WO2016041042A1 - Peptides synthétiques se liant aux récepteurs de vegf et leurs utilisations - Google Patents

Peptides synthétiques se liant aux récepteurs de vegf et leurs utilisations Download PDF

Info

Publication number
WO2016041042A1
WO2016041042A1 PCT/BR2015/050152 BR2015050152W WO2016041042A1 WO 2016041042 A1 WO2016041042 A1 WO 2016041042A1 BR 2015050152 W BR2015050152 W BR 2015050152W WO 2016041042 A1 WO2016041042 A1 WO 2016041042A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
vegf receptor
peptide
peptides according
binding peptides
Prior art date
Application number
PCT/BR2015/050152
Other languages
English (en)
Portuguese (pt)
Inventor
Ricardo José GIORDANO
Jussara Michaloski SOUZA
Caio Cesar Nogueira CAMBUI
Original Assignee
Universidade De São Paulo - Usp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Universidade De São Paulo - Usp filed Critical Universidade De São Paulo - Usp
Publication of WO2016041042A1 publication Critical patent/WO2016041042A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/03—Peptides having up to 20 amino acids in an undefined or only partially defined sequence; Derivatives thereof
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K4/00—Peptides having up to 20 amino acids in an undefined or only partially defined sequence; Derivatives thereof
    • C07K4/12—Peptides having up to 20 amino acids in an undefined or only partially defined sequence; Derivatives thereof from animals; from humans

