Classifications

• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K31/00—Medicinal preparations containing organic active ingredients
  • A61K31/33—Heterocyclic compounds
  • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
  • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
  • A61K31/496—Non-condensed piperazines containing further heterocyclic rings, e.g. rifampin, thiothixene or sparfloxacin
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K31/00—Medicinal preparations containing organic active ingredients
  • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
  • A61K31/702—Oligosaccharides, i.e. having three to five saccharide radicals attached to each other by glycosidic linkages
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides
  • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
  • A61K38/07—Tetrapeptides
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
  • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
  • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
  • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
  • A61K47/549—Sugars, nucleosides, nucleotides or nucleic acids
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
  • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
  • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
  • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
  • A61K47/55—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound the modifying agent being also a pharmacologically or therapeutically active agent, i.e. the entire conjugate being a codrug, i.e. a dimer, oligomer or polymer of pharmacologically or therapeutically active compounds
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
  • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
  • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
  • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
  • A61K47/555—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound pre-targeting systems involving an organic compound, other than a peptide, protein or antibody, for targeting specific cells
  • A61K47/557—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound pre-targeting systems involving an organic compound, other than a peptide, protein or antibody, for targeting specific cells the modifying agent being biotin
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
  • A61P21/02—Muscle relaxants, e.g. for tetanus or cramps
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
  • A61P21/04—Drugs for disorders of the muscular or neuromuscular system for myasthenia gravis
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00

