers below the RT-PCR band represent the change in magnification for the normalized control band.

Figure 17 is a schematic diagram showing the developmental path of diabetes in autophagy obese mice.

In an autophagy-incomplete state ( Atg7 ^+/- ), lipid overload increases lipid accumulation due to incomplete lipolysis . Autophagy insufficiency causes retardation of mitochondrial circulation and mitochondrial dysfunction, and inflammatory control complexes are activated by lipids that activate inflammatory control complexes. The combined effect and interaction of increased lipids with activated inflammatory regulatory complexes exacerbate insulin resistance and diabetes.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention in more detail, it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples in accordance with the gist of the present invention. .

Example

Materials and methods

mouse

C57BL / 6 strains of Atg7 ^{F / F} (Atg7-floxed mice) were crossed with CMV-Cre 'deleter' mice (Jackson Laboratory) to make Atg 7 ^+/− mice. Among the first generation mice, mice showing hemizygous deletion for Atg7 were selected and crossed with C57BL / 6 mice to make mice without CMV-Cre sequence and with homozygous Atg7 deleted germ cells. To make Atg7 ^+/- -ob / ob mice were crossed Atg7 ^+/- mice and ob / w mice (Jackson Laboratory). Mouse genotyping was performed through PCR analysis of the tail DNA ⁶ . Atg7 ^+/- and Atg7 ^{+ / +} mice were given a high-fat diet (HFD) from 5 weeks to 21 weeks of age. Liver, muscle and epididymal adipose tissues were isolated 7 min after injection of 5 U kg ^-1 regular insulin into the tail vein to examine in vivo insulin signaling by western blotting ²⁰ . Imatinib (provided by Dr. Buchdunger of Novartis Pharma) or trehalose (Sigma) was administered to mice by modifying a known protocol ²⁰ . 25 mg kg ⁻¹ imatinib or 2 g kg ⁻¹ trehalose were dissolved in PBS, and Atg7 ^+/− −ob / ob mice were intraperitoneally injected three times a week for 8 weeks from 8-10 weeks of age. All animal experiments were conducted in accordance with the Public Health Service Policy on Humane Care and Use of Laboratory Animals and were approved by the Samsung Medical Center Institutional Review Board.

Glucose and insulin load tests

After fasting for 16 hours, IPGTT was performed by intraperitoneal injection of 1 g kg ⁻¹ glucose ²⁰ . HOMA-IR was calculated according to the following formula ²¹ : [(fasting insulin × fasting glucose) /22.5]. Measured using ACCU-CHEK glucometer (Roche) before (0 min) glucose injection, 15, 30, 60, 120 and 180 min post injection. Serum insulin concentrations were measured using an ELISA kit (Shibayagi). Insulinogenic index (IGI) was calculated as follows: Δinsulin _{15 minutes} (pM) / Δglucose _{15 minutes} (mM). ITT was performed by intraperitoneal injection of regular insulin 0.75 U kg ⁻¹ in fasted mice for 6 hours or more, and blood glucose levels were measured at 0, 15, 30, 60 and 120 minutes. The insulin sensitivity index, K _ITT, was calculated as follows: 0.693 / _{t1 / 2} × 100 (% per min) ⁶⁰ .

In vivo autophagy

GFP- LC3 ⁺ -Atg 7 ^+/- mice were made to cross GFP- LC3 ⁺ mice (provided by Dr. Mizushima University of Tokyo) with Atg 7 ^+/- mice to measure in vivo autophagy levels. In addition, the GFP -LC3 ⁺ mice and ob / w were bred to make GFP -LC3 ⁺ -ob / ob. GFP spots were identified by fluorescence microscopy ¹⁷ . In vivo, autophagic flux was assessed by administering 30 mg kg ⁻¹ leupeptin to the mice and analyzing LC3 conversion in the liver 4 hours ¹⁹ . GFP cleavage in GFP-LC3 ⁺ mouse tissues representing the lysosomal stage of autophagy was confirmed by immunoblot analysis using anti-GFP antibody (Santa Cruz Biotechnology sc-9996, 1: 1,000 dilution).

cell

SK-Hep1 and Hepa1c1c7 cells were cultured using DMEM additionally containing 10% fetal calf serum (FCS) and penicillin-streptomycin (Lonza). MEFs were obtained from 13.5 day-old embryos. Cells were treated with PA and OA for 24-48 hours and the amount of intracellular TG was measured. Lipids were treated for 24 hours to detect insulin signaling, followed by immunoblot analysis by treating 100 nM insulin with cells for 10 minutes. Hepatocytes were isolated from C57BL / 6 mice using the retrograde two-step collagenase perfusion technique ⁶¹ .

In brief, perfusion of the liver using 10 ml of 1 × liver perfusion buffer (Gibco # 17701), followed by a secondary buffer (66.7 mM NaCl, 6.7 mM KCl) containing 700 mg l- ¹ collagenase (Sigma C5138). , 4.8 mM CaCl ₂ and 0.1 M HEPES, pH 7.6) for 6 minutes at a rate of 5 ml / min. Then, hepatocytes were obtained by penetrating the liver with a filter gauge and then centrifuging Percoll gradient. Peritoneal macrophages were isolated from Atg7 ^{+ / +} and Atg7 ^+/− mice using 3.85% thioglycolate medium and treated with or without 500 ng ml ⁻¹ LPS (Sigma). After 24 hours, the amount of IL-1β in the culture supernatant was measured using a mouse ELISA kit (R & D Systems).

blood Chemistry

Serum ALT / AST, TG and total cholesterol levels were measured using a blood chemistry analyzer ²⁰ . Serum FFA was measured using LabAssay NEFA kit (Wako).

