WO2016005985A2 - Méthode pour reprogrammer des cellules - Google Patents
Méthode pour reprogrammer des cellules Download PDFInfo
- Publication number
- WO2016005985A2 WO2016005985A2 PCT/IL2015/050715 IL2015050715W WO2016005985A2 WO 2016005985 A2 WO2016005985 A2 WO 2016005985A2 IL 2015050715 W IL2015050715 W IL 2015050715W WO 2016005985 A2 WO2016005985 A2 WO 2016005985A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cell
- itsc
- isolated
- cells
- transcription factor
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0603—Embryonic cells ; Embryoid bodies
- C12N5/0605—Cells from extra-embryonic tissues, e.g. placenta, amnion, yolk sac, Wharton's jelly
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/10—Growth factors
- C12N2501/119—Other fibroblast growth factors, e.g. FGF-4, FGF-8, FGF-10
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/60—Transcription factors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/60—Transcription factors
- C12N2501/606—Transcription factors c-Myc
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/90—Polysaccharides
- C12N2501/91—Heparin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
- C12N2506/13—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells
Definitions
- the present invention in some embodiments thereof, relates to a method for reprogramming cells and, more particularly, but not exclusively, to a method for reprogramming cells to induced trophoblast stem cells (iTSC).
- iTSC induced trophoblast stem cells
- Embryonic stem cells are pluripotent cells that are capable of long-term growth, self-renewal, and can give rise to every cell, tissue and organ in the fetus's body.
- ESCs hold great promise for cell therapy as a source of diverse differentiated cell types. Few major bottlenecks to realizing such potential are the risk of teratoma formation, allogenic immune rejection of ESC-derived cells by recipients and ethical issues.
- iPSC induced pluripotent stem cells
- Key master regulators are prevailing transcription factors that determine cell identity. Each cell type expresses a specific combination of key master regulators that together modulate the gene expression program of the cell. Alongside the master regulators, there are thousands of transcription factors, co-factors and chromatin modifiers which expression in the cell is crucial to maintain a stable cell state. The transcriptome of each cell type is tightly controlled by these factors to allow the cell to execute its function properly.
- the first report that demonstrated how powerful key master regulators are in modulating cell identity was in the 1980s, when Davis et al. showed that ectopic expression of MyoD in fibroblasts can convert them into myocyte- like cells(l). Almost twenty years later, Xie et al. demonstrated that forced expression of C/ ⁇ / ⁇ can convert differentiated B cells into macrophage-like cells(2).
- iPSCs are more prone to malignant transformation.
- stem cell-like cells although expressing a large set of markers and partially functioning in their native environment, are still dissimilar in many examined aspects to their in vivo counterparts. This suggests that the prevailing current reprogramming method affects the quality of the resulting converted cells and raises the question of whether stable conversion and a high degree of nuclear reprogramming state can be achieved only in pluripotent cells.
- TSCs trophoblast stem cells
- TE blastocyst polar trophectoderm
- E extraembryonic ectoderm
- TSC In humans embryos, TSC were identified in the blastocyst stage, however, to date, all attempts to isolate and culture human TSCs in their undifferentiated state were unsuccessful (18).
- the trophoblast cell lineage is the source for the most essential cell types of the main structural and functional components of the placenta. Therefore, TSCs have tremendous biomedical relevance, as one third of all human pregnancies are affected by placental-related disorders (20).
- iTSCs induced TSC-like cells
- ESCs embryonic stem cells
- somatic cells e.g. fibroblast
- a method of generating an induced trophoblast stem cell (iTSC) from a cell comprising expressing within the cell at least one exogenous transcription factor selected from the group consisting of Gata3, Eomes and Tfap2c, under conditions which allow generation of an iTSC from the cell, thereby generating the iTSC from the cell, with the proviso that the method does not consist of expressing within the cell Eomes, Cdx2, Elf5, cMyc and Klf4.
- iTSC induced trophoblast stem cell
- a method of generating an induced trophoblast stem cell (iTSC) from a cell comprising expressing within the cell exogenous Gata3, Eomes and Tfap2c transcription factors, under conditions which allow generation of an iTSC from the cell, thereby generating the iTSC from the cell.
- iTSC induced trophoblast stem cell
- the expressing comprises transiently expressing.
- the method comprising expressing within the cell an exogenous c-Myc transcription factor.
- the method comprising expressing within the cell at least one exogenous transcription factor selected from the group consisting of Tead4, Ets2, Cdx2 and Elf5.
- the conditions are such that expressing is for at least 10 days following introducing the exogenous transcription factor into the cell.
- the conditions are such that expressing is for no more than 30 days following introducing the exogenous transcription factor into the cell.
- the iTSC does not comprise the exogenous transcription factor as determined by PCR, western blot and/or flow cytometry.
- the conditions comprise a culture medium comprising FGF4 and heparin.
- the expressing comprises introducing into the cell a polynucleotide encoding the transcription factor.
- the polynucleotide is a DNA.
- the polynucleotide is a RNA.
- the method comprising isolating the iTSC.
- nucleic acid construct or system comprising at least one polynucleotide comprising a nucleic acid sequence encoding at least two transcription factors selected from the group consisting of Gata3, Eomes and Tfap2c.
- the at least one polynucleotide comprises a nucleic acid sequence encoding c-Myc transcription factor. According to some embodiments of the invention, the at least one polynucleotide comprises a nucleic acid sequence encoding at least one exogenous transcription factor selected from the group consisting of Tead4, Ets2, Cdx2 and Elf5.
- an isolated cell expressing at least two exogenous transcription factor selected from the group consisting of Gata3, Eomes and Tfap2c.
- an isolated cell expressing exogenous Gata3, Eomes and Tfap2c transcription factors.
- the isolated cell further expressing an exogenous Myc transcription factor.
- the isolated cell further expressing at least one exogenous transcription factor selected from the group consisting of Tead4, Ets2, Cdx2 and Elf5.
- the cell is de-differentiated.
- the cell comprises a DNA molecule encoding the at least one transcription factor.
- the cell comprises a RNA molecule encoding the at least one transcription factor.
- the cell comprises a protein molecule of the at least one transcription factor.
- the expressing is not in the natural location and/or expression level of the native gene of the transcription factor.
- the at least one exogenous transcription factor comprises at least two exogenous transcription factors.
- the at least one exogenous transcription factor comprises Gata3, Eomes and Tfap2c.
- the cell is a human cell.
- the cell is a somatic cell.
- the somatic cell is a fibroblast.
- an isolated induced trophoblast stem cell iTSC obtainable according to the method.
- an isolated induced trophoblast stem cell maintaining differentiation level of a trophoblast stem cell for at least 20 passages in culture.
- the iTSC maintaining the differentiation level in an absence of exogenous Gata3, Eomes and Tfap2c transcription factors as determined by a PCR assay.
- the iTSC comprises an ectopic DNA of a transcription factor integrated in the genome.
- the iTSC is characterized by at least one of:
- TSC markers as determined by an immunocytochemistry and/or PCR assay
- the methylation pattern comprises hypomethylation of the Elf 5 promoter, hypomethylation of the Handl promoter and/or hypermethylation of the Nanog promoter as compared to a somatic cell and/or an ESC cell.
- a cell culture comprising the isolated iTSC and a culture medium.
- a cell culture comprising the isolated cell and a culture medium.
- the culture medium comprises FGF4 and heparin.
- the iTSC being a cell line. According to some embodiments of the invention there is provided a cell line of the cell.
- a pharmaceutical composition comprising the iTSC and a pharmaceutically acceptable carrier or diluent.
- an isolated placenta or a blastocyst comprising the iTSC or the construct.
- a method of augmenting a placenta or a blastocyts comprising introducing into a placenta or a developing embryo the iTSC or the construct.
- a method of treating and/or preventing a disorder associated with development and/or activity of trophoblasts in a subject in need thereof comprising administering to the subject a therapeutically effective amount of the iTSC, the pharmaceutical composition, or the construct, thereby treating and/or preventing the disorder associated with development and/or activity of trophoblasts in the subject.
- the disease is selected from the group consisting of recurrent miscarriage, Preeclampsia, Fetal Growth Restriction (FGR), hydatiform mole and choriocarcinoma.
- a method of identifying an agent capable of modulating trophoblast development and/or activity comprising:
- an effect of the agent on the development and/or activity of the isolated iTSC or the isolated placenta above a predetermined level relative to the development and/or activity of the isolated iTSC or the isolated placenta without the agent is indicative that the drug modulates trophoblast development and/or activity.
- a method of obtaining a compound produced by a trophoblast comprising culturing the isolated iTSC or the cell culture and isolating from the culture medium a compound secreted by the cells, thereby obtaining the compound produced by the trophoblast.
- the compound is a growth factor or a hormone.
- iTSC induced trophoblast stem cell
- iTSC induced trophoblast stem cell
- iPSC induced pluripotent stem cells
- nucleic acid sequence encoding a second reporter polypeptide and a regulatory element for directing expression of the second reporter polypeptide, the regulatory element being under the control of a second early predictive marker of an iTSC and/or iPSC;
- first reporter polypeptide, the second reporter polypeptide and the third reporter polypeptide are distinguishable.
- the iTSC late predictive marker is Elf 5.
- the iPSC late predictive marker is Nanog.
- the early predictive markers are Utf 1 and Esrrb.
- an isolated cell comprising the construct.
- a transgenic animal comprising the cell.
- a method of identifying a reprogrammable iTSC or iPSC comprising: (i) obtaining the cell or a cell isolated from the transgenic animal; and
- FIG. 1 is a schematic representation of the strategy to reprogram fibroblasts to induced trophoblast stem cell-like (iTSCs) cells.
- iTSCs induced trophoblast stem cell-like
- FIGs. 2A-B show that iTSC colonies express TSC markers.
- Figure 2A presents bright field images and immuno staining against Esrrb, Utfl, Elf5 and Cdx2 in stable iTSC colonies generated by 12 transcription factors (12F). Scale bar indicates 100 ⁇ .
- Figure IB is a graph showing mRNA levels of the indicated TSC gene markers normalized to the Gapdh housekeeping gene in MEFs and five iTSC colonies as determined by qRT-PCR.
- FIG. 3 is a representative bright field image of a multinucleate giant cell derived from iTSC colonies generated by 12 transcription factors (12F) following Fgf4 and heparin withdrawal.
- FIG. 4 shows graphs of the viral integration of each of the 12 factors into the genome of five isolated iTSC colonies (12F-iTSC), as determined by qRT-PCR.
- FIG. 5 shows bright field images showing blastocyst-derived TSC colonies (TSC blast#1 ) and stable iTSC colonies generated by 3 factors (Gata3, Eomes and Tfap2c, 3F-iTSC) and 4 factors (Gata3, Eomes, Tfap2c and Myc, 4F-iTSC), all from mice with mixed C57BL/6 x 129 background.
- Upper panel shows colonies that grew under standard TSC culture condition (70 % MEF conditioned medium (MEF-CM), 30 % TSC medium +FGF4 and Heparin).
- Lower panel shows colonies that grew under defined culture condition (TX medium + FGF4, Heparin and Tgfpi on matrigel).
- FIG. 6 shows bright field images showing cells in 4 factors reprogramming (Gata3, Eomes, Tfap2c and Myc, GETM) at the indicated time points. Dashed circles indicate colonies in formation, before and after isolation.
- FIG. 7 is a graph summarizing the number of Sox-GFP colonies generated by reprogramming of Sox2-GFP Mouse embryonic fibroblasts (MEFs) or tail tip fibroblasts (TTFs) by 3 factors (GET) or 4 factors (GETM). The graph represents the results of 30X10 5 seeded cells within a 10 cm plate.
- FIG. 8 is a graph demonstrating the proliferation curve of MEFs infected with GET or GETM during 14 days of reprogramming as indicated by cell number.
- FIG. 9 shows graphs of the viral integrations of Gata3, Eomes, Tfap2c and Myc in the genomes of the indicated colonies, as determined by qRT-PCR.
- FIG. 10 shows graphs of the endogenous and exogenous mRNA levels of Gata3, Eomes, Tfap2c and Myc normalized to the Gapdh housekeeping control gene in MEFs, one blastocyst-derived clone, two 3F and two 4F representative iTSC clones, as evaluated by qRT-PCR.
- FIG. 11 shows flow cytometry histograms demonstrating Sox2 expression in a Sox2-GFP iTSC clone, 4F-iTSC Sox2 GFP #l, that grew under standard TSC culture conditions (TSC medium- 70 % MEF-CM and 30 % TSC medium on feeder) and under defined culture conditions (TX medium).
- FIG. 12 shows bright field images of a stable iTSC colony generated by 3 factors from MEFs isolated from C57BL/6 mice.
- FIG. 13 shows bright field and GFP channel images of a stable iTSC colony expressing endogenous Sox2, generated by 4 factors from tail tip fibroblasts (TTFs) isolated from Sox2-GFP mice.
- FIG. 14 shows bright field and GFP channel images of a stable iTSC colony generated by 4 factors from MEFS isolated from Sox2-GFP mice and Oct4-GFP mice, demonstrating that the cells express endogenous Sox2 and not Oct4.
- FIG. 15 shows graphs of mRNA levels of the indicated genes normalized to the Gapdh housekeeping control gene in MEFs, ESCs, blastocyst-derived TSC and 3 and 4 factors representative iTSC colonies, as determined by qRT-PCR.
- FIGs. 16A-C demonstrate that reprogramming to TSC begins with the initiation of a mesenchymal-to-epithelial transition (MET).