Definitions

• RNA dysfunction causes disease through various mechanisms, including microRNA silencing of pro-apoptotic proteins,' 11 translation of aberrant protein, [ ] and gain-of-function. [3] It has been difficult, however, to design small molecule chemical probes of RNA function or lead therapeutics. If broadly applicable methods were developed to drug non-ribosomal RNAs with small molecules, it could have important applications in chemical biology and medicinal chemistry 41
• RNA-mediated diseases is caused by expanded repeating RNAs, or microsatellite disorders. There are >20 known microsatellite disorders, including myotonic dystrophy (DM) and amyotrophic lateral sclerosis (Lou Gehrig's Disease; ALS).
• Myotonic dystrophy type 2 (DM2) is caused by a toxic gain-of-function by a r(CCUG) repeat expansion (r(CCUG) exp .
• Myotonic dystrophy type 1 (DM1 ) is caused by a toxic gain-of- function by a r(CUG) repeat expansion (r(CUG) exp ).
• DM2 myotonic dystrophy type 2
• ZNF9 zinc finger protein 9
• r(CCUG) exp are based on a kanamycin A derivative, which is acylated at the 6' position, that binds 5 'CCUG/3 'GUCC with high affinity. Notably, acylation of the 6' amine ablates binding to rRNA.
• the kanamycin derivative and modularly assembled (or multivalent) compounds thereof improve DM2-associated defects in a cellular model.
• modularly assembled compounds are more potent inhibitors of cellular dysfunction, presumably due to their high affinities, selectivities, and the larger surface areas they sequester on the target.
• DM1 myotonic dystrophy type 1
• DM1 is caused by a toxic gain-of- function by a r(CUG) repeat expansion (r(CUG) e ) that is located in the 3' untranslated region (UTR) of the dystophia myotonica protein kinase (DMPK) mRNA.
• UTR 3' untranslated region
• DM1 Other aspects of this invention for DM1 include: (i) design of optimized dimeric compounds that target r(CUG) exp ; (ii) covalent small molecules that target r(CUG) exp and allow for target validation (RNAs bound) and the sites in the RNAs that bind the small molecules; (iii) use of in cellulo click chemistry to synthesize inhibitors on-site that are highly potent and selective; (iv) fluorescence resonance energy transfer (FRET) approaches to use r(CUG) ex as a catalyst to synthesize FRET sensors; and (v) design of small molecules targeting r(CUG) exp that cleave r(CUG) exp in patient-derived cells.
• FRET fluorescence resonance energy transfer
• the invention provides, in various embodiments, a method of forming, within a living cell, a modulator of RNA function, comprising exposing the cell to one or two small molecule modules to which the cell is permeable, a single module bearing both alkyne and azide groups, or the two modules comprising respectively alkyne and azide moieties that bind adjacent internal loops in r(CCUG) exp or r(CUG) e , the causative agent of myotonic dystrophy type 2 (DM2) and type 1 (DM1) (Day, J. W., and Ranum, L. P. (2005) RNA pathogenesis of the myotonic dystrophies, Neuromuscul. Disord. 15, 5-16.; Miller, J.
• Expanded CUG repeats trigger aberrant splicing of Clcn-1 chloride channel pre-mRNA and hyperexcitability of skeletal muscle in myotonic dystrophy, Mol. Cell 10, 35-44), respectively, such that the one module, or the two modules are transformed by condensation of the alkyne and azide group in a 1,3 Huisgen dipolar cycloaddition reaction into oligomeric, potent inhibitors of DM1 or DM2 RNA dysfunction via a 1 ,3 Huisgen dipolar cycloaddition reaction.
• the monomeric precursors of the oligomeric modulator can either be single compounds that display azide and alkyne units on the same molecule can bind to adjacent sites and undergo a 1,3 Huisgen dipolar cycloaddition reaction, or a pair of molecular structures, one of which bears an alkyne group and the other of which bears an azide group.
• the invention also provides, in various embodiments, a method of forming, within a living cell, a modulator of RNA function, comprising exposing the cell to small molecule modules to which the cell is permeable in which the module contains both alkyne and azide moieties.
• the invention further provides, in various embodiments, modulators of RNA function, formed by exposing a cell containing RNA expanded repeat sequences r(CCUG) ex or r(CUG) ex , the causative agent of myotonic dystrophy type 2 (DM2) and type 1 (DM1) respectively, to one or more RNA extended repeat binding modules to which the cell is permeable, the two modules comprising respectively alkyne and azide moieties that can condense via a Huisgen 1,3 -dipolar cycloaddition reaction to form an oligomeric modulator that interferes with the function of the toxic RNAs.
• the cell-permeable modules can comprise kanamycin analogs.
• the cell- permeable modules can comprise bis-benzimidazoles or other heteroaryl compounds.
• Figure 1 In cellulo, in situ click chemistry to synthesize potent inhibitors of the RNA that causes DM2.
• A, DM2 is caused by a r(CCUG) repeat that binds and sequesters
• MBNL1 muscleblind-like 1 protein
• Small molecules that contain azide and alkyne functional groups (N 3 -K, K-Ak, N 3 -K-Ak, and N 3 -K-AaK) bind adjacent sites in r(CCUG) exp and undergo a Huisgen dipolar cycloaddition reaction.
• B Molecular dynamics (MD) simulation models of clickable modules binding to a mimic of r(CCUG) exp .
• BI Conformational searching reveals close proximity between azide and alkyne groups presented by K modules bound to adjacent sites.
• BII A low energy state in MD simulation of 1 ,4-triazole adduct from N 3 -K and K-Aak is shown in stereoview.
• RNA and K Hydrogen bonds between the RNA and K are shown in dashed lines.
• Bill Low energy snapshot of MD simulations showing other linker models.
• Figure 2. Identifying the extent of in cellulo click reactions and the targets of clickable small molecules.
• A Schematic of ChemReactBlP, an approach to identify the cellular targets of small molecules. Studies were enabled by using a biotinylated monomer with a single N 3 group to participate in the click reaction, or N 3 -K-Biotin, which allows isolation of the clicked oligomer and bound RNA targets by passing cell lysates over streptavidin resin.
• Figure 3 Results of cellular studies evaluating the effect of in cellulo, in situ click on DM2-associated defects.
• A Evaluation of click compounds for inhibiting formation of nuclear foci of r(CCUG) 3 oo upon treatment with various compounds.
• B Schematic of the alternative splicing of bridging integrator 1 (BIN1) pre-mRNA exon 1 1 in healthy cells and cells that express r(CCUG) 3 oo-