Adenovirus

CDNA encoding Atg7 siRNA was cloned into the pAd-Track transfer vector. Homologous recombination was performed by transfecting pre-modified pluripotent pAdEasy-AD-293 cells with a linear recombinant pAd-Track comprising Atg7 shRNA oligonucleotides regulated by a mouse U6 promoter with an adenovirus gene carrier vector ⁶² . Atg7 shRNA oligonucleotides targeted the common sequence and murine Atg7 (5'-TGGCTGCTACTTCTGCAATGA-3 ') for humans. Adenovirus was amplified in 293AD cells and isolated via CsCl density gradient centrifugation. Cells were infected with adenovirus expressing Atg7 or control siRNA at moi (multiplicity of infection) 50.

EM

Changes in cellular microorganisms at the level of organelles were measured by EM6. The number of autophagosomes with double membrane-like structures in the scanned area was measured using a software program (ImagePro).

Immunoblotting

Tissue lysates were isolated on 8-15% SDS-PAGE, then transferred to Hybond ECL nitrocellulose membrane (Amersham), anti-JNK (# 9252), -phospho-JNK Thr183 / Tyr185 (# 9251), -IRS- 1 (# 2382), -Akt (# 9272), -phospho-Akt S473 (# 9271) (Cell Signaling, 1: 1,000 Dilution), -phospho-IRS-1 Ser307 (Upstate Biotechnology # 07-247, 1: 1,000 Dilution), -LC3 (Novus NB100-2331, 1: 1,000 dilution), -p62 (Progen GP62-C, 1: 1,000 dilution), -nitrotyrosine (Millipore # 06-284, 1: 1,000 dilution), -p53 (Calbiochem # OP03, 1: 1,000 dilution), -phospho p53 (Cell Signaling # 9284, 1: 1,000 dilution), -IL-1b (R & D Systems AF-401-NA, 1: 1,000 dilution), -caspase-1 (Santa Cruz Immunoblot analysis was performed using sc-514, 1: 1,000 dilution) and -β-actin (Santa Cruz sc-47778, 1: 5,000 dilution) antibody. Immunoblot bands were quantified using a densitometer (Bio-Rad), and each figure was normalized to the control bands.

ROS  damaged

Detection of nitrate proteins that affect ROS damage of proteins in vivo was performed by immunohistochemistry using anti-nitrotyrosine antibodies ⁶³ . Carbonylated protein was detected through immunoblot analysis using Kit (Millipore). To detect in vivo ROS, frozen tissue sections were immersed in 10 mM DHE solution (Invitrogen) and incubated at 37 ° C. for 30 minutes ⁶⁴ . After washing with PBS, sections were observed under a fluorescence microscope. To measure SA-β-gal activity, the tissues were placed in a staining solution containing 1 mg ml ^-1 of X-gal dissolved in 5 mM K-ferrocyanide and N, N-dimethylformamide and incubated overnight at 37 ° C. ⁶⁵ . The tissue was then observed by light microscopy.

ORO  Staining and TG Measurement

Formalin fixed cells or tissue sections were stained with 3 mg ml ^-1 ORO solution for 30 minutes, then the dye was removed with isopropanol and measured at A ₅₄₀ . Lipids were isolated from homogenized tissue using a chloroform / methanol mixture (2: 1) to determine the TG amount. After evaporation, the fat was dissolved in 100% ethanol in 1% Triton X-100 dissolved and mixed with preglycerol reagent (Sigma) containing lipase. After incubation at 37 ° C. for 5 min, A ₅₄₀ was measured and TG concentration was calculated using a standard curve ⁶¹ .

SVF

Visceral adipose tissue was cut into small pieces of 2 mm or less to separate SVF. Soaked in 2 mg ml ^-1 collagenase solution (collagenase type 2, Worthington) and incubated for 45 minutes in a 37 ℃ water bath, then the cut tissue was centrifuged at 1,000 g for 8 minutes. The suspended pellets were passed through a 70-μm mesh, followed by RBC lysis, and SVF was added to 100 mM NaCl, 10 mM TrisCl, pH 7.6, 1 mM EDTA, 1% NP-40, 1 mM PMSF for immunoblotting. , 1 mM NaF, 1 mM Na ₃ VO ₄ and a protease inhibitor (Roche) were suspended in a buffer ⁶⁶ .