Definitions

  • the invention is in the field of pharmacology, and more specifically in the field of pharmacologically active peptides, as it relates to synthetic VEGF family tyrosine kinase receptor-binding peptides and their uses.
  • the industrial application of the invention relates to the fact that synthetic peptides are produced in the industrial environment with various application possibilities.
  • angiogenesis The formation of new blood vessels in an adult organism occurs mainly through a process called angiogenesis, in which these new vessels form by germination from existing vessels.
  • Angiogenesis is an important process in the progression of many diseases, including cancer and retinopathies.
  • Compounds capable of inhibiting angiogenesis are potential therapeutic agents.
  • VEGF Vascular Endothelial Growth Factor
  • family members are important in angiogenesis
  • anti-VEGF therapies are already successful in treating Age-Related Macular Degeneration (AMD), which causes blindness, and also prolong survival. of patients with certain cancers.
  • AMD Age-Related Macular Degeneration
  • these therapeutic agents including anti-VEGF monoclonal antibodies, may have resistance and some serious side effects such as intestinal perforation, hypertension and cardiac changes (Ellis & Hicklin, 2008; Welti et al., 2013).
  • New drugs that selectively inhibit pathological angiogenesis without affecting normal endothelial cell homeostasis are therefore required for the effectiveness of anti-angiogenic therapies.
  • VEGF vascular endothelial growth factor
  • VEGFR vascular endothelial growth factor
  • the vascular endothelial growth factor family consists of 5 members: VEGF, VEGF-B, VEGF-C, VEGF-D, and P1GF (Placental Growth Factor) ( Figure 1).
  • VEGF also known as VEGF-A
  • VEGFR-1, VEGFR-2 Figure 1). Therefore, most angiogenesis inhibitors used in therapies are directed against VEGF and its main receptor, VEGFR-2 (Ellis & Hicklin, 2008).
  • VEGFR-3 receptor is an important target in anti-angiogenic therapy (Tammela et al., 2008).
  • the VEGFR-3 receptor interacts with two VEGF family ligands (VEGF-C and VEGF-D), being expressed in lymphatic endothelial cells and is involved in lymphangiogenesis (Ellis and Hicklin, 2008), as shown in Figure 1.
  • VEGF-C and VEGF-D VEGF family ligands
  • VEGFR-3 is highly expressed in blood vessel endothelial cells, particularly during angiogenesis, in tip cells which are end cells that guide the migration process of the newly forming blood vessel (Tammela et al. al., 2008).
  • Antibodies that block the action of VEGFR-3, in addition to affecting lymphatic vessel formation, are also able to inhibit angiogenesis in tumors (Laakkonen et al., 2007; Tammela et al., 2008).
  • VEGFR-3 and its VEGF-C ligand are interesting targets in anti-angiogenic therapy because, unlike VEGF and its receptor VEGFR-2 (expressed in quiescent endothelial cells and important for the survival of these cells), VEGFR-3 only It is expressed in endothelial cells that are migrating and consequently are involved in the process of formation of new blood vessels.
  • VEGFR-1 molecules and their P1GF ligand are also important in vessel formation by the disease-associated angiogenesis process. Inhibitors of these molecules block retinal vessel formation and reduce tumor growth (Wu et al, 2006; Dewerchin & Carmeliet, 2012). Therefore, molecules that interfere and modulate VEGFR-1 and P1GF activity may be important for the treatment of diseases with an angiogenic component, such as cancer and retinopathy.
  • the Phage Display technique allows the identification of linker peptides of virtually any biological molecule. This is done by surface expression of viral particles (bacteriophages) of a wide variety of peptide sequences (over 10 9 different peptides). Bacteriophages, also called phages, expressing different peptides form a phage library that can be incubated with a target molecule or cell surface, both in vitro and in vivo, and those phages that bind to the target or cell surface through peptides can be recovered by bacterial infection (as these viruses infect bacteria). The process of targeting phage binding and infection of these phages into bacteria can be repeated until phage sample enrichment expressing target-binding peptides occurs.
  • peptide selection assays can be performed in vitro against: surface-attached target molecules; cells that may or may not be stimulated to alter receptor expression; dissected tissues; and also in vivo by injecting the phages into the animal's circulation, removing the organs of interest and selecting those phages expressing peptides that interact with the vasculature of different organs of the organism.
  • Selective therapeutic agents against VEGF receptors may be effective in inhibiting pathological angiogenesis.
  • VEGFR-3 has been chosen as a target for the search for new compounds that can be used in angiogenic therapies.
  • the present invention describes peptides with antagonist and agonist activity of different members of the VEGF family to their receptors.
  • PCAIWF vascular endothelial growth factor
  • FGF fibroblast growth factor
  • PDGF platelet derived growth factor
  • the PCAIWF peptide administered by intraocular injection is capable of inhibiting retinal neovascularization (angiogenesis) in the animal model of prematurity retinopathy we established in the laboratory.
  • angiogenesis retinal neovascularization
  • the PCAIWF peptide is recognized by receptors expressed on endothelial cell surface and undergoes internalization and may act as a specific target of these cells.
  • the anti-angiogenic activity of the PCAIWF peptide has therapeutic potential in the prevention and / or treatment of retinopathies and perhaps other human diseases with an associated angiogenic component, and may also be used for addressing. specific drug targeting endothelial cells.
  • CPLWYYWYEC sequence Another peptide of this invention (CPLWYYWYEC sequence) is an allosteric agonist, increasing the affinity of VEGFR-3 for its VEGF-C ligand. Based on this result, we suggest that the CPLWYYWYEC peptide may be used as a pro-lymphangiogenic and pro-angiogenic agent, stimulating the formation of lymphatic and blood vessels. This is desirable in situations where lymphatic vessels do not function properly (eg, lymphedema) or cardiac ischemia, where new blood vessel formation is desirable.
  • the invention relates to synthetic VEGF receptor binding peptides and their uses.
  • the present invention describes inhibitors and activators of VEGF family angiogenic factors.
  • Figure 1 refers to a schematic representation of VEGF family factors and their receptors.
  • Figure 2 is a flowchart of the phage library construction.
  • Figure 3A is a graphical representation of panning results against VEGFR-3 target using the CX8C phage library.
  • Figure 3B is a graphical representation of panning results against the VEGFR-3 target using the X6 phage library.
  • Figure 4A is a graphical representation of the results of the peptide-receptor interaction validation assay demonstrating the selected phages in panning against VEGFR-3 and surface depicted only with the CPLWYYWYEC (A) peptide incubated with different targets.
  • Figure 4B is a graphical representation of the results of the peptide-receptor interaction validation assay demonstrating the selected phages in panning against VEGFR-3 and surface PCAIWF (B) incubated with different targets only.
  • Figure 5A is a graphical representation of the results of competition assays in which phages bearing the CPLWYYWYEC peptides were incubated with the extracellular portion of the VEGFR-3 receptor in the presence and absence of competitor VEGF-C and VEGF165. .
  • Figure 5B is a graphical representation of the results of competition assays in which phages displaying the PCAIWF peptides were incubated with the extracellular portion of the VEGFR-3 receptor in the presence and absence of competitor VEGF-C and VEGF165. .
  • Figure 6 is a graphical representation of the results of competition assays in which phages displaying the PCAIWF peptides were incubated with the extracellular portion of the VEGFR-3 receptor in the presence and absence of increasing concentrations of competitor VEGF-C and no competitor.
  • Figure 7A is a graphical representation of the results of competition assays in which the synthetic peptide PCAIWF inhibits binding of phage-PCAIWF to the VEGFR-3 receptor, while the control peptide IFCAPW has no effect.
  • Figure 7B is a graphical representation of the results of competition assays showing inhibition of phage-PCAIWF binding to VEGFR-3 receptor is inhibited by synthetic peptide PCAIWF is dependent on peptide concentration while higher dose peptide IFCAPW control has no effect.
  • Figure 8A is a graphical representation of the effects of the presence of PCAIWF synthetic peptide, PSAIWF, or IFCAPW control peptide on in vitro ligand-receptor interaction relative to VEGF-C / VEGFR-3.
  • Figure 8B is a graphical representation of the effects of the presence of PCAIWF synthetic peptide, PSAIWF or IFCAPW control peptide on in vitro ligand-receptor interaction relative to VEGF-C / VEGFR-2.
  • Figure 8C is a graphical representation of the effects of the presence of PCAIWF synthetic peptide, PSAIWF or IFCAPW control peptide on in vitro ligand-receptor interaction relative to P1GF / VEGFR-1.
  • Figure 8D is a graphical representation of the effects of the presence of PCAIWF synthetic peptide or IFCAPW control peptide on in vitro ligand-receptor interaction relative to VEGF-A / VEGFR-2.
  • Figure 8E refers to the graphical representation of the effects of the presence of PCAIWF synthetic peptide or IFCAPW control peptide on in vitro ligand-receptor interaction in relation to VEGF-A / VEGFR-1.
  • Figure 9A is a graphical representation of the effects of the presence of PCAIWF synthetic peptide or IFCAPW control peptide on in vitro ligand-receptor interaction relative to PDGF-BB / PDGFR-Beta.
  • Figure 9B is a graphical representation of the effects of the presence of PCAIWF synthetic peptide or IFCAPW control peptide on in vitro ligand-receptor interaction with respect to FGF / FGFR-beta.
  • Figure 10A refers to the effect of synthetic peptide PCAIWF on retinal vascularization of mice in the prematurity retinopathy model.