- Figures 16A and 16B are representative bright field images showing the formation of epithelial foci within the indicated days of iTSC reprogramming with 4 factors (GETM, Figure 16A) or 3 factors (GET, Figure 16B).
- Figure 16C is a schematic representation of the MET process and key factors that block it.
- FIG. 17 shows graphs of mRNA levels of the indicated MET blocking genes normalized to the Gapdh housekeeping control gene in MEFs, ESCs, blastocyst-derived TSCs and MEFs reprogrammed with 4 factors following incubation with dox for the indicated amount of days, as determined by qRT-PCR.
- FIG. 18A-B show graphs of mRNA levels of the indicated epithelial and mesenchymal markers genes normalized to the Gapdh housekeeping control gene in MEFs, ESCs, blastocyts-derived TSCs and MEFs reprogrammed with 4 factors ( Figure 18 A) or 3 factors ( Figure 18B) following incubation with dox for the indicated amount of days, as determined by qRT-PCR.
- FIG. 19 shows representative immuno staining images depicting the protein levels of the epithelial markers, Krtl8 and Cdhl, and the mesenchymal marker, Acta2, in MEFs, MEFs expressing the 4 factors for 12 days (GETM 12 days on dox), blastocyst-derived TSCs (TSC blast #l) and the 4F-iTSC#l clone.
- FIGs. 20A-D demonstrate unbiased comparative transcriptome analysis clusters iTSCs with blastocyst-derived TSCs and far from ESCs and MEFs.
- Figure 20A shows hierarchical clustering of global gene expression profiles for two RNA-seq technical replicates for the indicated iTSC, blastocyst-derived TSC, ESC and MEF lines. Replicate pairs were assigned a shared numerical value.
- Figure 20C are scatter plots for the indicated comparisons.
- the blue line shows the linear representation of the data
- the red dots show the position of the indicated genes.
- Figure 20D shows heatmap of the indicated samples using the 10,000 most highly expressed genes over all samples. The heatmap was generated using the Bioconductor R package DESeq (Andres and Huber, 2010).
- FIGs. 21A-C demonstrate that iTSCs exhibit genomic stability compared to blastocyst-derived TSCs.
- Figure 21A is a graph showing frequency of chromosomal aberrations in single ESCs, MEFs, blastocyst-derived TSCs and the indicated iTSCs clones using a single cell sequencing. Anova statistical test was used for analysis of variance.
- Figure 21B is a graph showing the average number of sister chromatid exchanges (SCEs) occurring at the single cell level in the indicated lines using the Strand-seq technique. Error bars present mean + SD of the indicated number of cells (n) examined.
- Figure 21C is a representative Strand-seq library from 4F-iTSC#5 clone. Sister chromatid exchanges are indicated by black arrows.
- FIG. 22 presents promoter methylation screen of Elf5, Nanog and Handl demonstrating Elf5 and Handl hypomethylation and Nanog hypermethylation in iTSCs and blastocyst-derived TSCs.
- the Figure shows bisulfite analysis of promoter region of Elf5 (-652 to -263) (upper panel), the promoter region of Nanog (-399 to +49) (middle panel) and the promoter region of Handl (-110 to +40) (lower panel) in blastocyst- derived TSCs, iTSCs, ESCs and MEFs.
- Each circle represents one CG sequence in the depicted locus and each row represents one PCR product that was cloned into TA cloning vector and sequenced. Open circles present non-methylated promoter and the filled circles present methylated promoter.
- FIG. 23 is a graph summarizing the mRNA levels of the indicated gatekeeper genes in the indicated groups as measured by RN A- sequencing analysis.
- FIGs. 24A-B present deposition patterns in iTSC clones and demonstrate their resemblance to blastocyst-derived TSC clones.
- Figure 24A is a bar chart summarizing the number of differential H2A.X deposition domains (compared to TSC blast #l control line) in the indicated iTSC and TSC lines, MEFs and ESCs (p-value ⁇ l.OE-100, chi- square test).
- Figure 24B shows comparative H2A.X depositions in the indicated iTSC clones, blastocyst-derived TSCs, ESCs and MEFs at the depicted chromosomes (Chr: 15, 1, 4 and 8).
- Y axis represents the relative H2A.X deposition level (RSEG enrichment score, compared to TSC control line. Positive value present regions enriched for H2A.X deposition over control; and negative values present regions devoid of H2A.X deposition over control.
- FIGs. 25A-C demonstrate that iTSCs are multipotent and can differentiate invito) into various trophoblast lineages.
- Figure 25 A shows representative bright field images of iTSCs (4F-iTSC#5) grown in differentiation media for the indicated time points.
- Figure 25B shows flow cytometry histograms of iTSCs (4F-iTSC#5) grown in differentiation media for the indicated time points following propidium iodide (PI) staining. Markers indicate the staining intensities, representative of DNA copy number. The percentage of cells from each sample in every phase is indicated on the histogram.
- PI propidium iodide
- Figure 25C shows graphs of mRNA levels of the indicated trophoblast lineage and TSC markers normalized to Gapdh housekeeping control genes in 3F and 4F iTSC grown in differentiation media for the indicated time points, as determined by qRT-PCR.
- FIGs. 26A-B demonstrate that iTSCs are functional and able to generate hemorrhagic lesions in-vivo.
- Figure 26 A is a picture showing hemorrhagic lesion 7 days following subcutaneous injection of iTSCs into nude mice.
- Figure 26B shows representative hematoxylin and eosin (H&E) staining of paraffin sections of hemorrhagic lesions obtained from nude mice 7 days following subcutaneous injection of iTSCs.
- the left image is a low power image; the right image is a higher power image showing necrotic tissue with blood and scattered giant cells (marked with an arrow).
- FIG. 27 demonstrates that iTSCs can integrate into the trophectoderm of blastocysts following injection into 8-cell stage embryo.
- the left panel shows bright field and red channel images of a stable iTSC colony with constitutive tdTomato expression generated by 3 factors (3 F . iTS c B6/R26 - tdTomato #4).
- the right image shows localization of the injected iTSCs into the extraembryonic layer.
- FIG. 28 shows bright field and green chancel images of stable iTSC clones, 3F- iTSC H2b ⁇ GFP #l, 4F-iTSC H2b ⁇ GFP #l and 4F-iTSC H2b ⁇ GFP #5, with constitutive nuclear GFP expression (H2b-GFP).
- FIGs. 29A-B demonstrate that iTSCs and blastocyst-derived TSCs localize to the extraembryonic region of blastocyts.
- 4F-iTSC H2b GFP #l ( Figure 29A) and blastocyst-derived TSC clone, TS c blast H2b GFP #l ( Figure 29B) were injected into 8-cell stage embryos and analyzed at the hatched blastocyst stage using confocal fluorescent microscopy. To detect trophectoderm cells, the blastocysts were stained for Cdx2 (red staining). To detect cells from the inner cell mass, the blastocysts were stained for Nanog (white).
- H2b-GFP nuclei and Cdx2 nuclei Co-localization of H2b-GFP nuclei and Cdx2 nuclei (yellow staining) is marked by white arrows.
- H2b-GFP-positive nuclei that are Cdx2-negative are marked by pink arrows.
- Figures 30A-C show the contribution of H2b-GFP iTSCs, 3F-iTSC H2b GFP #l ( Figure 30A) and 4F-iTSC H2b GFP #4 ( Figure 30B), to the developing 13.5 dpc placenta.
- a clear H2b-GFP signal was detected in several patches within the placenta (white squares) and was completely absent in the embryo. A magnification of one region is illustrated by dashed lines.
- placentas were imaged using the green and red channels to detect autofluorescence.
- White oval shows autofluorescence structure.
- Figure 23C is an immuno staining photomicrograph of GFP in placental tissue isolated from El 3.5 fetus following blastocyst injection of 4F-iTSC H2b GFP #5 cells showing a clear nuclear GFP staining.
- FIG. 31 is an immuno staining photomicrograph of GFP (green) and Tfap2c (red staining) in placental tissue isolated from E13.5 fetus following blastocyst injection of 3F-iTSC H2b GFP #l cells demonstrating double positive cells (yellow staining, marked by white arrows).
- FIG. 32 is a graph showing mRNA levels of the indicated ESC and TSC genes normalized to the Gapdh housekeeping control gene in MEFs, iTSC clones, blastocytes- derived TSCs and ESCs.
- FIG. 33 shows bright field images, green channel images and flow cytometry analysis of iPSCs generated by OSKM expression in MEFs isolated from Nanog-GFP (left panel) or Oct4-GFP (right panel) mice grown in ESC or in TSC medium.
- FIG. 34 shows flow cytometry histograms of GFP positive cells during reprogramming of MEFs isolated from Nanog-GFP or Oct4-GFP mice with the 4 factors at the indicated time points.
- FIG. 35 is a graph showing mRNA levels of the early pluripotent marker Fbxol5 normalized to the Gapdh housekeeping control gene in MEFs, TSCs, ESCs and MEFs exposed to OSKM or GETM in the indicated time points, as determined by qRT-PCR.
- FIG. 36 shows bright field images, green channel images of a representative stable iTSC colony expressing endogenous Sox2/GFP, generated from Sox2-GFP MEFs infected with GETM in the presence of JAK inhibitor (JAKi)
- JAK inhibitor JAK inhibitor
- FIGs. 37A-C demonstrate the generation of iTSCs using GETM is independent of Oct4 while generation of iPSCs using OSKM is dependent on the presence of Oct4.
- Figure 37A is a schematic representation of the strategy for growing iTSC or iPSC clones without Oct4.
- Figure 37B shows semi-quantitative PCR analysis using primers for the recognition of Cre activity on Oct4 loxP sites and using primer pair C, producing a 245 bp fragment from floxed alleles and a 1455 bp fragment from non-floxed alleles (upper photomicrograph) or using primer pair A, producing a 498 bp fragment from WT Oct4 alleles or a 532 bp (498+34 bp of the loxP) fragment from flox oct4 alleles or no PCR product (white star) (lower photomicrograph).
- Figure 37C shows bright field and green channel representative images of iTSC and iPSC colonies, with or without Cre expression.
- FIGs. 38A-D demonstrate the generated iTSCs do not differentiate to cardiomyocytes.
- Figure 38A shows bright field images of beating colonies generated by OSKM, 6 and 10 days following dox induction as compared to bright field images of cells infected with the 4 factors (GETM), 6 and 10 days following dox exposure.
- Figure 38B is a graph summarizing the percentages of beating and non-beating colonies out of the total "n" number of colonies generated by OSKM or GETM, 6 and 10 days following dox induction.
- Figure 38C shows bright field images and immuno staining with anti-Tnnt2 (Troponin2) antibody in a beating colony generated by OSKM, 10 days following dox induction as compared to cells infected with GETM, 10 days following dox exposure.
- Troponin2 anti-Tnnt2
- Figure 38D shows bright field images and immuno staining with anti- Tnnt2 (Troponin2) antibody in a beating colony generated by OSKM, 6 days following dox induction as compared to cells infected with GETM, 6 days following dox exposure.
- Tnnt2 Troponin2
- FIG. 39 is a schematic presentation of the fluorescent knock-in reporter systems for studying reprogramming indicating the different fluorescent proteins and their targeted loci in the ESC KH2 line.
- FIG.s 40A-F demonstrate the establishment of the dox-inducible fluorescent knock-in reporter KH2 systems.
- Figure 40A shows southern blot analysis of 24 KH2 colonies that were electroporated with the Nanog-2A-EGFP targeting construct along with a CRISPR/Cas9 vector containing a guide RNA targeting the 3 'UTR of Nanog (Upper panel). Red asterisk represents correctly targeted clones.
- C represents control untargeted KH2 cells.
- Bright field and green channel images of correctly targeted colony number 12 (KH2-Ng#12) are presented in the lower panel.
- FIG. 40B shows southern blot analysis of 24 KH2-Ng#12 colonies that were electroporated with the Esrrb-2A-EBFP targeting construct along with a CRISPR/Cas9 vector containing a guide RNA targeting the 3 'UTR of Esrrb (Upper panel). Images of correctly targeted colony number 24 (KH2- NgEb#24) are presented in the right panel. This colony was picked for further targeting events since it displayed a proper ESC morphology and a stable EGFP and EBFP expression under the microscope and when analysed by flow cytometry (lower panel).
- Figure 40C shows southern blot analysis of 15 KH2-Ng#12 colonies that were electroporated with the Utfl-2A-tdTomato targeting construct along with a CRISPR/Cas9 vector containing a guide RNA targeting the 3 'UTR of Utfl (Upper panel). Images of correctly targeted colony number 4 (KH2-NgUr#4) are presented in the right panel. This colony was selected since it displayed a proper ESC morphology and a stable EGFP and tdTomato expression under the microscope and when analysed by flow cytometry (lower panel).
- Figure 40D shows representative images of a gonad isolated from E13.5 embryos generated following injection of KH2-NgUr#4 and KH2- NgEb#24 into tetraploid (4n) blastocysts demonstrating expression of the Nanog-2A- EGFP and Utfl-2A-tdTomato reporters solely in the germ cells.
- Figure 29E shows representative images adult mice generated following injection of KH2-NgUr#4 and KH2-NgEb#24 into tetraploid (4n) blastocysts.