Proteolysis Assay

Degradation of long-lived proteins was measured by modifying a method ⁴⁵ known in the art. Briefly, cells were plated on collagen coated plates and incubated for 24 hours. Cells were then labeled with 0.5 μCi ml ⁻¹ C ¹⁴ -leucine (Perkin Elmer) for 16 hours. 2 hours of incubation with medium replacement with medium that degrades short-lived proteins, 2 mM of unlabeled leucine and with or without 10 μg ml ⁻¹ and 20 mM NH ₄ Cl for each of E64d / pepstatin A and The cells were incubated at 37 ° C. for 3-6 hours after replacement with serum-free medium containing lipids (PA or OA). Aliquots were precipitated with trichloroacetic acid and proteolysis was calculated as the ratio of released radioactivity relative to initial cell radioactivity. Lysosomal protein degradation was defined as protein decomposition rate differences under E64d / pepstatin A / NH ₄ Cl member under protein decomposition rate and E64d / pepstatin A / NH ₄ Cl present.

Detection of dead cells

Insulin immunohistochemical staining was performed on three or more parallel pancreatic sections of different sites, and counted after morphology analysis to measure β-cell amount ⁶ . Killed cells were detected in vivo by staining deparaffinized sections with TUNEL reagent (Roche Applied Science) and diaminobenzidine (Invitrogen) as color substrate ⁶⁷ . Macrophage aggregates consist of up to 15 macrophages stained with F4 / 80 antibody (Abcam) and surround each adipocyte. This set of macrophages was considered CLS and the number of CLS per 100 adipocytes was counted ⁶⁸ .

FGF21  Level measurement

Serum FGF21 levels were measured using a mouse FGF21 ELISA kit (R & D Systems). FGF21 expression in insulin target tissues was measured via RT-PCR using specific primers ¹¹ .

RT- PCR  And real-time RT- PCR

RNA was prepared using TRIzol reagent (Invitrogen). cDNA was synthesized using Superscript II (Promega) and oligo (dT) _12-18 primers. The expression of Tnfa , Il6 , F4 / 80, p21, pro-Ilb , human and murine Atg7 was evaluated by PCR using a specific primer set (Table 1). RT-PCR bands were quantified using a densitometer (Bio-Rad), and in each figure RT-PCR bands were expressed by normalizing to the control band. Real-time RT-PCR was performed using SYBR Green I (Takara) on ABI Prism 7000 (Applied Biosystems).

Primer sequence

name	Sequence (5 '→ 3')
Tnfa	(F): CCTGTAGCCCACGTCGTAG	(R): TTGACCTCAGCGCTGAGTTG
Il6	(F): TTGCCTTCTTGGGACTGATGC	(R): GTATCTCTCTGAAGGACTCTGG
F4 / 80	(F): CTTTGGCTATGGGCTTCCAGTC	(R): GCAAGGAGGACAGAGTTTATCG
p21	(F): CGAGAACGGTGGAACTTTGAC	(R): TCCCAGACGAAGTTGCCCT
pro- Il1b	(F): GAATGACCTGTTCTTTGAAGT	(R): TTTGTTGTTCATCTCGGAGCC
hAtg7	(F): ACCTTGGGTTGCAATGTAGC	(R): CTCCTTGCTGCTTTGGTTTC
mAtg7	(F): TGTGGAGCTGATGGTCTCTG	(R): TGATGGAGCAGGGTAAGA
Actin	(F): GAGGCACTCTTCCAGCCTTC	(R): TAGAAGCATTTGCGGTGGAC
Fgf21	(F): TACACAGATGACGACCAAGA	(R): GGCTTCAGACTGGTACACAT

Mitochondrial changes

NAD ⁺ / NADH ratios were measured using the measurement kit (BioVision) according to the manufacturer's instructions. Peritoneal macrophages were stained for 25 minutes at 37 ° C. with 1 mM of mitotracker green and mitotracker red (Invitrogen) to measure mitochondrial potential. Stained cells were suspended in PBS containing 1% FCS and measured by FACSVerse (BD Biosciences), and data were analyzed using FlowJo software (TreeStar). In order to measure the amount of mitochondrial ROS, cells were incubated at 37 ° C. for 5 minutes with 5 mM MitoSOX (Invitrogen), and flow cytometry was performed by the above-described method.

Statistical analysis

All results are expressed as mean ± standard error obtained from three independent experiments. A bilateral Student's t-test was used to compare the measurements between the two groups. Tukey's test and one-way ANOVA were used to compare the measurements between the multiple groups. Repeated measures ANOVA and Bonferroni's post test were used to compare multiple repeated measures between groups. In case of missing values, two-way ANOVA with linear mixed model (LMM) was used. P values <0.05 are considered to represent statistically significant differences.