• C Rescue of the BIN1 splicing defect by templated click reactions.
• Top Representative gel image of BIN1 splicing products in the presence and absence of r(CCUG) 3 oo.
• Bottom quantification of BIN1 splicing patterns in treated and untreated cells. The
• FIG. 13 Top, Representative gel images demonstrating the effect of K derivatives on BINl alternative splicing patterns.
• a 1 1 mixture of N 3 -K and K-Ak improves BINl patterns to a similar extent as pre-synthesized dimers.
• Bottom Quantification of BINl alternative splicing patterns in treated and untreated cells. The activities of monomers N 3 -K and K-Ak were compared to pre-synthesized dimers as well as an equimolar mixture of each monomer. The pre- synthesized dimers improved splicing to the greatest extent while a mixture of azide and alkyne monomers improved splicing to a greater extent than each monomer alone. "*" indicates p ⁇ 0.05; "***” indicates p ⁇ 0.001 as determined by a two-tailed Student t-test (n > 3).
• FIG. 14 Top, Representative gel images of BINl splicing patterns in cells treated with N 3 -K-Ak. Improvement in splicing patterns was observed when cells were treated with 10 and 1 ⁇ N 3 -K-Ak. Middle, Representative gel images of BINl splicing patterns in cells treated with N 3 -K-Aak. Improvement in splicing patterns was observed when cells were treated with 10 ⁇ , 1 ⁇ , and 100 nM N 3 -K-Ak. Bottom, Quantification of BINl splicing patterns in untreated cells and cells treated with oligomerizable K compounds. N 3 -K-Aak was the most potent compound evaluated.
• FIG. 15 Top, Representative gel images showing that K derivatives do not affect BINl splicing patterns in cells that do not express r(CCUG) 3 oo.
• Bottom Quantification of BINl splicing patterns in cells that do not express r(CCUG) 3 oo- None of the compounds evaluated had a statistically significant effect on BINl pre-mRNA splicing patterns in the absence of r(CCUG) 3 oo as determined by a two-tailed Student t-test (n > 3). The concentration of compound tested is provided in parentheses (mM).
• Figure 16 shows the scheme for synthesis of the K 1,4 Dimer.
• Figure 17 shows the scheme for synthesis of the K 1,5 Dimer.
• Figure 18 shows the scheme for synthesis of N 3 -K-Ak.
• Figure 19 shows the scheme for synthesis of N 3 -K-Aak.
• Figure 20 shows the scheme for synthesis of N 3 -K-Biotin.
• Figure 21 The toxic RNA-protein complex causative of DM1 and designer small molecules that are used to ameliorate and study disease-associated cellular dysfunction and in cellulo target selectivity.
• FIG. 22 Lead optimization of compounds for metabolic stability.
• Compound 2H- K4NMe is unstable in microsomes (bottom right plot) and instability was traced to the imino proton, which was removed by TV-methylation to provide 2H- 4NMeS, which is stable in microsomes.
• FIG 23 Designer small molecule 2H-K4NMeS improves DM1 -associated pre- mRNA splicing defects in patient-derived cell lines (left) and in a DM1 mouse model (right).
• FIG. 24 The designer small molecule 2II-K4NMeS is appended with a reactive module (CA) and a purification tag (biotin) to produce 2H-K4NMeS-CA-Biotin.
• This compound forms a cross-link (covalent bond) with bound RNAs in cells and allows them to be purified and quantified to validate the targets of the small molecules by using an approach termed Chemical Cross-Linking and Isolation by Pull Down (Chem-CLIP)
• A The structure of the probe compound.
• B In vitro data showing that the probe selectively reacts with r(CUG) exp .
• C 2H-K4NMeS-CA-Biotin improves DM1 -associated pre-mRNA splicing defects in cells.
• the non-covalent compound 2H-K4NMeS can compete 2H-K4NMeS-CA-Biotin from reaction with the r(CUG) exp target as determined by Competitive Chem-CLIP (C-Chem-CLIP).
• C-Chem-CLIP Competitive Chem-CLIP
• Pulldown of the RNA targets by 2H-K4NMeS-CA-Biotiii shows the compound binds to disease- causing expanded transcripts and not other RNAs with shorter (non-pathogenic length) r(CUG) repeats.
• FIG. 25 Chemical Cross-Linking and Isolation by Pull Down and Ligand Binding- Site Mapping (Chem-CLIP-Map).
• the DMPK mRNA that reacted with 2H-K4NMeS-CA- Biotin was site specifically digested with RNase H by using oligonucleotides complementary to different regions in the mRNA. After digestion, regions of the RNA that reacted with 2H- K4NMeS-CA-Biotin were captured on a streptavidin resin and quantified by using qRT-PCR. Data shows that 2H-K4NMeS-CA-Biotin binds to r(CUG) exp in DMPK mRNA.
• Figure 26 The structures of the compounds that were tested for validating the on-site drug synthesis in vitro.
• Figure 27 Data for the in vitro oligomeric drug synthesis by using nucleic acids as catalysts.
• A Results of probing linker length to determine the optimal distance for reaction;
• B Evaluation of in vitro drug synthesis between N3-2H-K4NMeS and 2H-K4NMeS- Aminohexanoate Aak in the presence of various RNAs.
• Figure 28 The designer compound N3-2H-K4NMeS-Aak that can form oligomeric species that has a azide and alkyne site on a single r(CUG) exp binding ligand.
• Figure 30 Ability of in cellulo click compounds to improve A, Pre-mRNA splicing, B, Nuclear foci, and C, A translational defect that is associated with DM1.
• Figure 31 A 2H-K4NMeS derivative that is conjugated to bleomycin to allow for the targeted cleavage of r(CUG) exp in DM1 patient-derived cells.
• A structure of the compound;
• B qRT-PCR data to show that the target is cleaved;
• C competitive cleaving data in which 2H- 4NMeS-Bleomycin A5 and 2H-K4NMeS are co-added to cells showing that 2H-K4NMeS can inhibit targeted r(CUG) ex cleavage.
• D Improvement of downstream DM1 -associated pre- mRNA splicing defects.
• FIG 32 Scheme of the fluorescence resonance energy transfer (FRET) experiment to synthesize a FRET sensor by using r(CUG) exp as a catalyst.
• A A schematic of the approach.
• B Compounds used in these experiments.
• C Representative data.
• FIG. 34 Synthetic scheme for 2H-K4NMeS-CA-Biotin.
• FIG. 35 Synthetic scheme for 2NAc-K4NMeS-CA-Biotin.
• Figure 36 Synthetic scheme for 2H-K4NMeS-Bleomycin AS.
• Figure 40 Synthetic scheme for N 3 -2H-K4NMeS-Aak.
• Figure 41 Synthetic scheme for Biotin N 3 -2H-K4NMeS-Aak.
• Figure 42 Synthetic scheme for N 3 -2H-K4NMeS-TAMRA.
• Figure 43 Synthetic scheme for FAM-2H-K4NMeS-Aak.
• N 3 -K and K-Ak when N 3 -K and K-Ak are mixed in equal amounts, a dimer could be formed; likewise, a derivative that displays both a 6" azide and a 6' alkyne (N 3 -K-Ak; Figure IB) could form an oligomer.
• N 3 -K-Ak a dimer
• Figure IB a derivative that displays both a 6" azide and a 6' alkyne