  • Figure 10B is a graphical representation of the percentage of neovascularized area in the synthetic peptide effect test in the animal model of oxygen-induced retinoplasty.
  • Figure 11A is a representative image of the retina of an animal used to quantify the number of blood vessels for each treatment in the PCAIWF peptide assay inhibiting retinal vessel formation under pathological conditions at a dose of 30 ⁇ g.
  • Figure 11B is a graphical representation of the quantification of retinal vascularized area in the PCAIWF peptide assay inhibiting retinal vessel formation under pathological conditions at a dose of 30 ⁇ g.
  • Figure 11C is a graphical representation of the quantification of the number of buds and bifurcations in angiogenic vessels in the PCAIWF peptide assay inhibiting the retinal vessel formation under pathological conditions at a dose of 30 ⁇ g.
  • Figure 12A is a graphical representation of the effects of the presence of the synthetic peptide PCAIWF, D (PCAIWF), or IFCAPW or D (IFCAPW) control peptides on in vitro ligand-receptor interaction relative to VEGF-C / VEGFR -3.
  • Figure 12B is a graphical representation of the effects of the presence of synthetic peptide PCAIWF, D (PCAIWF), or IFCAPW or D (IFCAPW) control peptides on in vitro ligand-receptor interaction relative to VEGF-C / VEGFR -2.
  • Figure 12C is a graphical representation of the effects of the presence of synthetic peptide PCAIWF, D (PCAIWF), or control peptides IFCAPW or D (IFCAPW) on in vitro ligand-receptor interaction relative to VEGF-A / VEGFR. -2.
  • Figure 12D is a graphical representation of the effects of the presence of PCAIWF synthetic peptide or IFCAPW control peptide on in vitro ligand-receptor interaction relative to VEGF-A / VEGFR-1.
  • Figure 12E is a graphical representation of the effects of the presence of PCAIWF synthetic peptide or IFCAPW control peptide on in vitro ligand-receptor interaction relative to P1GF / VEGFR-1.
  • Figure 13 refers to the ability of endothelial cells to internalize phage-PCAIWF.
  • the invention is in the field of pharmacology, and more specifically in the field of active peptides. as it refers to synthetic VEGF receptor-binding peptides and their uses.
  • the present invention describes peptides that specifically interact with VEGF receptors and modulate their activity by inhibiting it (antagonists) or increasing it (agonists).
  • Peptides are small molecules that can be synthesized to the standards required for human use (Good manufacturing practice, GMP) and thus synthetic peptides are inputs with important biotechnological applications such as biopharmaceuticals.
  • the peptides described by the present invention are: CPLWYYWYEC; CFGVFDFFWC; CELSFRPMMC; CAHHRWAVC; PCAIWF; WVCSGG; PSAIWF; CEYWYYWLPC; CWFFDFVGFC; CMMPRFSLEC; CVAWRHHAC; FWIACP; GGSCVW; FWIASP as shown in SEQ. ID No. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 and 14, respectively.
  • CELSFRPMMC peptide we are referring to the peptide described in SEQ. ID No. 3
  • Said peptides are receptor binders. of VEGF and inhibitors of angiogenic factors of the VEGF family, as shown in the exemplary embodiment of the invention.
  • the peptides of this invention may be synthesized by chemical methods (in solution or coupled to a solid phase) or by biological methods.
  • nucleic acids RNA, DNA or cDNA
  • peptides synthesized by chemical methods are limited to sizes between 5 and about 100 amino acids, by biological methods, peptides between 5 and over 1000 amino acids can be produced.
  • this invention contemplates peptides of between 3 and 1000 synthetically or biologically produced amino acids, which contain the contiguous amino acid sequences listed (SEQ. ID Nos. 1 to 14) or part thereof. These sequences may be found in the starting (amino-terminal) or final region of the protein (carboxy-terminal). But they can also be found in internal regions of proteins. It is important to note that this invention does not contemplate naturally occurring peptides which contain the sequences (or part thereof) of SEQ. ID Nos. 1 to 14. This invention contemplates only synthetic or purposely inserted sequences for modifying natural proteins to bind to VEGFs or their receptors.
  • Protein amino acids can be classified according to the composition of their side chains into: (1) aliphatic hydrophobic amino acids (G, A, L, I, V, P, M), (2) Aromatic (F, Y, W), (3) Hydrophilic (S, T, C, P, N, Q), (4) Basic (K, H, R) or (5) acids (D, E).
  • the amino acids of a peptide may be substituted for others with similar side chains, preserving their biological properties.
  • the peptide PCAIWF (SEQ ID NO: 5) may be synthesized as PSAIWF (SEQ ID NO: 13), where the amino acid cysteine (C) has been replaced by serine (S), both of which have properties. similar.
  • PSAIWF peptide has similar biological activity to the PCAIWF peptide (SEQ. ID No. 5).
  • this invention comprises the SEQ peptides. ID 1 to 14, synthesized using D-amino acids (represented by D (CPLWYYWYEC); D (CFGVFDFFWC);
  • D CELSFRPMMC
  • D CAHHRWAVC
  • D PCAIWF
  • D PSAIWF
  • D (WVCSGG); D (CEYWYYWLPC); D (CWFFDFVGFC); D (CMMPRFSLEC); D (CVAWRHHAC); D (FWIACP); D (FWIASP) and D (GGSCVW).
  • D-amino acid modified PCAIWF peptide SEQ ID NO: 5
  • D (PCAIWF) inhibits the binding of VEGF family angiogenic factors to their receptors in the same way as the peptide. synthesized with L-amino acids.
  • peptides can be synthesized using unnatural amino acids, modified and not found in proteins. These Modifications do not alter the pharmacological properties of peptides, but may alter their half-life within an organism and make them more resistant to degradation by enzymes (proteases and other enzymes involved in peptide metabolism and degradation). Some examples of amino acids that may be used to modify SEQ peptides.
  • ID 1-14 of this invention are beta-alanine (bAla), 3-hydroxyproline (3Hyp), 4-hydroxyproline (4Hyp), N-methyl glycine (MeGly), N-ethylglycine (EtGly), allo-isoleucine (alie ), N-methyl isoleucine (Melle), N-methylvaline (MeVal), norvaline (Nva) and norleucine (Nle).
  • the PCAIWF peptide (SEQ. ID. No. 5) may be synthesized using the modified amino acids beta-alanine in place of alanine and N-methylisoleucine in place of isoleucine.
  • modified amino acids include those skilled in the art, other modified amino acids, in addition to the 20 amino acids found in proteins, may be employed to alter the peptide sequence of this invention, preserving their applications and their pharmacological properties. modulate VEGF receptors and their ligands.
  • peptide PCAIWF SEQ. ID. No. 5
  • FWIACP SEQ. ID. 11
  • peptides SEQ. ID Nos. 8 to 14 may be synthesized as D (CEYWYYWLPC); D (CWFFDFVGFC); D (CMMPRFSLEC); D (CVAWRHHAC); D (FWIACP); D (GGSCVW);
  • FWIASP FWIASP
  • Peptides may also be modified by the addition of different molecules at the terminal amino and carboxyl ends, such as amide, formyl, acetyl, propionyl, succinyl, benzoyl or fatty acids (myristic, palmitic, stearic, among others) residues, to name a few examples.
  • the peptides may further be modified by the addition of polyethylene glycols (PEG) of different molecular sizes. These are modifications commonly used to increase the half-life of the peptide by improving its pharmacological properties.
  • modifications may be made directly on the peptide using terminal amino or carboxyl groups or they may be made on amino acid side chains. Modifications may further be made by the addition of additional amino acids to the peptide sequence.
  • the PCAIWF peptide (SEQ. ID NO: 5) may be synthesized by adding a lysine at the amino or carboxy terminus of the peptide, and the modification added to the side chain amino epsilon group of this lysine.
  • the residue used to add the modification for example lysine may be preceded by a glycine and serine spacer.
  • This spacer is used to increase the distance between the modification and the VEGF linker domain of the peptide.
  • Those skilled in the art will know that other spacers may be used for the same purpose without significantly altering the biological activity and applications of the peptides of this invention.
  • the peptides described in SEQ. ID Nos. 1 to 14 may be used separately or together for the prevention or treatment of diseases where VEGF receptors play an important role in the initiation and progression of the condition.
  • An example of use of this invention is diseases with an angiogenic component.
  • Angiogenesis is also an important component. of hyperplasias.
  • hyperplasia are the different types of cancer. In order for cancer cells to grow into tumors larger than 1 mm 3 , they need oxygen and nutrients to grow. Tumor cells are able to induce the formation of new blood vessels by the process of angiogenesis, and drugs inhibiting this process have been shown to be efficient in the clinic.
  • Angiogenesis inhibitors are therefore important targets in the prevention and / or treatment of patients with different types of cancer.
  • the present invention may be used for the prevention and / or treatment of cancer patients, primarily, but not exclusively, tumors that depend on VEGF-A, VEGF-C and P1GF for their growth.
  • the peptides of this invention for example, PCAIWF peptide (SEQ. ID No. 5), may be used with tumor growth inhibitors.
  • Hyperplasias may still be of the benign type when there is no tissue invasion and destruction.
  • prostate hyperplasia is a common disease in men over 50 years old and endometrial hyperplasia can affect women between 40 and 60 years old. In both cases, there is angiogenesis associated with organ growth (prostate or uterine wall).
  • myoma myoma (uterine bleeding).
  • the present invention may be used for the prevention and / or treatment of benign hyperplasia such as endometriosis, fibroid or hyperplasia. benign prostate.
  • the present invention may also be used for the prevention and / or treatment of other diseases where blood vessel formation is an important component.
  • diseases were classified by Dr. Judah Folkman in 2007 as angiogenesis-dependent diseases (Folkman, 2007) and include rheumatoid arthritis, atherosclerosis, psoriasis, and Crohn's disease (intestinal bleeding).
  • angiogenesis plays an important role
  • the peptides of this invention may be used for the prevention and / or treatment of obesity, especially morbidly obese obesity (where the patient's body mass index is greater than 40).