Experiment result

Atg7 ^+/- Diabetes and Insulin Resistance in Ob-ob / ob Mice

Atg7 ^{F / F} (Atg7-floxed mice) and CMV- Cre mice were crossed to produce mice with homozygous Atg7 deleted germ cells ( At7 ^+/− mice). Atg7 ^+/− mice are difficult to distinguish from Atg7 ^{+ / +} mouse litters. PCR with tail DNA showed deletion of a copy of the floxed Atg7 sequence 1 in Atg7 ^+/− mice (FIG. 1A). RT-PCR and real-time RT-PCR results showed that Atg7 mRNA expression was significantly lower in liver, muscle and white adipose tissue (WAT) of Atg7 ^+/− mice compared to Atg7 ^{+ / +} mice (FIG. 1B). An important step in autophagy, LC3-I to -II conversion ¹⁵ was lower in the tissues of Atg7 ^+/− mice compared to fasting Atg7 ^{+ / +} mice (FIG. 1C). In addition, level ¹⁶ of p62, a specific substrate of autophagy, was increased in tissues of Atg7 ^+/− mice compared to fasting Atg7 ^{+ / +} mice (FIG. 1C), and these results were compared to Atg7 ^{+ / +} mice. This means that the autophagic flux is reduced. The conversion from LC3-I to -II by rapamycin ¹⁵ , an autophagy inducer, in Atg7 ^+/- MEF (mouse embryonic fibroblasts) was shown to be at intermediate levels of Atg7 ^{+ / +} and Atg7 ^-/- MEF (FIG. 1D). The p62 level in Atg7 ^+/− MEF was also shown to be the median level of Atg7 ^{+ / +} and Atg7 ^{− / −} MEF (FIG. 1D). Atg7 ^+/- mice were self-crossed, transgenic mice (-LC3 GFP ⁺ mice) expressing GFP -LC3 Atg7 ^+/- mice and to determine a decrease in phagocytic ^17. After fasting for 6 hours, the number of self-GFP -LC3 spots indicating predation body is -LC3 GFP ⁺ - significantly less in the tissue of Atg7 ^+/- mice (Fig. 1e) - GFP -LC3 ⁺ Atg7 as compared to ^{+ / +} mice. Finally, the "clamp" the woman was treated with leupeptin predators process and measures a predation flux ^18,19. Flow LC3-Ⅱ levels in the liver of treated peptin fasting Atg7 ^+/- mice was lower compared to the Atg7 ^{+ / +} mice (FIG. 1f), which in Atg7 ^+/- tissue as compared to Atg7 ^{+ / +} tissue The autophagy flux is reduced.

Atg7 ^+/- mice were found to have moderate autophagy levels and activity, and then the metabolic profiles of these mice were examined. Unfastened blood glucose levels did not differ between Atg7 ^+/− and Atg7 ^{+ / +} mice by 8 months of age (FIG. 2A). Intraperitoneal glucose tolerance test (IPGTT) was not different between the two groups (FIG. 2B). There was no difference in blood chemistry and body weight (FIG. 2C-G). To determine whether autophagy haploinsufficiency adapts to metabolic overload without affecting basal metabolism, Atg7 ^+/− mice were crossed with ob / w mice to produce Atg7 ^+/− −ob / ob mice. Interestingly, blood glucose levels in Atg7 ^+/− −ob / ob mice were significantly increased compared to Atg7 ^{+ / +} −ob / ob mice to reach the diabetic range (FIG. 3A). In addition, IPGTT showed severe glucose intolerance with significantly increased area under the curve (AUC) in Atg7 ^+/- -ob / ob mice compared to Atg7 ^{+ / +} -ob / ob mice. Appeared (FIG. 3B). On the other hand, the weights of Atg7 ^+/- -ob / ob mice and Atg7 ^{+ / +} -ob / ob mice were not statistically significant (FIG. 4a), which was attributed to the same degree of obesity that autophagy was impaired. Means worsening metabolic stress. Glucose tolerance and body weight of Atg7 ^{+ / +} -ob / w and Atg7 ^+/- -ob / w mice were not different from Atg7 ^{+ / +} and Atg7 ^+/- mice, respectively (Figure 2ag). In using the Atg7 ^{+ / +} and ^+/- mice instead Atg7 Atg7 ^{+ / +} -ob ^/ w and tg7 ^+/- -ob / w mice were conducted a follow-up experiment. Next, diabetic mechanisms were examined in Atg7 ^+/- -ob / ob mice. Insulinogenic index (IGI) ^20, which represents insulin secretion from pancreatic β-cells in response to increased glucose levels, was significantly higher in Atg7 ^+/- -ob / ob mice compared to Atg7 ^{+ / +} -ob / ob mice ( 3b), which means that β-cell failure is not the primary cause of diabetes. Β -cell structure and amount of Atg7 ^+/- -ob / ob and Atg7 ^+/- -ob / w mice were not different from Atg7 ^{+ / +} -ob / ob and Atg7 ^{+ / +} -ob / w mice, respectively (Fig. 4c, d). The homeostatic model assessment of insulin resistance (HOMA-IR) index was then calculated ²¹ . HOMA-IR was significantly increased in Atg7 ^+/- -ob / ob mice compared to Atg7 ^{+ / +} -ob / ob mice (FIG. 3C), indicating that insulin resistance worsened in Atg7 ^+/- -ob / ob mice. Indicates. In addition, the insulin resistance test ITT (Insulin tolerance test) result, Atg7 ^{+ / +} -ob / ob damaged response to insulin in Atg7 ^+/- -ob / ob mice as compared to mice appeared (Fig. 3d). Insulin sensitivity index K _ITT was further reduced in Atg7 ^+/- -ob / ob mice compared to Atg7 ^{+ / +} -ob / ob mice and showed decreased K _ITT values compared to non-diabetic mice (FIG. 4E). . In vivo insulin signaling was examined to confirm aggravated insulin resistance in Atg7 ^+/- -ob / ob mice. Atg7 ^{+ / +} -ob ^/ ob mice as compared to insulin in Atg7 ^+/- -ob / ob mouse tissues induced Akt phosphorylation S473 was more damaging, Atg7 ^{+ / +} as compared to the -ob / w mouse insulin-induced Akt Phosphorylation was also reduced (FIG. 4E).