• N 3 -K-Ak Figure IB
• a cellular model system in which r(CCUG)3oo is expressed was employed.
• tl4J Cells were co-treated with N 3 -K and N 3 -K-Ak or N 3 -K-Aak.
• N 3 -K was used to poison the reaction in order to limit the molecular weight of the products, allowing for mass spectral analysis.
• reaction products were partially purified from cell lysates by precipitating cellular material and proteins with organic solvent.
• RNA repeating disorders may be a particularly attractive application.
• the nature of the target which could have thousands of repeating units, could produce high yields of templated products.
• many RNA gain-of-function disorders such as ALS, DM1 , and DM2 cause brain dysfunction, making it important to develop low molecular weight compounds that have potential to cross the blood-brain barrier.
• the click reaction could engender highly permeable low molecular weight monomers with potencies of multivalent compounds in both cellular and tissue models of disease.
• DM1 is caused by r(CUG) ex located in the 3 ' UTR of DMPK, which also binds to and sequesters proteins that are involved in RNA biogenesis such as MBNL1 ( Figure 21).
• N 3 -2H-K4NMeS-Aak oligomerization in patient-derived cells was tested by using ChemReactBIP.
• a version of N 3 -2H-K4NMeS-Aak was synthesized (Biotin-N 3 -2H-K4NMeS-Aak, Figure 29A) that allowed for both starting materials and products of a reaction to be purified from cells via streptavidin capture (Figure 29B).
• N 3 -2H- K4NMeS-Aak may alter in the subcellular localization of DMPK by alleviating sequestration in foci and stimulate translation. Addition of N 3 -2H-K4NMeS-Aak improved the DMPK translational defect at nanomolar concentrations in cells with long, toxic r(CUG) repeats, but has no effect on cells that did not have pathogenic repeats.
• Fluorescent reporters were also synthesized on-site based on the RNA-catalyzed click reaction.
• compounds that can undergo a click reaction are tagged with FRET pairs ( Figure 32A) such that FRET can be observed upon a click reaction.
• FAM fluorescein
• TAMARA 5-Carboxytetramethylrhodamine
• FRET dye pairs were used, affording FAM- 2H-K4NMeS-Aak and N 3 -2H-K4NMeS-TAMARA.
• Addition of the compounds showed enhancement in FRET only in the presence of r(CUG)i 2 .
• the approach allows for the on- site synthesis of FRET reporters that will have broad applicability.
• [1 1] a) A. Krasinski, Z. Radic, R. Manetsch, J. Raushel, P. Taylor, K. B. Sharpless, H. C. Kolb, J. Am. Chem. Soc. 2005, 127, 6686-6692; b) A. T. Poulin-Kerstien, P. B. Dervan, J. Am. Chem. Soc. 2003, 125, 1581 1 -15821.
• the linker sets with the closest reactive groups in each structure were used to generate models for cycloaddition end products, K 1,4-dimer and K 1,5-dimer.
• the K 1,5-dimer for each linker combination (hex-5-ynamide + N 3 or N-(2-amino-2-oxoethyl)propiolamide + N 3 ) has one conformation.
• the K 1,4-dimer for each linker combination showed two major
• the systems were pre-equilibrated using the NPT relaxation protocol, which consists of restrained/unrestrained minimizations and short simulations with isothermal and isobaric ensemble.
• the 10 ns MD simulations were performed at constant temperature (300K) and pressure (1.01325 bar). Positional restraints were applied to the RNA throughout the simulation. Short- and long-range Coulombic interactions were set to Cutoff method with 9 A radius (short) and smooth particle mesh Ewald tolerance method with a tolerance o 1 ⁇ 10 "9 (long). Analyses of the simulations were completed with Maestro graphics interface. No significant fluctuations of system volume, pressure, temperature and potential energy were observed.
• DIC N,N'-Diisopropylcarbodiimide
• DIEA N,N-Diisopropylethylamine
• DMF N,N-dimethylformamide
• HPLC high performance liquid chromatography
• HRMS high resolution mass spectrometry
• LC-MS liquid chromatography-mass spectrometry
• MeOH methanol
• MALDI ToF/ToF matrix-assisted laser desorption/ionization time of flight/time of flight
• MS mass spectrometry
• NBD 7-nitrobenz-2-oxa-l,3-diazole-4-yl
• TFA trifluoroacetic acid
• Fmoc-Rink amide resin (0.59 mmol/g) was purchased from Advanced ChemTech. N, N-dimethylformamide (DMF, anhydrous) was purchased from EMD and used without further purification. Piperidine, trifluoroacetic acid (TFA), N, N-diisopropylethyl amine (DIEA), and 2-bromoacetic acid were purchased from Sigma Aldrich. N, N'- diisopropylcarbodiimide (DIC), l-l -hydroxy-7-azabenzotriazole (HOAt), and Fmoc-P-alanine were purchased from Advanced ChemTech.
• Fmoc-N-methyl-L-alanine and N-(4-aminobutyl) ⁇ N-mefhyl carbamic acid tert-butyl ester were purchased from Combi-Blocks.
• N-(4-aminoethyl)- N-methyl carbamic acid tert-butyl ester was purchased from Oakwood Products.
• Chlorambucil was purchased from MP Biomedicals.
• Bleomycin A5 was purchased from LKT Laboratories. Hoechst carboxylate (Pushechnikov A, Lee MM, Childs-Disney JL, Sobczak K, French JM, Thornton CA, Disney MD. J Am Chem Soc. 2009 Jul 22;131(28):9767-79), 2H-K4NMe
• Preparative HPLC was performed using a Waters 1525 Binary HPLC pump equipped with a Waters 2487 dual absorbance detector system and a Waters Sunfire CI 8 OBD 5 ⁇ 19 x 150 mm column. Absorbance was monitored at 280 and 220 ran. A gradient of 0- 100% MeOH in H 2 0 with 0.1% TFA over 60 min was used for compound purification.
• Analytical HPLC was performed using a Waters Symmetry CI 8 5 ⁇ . 4.6 x 150 mm column. All compounds evaluated had >95% purity as determined by analytical HPLC.
• Mass spectrometry was performed with an Applied Biosystems MALDI ToF/ToF Analyzer 4800 Plus using an a-hydroxycinnamic acid matrix. All microwave reactions were performed using a Biotage initiator+ SP Wave microwave. High resolution mass spectral analysis was performed by the University of Illinois Urbana-Champaign School of Chemical Sciences Mass Spectrometry Center.
• N 3 -K (25 mg, 49 ⁇ ) was dissolved in a 1 : 1 mixture of acetone and water (2 mL) and NBD-activated 6-aminohexynoic acid (6 mg, 49 ⁇ ) was added. The reaction was stirred at room temperature overnight and then the solvent was removed in vacuo. The resulting residue was purified by reverse phase HPLC as described above. Yield: 20%; 5 mg of white solid as a TFA salt.
• N 3 -K-Aak Synthesis ofN 3 -K-Aak. See Figure 19.
• 2-Propiolamidoacetic acid (175 mg, 1.36 mmol) was dissolved in anhydrous DMF and was treated with DIC (213 ⁇ , 1.4 mmol), N-hydroxy-5- norborene-2,3-dicarboximide (243 mg, 1.36 mmol), and DIEA (600 ⁇ , 3.4 mmol). The reaction mixture was stirred under argon at room temperature overnight.