- Figure 40F shows southern blot analysis of 12 KH2-NgEb#24 colonies that were electroporated with the Utfl -2 A- tdTomato targeting construct along with a CRISPR/Cas9 vector containing a guide targeting the 3 'UTR of Utfl (Left panel). Representative images of correctly targeted colony number 1 (KH2-NgEbUr#l) are presented in the middle and right panels. This colony was picked for further targeting events since it displayed a proper ESC morphology and a stable EGFP/EBFP and tdTomato expression under the microscope.
- FIG. 41 demonstrates that Esrrb and Utfl reporters turn on during the conversion to iTSCs. Depicted are representative fluorescent microscope images of the various reporters following infection of the knock-in Nanog-EGFP and Esrrb-EBFP (KH2-NgEb#24) or Nanog-EGFP and Utfl -tdTomato (KH2-NgUr#4) MEFs with the 12 key master factors.
- the present invention in some embodiments thereof, relates to a method for reprogramming cells and, more particularly, but not exclusively, to a method for reprogramming cells to induced trophoblast stem cells (iTSC).
- iTSC induced trophoblast stem cells
- Regenerative medicine is a new and expanding discipline that aims at replacing lost or damaged cells, tissues or organs in the human body through cellular transplantation.
- the generation of induced stem cells and the direct conversion approach provide an invaluable resource of cells for regenerative medicine and disease modeling.
- the direct conversion approach refers to both de-differentiation of a somatic cell and reprogramming of a stem cell.
- a somatic cell In mammals, specialized cell types of the placenta mediate the physiological exchange between the fetus and mother during pregnancy.
- the precursors of these differentiated cells are trophoblast stem cells (TSCs) and therefore, TSCs have tremendous biomedical relevance.
- TSCs trophoblast stem cells
- iTSCs induced TSC-like cells
- ESCs embryonic stem cells
- somatic cells e.g. fibroblast has been described before; however, in all models lineage conversion remained incomplete and failed to confer a stable true TSC phenotype.
- TSC key master regulators Whilst reducing the present invention to practice, the present inventors have now uncovered that transient ectopic expression of TSC key master regulators in cells leads to the formation of stable and transgene-independent iTSCs that resemble endogenous TSCs in their transcriptome, methylome and function and suggest its use in disease modeling, drug screening, and placenta augmentation.
- TSC trophoblast stem cell
- MET mesenchymal-to-epithelial transition
- the induced TSCs may be cultured independently of the exogenous factors for a large number of passages (> 30 passages) and resemble blastocyst-derived TSCs in their morphology, expression of TSC specific markers, no expression of ESC specific and fibroblasts specific markers, transcriptome, genomic stability, methylation status, and H2A.X organization (Examples 1-3, Figures 1-23, 24A-B and 32).
- the inventors further demonstrate that the generated iTSCs can differentiate into all derivatives of the trophectoderm lineage in vitro (Example 1, Figure 3 Example 3 Figures 25A-C), can give rise to hemorrhagic lesions in nude mice (Example 3, Figures 26A-B), and can chimerize the placenta of the developing embryo (Example 3, Figures 27-31), suggesting that iTSCs acquire all hallmarks of TSCs. Careful examination of the conversion process indicates that the cells did not go through a transient pluripotent state (Example 3, Figures 33-36, 37A-C and 38A-D). Without being bound by theory, these results suggest that a high degree of nuclear reprogramming can be attained in non-pluripotent cells.
- the inventors have developed a fluorescent knock-in reporter system that can be used to capture a reprogrammable iTSC or iPSC early in the re- programming process (Example 4, Figures 39-41) that can be used along the teaching of the present invention.
- an isolated induced trophoblast stem cell maintaining differentiation level of a trophoblast stem cell for at least 20 passages in culture.
- isolated refers to at least partially separated from the natural environment e.g., from the mammalian (e.g., primate) embryo or the mammalian (e.g., primate) body or from other cells in culture. Isolation can be done such that pure populations e.g., above 80 %, above 85 %, above 90 %, above 95 % or 100 % iTSCs are produced.
- induced trophoblast stem cell refers to a cell obtained by de-differentiation or re-programming of a cell.
- the iTSC thus produced is endowed with multipotency, in this case being capable of differentiating into the trophoblastic lineage.
- such cells are obtained from a differentiated cell (e.g. a somatic cell such as a fibroblast) and undergo de- differentiation by genetic manipulation which re-program the cell to acquire trophoblast stem cells (TSC) characteristics.
- a differentiated cell e.g. a somatic cell such as a fibroblast
- the iTSC is capable of differentiating to the three types of the trophoblast lineage cells in the placental tissue: the villous cytotrophoblast, the syncytiotrophoblast, and the extravillous trophoblast.
- the villous cytotrophoblast cells are specialized placental epithelial cells which differentiate, proliferate and invade the uterine wall to form the villi. Cytotrophoblasts, which are present in anchoring villi can fuse to form the syncytiotrophoblast layer or form columns of extravillous trophoblasts (Cohen S. et al., 2003. J. Pathol. 200: 47-52).
- the iTSC is a primate cell.
- the iTSC is a human cell.
- the iTSC is a rodent cell (e.g. mouse, rat).
- An iTSC is typically similar to a TSC which is derived from the placenta of a mammalian embryo in e.g. morphology, expression of specific markers, transcriptome, methylation pattern, and function, as further described below.
- the iTSC is characterized by at least one of: (i) TSC morphology, as determined by e.g. microscopic evaluation (by bright field or H&E staining, electron microscopy.
- TSC morphology is characterized by flat dense colony with higher edges;
- TSC markers as determined by an immunocytochemistry and/or PCR assay
- the TSC markers are selected from the group consisting of Elf5, Cdx2, Esrrb, Utfl, Tead4 and Handl, Tfap2c, Ets2, Eomes, Sox2.
- the ESC specific markers are selected from the group consisting of Nanog, Oct4 and Dppa3.
- the fibroblast specific markers are selected from the group consisting of Thyl, Col5a2, Postn.
- the methylation pattern comprises hypomethylation of the Elf 5 promoter, hypomethylation of the Handl promoter and/or hypermethylation of the Nanog promoter as compared to the parental non- reprogrammed cell and/or an ESC cell.
- the iTSC is characterized by absence of embryonic stem cell (ESC) specific markers (e.g. Nanog, Oct4 and Dppa3), as determined by an immunocytochemistry and/or PCR assay;
- ESC embryonic stem cell
- the iTSC expresses ESC specific markers e.g. Oct4. According to specific embodiments, the iTSC maintains differentiation level of a TSC for at least 20, at least 30, at least 50 passages in culture.
- the iTSC maintains its differentiation level of a TSC for at least 20 passages.
- the iTSC maintains differentiation level of a TSC in an absence of expression of an exogenous transcription factor as determined by e.g. a PCR assay.
- the iTSC does not comprise the exogenous transcription factor as determined by PCR, western blot and/or flow cytometry.
- the iTSC does not comprise exogenous Gata3, Eomes and Tfap2c transcription as determined by PCR, western blot and/or flow cytometry.
- the iTSC comprises an exogenous transcription factor not in the natural location (i.e., gene locus) and/or expression level (e.g., copy number and/or cellular localization) of the native gene of the transcription factor.
- the iTSC comprises an ectopic DNA of an exogenous transcription factor integrated in the genome of the cell but not in its natural location (i.e. locus) and/or copy number.
- the transcription factor is selected form the group consisting of Gata3, Eomes and Tfap2c.
- the present inventors have developed a novel method for generating an iTSC.
- a method of generating an induced trophoblast stem cell (iTSC) from a cell comprising expressing within the cell at least one exogenous transcription factor selected from the group consisting of Gata3, Eomes and Tfap2c, under conditions which allow generation of an iTSC from said cell, thereby generating the iTSC from the cell, with the proviso that the method does not consist of expressing within said cell Eomes, Cdx2, Elf5, cMyc and Klf4.
- iTSC induced trophoblast stem cell
- a method of generating an induced trophoblast stem cell (iTSC) from a cell comprising transiently expressing within the cell at least one exogenous transcription factor selected from the group consisting of Gata3, Eomes and Tfap2c, under conditions which allow generation of a iTSC from said cell, thereby generating the iTSC from the cell.
- iTSC induced trophoblast stem cell
- a method of generating an induced trophoblast stem cell (iTSC) from a cell comprising expressing within the cell exogenous Gata3, Eomes and Tfap2c transcription factors, under conditions which allow generation of an iTSC from said cell, thereby generating the iTSC from the cell.
- iTSC induced trophoblast stem cell
- an isolated induced trophoblast stem cell obtainable by the method of some embodiments of the invention.
- cell refers to any cell derived from an organism including an adult cell, a fetal cell, a somatic cell and a stem cell.
- the cell is a stem cell.
- stem cell refers to a cell which is not terminally differentiated i.e., capable of differentiating into other cell types having a more particular, specialized function (e.g., fully differentiated cells).
- the term encompasses embryonic stem cells, fetal stem cells, adult stem cells or committed/progenitor cells.
- the cell is a somatic cell.
- somatic cell refers to a terminally differentiated cell.
- somatic cells include a fibroblast, a blood cell, an endothelial cell, a hepatocyte, a pancreatic cell, a cartilage cell, a myocyte, a cardiomyocyte, a smooth muscle cell, a keratinocyte, a neural cell, a retinal cell, an epidermal cell, an epithelial cell (e.g., isolated from the oral cavity) or a cell isolated from placenta.
- the somatic cell is selected from the group consisting of a fibroblast, a blood cell, a keratinocyte, an epithelial cells e.g., a cell isolated from the oral cavity or a cell isolated from placenta.
- the somatic cell is a fibroblast.
- the cell is a primate cell.
- the cell is a human cell.
- the cell is a rodent cell (e.g. mouse, rat).
- rodent cell e.g. mouse, rat
- the cell is comprised in a homogenous population of cells, i.e. wherein at least about 80 % of the cells in the population are iTSCs.
- the cell is comprised in a heterogeneous population of cells, i.e. in a population which comprises more than one cell type, in which at least 30 % are iTSCs.
- an exogenous transcription factor is expressed in the cell.
- transcription factor refers to a cellular factor regulating gene transcription.
- the transcription factor is a polypeptide with the ability to bind a specific nucleic acid sequence (i.e. the binding site) which is specific for a specific transcription factor(s).
- the transcription factor of the present invention is a key master regulator that is part of the core circuitry of the cell.
- transcription factors include Tfap2c, Tead4, Handl, Dppal, Gata3, Ets2, Elf5, Cdx2, Eomes, c-Myc, Utfl and Esrrb.
- Tfap2c also known as Transcription Factor AP-2 Gamma, Activating Enhancer-Binding Protein 2 Gamma, Estrogen Receptor Factor 1 and AP2-GAMMA, refers to the polynucleotide and expression product e.g., polypeptide of the TFAP2C gene.
- the Tfap2c refers to the human Tfap2c, such as provided in the following GeneBank Numbers NP_003213 and NM 003222 (SEQ ID NO: 122-123).
- the Gata3 refers to the mouse Tfap2c, such as provided in the following GeneBank Numbers NP_001153168 and NM_001159696 (SEQ ID NO: 124-125).
- a functional expression product of Tfap2c is capable of supporting, optionally along with other factors which are described herein, the generation of iTSC.
- Tead4 also known as TEA Domain Family Member 4, TCF13L1, RTEF1, TEF3, HRTEF-1B, EFTR-2 and TEFR-1, refers to the polynucleotide and expression product e.g., polypeptide of the TEAD4 gene.
- the Tead4 refers to the human Tead4, such as provided in the following GeneBank Numbers NP_003204 and NM_003213 (SEQ ID NO: 126-127).
- the Tead4 refers to the mouse Tead4, such as provided in the following GeneBank Numbers NP_001074448 and NM_001080979 (SEQ ID NO: 128-129).
- a functional expression product of Tead4 is capable of supporting, along with other factors which are described herein, the generation of iTSC.
- Handl also known as Heart And Neural Crest Derivatives Expressed 1, Class A Basic Helix-Loop-Helix Protein 27, BHLHa27, EHand, Thingl and Hxt refers to the polynucleotide and expression product e.g., polypeptide of the HAND1 gene.
- the Handl refers to the human Handl, such as provided in the following GeneBank Numbers NP_004812 and NM_004821 (SEQ ID NO: 130-131).
- the Handl refers to the mouse Handl, such as provided in the following GeneBank Numbers NP_032239 and NM_008213 (SEQ ID NO: 132-133).
- a functional expression product of Handl is capable of supporting, along with other factors which are described herein, the generation of iTSC.
- Gata3 also known as GATA Binding Protein 3 and HDRS, refers to the polynucleotide and expression product e.g., polypeptide of the GAT A3 gene.
- the Gata3 refers to the human Gata3, such as provided in the following GeneBank Numbers NP_001002295 and NM_001002295 (SEQ ID NO: 134-135).
- the Gata3 refers to the mouse Gata3, such as provided in the following GeneBank Numbers NP_032117 and NM_008091 (SEQ ID NO: 136-137).
- a functional expression product of Gata3 is capable of supporting, optionally along with other factors which are described herein, the generation of iTSC.
- Ets2 also known as V-Ets Avian Erythroblastosis Virus E26 Oncogene Homolog 2 and Protein C-Ets-2, refers to the polynucleotide and expression product e.g., polypeptide of the ETS2 gene.
- the Ets2 refers to the human Ets2, such as provided in the following GeneBank Numbers NP_001243224 and NM_001256295 (SEQ ID NO: 138-139).
- the Ets2 refers to the mouse Ets2, such as provided in the following GeneBank Numbers NP_035939 and NM_011809 (SEQ ID NO: 140-141).