Atg7 ^+/- -oxidative stress in ob / ob mice And lipids  damaged

The mechanism for exacerbated insulin resistance in Atg7 ^+/- -ob / ob mice was investigated. JNK phosphorylation ^{22 , 23} , the major mediator of insulin resistance ^, was better seen in Atg7 ^+/− −ob / ob mouse tissues compared to Atg7 ^{+ / +} −ob / ob mice (FIG. 5A). IRS-1 S307 phosphorylation activates JNK phosphorylation downstream and inhibits IRS-1 signaling ²² . IRS-1 S307 phosphorylation was more pronounced in Atg7 ^+/- -ob / ob mouse tissues compared to Atg7 ^{+ / +} -ob / ob mice (FIG. 5A). Next, we tested whether free radicals could be increased in autophagy deficiency ^{24 , 25,} and phosphorylation of JNK ²⁶ . Nitrotyrosine accumulation indicative of ROS damage was more pronounced in Atg7 ^+/- -ob / ob mice compared to Atg7 ^{+ / +} -ob / ob mice or Atg7 ^+/- -ob / w mice (FIG. 5B). Dihydroethidium (DHE) -stained cell populations reflecting ROS production are sparse in Atg7 ^{+ / +} -ob / ob mice, while well observed in Atg7 ^+/- -ob / ob mice liver. Almost no DHE-stained cells were observed in the liver of Atg7 ^+/- -ob / w or Atg7 ^{+ / +} -ob / w mice (FIG. 6A). Protein carbonylation was increased from Atg7 ^+/- -ob / ob mouse tissues as compared to Atg7 ^{+ / +} -ob ^/ ob or Atg7 ^+/- -ob / w mouse (Figure 5c) indicating the ROS damage. Since p53 activity can be increased in obese mouse tissues by ROS, p53 of insulin target tissues of ^{27 , 28} autophagy-impaired mice was measured. p53 phosphorylation and its downstream of p21 expression was found to be Atg7 ^{+ / +} -ob ^/ ob or Atg7 ^+/- compared with -ob / w ^+/- mouse Atg7 -ob / ob further increase in mouse tissues (Fig. 5d). The aging-like phenotype index reflecting ROS damage, SA-β-gal activity ^{27 , 29} was more pronounced in WAT in Atg7 ^+/- -ob / ob mice compared to the modest increase in Atg7 ^{+ / +} -ob / ob mice. Markedly increased (FIG. 6B).

In addition, the amount of lipids that could be affected by autophagy was measured ³⁰ . Triglyceride levels in Atg7 ^+/- -ob / w mice were measured by ORO (Oil Red O) staining and lipid extraction or biochemical methods, and the results were significantly different from those in Atg7 ^{+ / +} -ob / w mice. None (FIGS. 7A-B). However, the amount of TG between Atg7 ^+/- -ob / ob mice was significantly higher compared to Atg7 ^{+ / +} ob / ob mice (Figures 7a-b), which was insufficient 'lipids in Atg7 ^+/- -ob / ob mice. It may be because 'lipophagy' has occurred. As a result of electron microscopic observation, the droplet size was larger in the liver of Atg7 ^+/- -ob / ob mice compared to Atg7 ^{+ / +} -ob / ob mice (FIG. 7C). Compared to Atg7 ^{+ / +} -ob / ob mice, serum ALT / AST (alanine aminotransferase / aspartate aminotransferase) levels were significantly higher in Atg7 ^+/- -ob / ob mice, presumably due to increased lipid accumulation in the liver. Seems to be (FIG. 7D). In addition, serum FFA (free fatty acid) levels compared with Atg7 ^{+ / +} -ob ^/ ob mice were significantly higher in Atg7 ^+/- -ob / ob mice (FIG. 7e). Hepatocellular apoptosis steadily increased serum ALT / AST are shown in comparison with Atg7 ^{+ / +} -ob ^/ ob mice and increased in Atg7 ^+/- -ob / ob mice (FIG. 7f).