• N 3 -K (20 mg, 40 ⁇ ) was dissolved in a 1 : 1 mixture of acetone and water (2 mL), and 500 ⁇ . of the NBD- activated acid was added gradually over 4 h.
• N 3 -K-Biotin 17 mg, 30 ⁇
• NBD-biotin (12 mg, 30 ⁇ ) was added.
• the reaction was stirred at room temperature overnight and then the solvent was removed in vacuo.
• the resulting residue was purified by reverse phase HPLC as described above. Yield: 7%; 1.6 mg of white solid as a TFA salt.
• the resin was washed with DMF (3 x 5 mL) and reacted with a solution of N-(4-aminobutyl)-/V-methyl carbamic acid tert-butyl ester (121 mg, 0.6 mmol) in DMF (4 mL) via microwave irradiation (3 x 15 s) using a 700 W microwave set to 10% power.
• the resin was shaken with this solution at room temperature for 1 h and then washed with DMF (3 x 5 mL).
• the resin was washed with DMF (3 x 5 mL) and reacted with a solution of N-(4-aminobutyl)-7V- methyl carbamic acid tert-butyl ester (121 mg, 0.6 mmol) in DMF (4 mL) via microwave irradiation (3 x 15 s) using a 700 W microwave set to 10% power.
• the resin was shaken with this solution at room temperature for 1 h and then washed with DMF (3 x 5 mL).
• the resin was washed with DMF (3 x 5 mL) and reacted twice with a solution of 1M bromoacetic acid (4 mL) in DMF and DIC (250 ⁇ iL, 1.6 mmol) via microwave irradiation (3 x 15 s) using a 700 W microwave set to 10% power.
• the resin was washed with DMF (3 5 mL) and reacted with a solution of N-(4-aminoethyl)-N-methyl carbamic acid tert-butyl ester (105 mg, 0.6 mmol) in DMF (4 mL) via microwave irradiation (3 x 15 s) using a 700 W microwave set to 10% power.
• the resin was shaken with this solution at room temperature for 1 h and then washed with DMF (3 x 5 mL).
• the resulting pale yellow oil was treated with a solution of Hoechst carboxylate (80 mg, 0.16 mmol), HOAt (22 mg, 0.16 mmol), DIC (25 ⁇ , 0.16 mmol) and DIEA (100 ⁇ ) in DMF (2 mL) and heated via microwave to 75 0 C for 1.5 h. The solution was then concentrated in vacuo and purified using reverse phase HPLC with 20-100% MeOH/H 2 0 + 0.1% (v/v) TFA over 1 h. Then the Fmoc was removed with 20% piperidine/DMF (1 x 10 min) and then concentrated in vacuo.
• the resulting pale yellow oil was treated with a solution of Hoechst carboxylate (80 mg, 0.16 mmol), HOAt (22 mg, 0.16 mmol), DIC (25 ⁇ , 0.16 mmol) and DIEA (100 ⁇ ) in DMF (2 mL) and heated via microwave to 75 0 C for 1.5 h. The solution was then concentrated in vacuo and purified using reverse phase HPLC with 20-100% MeOH/H 2 0 + 0.1% (v/v) TFA over 1 h. Then the Fmoc was removed with 20% piperidine/DMF (1 x 10 min) and then concentrated in vacuo.
• the resin was washed with DMF (3 x 3 mL) and reacted with a solution of 3-azidopropylamine (60 mg, 0.6 mmol) in DMF (2 mL) via microwave irradiation (3 x 15 s) using a 700 W microwave set to 10%) power.
• the resin was shaken with this solution at room temperature for 1 h and then washed with DMF (3 x 3 mL).
• the resin was again reacted twice with a solution of 1M bromoacetic acid (2 mL) in DMF and DIC (125 ⁇ xL, 0.8 mmol) via microwave irradiation (3 x 15 s) using a 700 W microwave set to 10%> power.
• the resin was washed with DMF (3 x 3 mL) and reacted with a solution of N-(4-aminobutyl)-N-methyl carbamic acid tert-butyl ester (60 mg, 0.3 mmol) in DMF (2 mL) via microwave irradiation (3 x 15 s) using a 700 W microwave set to 10% power.
• the resin was shaken with this solution at room temperature for 1 h and then washed with DMF (3 x 3 mL).
• the resin was washed with DMF (3 x 5 mL) and reacted with a solution of 3-azidopropylamine (120 mg, 1.2 mmol) in DMF (5 mL) via microwave irradiation (3 x 15 s) using a 700 W microwave set to 10% power.
• the resin was shaken with this solution at room temperature for 1 h and then washed with DMF (3 x 5 mL).
• the resin was again reacted twice with a solution of 1M bromoacetic acid (4 mL) in DMF and DIC (250 ⁇ xL, 1.6 mmol) via microwave irradiation (3 x 15 s) using a 700 W microwave set to 10% power.
• the resin was washed with DMF (3 x 5 mL) and reacted with a solution of N-(4-aminobutyl)-N-methyl carbamic acid tert-butyl ester (121 mg, 0.6 mmol) in DMF (4 mL) via microwave irradiation (3 x 15 s) using a 700 W microwave set to 10% power.
• the resin was shaken with this solution at room temperature for 1 h and then washed with DMF (3 5 mL).
• the resin was washed with DMF (3 5 mL) and reacted twice with a solution of 1M bromoacetic acid (4 mL) in DMF and DIC (250 ⁇ ⁇ , 1.6 mmol) via microwave irradiation (3 x 15 s) using a 700 W microwave set to 10% power.
• the resin was washed with DMF (3 x 5 mL) and reacted with a solution of N-(4-aminoethyl)-N- methyl carbamic acid tert-butyl ester (105 mg, 0.6 mmol) in DMF (4 mL) via microwave irradiation (3 x 15 s) using a 700 W microwave set to 10% power.
• the resin was shaken with this solution at room temperature for 1 h and then washed with DMF (3 x 5 mL). Next the resin was treated with a solution of D-biotin (195 mg, 0.81 mmol), DIC (250 1.6 mmol), HOAt (1 10 mg, 0.81 mmol), and DIEA (140 ⁇ ,, 0.81 mmol) in DMF (5 mL) was added and the reaction was heated via microwave to 75 °C for 30 min. Next the resin was washed with DMF and DCM and then treated with 30% TFA/DCM (5 mL) for 10 min. The solution was concentrated in vacuo and azeotroped with toluene three times.
• the resulting pale yellow oil was treated with a solution of Hoechst carboxylate (40 mg, 0.08 mmol), HOAt (1 1 mg, 0.08 mmol), DIC (25 ⁇ , 0.16 mmol) and DIEA (50 ⁇ ) in DMF (1 mL) and heated via microwave to 75 0 C for 1.5 h. The solution was then concentrated in vacuo and purified using reverse phase HPLC with 20-100% MeOH/H 2 0 + 0.1% (v/v) TFA over 1 h.
• the resin was washed with DMF (3 x 5 mL) and reacted with a solution of 3-azidopropylamine (300 mg, 3 mmol) in DMF (5 mL) via microwave irradiation (3 x 15 s) using a 700 W microwave set to 10% power.
• the resin was shaken with this solution at room temperature for 1 h and then washed with DMF (3 x 5 mL).
• the resin was again reacted twice with a solution of 1M bromoacetic acid (5 mL) in DMF and DIC (500 ⁇ , 3.2 mmol) via microwave irradiation (3 15 s) using a 700 W microwave set to 10% power.
• the resin was washed with DMF (3 x 5 mL) and reacted with a solution of N-(4-aminobutyl)-N ⁇ methyl carbamic acid tert-butyl ester (240 mg, 1.2 mmol) in DMF (5 mL) via microwave irradiation (3 x 15 s) using a 700 W microwave set to 10% power.
• the resin was shaken with this solution at room temperature for 1 h and then washed with DMF (3 x 5 mL).