  • VEGF and its receptors are also important in the formation of the lymphatic system.
  • the lymphatic vessels are also part of the circulatory system, and are responsible for the removal of interstitial fluid and its return to the blood circulatory system. They are also important in the absorption of nutrients in the small intestine (fatty acids) and in the circulation of system cells. immune. Failures in the lymphatic system cause various diseases in humans, and the peptides of this invention may be used for their prevention and / or treatment.
  • VEGF-C, VEGF-D and their receptors, VEGFR-2 and VEGFR-3 are important in lymphatic vessel system formation and therefore VEGF-C, VEGF-D and VEGFR-3 are important targets. for the prevention and / or treatment of diseases of the lymphatic system (Cueni & Detmar, 2008). Lymphatic vessels are important in homeostasis of biological fluids, circulation of immune cells or tumor cells in establishing new metastatic sites (Liersch & Detmar, 2007).
  • lymphedema also known as lymphatic obstruction
  • lymphatic obstruction is a dysfunction caused by obstruction of vessels in the lymphatic system, which results in fluid accumulation in the affected organ (s) or tissue (s).
  • the peptides of this invention for example, the CPLWYYWYEC peptide (SEQ ID NO: 1) which enhances the activity of the lionfangiogenic factor VEGF-C
  • carcinomas are known to use the vessels of the lymphatic system to distribute themselves throughout the body.
  • Carcinomas malignant tumors from epithelial cells
  • lymph nodes near the primary tumor to colonize other tissues, giving rise to secondary tumors (metastases). Therefore, when operating patients with breast tumors (carcinomas), surgeons routinely remove the patient's lymph nodes (and sometimes the entire breast) to reduce the chances of return of the breast. tumor.
  • a possible application of the peptides of this invention e.g., PCAIWF peptide (SEQ. ID. No. 5)
  • PCAIWF peptide SEQ. ID. No. 5
  • carcinomas that can be prevented and / or treated with this invention, we refer to tumors of the breast, penis, skin, mouth, lung, stomach, cervix and prostate.
  • the peptides described in SEQ. ID Nos. 1 to 14, for example: PCAIWF may be combined with a drug with high toxicity, such as chemotherapy for cancer prevention and / or treatment, for example. That way the drug in question will be targeted.
  • these drugs may preferably be directed to cells expressing larger VEGF receptors (e.g., cancer cells and tumor blood vessel cells), minimizing the effect of chemotherapy in other tissues of the body.
  • VEGF receptor-binding peptides may be chemically conjugated to other drugs to direct the therapeutic agent to cells expressing VEGF receptors.
  • VEGF and its receptors are important targets that can be used to target drugs to tumors.
  • therapeutic agents which may be conjugated to this invention are cisplatin, gemcitabine, methotrexate, mitomycin, tamoxifen or taxol chemotherapeutic agents.
  • cisplatin gemcitabine
  • methotrexate mitomycin
  • tamoxifen or taxol chemotherapeutic agents.
  • these drugs used to treat cancer a disease in which tumor cells commonly produce large amounts of one or more VEGF receptors (VEGFR-1, VEGFR-2 or VEGFR-3).
  • this invention may be used to target these drugs preferentially to tumor cells, reducing systemic cytotoxic effects of these chemotherapeutic agents.
  • the peptides of this invention may also be conjugated to other types of medicaments such as anti-angiogenics (TNP-470, angiostatin, endostatin, thalidomide, sunitinib or avastin), steroidal anti-inflammatory drugs (hydrocortisone, cortisone, prednisone, betamethasone , dextamethasone) or non-steroids
  • anti-angiogenics TNP-470, angiostatin, endostatin, thalidomide, sunitinib or avastin
  • steroidal anti-inflammatory drugs hydrocortisone, cortisone, prednisone, betamethasone , dextamethasone
  • antibiotics penicillin, bacitracin, gentamicin, kanamycin, neomycin, streptomycin, spectromycin, cefaclor, tobramycin, cefazolin, vancomycin, erythromycin, amoxillin, among others.
  • growth factors, hormones, pro-apoptotic molecules, cytokines and cytokines may be conjugated to the peptides of this invention so that the molecule in question can be directed to the vasculature or cells expressing VEGF receptors.
  • peptides can be conjugated by biological (or chemical) methods to hormones, cytokines or cytokines, improving their pharmacology and, consequently, decreasing their toxicity (Corti et al., 2012).
  • growth factors, hormones, cytokines and cytokines that may be conjugated to the peptides of this invention: growth hormone, thyroid and parathyroid hormones, insulin, follicle stimulating hormones (FSH), testosterone and hormones.
  • peptides of this invention may further be conjugated to suicide molecules, which induce target cell death (apoptosis).
  • suicide molecules which induce target cell death (apoptosis).
  • apoptotic molecules are Bel proteins, Fas and caspases, or ceramide molecules and peptide D (KLAKLAKKLAKLAK) according to SEQ. ID 15
  • gene therapy vectors e.g., adenovirus and lentivirus
  • gene therapy vectors e.g., adenovirus and lentivirus
  • These viral vectors are capable of infecting a wide variety of cells and thus transferring their genetic content to these cells.
  • a viral vector eg, genetically modified adenovirus
  • peptides described in SEQ. ID Nos. 1 to 14, for example, PCAIWF allow cells producing VEGF receptors to be infected preferentially (or exclusively) and to receive the gene of interest.
  • An example of application is the use of peptides PCAIWF (SEQ. ID. No. 5) or CPLWYYWYEC (SEQ.
  • the herpes simplex virus thymidine kinase (HSV-TK) gene combined with ganciclovir treatment is an experimental suicide therapy for the treatment of tumors (Fillat et al., 2003).
  • the difficulty is to incorporate the HSV-TK gene into the cells of the organism to be deleted (eg, tumor cells). Then treatment with the drug ganciclovir kills only the cells that received and expressed the HSV-TK gene.
  • the peptides of this invention they may be coupled with viral vectors to carry suicidal genes (such as HSV-TK) to tumor cells and VEGF receptor positive cells. Used in conjunction with ganciclovir, the lentiviral vectors containing the peptides of this invention may thus be used for the development of gene or suicidal therapies.
  • DOTA 1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid
  • DOTA is a chelating molecule and is a substance that binds to various radionuclides (e.g. Galium-68, a 68-minute half-life positron emitter used for diagnostics on PET Scan (Positron Emission Tomography) equipment.
  • radionuclides e.g. Galium-68, a 68-minute half-life positron emitter used for diagnostics on PET Scan (Positron Emission Tomography) equipment.
  • the peptides described in SEQ. ID Nos. 1 to 14, for example: PCAIWF may be conjugated to a DOTA molecule to carry radionuclides for tumor imaging, for example.
  • ID No. 1 to 14 examples of molecules that may be conjugated to SEQ peptides.
  • ID No. 1 to 14 are fluorophores for ultraviolet fluorescence detection (indocarbocyanine, rhodamine, fluorescein, carboxyfluorescein, 4 ', 6-diamidine-2-phenylindole [dapi], etc.) in the near infrared (IRDye® 800CW TM, IRDye® 700DX TM, IRDye® 680RD TM - LiCor Corporate, USA), or fluorescent nanoparticles (quantum dots), among other molecules.
  • fluorophores for ultraviolet fluorescence detection indocarbocyanine, rhodamine, fluorescein, carboxyfluorescein, 4 ', 6-diamidine-2-phenylindole [dapi], etc.
  • near infrared IRDye® 800CW TM, IRDye® 700DX TM, IRDye® 680RD TM
  • the peptides of this invention may further be fused by molecular biology methodologies to fluorescent proteins such as green (GFP), yellow (YFP) or red (RFP) fluorescent protein, TagRFPs, KFP, mCherry, UnaG, Dronpa, and IrisFP, among others.
  • fluorescent proteins such as green (GFP), yellow (YFP) or red (RFP) fluorescent protein, TagRFPs, KFP, mCherry, UnaG, Dronpa, and IrisFP, among others.
  • the peptides of this invention will allow localization of the fluorophore in cells, tissues or organs with high expression of VEGFs and their receptors, thereby allowing their visualization with suitable equipment (eg fluorescent tomography, near infrared imaging [NIRI]). , among other modalities).
  • suitable equipment eg fluorescent tomography, near infrared imaging [NIRI]
  • NIRI near infrared imaging
  • An important application is the visualization of primary tumors and their metastases. Tumor cells commonly express high levels of VEGFs receptors and their receptors (Goel & Mercury, 2013).
  • Conjugation of the peptides of this invention may be used to visualize tumors in vivo and metastases, assisting the physician in the diagnosis and appropriate therapy for the patient. If the imaging is positive and high fluorophobic, this will indicate to the doctor that the tumor is positive for VEGF and its receptors. Thus, he can then indicate to the patient a VEGF blocking drug and its receptors.
  • the present invention used the methodology of Phage Display in pannings (phage selection assays showing peptides on the surface) to select peptides with angiogenic activity.
  • libraries were constructed in which phages display more than one billion different peptides on their surface.
  • X6 6-amino acid linear peptides
  • CX8C cyclic octapeptides
  • Phage libraries were produced using the fUSE55 vector and the methodology developed by George Smith (Smith and Scott, 1993), with modifications for better efficiency and greater number of final clones (Koivunen et al., 1993, 1999). ).
  • the fUSE55 vector contains two BglI restriction enzyme sites, both located at the beginning of the pIII gene encoding the bacteriophage capsid protein III (phage). Insertion of the BglI sites alters the reading phase of gene III and does not translate a functional pIII protein. Since pIII protein is required for phage infection in bacteria, bacteria carrying this vector do not produce infecting phages, although as plasmid fUSE55 may be propagated due to the presence of the phage gene.
  • the binding reaction product (2) was transformed into the electrocompetent bacterium E.coli strain MC1061 F- (3) and the phages produced expressing recombinant protein pIII (4) were recovered by precipitation with PEG / NaCl.