In lipid overload  by Self-feeding

Since insufficient autophagy in Atg7 ^{+ / +} -ob / ob mice did not fully support adaptation changes to metabolic stress, GFP- LC3 ⁺ -ob / ob mice were constructed to investigate the relationship between obesity and autophagy. LC3 spots were rarely found in GFP -LC3 ⁺ -ob / w mice, while well observed in GFP -LC3 ⁺ -ob / ob mouse tissues (FIG. 8A). LC3 spot number was significantly increased in GFP- LC3 ⁺ -ob / ob mouse tissues compared to GFP -LC3 ⁺ -ob / w mice (FIG. 8A), indicating an increase in autophagy levels in obese mice. In addition, as a result of electron microscopy, the number of autophagosomes was significantly higher in the tissues of ob / ob mice than in ob / w mice (FIG. 8B). Immunoblot analysis was performed using anti-GFP antibodies to confirm that increased LC3 spots were due to increased activation of autophagy or inhibition of autophagy ¹⁵ . Cleavage of GFP ³¹ reflecting lysosomal degradation and autophagy activity of autophagy substrates was not observed in GFP -LC3 ⁺ -ob / w mice, but was observed in GFP -LC3 ⁺ -ob / ob mouse tissue (FIG. 8C), This indicates that autophagy flux was increased in ob / ob mice. On the other hand, LC3 conversion after autophagy 'clamping' at the lysosomal stage by in vivo leupeptin administration was investigated ¹⁹ . LC3 conversion was increased in liver of ob / ob mice treated with leupeptin (FIG. 8D), indicating that increased autophagy levels in ob / ob mouse tissue are due to increased autophagy flux. However, p62 levels in ob / ob mice liver were increased compared to ob / w mice under leupeptin treatment conditions (FIG. 8D), which is inconsistent with the increase in autophagy activity ¹⁵ . Thus, proteolytic assays showing final degradation of autophagy protein substrates were performed using SK-Hep1 cells ¹⁵ . Lysosomal degradation of longevity proteins is markedly inhibited by palmitic acid (PA) or oleic acid (OA) (FIG. 8E), which is increased by lipids whose autophagy activity enables intracellular lipid processing, but proteolysis In spite of increased predation activity, this means a reduction in autophagy organ sequestration for 'lipid lysis'. In addition, this result means that lipid overload increases the need for autophagy that is not met in Atg7 ^+/- -ob / ob mice.

Next, after loading the lipids in vitro, it was tested whether autophagy failure affects the amount of lipids in the cells. Loading the PA and OA mixture was then significantly increased in Atg7 ^+/- MEF as compared to the amount Atg7 ^{+ / +} MEF of TG (Fig. 8f). Subsequently, experiments were conducted to determine whether increased lipid levels affect insulin signaling in cells that lack autophagy. Insulin signaling is more related to hepatocytes than MEF, so Atg7 instead of Atg7 ^+/- MEF Hepatocyte lines infected with adenovirus expressing siRNA were used for the experiment. Adenovirus Atg7 siRNA expression decreased Atg7 mRNA expression by ˜50 % in SK-Hep1 or Hepa1c1c7 cells (FIG. 9A). The amount of TG following loading of the PA and OA mixtures was compared to Atg7 compared to control-infected cells. It was significantly higher in cells infected with adenovirus expressing siRNA (FIG. 9B). In addition, insulin resistance by PA and OA mixtures was exacerbated by adenovirus expression in lipid-loaded cells compared to control siRNA expression (FIG. 9C), with autophagy insufficiency with lipid overload resulting in increased lipid accumulation and insulin resistance. It means to cause. Consistently JNK activation and IRS-1 S307 phosphorylation were compared to Atg7 compared to control-infected cells It was more pronounced in cells infected with adenovirus expressing siRNA (FIG. 9D).

Self-feeding  In insufficient condition Increased  Inflammatory response

Autophagy deficiency causes proinflammatory reactions ^{32 , 33} , and because the inflammatory response is a major component of insulin resistance associated with lipid damage, the expression of inflammatory markers was investigated. The number of crown-like structures (CLS) ³⁴ exhibiting lipid related inflammation in WAT of Atg7 ^+/- -ob / ob mice was significantly increased compared to Atg7 ^{+ / +} -ob / ob mice (FIG. 10A). RT-PCR (FIG. 10b) and real-time RT-PCR (FIG. 11ac) show expression of inflammatory cytokines such as Tnfα or Il6 , F4 / 80 showing macrophage infiltration compared to Atg7 ^{+ / +} -ob / ob mice Increased in Atg7 ^+/- -ob / ob mouse tissue.

Activation of the inflammasomes plays an important role in lipid-induced insulin resistance ^{35 and 36} , autophagy deficiency increases the maturation of ³³ IL-1β by accumulation of damaged mitochondria, thus the expression and inflammation of ³² IL-1β. The activation of regulatory complexes was investigated. RT-PCR (Fig. 5b), and real-time RT-PCR (Fig. 11d) results, pro- Il1b expression Atg7 ^{+ / +} -ob ^/ w as compared to the mouse Atg7 ^{+ / +} -ob ^/ ob mouse WAT of the SVF (stromal vascular fraction). However, Atg7 ^+/- -ob / ob mouse in the tissue pro- Il1b expression was not increased as compared with Atg7 ^{+ / +} -ob ^/ ob mice (Fig. 10b and 11d). On the other hand, wherein the antibody -IL-1β to mature IL-1β in a pro-IL-1β by measuring the immune blotting using compares and Atg7 ^{+ / +} -ob ^/ ob mouse Atg7 ^+/- -ob / ob mice There was a marked increase in SVF (FIG. 10C). Cleavage of the caspase-1 in an important pro-inflammatory caspase-1 in complex control activation and IL-1β maturation Atg7 ^{+ / +} as compared to the -ob / ob mice was increased in Atg7 ^+/- -ob / ob mouse SVF ( Fig. 10d), which Atg7 ^{+ / +} as compared to the -ob / ob mouse in Atg7 ^+/- -ob / ob mice the induction of pro- Il1b self rather than to contribute to the inflammation control complex activated macrophages increase in half failure state means increased maturation from pro-IL-1β to IL-1β. To reconfirm this in vitro, it was tested whether autophagy hepatic insufficiency macrophages secrete more IL-1β in response to lipid treatment. PA with the LPS (lipopolysaccharide) Atg7 ^+/- - treatment in macrophages and a result of measuring the secretion amount of IL-1β through the ELISA, Atg7 ^{+ / +} - macrophages than Atg7 ^+/- - IL- in macrophages 1β was found to be significantly secreted (FIG. 10E), which suggests that increased inflammatory complex activation in response to metabolic stress in autophagy-deficient conditions causes insulin resistance and diabetes in Atg7 ^+/- -ob / ob mice. It means.