- a functional expression product of Ets2 is capable of supporting, along with other factors which are described herein, the generation of iTSC.
- Elf5 also known as E74-like factor 5
- Epithelium- Restricted ESE-1 -Related Ets Factor Epithelium-Specific Ets Transcription Factor 2 and ESE2
- Elf5 refers to the polynucleotide and expression product e.g., polypeptide of the ELF5 gene.
- the Elf5 refers to the human Elf5, such as provided in the following GeneBank Numbers NP_001230009 and NM_001243080 (SEQ ID NO: 142-143).
- the Elf5 refers to the mouse Elf5, such as provided in the following GeneBank Numbers NP_001139285 and NM_001145813 (SEQ ID NO: 144-145).
- a functional expression product of Elf5 is capable of supporting, along with other factors which are described herein, the generation of iTSC.
- Cdx2 also known as Caudal Type Homeobox 2, CDX3 and CDX2/AS, refers to the polynucleotide and expression product e.g., polypeptide of the CDX2 gene.
- the Cdx2 refers to the human Cdx2, such as provided in the following GeneBank Numbers NP_001256 and NM_001265 (SEQ ID NO: 146-147).
- the Cdx2 refers to the mouse Cdx2, such as provided in the following GeneBank Numbers NP_031699 and NM_007673 (SEQ ID NO: 148-149).
- a functional expression product of Cdx2 is capable of supporting, along with other factors which are described herein, the generation of iTSC.
- Eomes also known as Eomesodermin, TBR2 and T- Box Brain Protein 2 refers to the polynucleotide and expression product e.g., polypeptide of the EOMES gene.
- the Eomes refers to the human Eomes, such as provided in the following GeneBank Numbers NP_005433 and NM_005442 (SEQ ID NO: 150-151).
- the Eomes refers to the mouse Eomes, such as provided in the following GeneBank Numbers NP_001158261 and NM_001164789 (SEQ ID NO: 152-153).
- a functional expression product of Eomes is capable of supporting, optionally along with other factors which are described herein, the generation of iTSC.
- c-Myc also known as V-Myc Avian Myelocytomatosis Viral Oncogene Homolog, Class E Basic Helix-Loop-Helix Protein 39, Transcription Factor P64, BHLHe39, MRTL and MYCC, refers to the polynucleotide and expression product e.g., polypeptide of the MYC gene.
- the c-Myc refers to the human c-Myc, such as provided in the following GeneBank Numbers NP_002458 and NM_002467 (SEQ ID NO: 154-155).
- the c-Myc refers to the mouse c-Myc, such as provided in the following GeneBank Numbers NP_001170823 and NM_001177352 (SEQ ID NO: 156-157).
- a functional expression product of c-Myc is capable of supporting, along with other factors which are described herein, the generation of iTSC.
- Utfl also known as Undifferentiated Embryonic Cell Transcription Factor 1 refers to the polynucleotide and expression product e.g., polypeptide of the UTF1 gene.
- the Utfl refers to the human Utfl, such as provided in the following GeneBank Numbers NP_003568 and NM_003577 (SEQ ID NO: 158-159).
- the Utfl refers to the mouse Utfl, such as provided in the following GeneBank Numbers NP_033508 and NM_009482 (SEQ ID NO: 160-161).
- a functional expression product of Utfl is capable of supporting, along with other factors which are described herein, the generation of iTSC.
- Esrrb also known as Estrogen-related receptor beta and NR3B2 refers to the polynucleotide and expression product e.g., polypeptide of the ESRRB gene.
- the Esrrb refers to the human Esrrb, such as provided in the following GeneBank Numbers NP_004443 and NM_004452 (SEQ ID NO: 162-163).
- the Esrrb refers to the mouse Esrrb, such as provided in the following GeneBank Numbers NP_001152972 and NM_001159500 (SEQ ID NO: 164-165).
- a functional expression product of Esrrb is capable of supporting, along with other factors which are described herein, the generation of iTSC.
- Dppal also known as developmental pluripotency associated 1 refers to the polynucleotide and expression product e.g., polypeptide of the DPPA1 gene.
- the Dppal refers to the mouse Dppal, such as provided in the following GeneBank Numbers NP_001156830, NP_839978 and NM_001163358, NM_178247 (SEQ ID NO: 166-169).
- a functional expression product of Dppal is capable of supporting, along with other factors which are described herein, the generation of iTSC.
- Tfap2c Tead4
- Handl Gata3
- Ets2 Elf 5"
- Cdx2 Eomes
- c-Myc Utf 1
- Esrrb Eomes
- Dppal Dppal
- Tfap2c Tead4
- Handl Gata3, Ets2, Elf5, Cdx2, Eomes, c-Myc, Utfl, Esrrb and Dppal, homologues which exhibit the desired activity (i.e., de-differentiating or reprogramming a cell to an iTSC).
- Such homologues can be, for example, at least 80 %, at least 81 %, at least 82 %, at least 83 %, at least 84 %, at least 85 %, at least 86 %, at least 87 %, at least 88 %, at least 89 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100 % identical or homologous to the polypeptide of SEQ ID NOs: 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166 and 167, respectively, or 80 %, at least 81 %, at least 82 %, at least
- the homolog may also refer to an ortholog, a deletion, insertion, or substitution variant, including an amino acid substitution, as long as it retains the activity.
- Sequence identity or homology can be determined using any protein or nucleic acid sequence alignment algorithm such as Blast, ClustalW, and MUSCLE.
- the present invention contemplates expressing at least one transcription factor selected form the group consisting of Gata3, Eomes and Tfap2c.
- one, two or all of the transcription factors are exogenously expressed in the cell i.e.: Gata3; Eomes; Tfap2c; Gata3 + Eomes; Gata3 + Tfap2c; Eomes + Tfap2c; or Gata3+ Eomes + Tfap2c.
- all of the transcription factors are exogenously expressed in the cell i.e. Gata3+ Eomes + Tfap2c.
- the method comprises expressing within the cell an exogenous c-Myc transcription factor.
- the method comprises expressing within the cell least one exogenous transcription factor selected from the group consisting of Tead4, Ets2, Cdx2 and Elf 5.
- one, two, three or all of the transcription factors are exogenously expressed in the cell i.e.: Tead4; Ets2; Cdx2; Elf5; Tead4 + Ets2; Tead4 + Cdx2; Tead4 + Elf 5; Ets2 + Cdx2; Ets2 + Elf 5; Cdx2 + Elf 5; Tead4 + Ets2 + Cdx2; Tead4 + Ets2 + Elf5; Tead4 + Cdx2 + Elf 5; Ets2 + Cdx2 + Elf 5; or Tead4 + Ets2 + Cdx2 + Elf 5.
- Additional transcriptional factors which may be expressed according to some embodiments of the invention may be selected from the group consisting of Tead4, Handl, Dppal, Ets2, Utfl and Esrrb.
- the method comprises expressing Gata3, Tfap2c, Eomes, Tead4, Ets2, Cdx2, Esrrb and optionally c-Myc exogenous transcription factors.
- the method comprises expressing Gata3, Tfap2c, Eomes, Tead4, Ets2, Cdx2, Elf5 and optionally c-Myc exogenous transcription factors.
- the method comprises expressing Gata3,
- Tfap2c Eomes
- Tead4 Ets2
- optionally c-Myc exogenous transcription factors optionally c-Myc exogenous transcription factors.
- the method comprises expressing Gata3, Tfap2c, Eomes, Tead4 and optionally c-Myc exogenous transcription factors.
- the method comprises expressing Gata3, Tfap2c, Eomes, Ets2 and optionally c-Myc exogenous transcription factors.
- the method comprises expressing Gata3, Tfap2c, Eomes, c-Myc and Esrrb exogenous transcription factors. According to specific embodiment, the method does not consist of expressing within the cell Eomes, Cdx2, Elf5, c-Myc and Klf4.
- Klf4 also known as Kruppel-Like Factor 4 (Gut), GKLF and EZF, refers to the polynucleotide and expression product e.g., polypeptide of the KLF4 gene.
- the Klf4 refers to the human Klf4, such as provided in the following GeneBank Numbers NP_004226 and NM_004235 (SEQ ID NO: 170-171).
- the Klf4 refers to the mouse Klf4, such as provided in the following GeneBank Numbers NP_034767 and NM_010637 (SEQ ID NO: 172-173).
- Klf4 also refers for Klf4 homologues and orthologs.
- Such homologues can be, for example, at least 80 %, at least 81 %, at least 82 %, at least 83 %, at least 84 %, at least 85 %, at least 86 %, at least 87 %, at least 88 %, at least 89 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100 % identical or homologous to the polypeptide of SEQ ID NOs: 170 and 172 or the polynucleotide sequence encoding same.
- expressing refers to gene expression at the RNA and/or protein level.
- the term also refers to upregulating gene expression by expressing the DNA or RNA or upregulating the level of the protein by direct administration of the protein to the cell.
- exogenous refers to a heterologous polynucleotide or polypeptide which is not naturally expressed within the cell or which overexpression in the cell is desired.
- the exogenous polynucleotide and/or polypeptide may be introduced into the cell in a stable or transient manner.
- a polynucleotide introduction is effected so as to produce a ribonucleic acid (RNA) molecule and/or a polypeptide molecule.
- expressing comprises transiently expressing.
- exogenous polynucleotide and/or polypeptide may comprise a nucleic acid sequence and/or an amino acid sequence, respectively, which is identical or partially homologous to an endogenous nucleic acid sequence and/or an endogenous amino acid sequence of the cell.
- Methods of expressing an exogenous nucleic acid sequence and/or amino acid sequence are known in the art and include those described for example in the materials and methods of the Examples section which follows and in Mansour et al. 2012; Warren et al. 2010 and Hongyan Zhou al. Cell Stem Cell (2009) 4(6): 581; Rabinovich and Weissman (2013) Methods Mol Biol. 969:3-28; International Application Publication No. WO 2013049389 and US Patent No. US 8557972, which are fully incorporated herein by reference in their entirety.
- expressing is not in the natural location (i.e., gene locus) and/or expression level (e.g., copy number and/or cellular localization) of the native gene of the transcription factor.
- expressing is not in the natural position and/or copy number of the native gene of the transcription factor in a genome.
- exogenous expression of a transcription factor may be facilitated by activation of the endogenous locus of these genes such that the transcription factor is overexpressed in the cell.
- Methods of activating and overexpressing an endogenous gene are well known in the art [see for example Menke D. Genesis (2013) 51: - 618; Capecchi, Science (1989) 244: 1288-1292; Santiago et al. Proc Natl Acad Sci USA (2008) 105:5809-5814; International Patent Application Nos. WO 2014085593, WO 2009071334 and WO 2011146121; US Patent Nos. 8771945, 8586526, 6774279 and UP Patent Application Publication Nos.
- ZFNs Zinc finger nucleases
- TALENs transcription-activator like effector nucleases
- rAAV recombinant adeno-associated virus
- endogenous refers to a polynucleotide or polypeptide which is present and/or naturally expressed within the cell. Distinguishing a cell expressing an exogenous polynucleotide and/or polypeptide (e.g. transcription factor) from a cell not expressing the exogenous polynucleotide and/or polypeptide can be effected by e.g. determining the level and/or distribution of the RNA and/or protein molecules in the cell, the location of DNA integration in the genome of the cell and/or the number of gene copy number.
- an exogenous polynucleotide and/or polypeptide e.g. transcription factor
- Methods of determining the presence of an exogenous polynucleotide and/or polypeptide in a cell include e.g. PCR, DNA and RNA sequencing, Southern blot, Western blot, immunoprecipitation, immunocytochemistry, flow cytometry and imaging.
- polynucleotide refers to a single or double stranded nucleic acid sequence which is isolated and provided in the form of an RNA sequence, a complementary polynucleotide sequence (cDNA), a genomic polynucleotide sequence (e.g. sequence isolated from a chromosome) and/or a composite polynucleotide sequences (e.g., a combination of the above).
- RNA sequence a complementary polynucleotide sequence
- cDNA complementary polynucleotide sequence
- genomic polynucleotide sequence e.g. sequence isolated from a chromosome
- composite polynucleotide sequences e.g., a combination of the above.
- This term includes polynucleotides and/or oligonucleotides derived from naturally occurring nucleic acids molecules (e.g., RNA or DNA), synthetic polynucleotide and/or oligonucleotide molecules composed of naturally occurring bases, sugars, and covalent internucleoside linkages (e.g., backbone), as well as synthetic polynucleotides and/or oligonucleotides having non-naturally occurring portions, which function similarly to the respective naturally occurring portions.
- naturally occurring nucleic acids molecules e.g., RNA or DNA
- synthetic polynucleotide and/or oligonucleotide molecules composed of naturally occurring bases, sugars, and covalent internucleoside linkages (e.g., backbone)
- synthetic polynucleotides and/or oligonucleotides having non-naturally occurring portions which function similarly to the respective naturally occurring portions.
- polypeptide encompasses native peptides (either degradation products, synthetically synthesized peptides or recombinant peptides) and peptidomimetics (typically, synthetically synthesized peptides), as well as peptoids and semipeptoids which are peptide analogs, which may have, for example, modifications rendering the peptides more stable while in a body or more capable of penetrating into cells. Such modifications include, but are not limited to N terminus modification, C terminus modification, peptide bond modification, backbone modifications, and residue modification. Methods for preparing peptidomimetic compounds are well known in the art and are specified, for example, in Quantitative Drug Design, C.A. Ramsden Gd., Chapter 17.2, F. Choplin Pergamon Press (1992), which is incorporated by reference as if fully set forth herein.