• the resin was washed with DMF (3 x 5 mL) and reacted twice with a solution of 1M bromoacetic acid (5 mL) in DMF and DIC (500 3.2 mmol) via microwave irradiation (3 x 15 s) using a 700 W microwave set to 10% power.
• the resin was washed with DMF (3 x 5 mL) and reacted with a solution of N-(4 ⁇ aminoethyl)-N- methyl carbamic acid tert-butyl ester (210 mg, 1.2 mmol) in DMF (5 mL) via microwave irradiation (3 x 15 s) using a 700 W microwave set to 10% power.
• the resin was shaken with this solution at room temperature for 1 h and then washed with DMF (3 x 5 mL). Then the resin was treated with a solution of N-Fmoc aminohexanoic acid (565 mg, 1.6 mmol), DIC (500 ⁇ ,, 3.2 mmol), HOAt (220 mg, 1.6 mmol), and DIEA (280 ⁇ , 1.6 mmol) in DMF (5 mL) was added and the reaction was heated via microwave to 75 °C for 30 min. The resin was washed with DMF and the Fmoc was removed with 20% piperidine/DMF (2 x 10 min).
• the resulting pale yellow oil was treated with a solution of Hoechst carboxylate (40 mg, 0.08 mmol), HOAt (1 1 mg, 0.08 mmol), DIC (25 ⁇ ,, 0.16 mmol) and DIEA (50 ⁇ ) in DMF (1 mL) and heated via microwave to 75 0 C for 1.5 h.
• the solution was then concentrated in vacuo and purified using reverse phase HPLC with 20- 100% MeOH/H 2 0 + 0.1 % (v/v) TFA over 1 h. 2.95 ⁇ of product was isolated and the Fmoc was removed by treating with 1 mL of 20% piperidine/DMF for 20 min at room
• the resulting pale yellow oil was treated with a solution of Hoechst carboxylate (40 mg, 0.08 mmol), HOAt (1 1 mg, 0.08 mmol), DIC (25 ⁇ , 0.16 mmol) and DIEA (50 ⁇ xL) in DMF (1 mL) and heated via microwave to 75 0 C for 1.5 h. The solution was then concentrated in vacuo and purified using reverse phase HPLC with 20-100%) MeOH/H 2 0 + 0.1 % (v/v) TFA over 1 h. The product was isolated and the Fmoc was removed by treating with 1 mL of 20%o piperidine/DMF for 20 min at room temperature and the solution was concentrated in vacuo.
• LC-MS Liquid Chromatography-Mass Spectrometry
• N 3 -K and K-Ak 500 ⁇ final concentration each were added and the reaction mixtures were incubated at 37 °C for 48 h. Each sample was analyzed by LC-MS using a Thermo Scientific LTQ-ETD mass spectrometer. A gradient of 0-100% acetonitrile in water plus 0.1% formic acid over 10 min was used for analysis. Total ion counts for each component were normalized to the percent ionization of each component as measured by using a control injection containing an equimolar mixture of N3-K, K-Ak, and K 1,4 dimer.
• DM2-associated pre-mRNA splicing defects in a DM2 cell culture model.
• C2C12 cells were maintained as monolayers in growth medium (1 x DMEM, 10% FBS, and 1 x Glutamax (Invitrogen)) at 37 °C and 5% C0 2 . Once cells in 96-well plates reached 60-70% confluency, each sample was transfected with 200 ng of total plasmid using 1 ⁇ ⁇ of
• Lipofectamine 2000 (Invitrogen) according to the manufacturer's standard protocol. Equal amounts of plasmid expressing a DM2 mini-gene with 300 CCTG repeats [i] and a BIN1 reporter mini-gene were used ⁇ . After 5 h, the transfection cocktail was removed and replaced with differentiation medium (l DMEM, 2% horse serum, and l x Glutamax) containing the compound of interest. After 72 h, total RNA was harvested using a Zymo Quick RNA miniprep kit. Approximately 150 ng of total RNA was subjected to RT-PCR. The RT-PCR primers for the BIN! mini-gene were 5 ' C ATTC ACC AC ATTGGTGTGC (forward) and 5'
• RT-PCR products were separated using a denaturing 8% polyacrylamide gel run at 200 V for 90 min in 1 ⁇ TBE buffer. The products were visualized by staining with SYBR Gold (Molecular Probes) and scanned using a Bio-Rad Gel Doc XR+ imaging system.
• FISH fluorescence in situ hybridization
• the cells were treated with compound for 72 h followed by FISH as previously described using 1 ng/ ⁇ , DY547 -2'0Me-(CAGG) 5 [ - ] .
• Cells were imaged in 1 ⁇ DPBS using an Olympus FluoView 1000 confocal microscope at lOOx magnification.
• C2C12 cells were grown in T-75 dishes in growth medium. Once the cells reached 60-70% confluency, each dish was transfected with 10 ⁇ g of a plasmid expressing the DM2 mini-gene using Lipofectamine 2000 according to the manufacturer's standard protocol. After 5 h, the transfection cocktail was removed and replaced with differentiation medium containing the compounds of interest. Cells were treated with a mixture of 12.5 ⁇ N 3 -K and either 12.5 ⁇ K-Ak, 12.5 ⁇ N 3 -K-Ak, or 12.5 ⁇ N 3 -K-Aak immediately after transfection.
• N -K was added to limit the molecular weight of the oligomeric products in order to enable detection by LC-MS.
• the cells were lysed by freezing and thawing with 10% water in acetonitrile. The thawed lysate was concentrated and re-suspended in 1 mL of 10% water in acetonitrile. Insoluble cellular debris was pelleted, and the supernatant was used for mass spectral analysis. Approximately 20 ⁇ oL of each sample was analyzed by LC-MS using a Thermo Scientific LTQ-ETD mass spectrometer. A gradient of 0-100%) acetonitrile in water plus 0.1% formic acid over 10 min was used for analysis. Total ion counts for each component were normalized to the percent ionization of each component in a control injection containing an equimolar mixture of N -K, K-Ak, and K 1,4 tjimer.
• C2C12 cells were grown in T-25 flasks as monolayers in growth medium and were transfected at 60-70%) confluency. Each dish was transfected with 3.4 ⁇ g of a plasmid expressing the DM2 mini-gene using Lipofectamine 2000 according to the manufacturer's standard protocol. After 5 h, the transfection cocktail was removed and replaced with differentiation medium containing the compounds of interest. Cells were treated with a mixture of 5 ⁇ N 3 -K-Biotin and either 5 ⁇ K-Ak, 5 ⁇ N 3 -K-Ak, or 5 ⁇ N 3 -K-Aak immediately after transfection.
• N 3 -K-Biotin was added to limit the molecular weight of the oligomeric products in order to enable detection by LC-MS.
• the cells were washed with 1 ⁇ DPBS and trypsinized.
• the pelleted cells were lysed by treating with 500 of Lysis Buffer (2% Triton X-100, 2% NP40, 1/25 RNAsecure (Ambion), and 1 RQ1 DNAse (Promega)) [2] for 5 min at room temperature and then incubated at 75 °C for 5 min.
• Lysis Buffer 2% Triton X-100, 2% NP40, 1/25 RNAsecure (Ambion), and 1 RQ1 DNAse (Promega)
• Reverse transcription reactions were carried out using qScript cDNA synthesis kit by adding approximately 10% volume of either cell lysate or eluted material according to the manufacturer's protocol. Then, 30% of each cDNA sample was used for real time PCR (qPCR) analysis for each primer set. qPCR was performed on a 7900HT Fast Real-Time PCR System (Applied Biosystems) using SYBR Green I.