  • the constructed libraries were of type X6 and CX8C (X represents any amino acid and C represents cysteines that allow to create cyclic libraries), ie libraries were created in which phage display 6 peptides in a linear array or 8 peptides in a cyclic array in pIII phage proteins.
  • Phages from the X6 and CX8C libraries were produced in bacterium E. coli strain MC1061 transformed with the fUSE55 vector containing the X6 and CX8C inserts. Phages were purified from the culture supernatant by the PEG / NaCl precipitation method (Smith and Scott, 1993). Some library clones in the bacterium were plated, selected and sequenced for analysis of peptides expressed in both libraries. Table 1 shows the data from the two built libraries.
  • Table 1 Phage libraries. Data for the two constructed phage libraries.
  • the CX8C library has random cysteine flanked 8 amino acid sequences which cause peptides to be cyclically exposed on the surface of the phage.
  • the X6 library has random 6 amino acid sequences exposed on the surface of the phage linearly.
  • the two libraries each have over one billion peptides displayed on the phage surface.
  • the high diversity of peptides ensures that virtually the X6 and CX8C libraries have ligands for any biological target.
  • 0 indicates that the title of each microliter phage libraries used to infect bacteria, provides more than 8 IO transducing units (TU) of bacteria.
  • the number of premature stop codons that interrupt the synthesis of the presented peptides in both libraries is low: less than 15%.
  • the CX8C library has only 4% phage carrying empty vectors, therefore no peptides presented in the phage, whereas in sequenced clones of the X6 phage library none with empty vector were detected.
  • each microliter phage libraries used to infect bacteria provides more than 8 IO transducing units (TU) of bacteria.
  • the number of premature stop codons that interrupt the synthesis of the presented peptides in both libraries is low: less than 15%.
  • the CX8C library has only 4% phage carrying empty vectors, therefore no peptides presented in the phage, whereas in sequenced clones from the X6 phage library no empty vector was detected.
  • the phages are not plated for counting bacterial transducer units (TUs) because in theory the isolated phages are unique and by quantifying by plating bacteria we could lose peptides that have not yet been amplified.
  • the second and third selection cycles are similar to the first. In the second and third rounds of selection, each phage expressing a particular peptide already has many copies and part of the phage recovered by infection can be plated to count the number of TUs. Three selection cycles were performed in this panning. We obtained a 233-fold enrichment in the total number of phages from the second to the third cycle by panning with the CX8C library ( Figure 3A). And a 7.6-fold enrichment in the number of phages recovered from the second to the third cycle in panning with the X6 library ( Figure 3B).
  • Figures 3A and 3B refer to in vitro Phage Display results against the VEGFR-3 receptor.
  • the CX8C phage library (A), and the X6 phage library (B) were used in selection cycles against the extracellular region of the recombinant VEGFR-3 receptor immobilized in vitro.
  • the total number of phage recovered in each selection cycle is shown in the phage enrichment graphs. From the second to the third round of selection there was an enrichment of 233 (A) and 7.6 (B) times in the number of total phages recovered.
  • phages were recovered and sequenced for analysis of peptides displayed on their surface.
  • the lists of peptide sequences presented by the selected phages with library CX8C and X6 are shown below the enrichment graphs.
  • the first selection cycle (1 round) is not counted.
  • Phages displaying the PCAIWF and CPLWYYWYEC peptides interact specifically with VEGFR-3 and affect the interaction of VEGF-C ligand with VEGFR-3 receptor.
  • Phages displaying the peptide PCAIWF and CPLWYYWYEC were used in binding assays against different receptors: mouse and human VEGFR-1 and VEGFR-3, human VEGFR-3 and rat neuropillin-2 (co-receptor). VEGFR-3).
  • the purpose of this binding assay is to confirm that the interaction between peptide presented by the phage and the panning target receptor is specific.
  • the graph shown in Figure 3A shows that the phage expressing the CPLWYYWYEC peptide interacts with higher affinity with the mouse VEGFR-3 receptor and less affinity with the human VEGFR-3 receptor, but does not interact with VEGFR-1 and VEGFR-3.
  • Mouse 2 much less with the rat neuropilin-2 co-receptor.
  • the graph in Figure 3B shows that the PCAIWF peptide shows specific affinity for mouse and human VEGFR-3 and not with the other receptors tested, mouse and human VEGFR-1, human and neuropillin-1 and neuropillin-2.
  • Mouse In all peptide assays we observed that the control phage (Fd), which does not express any peptide on the surface, is unable to bind to any receptor, indicating that the presence of peptides is important for the interaction of the phage with the phage. VEGFR-3 receptor (data not shown in graph).
  • peptide expressing phages are not recovered from albumin-only (BSA) immobilized, confirming the specificity of the peptide-receptor interaction (Figure 4).
  • Figures 4A and 4B refer to the peptide-receptor interaction validation assay. Panning phages selected against VEGFR-3 and having only surface CPLWYYWYEC peptide ( Figure 4A) or PCAIWF peptide ( Figure 4B) were incubated with different targets: human VEGFR-3 (hVEGFR-3) and mouse (VEGFR -3 mouse), mouse VEGFR-2 (VEGFR-2 mouse), mouse VEGFR-1 (VEGFR-1 mouse), mouse neuropillin 2 (NRP-2) and albumin (BSA). The selected phages were recovered by bacterial infection. Bacteria transducer units were counted and values in the graph are the average of each plated triplicate plus standard error. Phages displaying the peptide on the surface show high specific affinity for both human and mouse VEGFR-3.
  • VEGF-C its ligand
  • VEGF-A VEGFR-3 non-ligand
  • VEGF165 is a VEGF isoform, VEGFR-2 ligand and VEGFR-1 (reviewed by Koch et al., 2011).
  • An expected result is that the presence of specific ligand inhibits the interaction of the peptide with the receptor.
  • the CPLWYYWYEC peptide is an allosteric modulator of VEGFR-3, increasing its affinity for VEGF-C and that the CPLWYYWYEC peptide may have proangiogenic and pro-lymphangiogenic activity, stimulating the formation of blood and lymphatic vessels.
  • the graph in Figure 5B shows that the presence of VEGF-C inhibits phage binding by presenting the peptide to VEGFR-3 indicating that the ligand, VEGF-C, and PCAIWF peptide compete for binding. in VEGFR-3.
  • the total number of VEGFR-3 binding phages in the presence of the unspecific ligand, VEGF is very close to the number of non-ligand binding phages.
  • the graph in Figure 6 shows that competition between the PCAIWF peptide for VEGFR-3 binding is dependent on VEGF-C concentration. This is indicative of the specificity of the interaction. This result further suggests that the PCAIWF peptide is a VEGFR-3 receptor inhibitor with anti-angiogenic and anti-lymphangiogenic activity, inhibiting the formation of blood and lymphatic vessels.
  • Figures 5A, 5B and 6 refer to the results of competition tests. Phages displaying the CPLWYYWYEC (Figure 5A) and PCAIWF ( Figure 5B and Figure 6) peptides were incubated with the extracellular portion of the VEGFR-3 receptor in the presence and absence of competitor VEGF-C and VEGF165. The selected phages were recovered by bacterial infection. The units Bacterial transducers were counted and the values in the graphs are the average of each plated quadruplicate plus the standard error. Statistical test: student's t.
  • the graph in Figure 7A shows that the presence of soluble PCAIWF synthetic peptide inhibits phage binding by presenting the same peptide to VEGFR-3 indicating that the ligand mediates the interaction between phage and VEGFR-3 and the PCAIWF peptide. that the synthetic peptide has the same properties as the PCAIWF phage.
  • the total number of VEGFR-3 binding phages in the presence of the unspecific ligand, the soluble IFCAPW synthetic peptide is very close to the number of ligand-free VEGFR-3 binding phages.
  • this competition is dependent on the concentration of the synthetic peptide PCAIWF, once again confirming the specificity of the interaction.
  • the IFCAPW peptide according to SEQ. ID No. 21 was chosen because it contains the same amino acids as the PCAIWF peptide, but arranged in another order. That is, the IFCAPW control peptide has similar chemical properties to the PCAIWF peptide (charge, solubility, isoelectric point, etc.), including the presence of a cysteine. containing a free SH group.
  • Figures 7A and 7B refer to the results of the synthetic peptide competition assays.
  • the phage displaying the PCAIWF peptide was incubated with the extracellular portion of the VEGFR-3 receptor in the presence and absence of the competitor PCAIWF and IFCAPW and without competitor.
  • the selected phages were recovered by bacterial infection. Bacteria transducer units were counted and values in the graphs are the average of each plated quadruplicate plus standard error.
  • Statistical test student's t.
  • PCAIWF pan-inhibitor of VEGFs in in vitro assays PCAIWF pan-inhibitor of VEGFs in in vitro assays.
  • VEGFR-3, VEGFR-2 or VEGFR-1 were immobilized on polystyrene microplates and incubated with VEGFR-2 and VEGFR-3 ligand: VEGF-C or VEGFR-ligand.
  • VEGFR-1 VEGF-A or VEGFR-1 ligand, P1GF, with and without the presence of competing synthetic peptide PCAIWF, or the mutated form PSAIWF, or control peptide (IFCAPW sequence).
  • the relative amount of VEGF-C, VEGF-A, or P1GF ligand that remained bound to the receptor was determined by binding of primary anti-ligand antibody followed by secondary antibody (IRDye 680LT from Li-COR Bioscience).
  • the signal of the secondary antibody which has a fluorescent marker (IRDye 680LT) conjugated to absorbs and emits at near infrared wavelengths, is detected on the Odyssey Infrared Imaging Systems (LI-COR Bioscience).
  • Figure 8 (A, B, C, D and E) refers to the effect of the presence of PCAIWF synthetic peptide on ligand-receptor interaction in vitro.
  • VEGF-C and VEGF-A were incubated with extracellular portions of recombinant human VEGFR-3, VEGFR-2 and VEGFR-1 immobilized on polystyrene plates without and with the presence of synthetic peptides: PCAIWF, PSAIWF and IFCAPW (Control).