- Natural aromatic amino acids, Trp, Tyr and Phe may be substituted by non- natural aromatic amino acids such as l,2,3,4-tetrahydroisoquinoline-3-carboxylic acid (Tic), naphthylalanine, ring-methylated derivatives of Phe, halogenated derivatives of Phe or O-methyl-Tyr.
- Tic l,2,3,4-tetrahydroisoquinoline-3-carboxylic acid
- naphthylalanine naphthylalanine
- ring-methylated derivatives of Phe ring-methylated derivatives of Phe
- halogenated derivatives of Phe or O-methyl-Tyr.
- polypeptides of some embodiments of the invention may also include one or more modified amino acids or one or more non-amino acid monomers (e.g. fatty acids, complex carbohydrates etc).
- modified amino acids e.g. fatty acids, complex carbohydrates etc.
- amino acid or “amino acids” is understood to include the 20 naturally occurring amino acids; those amino acids often modified post-translationally in vivo, including, for example, hydroxyproline, phosphoserine and phospho threonine; and other unusual amino acids including, but not limited to, 2-aminoadipic acid, hydroxylysine, isodesmosine, nor-valine, nor-leucine and ornithine.
- amino acid includes both D- and L-amino acids.
- polypeptides of some embodiments of the invention may be synthesized by any techniques known to those skilled in the art of peptide synthesis, for example but not limited to recombinant DNA techniques or solid phase peptide synthesis.
- expression vectors and modes of administering thereof into cells which can be used to express a polypeptide-of-interest (e.g., any of the proteins described hereinabove and below, e.g. Gata3, Eomes, Tfap2c and c-Myc and a reporter polypeptide) in a cell.
- a polypeptide-of-interest e.g., any of the proteins described hereinabove and below, e.g. Gata3, Eomes, Tfap2c and c-Myc and a reporter polypeptide
- expressing comprises introducing into the cell a polynucleotide encoding the polypeptide-of-interest (e.g. the transcription factor
- the polynucleotide is a DNA.
- the polynucleotide is a RNA.
- mRNA introduced into cells exists only in the cytoplasm, does not cause genome perturbations and is essentially transient. Unless expression of the mRNA changes the cell epigenetically, transient transfection is limited by the time of mRNA and cognate protein persistence in the cell, and does not continue after degradation of cognate proteins.
- a polynucleotide sequence encoding the polypeptide-of-interest is preferably ligated into a nucleic acid construct suitable for mammalian cell expression.
- teachings of the invention further contemplate that the polynucleotides are part of a nucleic acid construct system where the polypeptides of interest are expressed from a plurality of constructs.
- over-expression or exclusion of genes can be effected using knock-in and/or knock-out constructs [see for example, Fukushige, S. and Ikeda, J. E.: Trapping of mammalian promoters by Cre-lox site-specific recombination. DNA Res 3 (1996) 73-50; Bedell, M. A., Jerkins, N. A. and Copeland, N. G.: Mouse models of human disease. Part I: Techniques and resources for genetic analysis in mice. Genes and Development 11 (1997) 1-11; Bermingham, J. J., Scherer, S. S., O'Connell, S., Arroyo, E., Kalla, K. A., Powell, F. L. and Rosenfeld, M. G.: Tst-l/Oct-6/SCIP regulates a unique step in peripheral myelination and is required for normal respiration. Genes Dev 10 (1996) 1751-62].
- nucleic acid construct or system comprising at least one polynucleotide comprising a nucleic acid sequence encoding at least two transcription factors selected from the group consisting of Gata3, Eomes and Tfap2c.
- two or all of the transcription factors are encoded by the polynucleotide i.e.: Gata3 + Eomes; Gata3 + Tfap2c; Eomes + Tfap2c; or Gata3+ Eomes + Tfap2c.
- the at least one polynucleotide further comprises a nucleic acid sequence encoding c-Myc transcription factor.
- the at least one polynucleotide comprises a nucleic acid sequence encoding at least one exogenous transcription factor selected from the group consisting of Tead4, Ets2, Cdx2 and Elf5.
- one, two, three or all of the transcription factors are encoded by the polynucleotide i.e.: Tead4; Ets2; Cdx2; Elf5; Tead4 + Ets2; Tead4 + Cdx2; Tead4 + Elf 5; Ets2 + Cdx2; Ets2 + Elf 5; Cdx2 + Elf 5; Tead4 + Ets2 + Cdx2; Tead4 + Ets2 + Elf 5; Tead4 + Cdx2 + Elf 5; Tead4 + Cdx2 + Elf 5; Tead4 + Cdx2 + Elf 5; Ets2 + Cdx2 + Elf 5; Ets2 + Cdx2 + Elf 5; or Tead4 + Ets2 + Cdx2 +
- the nucleic acid construct or system comprising at least one polynucleotide comprising a nucleic acid sequence encoding Gata3, Eomes, Tfap2c and optionally c-Myc.
- the nucleic acid construct or system comprising at least one polynucleotide comprising a nucleic acid sequence encoding Gata3, Eomes, Tfap2c and Tead4 and optionally c-Myc.
- the nucleic acid construct or system comprising at least one polynucleotide comprising a nucleic acid sequence encoding Gata3, Eomes, Tfap2c and Ets2 and optionally c-Myc.
- the nucleic acid construct or system comprising at least one polynucleotide comprising a nucleic acid sequence encoding Gata3, Eomes, Tfap2c, Tead4 and Ets2 and optionally.
- the nucleic acid construct or system comprising at least one polynucleotide comprising a nucleic acid sequence encoding Gata3, Eomes, Tfap2c, Tead4, Ets2, Cdx2 and Elf5 and optionally c-Myc.
- the nucleic acid construct system comprises an individual nucleic acid construct for each transcription factor.
- a single construct comprises a number of transcription factors.
- Such a nucleic acid construct or system includes at least one cis-acting regulatory element for directing expression of the nucleic acid sequence.
- Cis-acting regulatory sequences include those that direct constitutive expression of a nucleotide sequence as well as those that direct inducible expression of the nucleotide sequence only under certain conditions.
- a promoter sequence for directing transcription of the polynucleotide sequence in the cell in a constitutive or inducible manner is included in the nucleic acid construct.
- mRNA since gene expression from an RNA source does not require transcription, there is no need in a promoter sequence or the additional sequences involved in transcription described hereinbelow.
- the nucleic acid construct or system (also referred to herein as an "expression vector") of some embodiments of the invention includes additional sequences which render this vector suitable for replication and integration in prokaryotes, eukaryotes, or preferably both (e.g., shuttle vectors).
- a typical cloning vector may also contain a transcription and/or translation initiation sequence, transcription and/or translation terminator and a polyadenylation signal.
- such constructs will typically include a 5' LTR, a tRNA binding site, a packaging signal, an origin of second-strand DNA synthesis, and a 3' LTR or a portion thereof.
- Eukaryotic promoters typically contain two types of recognition sequences, the TATA box and upstream promoter elements.
- the TATA box located 25-30 base pairs upstream of the transcription initiation site, is thought to be involved in directing RNA polymerase to begin RNA synthesis.
- the other upstream promoter elements determine the rate at which transcription is initiated.
- Enhancer elements can stimulate transcription up to 1,000 fold from linked homologous or heterologous promoters. Enhancers are active when placed downstream or upstream from the transcription initiation site. Many enhancer elements derived from viruses have a broad host range and are active in a variety of tissues. For example, the SV40 early gene enhancer is suitable for many cell types. Other enhancer/promoter combinations that are suitable for some embodiments of the invention include those derived from polyoma virus, human or murine cytomegalovirus (CMV), the long term repeat from various retroviruses such as murine leukemia virus, murine or Rous sarcoma virus and HIV. See, Enhancers and Eukaryotic Expression, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. 1983, which is incorporated herein by reference.
- CMV cytomegalovirus
- the promoter is preferably positioned approximately the same distance from the heterologous transcription start site as it is from the transcription start site in its natural setting. As is known in the art, however, some variation in this distance can be accommodated without loss of promoter function.
- Polyadenylation sequences can also be added to the expression vector in order to increase the efficiency of mRNA translation.
- Two distinct sequence elements are required for accurate and efficient polyadenylation: GU or U rich sequences located downstream from the polyadenylation site and a highly conserved sequence of six nucleotides, AAUAAA, located 11-30 nucleotides upstream.
- Termination and polyadenylation signals that are suitable for some embodiments of the invention include those derived from SV40.
- the expression vector of some embodiments of the invention may typically contain other specialized elements intended to increase the level of expression of cloned nucleic acids or to facilitate the identification of cells that carry the recombinant DNA.
- a number of animal viruses contain DNA sequences that promote the extra chromosomal replication of the viral genome in permissive cell types. Plasmids bearing these viral replicons are replicated episomally as long as the appropriate factors are provided by genes either carried on the plasmid or with the genome of the host cell.
- the vector may or may not include a eukaryotic replicon. If a eukaryotic replicon is present, then the vector is amplifiable in eukaryotic cells using the appropriate selectable marker. If the vector does not comprise a eukaryotic replicon, no episomal amplification is possible. Instead, the recombinant DNA integrates into the genome of the engineered cell, where the promoter directs expression of the desired nucleic acid.
- the expression vector of some embodiments of the invention can further include additional polynucleotide sequences that allow, for example, the translation of several proteins from a single mRNA such as an internal ribosome entry site (IRES) and sequences for genomic integration of the promoter-chimeric polypeptide.
- IRS internal ribosome entry site
- the individual elements comprised in the expression vector can be arranged in a variety of configurations.
- enhancer elements, promoters and the like, and even the polynucleotide sequence(s) encoding the protein-of- interest can be arranged in a "head-to-tail" configuration, may be present as an inverted complement, or in a complementary configuration, as an anti-parallel strand. While such variety of configuration is more likely to occur with non-coding elements of the expression vector, alternative configurations of the coding sequence within the expression vector are also envisioned.
- the expression construct of some embodiments of the invention can also include sequences engineered to enhance stability, production, purification, yield or toxicity of the expressed peptide.
- the expression construct include labels for imaging in cells, such as fluorescent labels.
- mammalian expression vectors include, but are not limited to, pcDNA3, pcDNA3.1(+/-), pGL3, pZeoSV2(+/-), pSecTag2, pDisplay, pEF/myc/cyto, pCMV/myc/cyto, pCR3.1, pSinRep5, DH26S, DHBB, pNMTl, pNMT41, pNMT81, which are available from Invitrogen, pCI which is available from Promega, pMbac, pPbac, pBK-RSV and pBK-CMV which are available from Strategene, pTRES which is available from Clontech, and their derivatives.
- Expression vectors containing regulatory elements from eukaryotic viruses such as retroviruses can be also used.
- SV40 vectors include pSVT7 and pMT2.
- Vectors derived from bovine papilloma virus include pBV-lMTHA, and vectors derived from Epstein Bar virus include pHEBO, and p205.
- exemplary vectors include pMSG, pAV009/A + , pMTO10/A + , pMAMneo-5, baculovirus pDSVE, and any other vector allowing expression of proteins under the direction of the SV-40 early promoter, SV-40 later promoter, metallothionein promoter, murine mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters shown effective for expression in eukaryotic cells.
- viruses are very specialized infectious agents that have evolved, in many cases, to elude host defense mechanisms.
- viruses infect and propagate in specific cell types.
- the targeting specificity of viral vectors utilizes its natural specificity to specifically target predetermined cell types and thereby introduce a recombinant gene into the infected cell.
- the type of vector used by some embodiments of the invention will depend on the cell type transformed. The ability to select suitable vectors according to the cell type transformed is well within the capabilities of the ordinary skilled artisan and as such no general description of selection consideration is provided herein.
- nucleic acid transfer techniques include transfection with viral or non-viral constructs, such as adenovirus, lentivirus, Herpes simplex I virus, or adeno-associated virus (AAV) and lipid-based systems.
- viral or non-viral constructs such as adenovirus, lentivirus, Herpes simplex I virus, or adeno-associated virus (AAV) and lipid-based systems.
- Naked DNA or RNA, cell penetrating peptide or Viral and non-viral vectors may be utilized as delivery vehicles in delivery of the polynucleotide or polypeptide as is known in the art.
- the delivery system used is biocompatible and nontoxic.
- naked DNA or RNA e.g., naked plasmid DNA (pDNA)
- pDNA naked plasmid DNA
- naked DNA or RNA is non-viral vector which can be produced in bacteria and manipulated using standard recombinant DNA techniques. It does not induce antibody response against itself (i.e., no anti-DNA or RNA antibodies generated) and enables long-term gene expression even without chromosome integration.
- naked DNA or RNA can be introduced by numerous means, for example but not limited to, intravascular and electroporation techniques [Wolff JA, Budker V, 2005, Adv. Genet. 54: 3-20], or by jet injection [Walther W, et al., 2004, Mol. Biotechnol. 28: 121-8].
- mammalian vectors are used, as further described hereinabove.
- the polynucleotide is comprised in a viral vector.
- a viral vector may be a virus with DNA based genome of a virus with RNA based genome (i.e. positive single stranded and negative single stranded RNA viruses).
- examples of viral vectors include, but are not limited to, Lentivirus, Adenovirus and Retrovirus.
- a viral construct such as a retroviral construct includes at least one transcriptional promoter/enhancer or locus-defining element(s), or other elements that control gene expression by other means such as alternate splicing, nuclear RNA export, or post-translational modification of messenger.