• the PCR primers for the r(CCUG) exp -containing mRNA were 5' GTGAGTTTGGGGACCCTTGA (forward) and 5'
• CACCCTGAAAACTTTGCCCC (reverse).
• the PCR primers for 18S ribosomal RNA were 5' GTAACCCGTTGAACCCCATT (forward) and 5' CCATCCAATCGGTAGTAGCG (reverse).
• DM1 Splicing Defects in Patient Derived Fibroblasts Bioactivity of small molecule dimers was assessed by using DM1 patient derived fibroblasts containing 500 CTG repeats (GM03987) and healthy fibroblasts (GM07492). Cells were grown as monolayers in 12 well plates in growth medium (IX EMEM (Lonza), 10% FBS, IX glutagro (Corning), IX MEM non-essential amino acids (Corning) and IX antibiotic/antimycotic (Corning)).
• cells were -80% confluent, they were treated with growth medium containing the compound of interest (10, 1 , 0.1 and 0.01 ⁇ 2H-K4NMeS; 100, 10 and 1 nM 2H-K4NMeS-CA-Biotin; 1 ⁇ N 3 -2H- K4NMeS; 500 nM N 3 -2H-K4NMeS + 500 nM 2H-K4NMeS-Aminohexanoate; 1000, 10 and 0.1 nM N 3 -2H-K4NMeS-Aak; 250, 100, and 50 nM 2H- 4NMeS-Bleomycin A5).
• the compound of interest 10, 1 , 0.1 and 0.01 ⁇ 2H-K4NMeS; 100, 10 and 1 nM 2H-K4NMeS-CA-Biotin; 1 ⁇ N 3 -2H- K4NMeS; 500 nM N 3 -2H-K4NMeS + 500 nM 2H-
• RT-PCR products were observed after 25 cycles of 95 °C for 30 s, 58 °C for 30 s, 72 °C for 1 min and a final extension at 72 °C for 1 min.
• the products were separated on an 2 % agarose gel ran at 100 V for 1 h in IX TAE buffer. The products were visualized by staining with ethidium bromide and scanned using a Bio-Rad Gel Doc XR+ imaging system.
• the RT-PCR primers for the MBNL1 were
• HSA LR mice express human skeletal actin RNA with 250 CUG repeats in the 3 ; UTR.
• Age- and gender-matched HSA LR mice were injected intraperitoneally with either 100 mg/kg 2H-K4NMe in water or 13.3 mg/kg 2H-K4NMeS for treatment and 0.9% NaCl for control once per day for 7 days. Mice were sacrificed one day after the last injection, and the vastus muscle was obtained. RNA was extracted from the vastus tissue, and cDNA was synthesized as previously described.
• Target Identification and Pull Down by Chem-CLIP by using the DM1 system Target identification of small molecule dimers was assessed using DM1 patient derived fibroblasts containing 500 CTG repeats (GM03987) and healthy fibroblasts (GM07492). Cells were grown as monolayers in 100 mm 2 in growth medium (IX EMEM (Lonza), 10% FBS, IX glutagro (Corning), IX MEM non-essential amino acids (Corning) and IX antibiotic/antimycotic
• RNA was used for RT qScript cDNA synthesis kit (Quanta Biosciences). 10% of the RT reaction was used for real time PCR (qPCR) with SYBR green master mix (Life Technologies) performed on a 7900HT Fast Real-Time PCR System (Applied Biosystems). Monitored rCUG-containing mRNAs DMPK (500 repeats), SUPT20HL1 (17 repeats), CASK (16 repeats), LRP8 (1 1 repeats), MAP3K4 (1 1 repeats), SCUBE (7 repeats) and SORCS2 (7 repeats). Quantified by AAQ relative to GAPDH
• Target Identification and Pull Down by Chem-CLIP -Map Target identification of the binding sites of small molecule dimers was assessed using DM1 patient derived fibroblasts containing 500 CTG repeats (GM03987).
• Cells were grown as monolayers in 100 mm 2 in growth medium (IX EMEM (Lonza), 10% FBS, IX glutagro (Corning), IX MEM non-essential amino acids (Corning) and IX antibiotic/antimycotic (Corning)). Once cells were -80% confluent, they were treated with growth medium containing the compound of interest (100 nM 2H-K4NMeS-CA-Biotin).
• the cut RNA solution was incubated with streptavidin-agarose beads (100 iL, Sigma) for 1 h at room temperature. Then the beads were washed with IX PBS and the bound RNA was eluted by adding 100 ⁇ , of 95% formamide, 10 mM EDTA pH 8.2 for 10 min at 60 0 C. The bound RNA was cleaned up using a Zymo Quick RNA miniprep kit.
• RNA was used for RT qScript cDNA synthesis kit (Quanta).
• RT reaction 40% of the RT reaction was used for real time PCR (qPCR) with SYBR green master mix (Life Technologies) performed on a 7900HT Fast Real-Time PCR System (Applied Biosystems). Quantified by AAC t relative to GAPDH.
• RNA containing 12 CUG repeats were incubated with an RNA containing 12 CUG repeats.
• rCUGi 2 100 ⁇ final concentration was folded in 1 x Folding Buffer (8 mM Na 2 HP0 4 , pH 7.0, 185 mM NaCl, and 1 mM EDTA) at 60 °C for 5 min.
• azide and alkyne dimers 25 ⁇ final concentration each were added and the reaction mixtures were incubated at 37 °C for 24 h.
• Each sample was analyzed by LC-MS using a Thermo Scientific LTQ-ETD mass spectrometer.
• DM1 patient derived fibroblasts containing 500 CTG repeats (GM03987) and healthy fibroblasts (GM07492) were grown to 80% confluence in growth medium (IX EMEM (Lonza), 10%» FBS, IX glutagro (Corning), IX MEM non-essential amino acids (Corning) and IX antibiotic/antimycotic (Corning)) in T25 dishes and treated with equimolar amounts of N 3 -2H-K4NMeS Biotin and 2H-K4NMeS-Ahx Alkyne (500 nM each) for 2 days.
• growth medium IX EMEM (Lonza)
• RNA was eluted by adding 20 ⁇ , of 95% formamide, 10 mM EDTA pH 8.2 for 5 min at 60 0 C. Approximately 4 ⁇ , of each sample was diluted in 20 ⁇ , of water plus 0.1% formic acid and analyzed by LC-MS using a Thermo Scientific LTQ-ETD mass spectrometer. A gradient of 0-100% acetonitrile in water plus 0.1% formic acid over 10 min was used for analysis.
• FISH Fluorescence In Situ Hybridization
• C2C12 cell lines expressing 800 or 0 CTG repeats in the 3' UTR of luciferase were grown as monolayers in 96-well plates in growth medium (IX DMEM, 10% FBS, IX glutagro, (Corning) and IX antibiotic/antimycotic (Corning)) [10] . Once the cells were 70% confluent, the click functionalized dimers were added in 100 ⁇ , of growth medium (1000 nM N 3 -2H- 4NMeS and 1000, 10 and 0.1 nM N 3 -2H-K4NMeS-Aak) .
• growth medium 1000 nM N 3 -2H- 4NMeS and 1000, 10 and 0.1 nM N 3 -2H-K4NMeS-Aak
• rCUGi 2 (80 ⁇ final concentration) was folded in 1 x Folding Buffer (20 mM HEPES, pFI 7.5, 100 M KCl, and 10 mM NaCl). After cooling to room temperature, FAM-2H-K4NMeS Aak (60 nM final concentration) and N3-2H-K4NMeS Aak (40 i M final concentration) were added and the reaction mixtures were incubated at 37 0 C for a total of 48 h, FRET was measured by exciting at 485 nm and measuring emission at 590 nm.
• Enhancement in FRET was quantified by comparing to controls with FAM-2H-K4NMeS Aak (60 nM final concentration) and N 3 -2H- K4NMeS Aak (40 nM final concentration) in the absence of RNA. Also FRET was measured using a base-paired control RNA (r(GC) 20 ) as a negative control.