  • VEGF-C The relative amount of VEGF-C, P1GF or VEGF-A was detected by primary anti-VEGF-C, anti-PIGF or anti-VEGF-A primary antibody and IRDye 680LT fluorophore-conjugated secondary antibody from Li-COR Bioscience in 700nm wavelength. Results are the mean plus standard deviation of duplicates for each experimental point.
  • the photo above the graphs shows the signal emitted by the fluorophore conjugated to the secondary antibody and captured in the infrared reader at 700nm wavelength (Odyssey LI ⁇ COR Bioscience).
  • Figure 8A is a graphical representation of the effects of the presence of PCAIWF synthetic peptide on in vitro ligand-receptor interaction relative to VEGFR-3 / VEGF-C.
  • Figure 8B is a graphical representation of the effects of the presence of PCAIWF synthetic peptide on in vitro ligand-receptor interaction relative to VEGFR-2 / VEGF-C.
  • Figure 8C refers to the graphical representation of the effects of the presence of PCAIWF synthetic peptide on ligand-receptor interaction in vitro to VEGFR-1 / P1GF.
  • Figure 8D is a graphical representation of the effects of the presence of PCAIWF synthetic peptide on in vitro ligand-receptor interaction relative to VEGFR-2 / VEGF-A.
  • Figure 8E is a graphical representation of the effects of the presence of PCAIWF synthetic peptide on in vitro ligand-receptor interaction relative to VEGFR-1 / VEGF-A.
  • This property of the PCAIWF peptide being a pan-inhibitor of VEGF is important in this invention because it characterizes it as a multiple anti-angiogenic action peptide since inhibition of major angiogenic factors (VEGF-A, P1GF and VEGF-C), in isolation, have been reported in the literature as possible targets for the treatment of diseases with an angiogenic component (Dewerchin & Carmeliet, 2012; Tammela et al., 2008).
  • VEGF-A, P1GF and VEGF-C major angiogenic factors
  • PCAIWF peptide does not inhibit the interaction of FGF and PDGF ligand to their receptors in in vitro assays.
  • PCAIWF peptide inhibits the interaction of VEGF family ligands
  • PDGF-BB Platelet-derived growth factor beta
  • FGF fibroblast growth factor
  • Figure 9 refers to the effect of the presence of PCAIWF synthetic peptide on in vitro ligand-receptor interaction.
  • PDGF-BB and FGF were incubated with extracellular portions of recombinant human PDGFR-beta and FGFR-beta immobilized on polystyrene plates without and with the presence of synthetic peptides: PCAIWF and IFCAPW.
  • the relative amount of PDGF-beta and FGF-beta was detected by anti-PDGF-beta or anti-FGF primary antibody and IRDye 680LT fluorophore conjugated secondary antibody from Li-COR Bioscience at 700nm wavelength. Results are the mean plus standard deviation of duplicates for each experimental point.
  • the photo above the graphs shows the signal emitted by the fluorophore conjugated to the secondary antibody and captured in the infrared reader at 700nm wavelength (Odyssey LI ⁇ COR Bioscience).
  • Figure 9A is a graphical representation of the effects of the presence of PCAIWF synthetic peptide on in vitro ligand-receptor interaction relative to PDGF-BB / PDGFR-beta.
  • Figure 9B is a graphical representation of the effects of the presence of PCAIWF synthetic peptide on ligand-receptor interaction in vitro with respect to FGF / FGFR-beta.
  • Synthetic peptide PCAIWF has anti-anglogenic effect on the Oxygen-Induced Retinopatla Animal Model.
  • C57BL / 6J mice were, aged P7 to P12, placed in a 75% oxygen atmosphere inside an oxygen chamber installed in the Animal Production and Experimentation Vivarium of the USP Institute of Chemistry and Faculty of Pharmaceutical Sciences .
  • this oxygen chamber the P7 mouse pups with their mothers are exposed for five days to the gas mixture consisting of 75% oxygen and 25% nitrogen.
  • the retina of these animals in the first weeks of life is developing similar to the retina of premature human babies and the vessels are forming (Fruttiger, 2007). Exposure to high oxygen concentrations causes vasoconstriction and decreased VEGF expression.
  • the animals, at the age of P12 are removed from the oxygen chamber (hyperoxia), breathing back into a 21% oxygen atmosphere (normoxia) which induces hypoxia.
  • VEGF vascular endothelial growth factor
  • the total retinal area pixel count compared to the pixel count of the strongly labeled isolectin B4-conjugated areas Alexa594 fluorophore provides a percentage of retinal neovascularized area as shown in Figure 10B.
  • Our results show that animals submitted to hyperoxia and not receiving intraocular injections (untreated), as well as those receiving vehicle injections, control peptide injections (CARAC), according to SEQ. ID No. 22, they develop in the retina a dense network of large blood vessels while animals kept in normoxia over the same period do not have the same neovascularization (Figure 10B).
  • PSAIWF serotonin-like protein
  • FIG. 10B The biological effect of the peptide carrying a mutation was also tested and we chose the synthetic PSAIWF peptide (serine cysteine alteration at position 2) to evaluate the effect on retinal vessel angiogenesis in the animal model.
  • Peptide de ⁇ Intraocular Injections PSAIWF (100mg / ml) were administered to animals at age P15, as in the other treatments. At age P17 the retinas were dissected and the vessels stained.
  • PSAIWF Intraocular Injections PSAIWF (100mg / ml) were administered to animals at age P15, as in the other treatments. At age P17 the retinas were dissected and the vessels stained.
  • Treatment of animals with the PSAIWF peptide caused a slight reduction in neovascularization (23%) compared to neovascularization observed in vehicle treated animals (Figure 10B).
  • Figures 10A and 10B refer to the effect of Synthetic Peptides on the Animal Model of Oxygen Induced Retinopathy. C57B1 / 6 mice were exposed to the atmosphere of 75% oxygen (hyperoxia) for five days at the age of P7 to P12.
  • Image pixels were quantified using the Adobe Photoshop program as Connor et al. , 2009. Treatment with DMSO intraocular injections of control peptide did not cause major changes in the dense and large vessel network that forms in animals exposed to hyperoxia, similar to that observed in untreated animals.
  • mice treated with intraocular injections of PCAIWF peptide show a more than 50% reduction in the amount of blood vessels present in their retinas when compared to untreated animals (Student's t-test). Mice treated with PSAIWF mutated peptide intraocular injections showed a slight 23% reduction in the amount of blood vessels present in their retinas when compared to untreated animals (t student test).
  • PCAIWF peptide The biological effect of the PCAIWF peptide was also tested at a lower concentration of 30 ⁇ g and using another control peptide, IFCAPW which contains the same amino acids as the PCAIWF peptide, but in another order.
  • Intraocular injections of ⁇ of PCAIWF peptide (30mg / ml) or IFCAPW peptide (30mg / ml) were administered to animals at age P15, as in the other treatments. At age P17 the retinas were dissected and the vessels analyzed.
  • Figure 11A shows a representative image of the retina of animals receiving the different treatments. It can be noted that the retina of animals treated with the PCAIWF peptide exhibit a visible reduction in their vascular network compared to retinas in animals that received no peptide or were treated with the IFCAPW control peptide.
  • IMSAPW control peptide intraocular injections of DMSO did not cause significant changes in the dense and large vessel network that forms in animals exposed to hyperoxia, similar to that observed in untreated animals.
  • treatment of animals with the PCAIWF peptide reduced neovascularization by approximately 44% compared to neovascularization observed in vehicle treated animals (DMSO).
  • the IFCAPW control peptide showed no reduction in retinal vascularization. It also indicates that the anti-angiogenic effect of the peptide is not due to the isolated reactivity of cysteine with retinal proteins.
  • Figure 11C quantified budding and vessel bifurcations by counting. This is because angiogenesis refers to the formation of new blood vessels from existing vessels. Thus, an anti-angiogenic drug is expected to reduce the number of new vessels that sprout or split from existing vessels in the retina. In fact, when we count In the number of bifurcations and sprouts, we note that there is a reduction of approximately 50% when compared to animals treated with vehicle (DMSO) and control peptide I FCAPW.
  • DMSO vehicle
  • Peptides may be altered during synthesis by the use of modified amino acids.
  • One possible change is the use of D enantiomers.
  • D-amino acid synthesized peptides are more resistant to biological degradation (e.g., are not cleaved by protease action).
  • the peptides of this invention may be synthesized using modified amino acids, e.g. D-amino acids, in order to improve their pharmaceutical properties without altering their modulating activity of VEGF or its receptors.
  • Figure 12 refers to the effect of the presence of synthetic peptide PCAIWF SEQ. ID No. 5, modified and synthesized with D-amino acids and referred to herein as D (PCAIWF), in ligand-receptor interaction in vitro.
  • VEGF-C and VEGF-A were incubated with extracellular portions of recombinant human VEGFR-3, VEGFR-2 and VEGFR-1 immobilized on polystyrene plates without and with the presence of synthetic peptides: PCAIWF, D (PCAIWF), IFCAPW [ Control] or D (IFCAPW) [D-Amino Acid Control].
  • VEGF-C The relative amount of VEGF-C, P1GF or VEGF-A was detected by primary anti-VEGF-C, anti-PIGF or anti-VEGF-A primary antibody and IRDye 680LT fluorophore-conjugated secondary antibody from Li-COR Bioscience in 700nm wavelength. Results are the mean plus standard deviation of duplicates for each experimental point.
  • the photo above the The graphs shows the signal emitted by the fluorophore conjugated to the secondary antibody and captured in the infrared reader at 700nm wavelength (Odyssey LI ⁇ COR Bioscience).
  • Figure 12A is a graphical representation of the effects of the presence of synthetic peptide D (PCAIWF) on in vitro ligand-receptor interaction relative to VEGFR-3 / VEGF-C.
  • PCAIWF synthetic peptide D