- Such vector constructs also include a packaging signal, long terminal repeats (LTRs) or portions thereof, and positive and negative strand primer binding sites appropriate to the virus used, unless it is already present in the viral construct.
- LTRs long terminal repeats
- Protocols for producing recombinant retroviruses and for infecting cells in-vitro or in-vivo with such viruses can be found in, for example, Ausubel et al., [eds, Current Protocols in Molecular Biology, Greene Publishing Associates, (1989)].
- Other suitable expression vectors may be an adenovirus, a lentivirus, a Herpes simplex I virus or adeno-associated virus (AAV).
- Regulatory elements that limit expression to particular cell types can also be included. Such features include, for example, promoter and regulatory elements that are specific for the desired cell type.
- expressing comprises introducing into the cell the polypeptide-of-interest (e.g. the transcription factor).
- the polypeptide-of-interest e.g. the transcription factor
- the polypeptide is provided in a formulation suitable for cell penetration that enhances intracellular delivery of the polypeptide as further described hereinbelow.
- CPPs Cell-Penetrating Peptides
- CPPs are short peptides ( ⁇ 40 amino acids), with the ability to gain access to the interior of almost any cell. They are highly cationic and usually rich in arginine and lysine amino acids. They have the exceptional property of carrying into the cells a wide variety of covalently and noncovalently conjugated cargoes such as proteins, oligonucleotides, and even 200 nm liposomes. Therefore, according to additional exemplary embodiment CPPs can be used to transport the polynucleotide or polypeptide to the interior of cells.
- TAT transcription activator from HIV-1
- pAntp also named penetratin, Drosophila antennapedia homeodomain transcription factor
- VP22 from Herpes Simplex virus
- Protocols for producing CPPs-cargos conjugates and for infecting cells with such conjugates can be found, for example L Theodore et al. [The Journal of Neuroscience, (1995) 15(11): 7158-7167], Fawell S, et al. [Proc Natl Acad Sci USA, (1994) 91:664-668], and Jing Bian et al. [Circulation Research. (2007) 100: 1626-1633].
- the expression level and/or activity level of the exogenous polynucleotide and/or polypeptide expressed in the cells of some embodiments of the invention can be determined using methods known in the arts, e.g but not limited to Northern blot analysis, PCR analysis, Western blot analysis, Immunohistochemistry, and Fluorescence activated cell sorting (FACS).
- methods known in the arts e.g but not limited to Northern blot analysis, PCR analysis, Western blot analysis, Immunohistochemistry, and Fluorescence activated cell sorting (FACS).
- Constants which allow generation of an iTSC from said cell refer to those conditions which are directly correlated with the de-differentiation/re-programming of the cells and maintenance of the TSC phenotype for at least 20 passages. These conditions may comprise culturing time, medium composition and expression of an exogenous transcription factor.
- the conditions are such that expressing is transient.
- the iTSC does not comprise the exogenous transcription factor as determined by PCR, western blot and/or flow cytometry.
- the conditions are such that expressing is for at least 5 days, 10 days, at least 15 days, at least 20 days, at least 25 days or at least 30 days following introducing of the exogenous transcription factor into the cell.
- the conditions are such that expressing is for at least 10 days following introducing the exogenous transcription factor into the cell.
- the conditions are such that expressing is for no more than 15 days, no more than 20 days, no more than 25 days, no more than 30 days, or no more than 40 days following introducing of the exogenous transcription factor into the cell.
- the conditions are such that expressing is for no more than 30 days following introducing the exogenous transcription factor into the cell.
- the conditions are such that the reprogramming is performed in the absence of eggs, embryos, embryonic stem cells (ESCs) or iPSCs. Thus any of these components are missing from the culture system.
- the conditions comprise a culture medium comprising FGF4 and heparin, as further described hereinbelow.
- the method comprising isolating the iTSC.
- isolating cells are well known in the art and include mechanical and marker based techniques.
- Non-limiting examples of isolating techniques include cell sorting of cells via fluorescence activated cell sorter (FACS), magnetic separation using magnetically-labeled antibodies and magnetic separation columns (e.g. MACS, Miltenyi) and manual picking under the microscope.
- FACS fluorescence activated cell sorter
- MACS magnetic separation using magnetically-labeled antibodies and magnetic separation columns
- manual picking under the microscope e.g. MACS, Miltenyi
- cell isolation is effected by picking the iTSC colonies under the binocular/microscope followed by trypsinization and culturing in a plate containing feeder cells.
- the isolation process yields a population comprising at least about 10%, at least about 12%, at least about 14%, at least about 16%, at least about 18%, at least about 20%, at least about 22%, at least about 24%, at least about 26%, at least about 28%, at least about 30%, at least about 32%, at least about 34%, at least about 36%, at least about 38%, at least about 40%, at least about 42%, at least about 44%, at least about 46%, at least about 48%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, e.g., 100% of the iTSCs of some embodiments of the invention.
- the method is effected ex-vivo or in-vitro.
- the present invention further contemplates a method of discovering at least one gene (e.g. transcription factor) that, when introduced into a cell, can reprogram the cell into trophoblast stem cell-like cells (iTSCs) the method comprising:
- stable refers to an iTSC maintaining the differentiation level of a TSC for e.g. at least 20 passages in culture optionally without expressing the introduced candidate gene.
- iTSCs of the present invention are generated by expressing the at least one transcription factor in a cell; according to another aspect of the present invention, there is provided an isolated cell expressing at least two exogenous transcription factors selected from the group consisting of Gata3, Eomes and Tfap2c.
- an isolated cell expressing exogenous Gata3, Eomes and Tfap2c transcription factors.
- the isolated cell further expresses an exogenous c-Myc transcription factor.
- the isolated cell expresses at least one, at least two, at least three, at least 4, at least 5, at least 6, at least 7, or at least 8 additional transcription factors.
- the additional transcriptional factors may be selected from the group consisting of Tead4, Handl, Dppal, Ets2, Elf5, Cdx2, Utfl and Esrrb.
- the isolated cell further expresses at least one exogenous transcription factor selected from the group consisting of Tead4, Ets2 Cdx2 and Elf 5.
- the isolated cell expresses Gata3, Tfap2c, Eomes, Tead4, Ets2, Cdx2, Esrrb and optionally c-Myc exogenous transcription factors.
- the isolated cell expresses Gata3, Tfap2c, Eomes, Esrrb and optionally c-Myc exogenous transcription factors.
- the isolated cell expresses Gata3, Tfap2c, Eomes, Tead4, Ets2, Cdx2, Elf5 and optionally c-Myc exogenous transcription factors.
- the isolated cell expresses Gata3, Tfap2c, Eomes, Tead4, Ets2 and optionally c-Myc exogenous transcription factors.
- the isolated cell expresses Gata3, Tfap2c, Eomes, Tead4 and optionally c-Myc exogenous transcription factors.
- the isolated cell expresses Gata3,
- the isolated cell comprises a DNA molecule encoding said at least one transcription factor.
- Methods of evaluating the presence of an exogenous DNA molecule include, but are not limited to, DNA sequencing, Southern blotting, FISH and PCR.
- the isolated cell comprises a RNA molecule encoding said at least one transcription factor.
- Methods of evaluating the presence of an exogenous RNA molecule include, but are not limited to, RNA sequencing, Northern blotting and PCR.
- the isolated cell comprises a protein molecule of said at least one transcription factor.
- Methods of evaluating the presence of an exogenous protein molecule include, but are not limited to western blot, immunoprecipitation, immunocytochemistry and flow cytometry.
- the isolated cell is de-differentiated from a somatic cell. At times such cell may still comprise markers of origin i.e., of the source somatic cell.
- the cells are cultured in a medium and being serially passaged.
- a cell culture comprising the isolated cell of the invention and a culture medium.
- a cell culture comprising the isolated iTSC and a culture medium.
- the culture comprises a feeder cell layer such as, but not limited to, mouse embryonic feeder (MEF) cells, human embryonic fibroblasts or adult fallopian epithelial cells and human foreskin feeder layer.
- a feeder cell layer such as, but not limited to, mouse embryonic feeder (MEF) cells, human embryonic fibroblasts or adult fallopian epithelial cells and human foreskin feeder layer.
- MEF mouse embryonic feeder
- human embryonic fibroblasts or adult fallopian epithelial cells and human foreskin feeder layer.
- feeder cell layers secrete factors needed for stem cell proliferation, while at the same time, inhibit their differentiation.
- the cell culture can be maintained in vitro, under culturing conditions, in which the cells are being passaged for extended periods of time (e.g., for at least 20 passages, e.g., at least about 30, 40, 50, 60, 70, 80, 90, 100 passages or more), while maintaining the cell differentiation level (i.e. their TSC undifferentiated state).
- extended periods of time e.g., for at least 20 passages, e.g., at least about 30, 40, 50, 60, 70, 80, 90, 100 passages or more
- the cell differentiation level i.e. their TSC undifferentiated state
- culturing the cell involves replacing the culture medium with a "fresh" medium (of identical composition) every 24-72 hours, and passaging each culture dish (e.g., a plate) every once - three times a week days.
- the culture dishes are washed [e.g., with phosphate buffered saline (PBS)] and the cells are subjected to enzymatic dissociation from the culture dish, e.g., using trypsinization (0.25 % or 0.05% Trysin + EDTA), e.g., until single cells or cell clumps are separated from each other.
- PBS phosphate buffered saline
- the culture conditions enable maintenance of the iTSC in their undifferentiated state without the need of further exogenous expression of the transcription factors. This is in sharp contrast to all prior attempts to generate iTSC which required exogenous expression of the transcription factors, and which upon withdrawal of these factors could not be maintained in the undifferentiated and pluripotent stem cells.
- cells are further monitored for their differentiation state.
- Cell differentiation can be determined by evaluating cell morphology, or by examination of cell or tissue- specific markers which are known to be indicative of differentiation.
- undifferentiated iTSC may express the TSC specific markers Elf5, Cdx2, Esrrb, Utfl, Tead4 and Handl, Tfap2c, Ets2, Eomes, and Sox2.
- differentiated cells express other specific markers, thus for example fibroblast specific markers include Thyl, Col5a2 and Postn; cardiomyocytes specific markers include Troponin2.
- Tissue/cell specific markers can be detected using immunological techniques well known in the art [Thomson JA et al., (1998). Science 282: 1145-7]. Examples include, but are not limited to, flow cytometry for membrane -bound markers and also for intracellular markers, immunohistochemistry for extracellular and intracellular markers and enzymatic immunoassay, for secreted molecular markers.
- Methods useful for monitoring the expression level of specific genes include RT-PCR, semi-quantitative RT-PCR, Northern blot, RNA in situ hybridization, Western blot analysis and immunohistochemistry.
- Determination of iTSC undifferentiated state can also be effected by evaluating their differentiating potential both in-vitro and in-vivo by methods well known in the art such as disclosed in the materials and methods of the Examples section that follows, and include growing the cells in specified differentiation culture medium, and formation of a trophoblastic hemorrhagic lesion, localization to the extraembryonic region of the Blastocyst or localization to the placenta of the developing embryo, as shown in the Examples section which follows.
- the iTSC are often also being monitored for genomic stability, transcriptome, methylation pattern and H2A.X deposition by methods well known in the art, such as disclosed for examples in the Examples section which follows; and compared to the corresponding species.
- the phrase "culture medium" refers to a solid or a liquid substance used to support the growth of cell.
- the culture medium is a liquid medium.
- the culture medium is capable of maintaining the iTSC in their differentiation state (i.e. an undifferentiated state).
- the culture medium is capable of maintaining the iTSCs in their differentiation level for at least 20 passages, e.g., at least about 30, 40, 50, 60, 70, 80, 90, 100 passages or more.
- the culture medium is capable of maintaining the iTSCs in their differentiation level for at least 20 passages.
- the culture medium used by the present invention can be a water-based medium which includes a combination of substances such as salts, nutrients, minerals, vitamins, amino acids, nucleic acids, proteins such as cytokines, growth factors and hormones, all of which are needed for cell proliferation and are capable of maintaining the stem cells in an undifferentiated state.
- a culture medium can be a synthetic tissue culture medium such as RPMI (Gibco-Invitrogen Corporation products, Grand Island, NY, USA), Ko-DMEM (Gibco-Invitrogen Corporation products, Grand Island, NY, USA), DMEM/F12 (Gibco-Invitrogen Corporation products, Grand Island, NY, USA), or DMEM/F12 (Biological Industries, Biet Haemek, Israel), supplemented with the necessary additives as is further described hereinunder.
- all ingredients included in the culture medium of the present invention are substantially pure, with a tissue culture grade.
- the culture medium comprises FGF4 and heparin.
- FGF4 refers to a polypeptide encoded by the FGF4 gene.
- the FGF4 the human polypeptide, such as provided in the following GeneBank Number NP_001998 (SEQ ID NO: 174), which is encoded by the nucleic acid set forth by GenBank Accession No. NM_002007 (SEQ ID NO: 175).
- the FGF4 used by the method according to some embodiments of the invention is capable of supporting, along with other factors which are described herein, the undifferentiated growth of iTSC.
- FGF4 can be obtained from various manufacturers such as PeproTech, R&D systems and Life Technologies.