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Medicinal Chemistry (AREA)
• Veterinary Medicine (AREA)
• Pharmacology & Pharmacy (AREA)
• Animal Behavior & Ethology (AREA)
• General Health & Medical Sciences (AREA)
• Public Health (AREA)
• Engineering & Computer Science (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Epidemiology (AREA)
• Molecular Biology (AREA)
• Immunology (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Organic Chemistry (AREA)
• General Chemical & Material Sciences (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Orthopedic Medicine & Surgery (AREA)
• Physical Education & Sports Medicine (AREA)
• Neurology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Gastroenterology & Hepatology (AREA)
• Biochemistry (AREA)
• Pain & Pain Management (AREA)
• Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
• Saccharide Compounds (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Priority Applications (9)

Applications Claiming Priority (2)

Related Child Applications (2)

Publications (1)

Family

ID=55079084

Family Applications (1)

Country Status (9)

Cited By (3)

Families Citing this family (1)

Citations (3)

Family Cites Families (3)

• 2015
  • 2015-07-17 EP EP15822000.4A patent/EP3169404A4/en not_active Withdrawn
  • 2015-07-17 JP JP2017502695A patent/JP6461306B2/ja active Active
  • 2015-07-17 WO PCT/US2015/040902 patent/WO2016011348A1/en not_active Ceased
  • 2015-07-17 SG SG11201700387QA patent/SG11201700387QA/en unknown
  • 2015-07-17 US US15/327,117 patent/US10220031B2/en active Active
  • 2015-07-17 CA CA2955428A patent/CA2955428A1/en not_active Abandoned
  • 2015-07-17 CN CN201580050560.0A patent/CN106714908A/zh active Pending
  • 2015-07-17 AU AU2015289524A patent/AU2015289524A1/en not_active Abandoned
• 2017
  • 2017-01-15 IL IL250113A patent/IL250113A0/en unknown
• 2018
  • 2018-12-25 JP JP2018241478A patent/JP2019068831A/ja active Pending
• 2019
  • 2019-02-04 US US16/266,832 patent/US10471057B2/en active Active

Patent Citations (3)

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events