  • Figure 12B is a graphical representation of the effects of the presence of synthetic peptide D (PCAIWF) on in vitro ligand-receptor interaction relative to VEGFR-2 / VEGF-C.
  • PCAIWF synthetic peptide D
  • Figure 12C is a graphical representation of the effects of the presence of synthetic peptide D (PCAIWF) on in vitro ligand-receptor interaction relative to VEGFR-2 / VEGF-A.
  • PCAIWF synthetic peptide D
  • Figure 12D is a graphical representation of the effects of the presence of synthetic peptide D (PCAIWF) on in vitro ligand-receptor interaction relative to VEGFR-1 / VEGF-A.
  • PCAIWF synthetic peptide D
  • Figure 12E is a graphical representation of the effects of the presence of synthetic peptide D (PCAIWF) on in vitro ligand-receptor interaction relative to VEGFR-1 / P1GF.
  • PCAIWF synthetic peptide D
  • Phage detection is done by immunocytochemistry with Dylight 488 fluorophore conjugated anti-phage antibody.
  • Phages displaying the PCAIWF peptide are internalized by endothelial cells, as shown in Figure 13 (example indicated by white arrows).
  • Phage Fd has no surface peptide (negative control) and is not internalized indicating that the presence of peptide at the end of phage capsid is important for internalization.
  • Phages displaying RGD peptide are efficiently internalized (indicated by white arrows) by cells. The peptide containing the RGD sequence is used as a positive control as RGD binds to integrins on the cell surface.
  • Figure 13 refers to the phage internalization assay. Phages displaying the PCAIWF peptide, phages displaying the RGD peptide (used as a positive control for presenting the RGD amino acid sequence that binds tightly to cell surface integrins) and Fd phages which have no surface peptides (used as a negative control) were incubated overnight with mouse heart endothelial cells. Internalized phages were detected by immunocytochemistry with Dylight488 fluorophore-conjugated anti-phage antibodies (green). The cell nucleus was stained with DAPI (blue).
  • the library called X6 contains phages that express on the capsid surface random sequences with 6 peptides.
  • the library called CX8C is composed of phages that express on the capsid surface random sequences with 8 peptides flanked by cysteines.
  • Digested DNA was purified with the PlasmidMaxi kit tip500 (Qiagen) maxipreparation system according to the manufacturer's instructions. DNA quality was analyzed by ethidium bromide stained 1% agarose gel electrophoresis and quantified by spectrophotometry (260nm, 280nm) on Nanodrop 1000 (Thermo Scientific).
  • Synthetic oligonucleotides were synthesized (Invitrogen), containing random sequences (NNK) n, where N represents any of the four nucleotides (G, T, A, C) and K represents only G or T.
  • N represents any of the four nucleotides (G, T, A, C) and K represents only G or T.
  • the sequences of these degenerate oligos are flanked by restriction sites recognized by the enzyme Bg11.
  • An oligonucleotide complementary to the 3 'region of degenerate oligos was also synthesized. The sequences of these oligonucleotides are:
  • n is a, g, c or t and "k” is g or t
  • n is a, g, c or t and "k” is g or t
  • the synthesis reaction of the X6 library insert used the combination of fUSE5-X6 Forward and fUSE5 Reverse oligos.
  • the fUSE5-X8 Forward + fUSE5 Reverse oligos combination was used.
  • the pair of oligos was treated with Klenow (10U / ⁇ , Fermentas) to form the double-tape insert.
  • the double-tape inserts were purified with the PlasmidMidi kit tiplOO system (Qiagen).
  • the X6 and CX8C inserts (1 ⁇ g total) were digested with the restriction enzyme BglI (10 ⁇ l, Fermentas) at a ratio of 17U enzyme for each ⁇ g DNA.
  • DNA quality was analyzed by 15% polyacrylamide gel electrophoresis stained with ethidium bromide and quantified by spectrophotometry on Nanodrop 1000 equipment (Thermo Scientific).
  • Phages from the X6 and CX8C libraries were purified from the E. coli bacterial culture supernatant, strain MC1061 by precipitation by the PEG / NaCl method (Giordano et al., 2001).
  • the fUSE55-X6 library has been resuspended in a final volume of 10 ml PBS and the fUSE55-X8 library in 3.5 ml PBS. Aliquots were stocked in the fridge.
  • Phages were titrated by serial dilution in LB medium, infected in E.coli K91kan, and seeded on LB-agar containing tetracycline (20 g / mL) and kanamycin (100 g / mL). The number of bacterial transducer units (TU) was calculated by counting the colonies obtained.
  • Phage libraries X6 and CX8C were used in an in vitro scan against the transmembrane portion of the VEGFR-3 receptor (Recombinant Mouse VEGF R3 / Flt4Fc Chimera, R&D Systems). Briefly, 1 ⁇ g of VEGR-3 protein dissolved in 50 ⁇ l PBS was immobilized in 96-well plate wells overnight at 4 ° C. The next day the protein was removed and the well was washed with PBS 2 times; blocked with PBS containing 3% BSA for 1 hour at room temperature and incubated with phage library
  • Binding phages were recovered by infection with E.coli K91kan (Giordano et al., 2008); cultured and amplified in LB medium containing tetracycline (20 g / mL) and kanamycin
  • the obtained phages were plated on LB-agar plates with tetracycline (40 g / ml) and kanamycin (100 g / ml) and selected individual colonies resuspended in 50 ⁇ PBS.
  • the DNA region expressing the peptide insert was amplified from 2 ⁇ l of this suspension in PCR reaction using the oligonucleotide combination:
  • Phage-PCR foward 5 'GCAAGCTGATAAACCGATACAATT3' (SEQ. ID. No. 19) and reverse Phage-PCR: 5 'CCCTCATAGTTAGCGTAACGATCT3' (SEQ. ID. No. 20), in 35-cycle thermocycler with the following cycling program: 94 ° C for 15 seconds; 60 ° C for 30 seconds; 72 ° C for 1 minute; 72 ° C 7 minutes.
  • PCR products were sequenced to identify the peptide presented by each selected phage.
  • Phages were isolated and purified from bacterial culture supernatant (E.coli MC1061 or K91kan), precipitated by the PEG / NaCl method (Giordano et al., 2001), and resuspended in PBS. Phages were titrated by serial dilution in LB medium, infected with E.coli K91kan, and seeded on tetracycline-containing LB-agar.
  • TU bacterial transducer units
  • VEGFR-3 transmembrane portion
  • VEGFR-1 commercially available R&D Systems
  • the protein was removed and the well was washed with PBS 2 times; blocked with PBS containing 3% BSA for 1 hour at room temperature and incubated with phage particles displaying specific peptides (10 8 TU in 50 ⁇ 1 PBS containing 3% BSA). After 2 hours at room temperature, the well was washed with PBS 10 times. Binding phages were recovered by infection with E.coli K91kan (Giordano et al., 2008); and plated at appropriate dilutions in LB-agar medium containing tetracycline (40 g / mL) and kanamycin (100 g / mL) for counting individual colonies.
  • the assay is similar to binding with the following modifications: 100 ng of receptors were immobilized on the 96-well plate. Phage particles displaying the CPLWYYWYEC and PCAIWF peptides (10 8 TU and 50 ⁇ PBS) were incubated with the immobilized receptor along with 10ng / ml ligand (VEGF-C or VEGF - R&D Systems).
  • Binding phages were recovered by infection with E.coli K91kan (Giordano et al., 2008); and plated at appropriate dilutions in tetracycline-containing LB-agar medium
  • VEGFR-3, VEGFR-2 and recombinant VEGFR-1 (R&D Systems) immobilized on 96-well High Cost Binding Plates (CAR) in 50 ⁇ 1 PBS solution at 8 ° C were used. ° C for 16 hours. The receptor solution was removed and washes with 0.05% Tween 1XPBS were made. A total of 20ng of VEGF-C or VEGF-A in PBS were incubated in each well for 1 hour and 30 minutes at 37 ° C. After washes with 0.05% PBS Tween, blocking with Odyssey Blocking Solution (Liquor) was performed at 37 ° C for 1.5h. The washes were repeated.
  • CAR High Cost Binding Plates
  • Anti-VEGF-C or anti-VEGF-A primary antibody (R&D Systems), diluted 1: 100, in 1% PBS odyssey blocking solution was incubated for 1.5h at 37 ° C; The same washes described above were repeated. Then secondary antibody (IRDye 680LT from Li-COR Bioscience) 1: 400 was incubated in 1% PBS odyssey blocking solution for 1h at 37 ° C. After 3 washes, the plate was centrifuged at 1000xg inverted for 5 minutes at room temperature. Absorbance readings were taken on the 700nm wavelength infrared reader (Odyssey LI-COR Bioscience).
  • the animal model of oxygen-induced retinopathy is one of the best accepted for studying pathological retinal neovascularization (Connor et al., 2009). This animal model was implanted in the laboratory for studies of angiogenesis and the efficacy of peptides as compounds with angiogenic activity.
  • mice (strain C57BL / 6) and their mothers were placed and kept in their cages between the 7th post-birth day (P7) and P12 within oxygen chamber with levels of 02 by 75%. After this period, the mice returned to room with ambient air (20.8% 02), where they remained until receiving the treatment of intraocular injections of ⁇ containing different synthetic peptides.
  • mice are anesthetized with avertin (0.015 ml / gram weight) and immediately sacrificed by cervical dislocation.
  • the eyes are removed, fixed at 4% PFA for 2 hours at 4 ° C, washed with IX PBS three times and kept in PBS / azide at 4 ° C for up to 15 days.
  • the eyes dipped in PBS are surgically opened and the retinas are carefully dissected.
  • Tissue is incubated in 1% Triton in PBS for 30 minutes and 1% Triton PBS containing 2 ⁇ g / ml Alexa594 conjugated Isolectin B4 (Invitrogen) protected from light in the refrigerator until the next day.
  • Retinas are washed in 1% Triton PBS for 15 minutes 4 times; with PBS for 15 minutes 2 times and distilled water 15 minutes 2 times.
  • PBS for 15 minutes 2 times
  • distilled water 15 minutes 2 times.
  • four symmetrical cuts from the edge to the center are made on the retina so that the tissue, concave before the cuts, is flat and flower-shaped with 4 petals.
  • the retinas are transferred to Star Frost slides and mounted with Vectashield without dapi (Vector Labs).
  • Endothelial cells (2,105 cells per well) were plated on 8-well slides (Lab-Tek® Chamber Slide) in DEM 10% fetal bovine serum (SFB) medium. Cell media was removed and 200 ⁇ l blocking solution (30% DMEM SFB) was added and incubated at 37 ° C in the cell oven. Blocking medium was removed after 1 hour and 200 ⁇ l 2% SFB DMEM solution with 108 phages were incubated overnight at 37 ° C.
  • FFB fetal bovine serum