- FGF4 is provided at a concentration range from about 0.5 nanogram per milliliter (ng/ml) to about 1000 ng/ml, e.g., about 1-1000 ng/ml, e.g., about 1-500 ng/ml, e.g., about 1-200 ng/ml, e.g., about 1- 100 ng/ml, e.g., about 1-50 ng/ml, e.g., about 2-50 ng/ml, e.g., about 4-50 ng/ml, e.g., about 5-50 ng/ml, e.g., about 10-50 ng/ml, e.g., about 10-40 ng/ml, e.g., about 10-30 ng/ml, e.g., about 25 ng/ml.
- ng/ml nanogram per milliliter
- heparin refers to a glycosaminoglycan with anticoagulant properties, CAS No. 9005-49-6. According to a specific embodiment, the heparin used by the method according to some embodiments of the invention is capable of supporting, along with other factors which are described herein, the undifferentiated growth of iTSC. Heparin can be obtained from various manufacturers such as Sigma- Aldrich, Baxter and Pharma Action.
- heparin is provided at a concentration range from about 0.1 microgram per milliliter ⁇ g/ml) to about 100 ⁇ g/ml, e.g., about 0.1-500 ⁇ g/ml, e.g., about 0.1-200 ⁇ g/ml, e.g., about 0.1-100 ⁇ g/ml, e.g., about 0.1-50 ⁇ g/ml, e.g. about 0.5-50 ⁇ g/ml, e.g., about 0.5-20 ⁇ g/ml, e.g., about 0.5-10 ⁇ g/ml, e.g., about 0.5-10 ⁇ g/ml.
- the culture medium further comprising at least one additional agent selected from the group consisting of 2i inhibitors (MEK inhibitor PD 0325901 and GSK3 inhibitor CHIR 99021), activin, fgf2, and Tgfbl.
- 2i inhibitors MEK inhibitor PD 0325901 and GSK3 inhibitor CHIR 99021
- activin fgf2, and Tgfbl.
- the culture medium comprises a conditioned medium.
- a conditioned medium is the growth medium of a monolayer cell culture (i.e., feeder cells) present following a certain culturing period.
- the conditioned medium includes growth factors and cytokines secreted by the monolayer cells in the culture.
- the culture medium is devoid of conditioned medium.
- the culture medium is devoid of serum, e.g., devoid of any animal serum.
- the culture medium is devoid of any animal contaminants, i.e., animal cells, fluid or pathogens (e.g., viruses infecting animal cells), e.g., being xeno-free.
- animal contaminants i.e., animal cells, fluid or pathogens (e.g., viruses infecting animal cells), e.g., being xeno-free.
- the culture medium is devoid of human derived serum.
- the culture medium further comprises serum replacement, such as but not limited to, KNOCKOUTTM Serum Replacement (Gibco-Invitrogen Corporation, Grand Island, NY USA), ALBUMAX®II (Gibco®; Life Technologies - Invitrogen, Catalogue No. 11021-029;
- serum replacement such as but not limited to, KNOCKOUTTM Serum Replacement (Gibco-Invitrogen Corporation, Grand Island, NY USA), ALBUMAX®II (Gibco®; Life Technologies - Invitrogen, Catalogue No. 11021-029;
- Lipid-rich bovine serum albumin for cell culture or a chemically defined lipid concentrate (Gibco®; Invitrogen, Life Technologies - Invitrogen, Catalogue No. 11905-031).
- the culture medium is devoid of serum replacement.
- the culture medium can further include antibiotics (e.g., PEN-STREP), L-glutamine, NEAA (non-essential amino acids).
- antibiotics e.g., PEN-STREP
- L-glutamine e.g., L-glutamine
- NEAA non-essential amino acids
- the medium comprises RPMI, 20 % FBS, Glutamine, pyruvate, 25 ng/ml Fgf4 and lmg/ml Heparin.
- the primary cultures of the isolated cells and/or the iTSC of the invention can be used to generate cell lines and/or iTSC lines which are capable of unlimited expansion in culture.
- Cell lines of some embodiments of the invention can be produced by immortalizing the isolated cell and/or iTSCs by methods known in the art, including, for example, expressing a telomerase gene in the cells (Wei, W. et al., 2003. Mol Cell Biol. 23: 2859-2870) or co-culturing the cells with NIH 3T3 hph-HOXl l retroviral producer cells (Hawley, R.G. et al., 1994. Oncogene 9: 1-12).
- a method of generating differentiated cells comprising subjecting the iTSC of some embodiments of the invention to differentiating conditions, thereby generating the differentiated cells.
- Methods of differentiating iTSC into a particular cell type are known in the art and the present invention contemplates all such methods such as disclosed e.g. in Kidder (2014) Methods Mol Biol. 1150:201-12; Lei et al. Placenta. 2007 Jan;28(l): 14-21; Chen et al. (2013) Biochemical and biophysical research communications 431, 197-202; and Genbacev et al.
- the method may involve genetic modification of the cells and/or culturing of the cells in media comprising differentiating factors. It will be appreciated that the re-differentiating stage may result in the generation of fully differentiated cells or partially differentiated cells along a particular lineage.
- the iTSC of some embodiments of the invention can be used to isolate lineage specific cells.
- the phrase "isolating lineage specific cells” refers to the enrichment of a mixed population of cells in a culture with cells predominantly displaying at least one characteristic associated with a specific lineage phenotype.
- an iTSC can be differentiated into any of the trophoblast cell lineages.
- Lineage specific cells can be obtained by directly inducing the expanded, undifferentiated iTSC to culturing conditions suitable for the differentiation of specific cell lineage by methods well known in the art.
- the culturing conditions suitable for the differentiation and expansion of the isolated lineage specific cells include various tissue culture medium, growth factors, antibiotic, amino acids and the like and it is within the capability of one skilled in the art to determine which conditions should be applied in order to expand and differentiate particular cell types and/or cell lineages.
- the invention contemplates the use of cells, tissues and organs generated from the iTSC of the invention using any differentiation protocol known in the art.
- the isolated cells and constructs of the present invention may be further used for disease modeling, drug screening, and patient-specific cell-based therapy.
- an isolated placenta or a blastocyst comprising the iTSC or the construct of the present invention.
- a method of augmenting a placenta or a blastocyts comprising introducing into a placenta or a developing embryo the iTSC or the construct of the invention.
- developing embryo refers to an embryo at any stage of development and includes an embryo at a 4-cell stage, 8- cell stage, 16- cell stage embryo, early morula, late morula, early blastocyst, and/or a late blastocyst.
- introducing the cells is performed in vitro or ex vivo via direct injection or aggregation with the developing host placenta or embryo.
- the iTCS and iTSC-derived cell preparations and the chimeric placentas may be used to prepare model systems for disorders associated with development and/or activity of trophoblasts, to screen for genes expressed in or essential for trophoblast differentiation and/or activity, to screen for agents or conditions (such as culture conditions or manipulation) that effect trophoblast differentiation and/or activity, to produce trophoblast specific growth factors and hormones and as a cell therapy for disorders associated with development and/or activity of trophoblasts. Consequently, the cell preparations and the chimeric placentas may be used to screen for potential agents that modulate trophoblast development or activity e.g. invasion or proliferation.
- a method of identifying an agent capable of modulating trophoblast development and/or activity comprising:
- an effect of said agent on said development and/or activity of said isolated iTSC or said isolated placenta above a predetermined level relative to said development and/or activity of said isolated iTSC or said isolated placenta without said agent is indicative that said drug modulates trophoblast development and/or activity.
- modulating refers to altering trophoblast development and/or activity either by inhibiting or by promoting.
- modulating is inhibiting development and/or activity.
- modulating is promoting development and/or activity.
- the effect of the candidate agent on trophoblast development and/or activity is generally expressed in comparison to the development and/or activity in a cell of the same species but not contacted with the candidate agent or contacted with a vehicle control, also referred to as control.
- an effect above a predetermined threshold refers to a change in trophoblast development and/or activity following contacting with the compound which is higher than a predetermined threshold such as a about 10 %, e.g., higher than about 20 %, e.g., higher than about 30 %, e.g., higher than about 40 %, e.g., higher than about 50 %, e.g., higher than about 60 %, higher than about 70 %, higher than about 80 %, higher than about 90 %, higher than about 2 times, higher than about three times, higher than about four time, higher than about five times, higher than about six times, higher than about seven times, higher than about eight times, higher than about nine times, higher than about 20 times, higher than about 50 times, higher than about 100 times, higher than about 200 times, higher than about 350, higher than about 500 times, higher than about 1000 times, or more relative to the level of expression prior to contacting with the compound.
- a predetermined threshold such as a about 10 %
- the candidate agent may be any compound including, but not limited to a chemical, a small molecule, a polypeptide and a polynucleotide.
- the cell preparations and the chimeric placentas derived from mutant animals can also be used to identify genes and substances that are important for the trophoblast development and/or activity.
- the isolated iTSC can also be modified by introducing mutations into genes in the cells or by introducing transgenes into the cells.
- the selected agents may be further used to treat various conditions requiring regulation of trophoblast development or activity such as the conditions described below.
- FGR fetal growth restriction
- a method of treating and/or preventing a disorder associated with development and/or activity of trophoblasts in a subject in need thereof comprising administering to the subject a therapeutically effective amount of the iTSC or the construct, thereby treating and/or preventing the disorder associated with development and/or activity of trophoblasts in the subject.
- treating refers to inhibiting, preventing or arresting the development of a pathology (e.g. recurrent miscarriage) and/or causing the reduction, remission, or regression of a pathology.
- a pathology e.g. recurrent miscarriage
- various methodologies and assays can be used to assess the development of a pathology, and similarly, various methodologies and assays may be used to assess the reduction, remission or regression of a pathology.
- subject in need thereof refers to a mammalian subject (e.g., human being) who is diagnosed with the pathology. In a specific embodiment, this term encompasses individuals who are at risk to develop the pathology.
- Veterinary uses are also contemplated.
- the subject may be of any gender or at any age including neonatal, infant, juvenile, adolescent, adult and elderly adult. According to specific embodiments, the subject is a female.
- This aspect of the present invention contemplated treating a disorder associated with development and/or activity of trophoblasts.
- the disease is selected from the group consisting of recurrent miscarriage, Preeclampsia, Fetal Growth Restriction (FGR), hydatiform mole and choriocarcinoma.
- a method of obtaining a compound produced by a trophoblast comprising culturing the isolated iTSC or the iTCS cell culture of the present invention and isolating from the culture medium a compound secreted by the cells, thereby obtaining the compound produced by the trophoblast.
- the compound is a growth factor or a hormone, such as but not limited to human Chorionic Gonadotropin (hCG).
- hCG human Chorionic Gonadotropin
- the cells or the nucleic acids of the present invention may be transplanted to a subject per se, or in a pharmaceutical composition where they are mixed with suitable carriers or excipients.
- the constructs of the present invention may be administered to a subject per se, or in a pharmaceutical composition.
- a "pharmaceutical composition” refers to a preparation of one or more of the active ingredients described herein with other chemical components such as physiologically suitable carriers and excipients.
- the purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism.
- active ingredient refers to the redifferentiated pancreatic cells of the present invention accountable for the biological effect.
- physiologically acceptable carrier and “pharmaceutically acceptable carrier” which may be interchangeably used refer to a carrier or a diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound.
- excipient refers to an inert substance added to a pharmaceutical composition to further facilitate administration of an active ingredient. Examples, without limitation, of excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols.
- compositions of the present invention may be manufactured by processes well known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.
- compositions for use in accordance with the present invention thus may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into preparations which, can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.
- the active ingredients of the pharmaceutical composition may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological salt buffer.
- the pharmaceutical composition is administered in a local rather than systemic manner, for example, via injection of the pharmaceutical composition directly into a tissue region of a patient.
- compositions described herein may be formulated for parenteral administration, e.g., by bolus injection or continuous infusion.
- Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multidose containers with optionally, an added preservative.
- the compositions may be suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
- compositions for parenteral administration include aqueous solutions of the active preparation in water-soluble form. Additionally, suspensions of the active ingredients may be prepared as appropriate oily or water based injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acids esters such as ethyl oleate, triglycerides or liposomes. Aqueous injection suspensions may contain substances, which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the active ingredients to allow for the preparation of highly concentrated solutions.
- compositions suitable for use in context of the present invention include compositions wherein the active ingredients are contained in an amount effective to achieve the intended purpose. More specifically, a therapeutically effective amount means an amount of active ingredients (insulin producing cells) effective to prevent, alleviate or ameliorate symptoms of a disorder (e.g., diabetes) or prolong the survival of the subject being treated.
- active ingredients insulin producing cells
- the therapeutically effective amount or dose can be estimated from animal models (e.g. STZ diabetic mice) to achieve a desired concentration or titer. Such information can be used to more accurately determine useful doses in humans.
- animal models e.g. STZ diabetic mice
- Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in experimental animals.
- the data obtained from these animal studies can be used in formulating a range of dosage for use in human.
- the dosage may vary depending upon the dosage form employed and the route of administration utilized.
- the exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See e.g., Fingl, et al., 1975, in "The Pharmacological Basis of Therapeutics", Ch. 1 p. l).
- Dosage amount and interval may be adjusted individually to provide cell numbers sufficient to induce normoglycemia (minimal effective concentration, MEC).
- MEC minimum effective concentration
- the MEC will vary for each preparation, but can be estimated from in vitro data. Dosages necessary to achieve the MEC will depend on individual characteristics and route of administration. Detection assays can be used to determine plasma concentrations of C peptide and/or insulin.
- compositions of the present invention may, if desired, be presented in a pack or dispenser device, such as an FDA approved kit, which may contain one or more unit dosage forms containing the active ingredient.