Experiments were carried out on the self-mitochondrial events important in inflammation control composite activated in order to investigate the mechanism of the increase in inflammation control complex activated macrophages associated with dysfunction half ^{33 and 38.} The percentage of NAD ⁺ / NADH reduction seen by PA or LPS alone treatment in Atg7 ^{+ / +} -macrophages was shown to be further reduced in Atg7 ^+/- -macrophages (FIG. 10F). It was also confirmed that the amount of mitochondrial ROS is important for inflammatory regulatory complex activation and can be increased by mitochondrial dysfunction ³⁷ . The mitochondrial ROS amount measured by MitoSox staining was less effective when LPS alone treatment, but the mitochondrial ROS amount was significantly increased when PA and LPS were treated together in wild-type macrophages (Fig. 10g). Increasing mitochondrial ROS levels by simultaneous treatment with PA and LPS resulted in larger Atg7 ^+/- macrophages (FIG. 10g), suggesting that autophagy failure increased mitochondrial ROS production and inflammatory regulatory complex activation by lipid damage. ^{33 , 38} . Flow cytometry after staining with mitotracker green and mitotracker red resulted in a decrease in the fraction of cells stained by mitotracker red after PA and LPS treatment, thus reducing mitochondrial translocation, compared to control macrophages. The fraction of cells stained with mitotracker red in Atg7 ^+/− macrophages was increased (FIG. 10H). This means that the increased inflammatory regulatory complex activation observed in Atg7 ^+/- macrophages plays an important role in mitochondrial dysfunction.

Atg7 ^+/- High Fat for Metabolic Profile in Mice Dietary  effect

The ob / ob mice lacked all of leptin signaling and provided a high-fat diet (HFD) to impose more severe physiological metabolic stress. Atg7 ^+/- provided by the 21 weeks HFD - mouse is a Atg7 ^{+ / +} HFD provides - compared to the mice showed the non-fasting blood glucose level high (Fig. 12a). Two-way ANOVA showed no significant difference in the blood glucose profiles of Atg7 ^+/- and Atg7 ^{+ / +} mice over the entire period of HFD presentation , whereas in each t-test, between 16-18 weeks of HFD presentation. Compared with Atg7 ^{+ / +} mice, the fasting blood glucose levels of Atg7 ^+/- mice were significantly increased (FIG. 12A). This implies that autophagy is impaired in the ability to control metabolic stress. Further, the HFD diet after 18 weeks in the fasting blood glucose level Atg7 ^+/- mice were significantly increased as compared to the Atg7 ^{+ / +} mice (FIG. 12b). HFD diet were impaired glucose tolerance is significantly deteriorated in Atg7 ^+/- mice as compared to Atg7 ^{+ / +} mouse showing the results, the increased AUC subjected to IPGTT after 18 weeks (Fig. 12c). In addition, HOMA-IR index representing insulin resistance was increased from Atg7 ^+/- mice as compared to Atg7 ^{+ / +} mice (Figure 12d). ITT was performed in Atg7 ^+/− mice after 18 weeks of HFD diet, showing a decreased K _ITT value compared to HFD-diet Atg7 ^{+ / +} mice, indicating a decrease in insulin sensitivity (FIG. 12E). Body weight did not differ between Atg7 ^+/− and Atg7 ^{+ / +} mice in either normal or HFD diets (FIG. 13A). After 18 weeks of HFD diet, IGI was increased in Atg7 ^+/− mice compared to Atg7 ^{+ / +} mice, indicating a change in β-cells with increased insulin resistance (FIG. 13B). HFD diet were 18-21 weeks of the results of measuring the amount of liver TG through the ORO stain, Atg7 ^{+ / +} mice as compared to the significant increase in serum FFA and ALT / AST levels in Atg7 ^+/- mice (Figure 13ce).