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Toxicology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

La présente invention concerne des peptides synthétiques se liant aux récepteurs du type tyrosine kinase de la famille du VEGF et leurs utilisations. Lesdits peptides peuvent être utilisés, séparément ou conjointement, pour la prévention ou le traitement de maladies dans lesquelles les récepteurs de VEGF jouent un rôle important en termes de déclenchement et de progression de la pathologie, telles que les maladies présentant une composante angiogénique.
PCT/BR2015/050152 2014-09-18 2015-09-16 Peptides synthétiques se liant aux récepteurs de vegf et leurs utilisations WO2016041042A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
BR102014023144-7A BR102014023144B1 (pt) 2014-09-18 2014-09-18 peptídeos sintéticos ligantes de receptores de vegf e seus usos
BRBR102014023144-7 2014-09-18

Publications (1)

Publication Number Publication Date
WO2016041042A1 true WO2016041042A1 (fr) 2016-03-24

Family

ID=55532362

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/BR2015/050152 WO2016041042A1 (fr) 2014-09-18 2015-09-16 Peptides synthétiques se liant aux récepteurs de vegf et leurs utilisations

Country Status (2)

Country Link
BR (1) BR102014023144B1 (fr)
WO (1) WO2016041042A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113533273A (zh) * 2021-06-26 2021-10-22 浙江工商大学 一种提高时间分辨荧光信号强度的标记方法及应用

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005027972A2 (fr) * 2003-09-23 2005-03-31 Novartis Ag Polytherapie combinant un inhibiteur des recepteurs du facteur vegf avec un agent chimiotherapeutique

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005027972A2 (fr) * 2003-09-23 2005-03-31 Novartis Ag Polytherapie combinant un inhibiteur des recepteurs du facteur vegf avec un agent chimiotherapeutique

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
FERRARA N.: "The biology of VEGF and its receptors.", NATURE MEDICINE., vol. 9, 2003, pages 669 - 676, XP008126354, DOI: doi:10.1038/nm0603-669 *
JOUKOV V.: "A novel vascular endothelial growth factor, VEGF-C, is a ligand for the Flt4 (VEGFR-3) and KDR (VEGFR-2) receptor tyrosine kinases.", EMBO J., vol. 15, no. 2, 1996, pages 290 - 298 *
VALTOLA R.: "VEGFR-3 and Its Ligand VEGF-C Are Associated with Angiogenesis in Breast Cancer.", THE AMERICAN JOURNAL OF PATHOLOGY., vol. 154, no. 5, 1999, pages 1381 - 1390, XP002221300 *
WITMER AN.: "VEGFR-3 in adult angiogenesis.", THE JOURNAL OF PATHOLOGY., vol. 195, no. 4, 2001, pages 490 - 497 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113533273A (zh) * 2021-06-26 2021-10-22 浙江工商大学 一种提高时间分辨荧光信号强度的标记方法及应用

Also Published As

Publication number Publication date
BR102014023144B1 (pt) 2020-12-15
BR102014023144A2 (pt) 2016-08-23

Similar Documents

Publication Publication Date Title
RU2488592C2 (ru) Пептиды направленного действия на vegfr-1/nrp-1
ES2299232T3 (es) Moleculas que migran hacia un organo o tejido seleccionado in vivo.
US8846859B2 (en) Compositions and methods of use of targeting peptides against placenta and adipose tissues
Li et al. Identification of peptide sequences that target to the brain using in vivo phage display
JP7014857B2 (ja) 血液脳関門を通過して輸送するための組成物及び方法
US7914780B1 (en) Aminopeptidase A (APA) targeting peptides for the treatment of cancer
PT1322755E (pt) Péptidos de direccionamento humanos e de murganho identificados por apresentação em fagos
JP2011504458A5 (fr)
ES2363044T3 (es) Péptidos específicos para las metástasis y sus aplicaciones en diagnóstico y terapéuticas.
JPH10506463A (ja) ペプチドライブラリー由来の抗原結合性ペプチド（アブチド）
JP2010085108A (ja) 生体光イメージング用プローブ
Rahn et al. Development of a peptide-based delivery platform for targeting malignant brain tumors
ES2360420T3 (es) Péptidos aptos para translocación en una membrana.
JP6612063B2 (ja) 悪性神経膠腫分子標的ペプチド
US20070264191A1 (en) Materials and Methods Relating to the Treatment of Glioblastomas
US20080176792A1 (en) Vegfr-1 targeting peptides
WO2016041042A1 (fr) Peptides synthétiques se liant aux récepteurs de vegf et leurs utilisations
Maruta* et al. Use of a phage display library to identify oligopeptides binding to the lumenal surface of polarized endothelium by ex vivo perfusion of human umbilical veins
Ho et al. Identification and characterization of novel human glioma-specific peptides to potentiate tumor-specific gene delivery
ES2319624T3 (es) Peptidos que se dirigen al conjunto de vasos linfaticos del tumor y procedimientos de utilizacion de los mismos.
Gonzalez et al. Epidermal growth factor targeting of bacteriophage to the choroid plexus for gene delivery to the central nervous system via cerebrospinal fluid
CN107353325A (zh) 叶酸受体α特异性结合肽1及其应用
CN114874990A (zh) 一种功能化外泌体及其制备方法和应用
CN107446020A (zh) 叶酸受体α特异性结合肽2及其应用
JP7370598B2 (ja) ペプチド及びその使用

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15842800

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15842800

Country of ref document: EP

Kind code of ref document: A1