Self-feeding Metabolism of enhancers  effect

According to the above results, autophagy dysfunction in metabolic overload was found to lead to an increase in lipid content and deterioration of insulin resistance. Finally, an experiment was performed to investigate the metabolic effects of autophagy enhancers. In vitro self used the imatinib known to have a promoting effect on the phagocytic experiments ^39,40. Hepatocytes pretreated with E64d / pepstatin A were used to determine whether imatinib increased autophagy flux (FIG. 14A). It was also confirmed whether imatinib can increase autophagy flux in vivo. When imatinib was administered to mice in combination with leupeptin, the conversion of LC3-I to -II in the liver was significantly increased as compared to leupeptin alone (FIG. 15A), which indicates that autophagy fluxes in imatinib in vivo Means to increase. In addition, imatinib induces increased GFP cleavage in GFP-LC3 ⁺ mouse tissue compared to the control (FIG. 14B), indicating that imatinib promotes autophagy activity in vivo. To confirm the autophagy -promoting effect of imatinib in vivo and in vitro, Atg7 ^+/- -ob / ob mice were administered imatinib and blood glucose was monitored. Two- way analysis revealed that imatinib significantly reduced non-fasting blood glucose levels in Atg7 ^+/- -ob / ob mice (FIG. 15B). The decrease in blood glucose levels induced by imatinib in Atg7 ^+/- -ob / ob mice is associated with increased autophagy activity in the liver measured after administration of leupeptin to mice treated with imatinib for 8 weeks (FIG. 14C). Body weight was not significantly affected by imatinib administration (FIG. 14D), which means that imatinib (25 mg / kg ⁻¹ ) did not exhibit a toxic or appetite reducing effect. In addition, IPGTT and ITT results showed significant glucose tolerance and insulin sensitivity improvement effects (FIG. 15C, d), which are associated with decreased AUC and increased K _ITT values, respectively (FIG. 14E). Liver TG amount and serum ALT / AST levels were markedly decreased by administration of imatinib to Atg7 ^+/- -ob / ob mice (FIG. 14F, g). Moreover, Akt S473 phosphorylation induced by insulin in liver and muscle is markedly enhanced by imatinib, which means that imatinib improves glucose profile by enhancing insulin sensitivity (FIG. 15E). Consistently, JNK and IRS-1 S307 phosphorylation is reduced by imatinib in the liver and muscle (FIG. 15F). In addition, imatinib improves the metabolic profile of Atg7 ^{+ / +} −ob / ob mice and enhances glucose tolerance and insulin sensitivity in IPGTT and ITT without weight change (FIG. 14H-K). This is similar to previous studies with db / db mice, meaning that the effects of imatinib are not limited to genetic autophagy-deficient mice.

Since imatinib may affect metabolism via other pathways besides autophagy , we tested the effects of other autophagy enhancers on the metabolic profile of ²² Atg7 ^{+ / +} -ob / ob mice. We selected trehalose, which is reported to inhibit neurodegeneration by enhancing autophagy activity ^{41 , 42} . As a result, trehalose enhanced the autophagy flux of hepatocytes in vitro (FIG. 14A). As a result of two-way dispersion analysis by administering trehalose to Atg7 ^{+ / +} -ob / ob mice for 8 weeks, the metabolic profile was greatly improved (FIG. 15B). This shows that enhancing autophagy activity can have a beneficial effect on body metabolism in autophagy mice under metabolic stress. In addition, glucose tolerance and insulin sensitivity were significantly improved in Atg7 ^+/- -ob / ob mice treated with trehalose for 8 weeks in IPGTT and ITT, which resulted in decreased AUC and increased K _ITT values. 15C, d and 14E. Atg7 ^+/- -ob / ob improve the metabolic profile in mice by administration of trehalose was converted into the LC3 -Ⅱ in-I appeared after the administration of leupeptin to Atg7 ^+/- -ob / ob mice treated with 8 weeks trehalose It is accompanied by an increase in in vivo autophagy fluxes demonstrated by increase (FIG. 14C). Liver TG amount and serum ASL / ALT levels in Atg7 ^+/− −ob / ob mice were markedly reduced by 8 weeks of trehalose administration (FIG. 14F, g).

Having described the specific part of the present invention in detail, it is apparent to those skilled in the art that such a specific technology is only a preferred embodiment, and the scope of the present invention is not limited thereto. Thus, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.

Claims (10)

1. Screening method for a diabetes treatment comprising the following steps:

   (a) administering a test substance to an animal other than a human showing Atg7 ^+/- -ob / ob trait; And

   (b) measuring a hematological or histological indicator value correlated with a diabetic or glucose metabolic abnormality from the animal, wherein the test substance changes normally the hematological or histological indicator value normally. Is considered a diabetes treatment.
2. The method of claim 1 wherein the animal is a mammal.
3. The method of claim 2, wherein the mammal is a mouse, rat, pig or monkey.
4. The method of claim 1, wherein the hematological or histological indicator value is at least one selected from the group consisting of blood diabetes related components, insulin resistance, blood glucose levels, and blood insulin levels.
5. The method of claim 4, wherein the blood-related diabetic component is any one selected from the group consisting of triglycerides, cholesterol, free fatty acids, ALT, AST, HDL and LDL.
6. A method of analyzing the therapeutic efficacy of a diabetes treatment comprising the following steps:

   (a) administering an antidiabetic agent to an animal other than a human showing Atg7 ^+/- -ob / ob trait; And

   (b) determining the therapeutic efficacy of the diabetes therapeutic agent by measuring a hematological or histological indicator value correlated with diabetes or glucose metabolic abnormalities from the animal.
7. Atg7 ⁺ /--Diabetic animal model, characterized in that the animal except humans showing the ob / ob trait.
8. The method of claim 7, wherein the animal model and the animals Atg7 ^{+/- +/-} Atg7 animal model, characterized in that obtained by mating the animal with the same kind of ob / w animal.
9. 8. The animal model of claim 7, wherein said animal is a mammal.
10. 10. The animal model of claim 9, wherein the mammal is a mouse, rat, pig or monkey.

Images