- the pack may, for example, comprise metal or plastic foil, such as a blister pack.
- the pack or dispenser advice may be a syringe. The syringe may be prepacked with the cells.
- the pack or dispenser device may be accompanied by instructions for administration.
- the pack or dispenser may also be accommodated by a notice associated with the container in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the compositions or human or veterinary administration.
- a notice associated with the container in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the compositions or human or veterinary administration.
- Such notice for example, may be of labeling approved by the U.S. Food and Drug Administration for prescription drugs or of an approved product insert.
- Compositions comprising a preparation of the invention formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition, as if further detailed above.
- the present teachings are directed to a knock in reporter system that can be used to capture a reprogrammable iTSC or iPSC early in the conversion process as according to the following aspect.
- nucleic acid construct or system comprising at least one polynucleotide comprising:
- a nucleic acid sequence encoding a first reporter polypeptide and a regulatory element for directing expression of said first reporter polypeptide, said regulatory element being under the control of a first early predictive marker of an induced trophoblast stem cell (iTSC) and/or induced pluripotent stem cells (iPSC);
- iTSC induced trophoblast stem cell
- iPSC induced pluripotent stem cells
- nucleic acid sequence encoding a second reporter polypeptide and a regulatory element for directing expression of said second reporter polypeptide, said regulatory element being under the control of a second early predictive marker of an iTSC and/or iPSC;
- the construct comprising a nucleic acid sequence encoding a forth reporter polypeptide and a regulatory element for directing expression of said forth reporter polypeptide, said regulatory element being under the control of a late predictive marker of an iTSC or iPSC, wherein said first reporter polypeptide, said second reporter polypeptide, said third reporter polypeptide and said forth reporter polypeptide are distinguishable.
- the regulatory element of said third reporter polypeptide is under the control of a late predictive marker of an iTSC and said regulatory element of said forth reporter polypeptide is under the control of a late predictive marker of an iPSC.
- the reporter polypeptide comprises a detectable moiety.
- detectable moieties can be used in the present invention such as, but not limited, to those disclosed in Example 4 of the Examples section which follows.
- the detectable moiety is a translational product. These include, but not are limited to, a phosphorescent chemical, a hemiluminescent chemical such as luciferase and galactosidase, a fluorescent chemical (fluorophore) such as GFP, an enzyme, a fluorescent polypeptide, an affinity tag, and molecules (contrast agents) detectable by Positron Emission Tomagraphy (PET) or Magnetic Resonance Imaging (MRI).
- PET Positron Emission Tomagraphy
- MRI Magnetic Resonance Imaging
- Fluorescence detection methods which can be used to detect the expression of a fluorescent reporter polypeptide include, for example, fluorescent plate reader, fluorescence activated flow cytometry (FACS), immunofluorescence confocal microscopy, fluorescence in-situ hybridization (FISH) and fluorescence resonance energy transfer (FRET).
- fluorescent plate reader fluorescence activated flow cytometry
- FISH fluorescence in-situ hybridization
- FRET fluorescence resonance energy transfer
- Non limiting example of a chemiluminescent chemical is luciferase.
- Chemiluminescent detection methods which can be used to detect the expression of a chemiluminescent moiety include, for example, luminescence plate reader.
- Detection of the detectable moiety can be effected by methods and apparatuses well known in the art including, but not limited to flow cytometer, fluorescent plate reader and luminescence plate reader.
- Methods of designing and integrating the reporter polypeptide and a regulatory element for specific predictive marker are known in the art and include those described for example in Example 4 of the Example section which follows and targeted homologous recombination (e.g. "Hit and run", “double-replacement"), site specific recombinases (e.g. the Cre recombinase and the Flp recombinase), PB transposases (e.g.
- RNA editing by engineered nucleases (e.g. meganucleases, Zinc finger nucleases (ZFNs), transcription-activator like effector nucleases (TALENs) and CRISPR/Cas system) and genome editing using recombinant adeno-associated virus (rAAV) platform.
- engineered nucleases e.g. meganucleases, Zinc finger nucleases (ZFNs), transcription-activator like effector nucleases (TALENs) and CRISPR/Cas system
- rAAV recombinant adeno-associated virus
- Expression of the reporter polypeptide is under the control of a predictive marker (e.g. early predictive marker of an iTSC and/or iPSC, late iTSC predictive marker or late iPSC predictive marker).
- a predictive marker e.g. early predictive marker of an iTSC and/or iPSC, late iTSC predictive marker or late iPSC predictive marker.
- the late predictive marker is an iTSC late predictive marker.
- the iTSC late predictive marker is Elf 5.
- the late predictive marker is an iPSC late predictive marker.
- the iPSC late predictive marker is Nanog.
- the early predictive markers are Utfl and
- an isolated cell comprising the construct encoding the reporter polypeptide of some embodiments of the invention.
- the present invention also contemplates a transgenic animal comprising the isolated cell of this aspect of the present invention.
- the transgenic animal is a primate.
- the transgenic animal is not human.
- the transgenic animal is a rodent.
- the cells containing the knock in reporter system can be used to capture a reprogrammable iTSC or iPSC early in the conversion process.
- a method of identifying a reprogrammable iTSC or iPSC comprising:
- iPSCs induced pluripotent stem cells
- induced pluripotent stem cells refers to cells obtained by de-differentiation of cells which are endowed with pluripotency (i.e., being capable of differentiating into the three embryonic germ cell layers, i.e., endoderm, ectoderm and mesoderm).
- pluripotency i.e., being capable of differentiating into the three embryonic germ cell layers, i.e., endoderm, ectoderm and mesoderm.
- a differentiated tissue e.g., a somatic cell such as a fibroblast
- Generation of the iPSC can be combined with any method known in the art for generating an iPSC such as described for example in Yamanaka S, Cell Stem Cell. 2007, l(l):39-49; Aoi T, et al., Generation of Pluripotent Stem Cells from Adult Mouse Liver and Stomach Cells. Science. 2008; IH Park, Zhao R, West JA, et al. Reprogramming of human somatic cells to pluripotency with defined factors. Nature 2008;451: 141-146; K Takahashi, Tanabe K, Ohnuki M, et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors.
- somatic cells include genetic manipulation of e.g. somatic cells, e.g., by retroviral transduction of e.g. somatic cells such as fibroblasts, hepatocytes, gastric epithelial cells with transcription factors such as Oct-3/4, Sox2, c- Myc, and KLF4.
- somatic cells e.g., by retroviral transduction of e.g. somatic cells such as fibroblasts, hepatocytes, gastric epithelial cells with transcription factors such as Oct-3/4, Sox2, c- Myc, and KLF4.
- the method comprising introducing at least two and preferably at least three genes.
- the method comprising introducing at least four genes.
- the method comprising introducing at least five genes.
- the at least two, at least three, at least four at least 5 at least 6 at least 7 or at least 8 genes are introduced to the somatic cell.
- the at least one introduced gene, sequence coding for gene product or protein product of the gene is a transcription factor.
- the transcription factor is a key master regulator being a transcription factor that is part of the core circuitry of the cells.
- the at least one introduced gene is discovered by: a) Cloning key master regulators (factors that contains large number of target genes) into delivery vehicles, preferably viruses,
- the introduced gene is discovered by the methods described in the Examples section which follows.
- the gene is selected from the group consisting of: Tfap2c, Tead4, Handl, Dppal, Gata3, Ets2, Elf5, Cdx2, Eomes, Myc, Utfl and Esrrb
- the gene is selected from the group consisting of Gata3, Tfap2c, Eomes, Tead4, Ets2, Cdx2 Esrrb, Myc.
- the introduced genes are at least one, at least two, at least three, at least four or all five of the genes selected from the group consisting of Gata3, Eomes, Tfap2c, Myc and Esrrb.
- the gene is selected from the group consisting of: Gata3, Tfap2c, Eomes, Myc and Esrrb.
- the gene is selected from the group consisting of Gata3, Tfap2c, Eomes and Myc.
- the gene is selected from the group consisting of Gata3, Tfap2c, Eomes.
- a method of improving the quality of iPSCs comprising introducing to the somatic cells to be reprogrammed to form iPSC, genes validated (e.g. by the prior art) for reprogramming somatic cells into iPSC, and in addition at least one, at least two, at least three preferably all fours of genes selected from the group consisting of Gata3, Eomes, Tfap2c.
- the improvement in the quality is evident by shortening of times until the iPSCs form colonies.
- the genes validating for reprogramming somatic cells to iPSC are Oct4, sox2, Klf4, Myc, Gata3, Tfap2c and Eomes.
- n genes validated already by research for reprogramming somatic cells to iPSC are Oct4, sox2, Klf4, Myc, Gata3, Tfap2c and Eomes.
- the somatic cell is a human cell.
- the somatic cell is selected from the group consisting of fibroblasts, blood cells (B -cells, T-cells Macrophage etc), keratinocytes, an epithelial cells e.g., a cell isolated from the oral cavity or a cell isolated from placenta.
- the introduction occurs by any viral vector, preferably by a viral vector selected from the group consisting of lenti, Adeno, Retro, episome,; by directed insertion of naked RNA, DNA or the protein product of the gene.
- the reprogramming is performed in the absence of eggs, embryos, embryonic stem (ES) cells or induced pluripotent stem cells (iPSCs).
- ES embryonic stem
- iPSCs induced pluripotent stem cells
- the medium comprises DMEM, 15% FBS, Glutamine, non essential amino acid, b-mercapto and LiF with or without the naive ground state inhibitors 2i condition (GSK3B inhibitor and MEK inhibitor).
- Protocols for insertions, cells to be used, selection, growing medium and the like can be found in WO2013159103 inserted herein in its entirety by reference.
- compositions, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.
- a compound or “at least one compound” may include a plurality of compounds, including mixtures thereof.
- various embodiments of this invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range.
- method refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.
- sequences that substantially correspond to its complementary sequence as including minor sequence variations, resulting from, e.g., sequencing errors, cloning errors, or other alterations resulting in base substitution, base deletion or base addition, provided that the frequency of such variations is less than 1 in 50 nucleotides, alternatively, less than 1 in 100 nucleotides, alternatively, less than 1 in 200 nucleotides, alternatively, less than 1 in 500 nucleotides, alternatively, less than 1 in 1000 nucleotides, alternatively, less than 1 in 5,000 nucleotides, alternatively, less than 1 in 10,000 nucleotides.
- MEFs Mouse embryonic fibroblasts
- TTFs tail tip fibroblasts
- Embryonic stem cells and induced pluripotent stem cells (iPSCs, generated by the OSKM factors) were grown in DMEM supplemented with 10 % fetal bovine serum, 1 % non-essential amino acids, 2 mM L-Glutamine, 2X10 6 units mLif, 0.1 mM ⁇ -mercaptoethanol (Sigma) and antibiotics with or without 2i-PD0325901 (PD, 1 ⁇ ), CHIR99021 (CH, 3 ⁇ ).
- Blastocyst-derived TSC lines were isolated as described by Oda et al. (Methods Enzymol (2006) 419, 387-400). All cells were maintained in a humidified incubator at
- MEFs were isolated from 13.5 days post coitum (dpc) embryos that were generated by three different crosses: (1) M2rtTA mouse X Oct4-GFP mouse (2) M2rtTA mouse X Sox2-GFP mouse (3) M2rtTA mouse X Nanog-GFP mouse. All infections were performed on MEFs (passage 0) that were seeded at 70 % confluency two days before the first infection. Blastocyst-derived TSC lines were isolated as described (Oda et al., 2006).
- TSCs and iTSCs were grown in a combined medium containing 30 % RPMI and 70 % conditioned media (CM) supplemented with 20 % FBS, 1 % non-essential amino acids, 2 mM L-Glutamine, 25 ng / ml human recombinant FGF4 (PeproTech) and 1 ⁇ g / ml heparin (Sigma- Aldrich).
- CM conditioned media
- iTSC For culture in defined medium, cells were grown on Matrigel-coated dishes in TX medium as described previously (Kubaczka et al., 2014). Identified iTSC colonies were picked under the binocular, trypsinized and cultured in one well of 6-well plate containing feeder cell layer. For differentiation experiments, medium without CM, FGF4, heparin and TGF- ⁇ was used. MEFs were directly converted into cardio myocytes as previously reported (Efe et al., 2011). Beating colonies were visualized under an inverted microscope.
- Molecular cloning and lentiviral infection - Dox-inducible embryonic trophoblast stem cell factors were generated by cloning the open reading frame of the factors, obtained by reverse transcription with specific primers (see Table 1 below), into the TOPO-TA vector (Invitrogen), and then restricted with EcoRI or Mfel and inserted into the FUW-teto expressing vector (Addgene).
- Replication-incompetent lentiviruses containing the embryonic trophoblast stem cell factors were packaged in 293T cells and collected 48, 60 and 72 hr after transfection. The supernatants were filtered through a 0.22 ⁇ filter, supplemented with 2 ⁇ g / ml of polybrene (Sigma) and then used to infect MEFs or TTFs.
- Reprogramming in the present of JAKI - MEFs were infected with dox-inducible GETM lenti- viral vectors.
- the infected MEFs were cultured in TSC reprogramming medium containing dox (2 ⁇ g / ml) and JAKi (5 ⁇ ).
- dox was removed from the medium.
- JAKi was removed as well to allow proper stabilization of iTSC colonies.
- Ten days after dox removal i.e., 7 days after JAKi removal
- stable iTSC colonies were isolated and cultured on feeder cells.
- Sox2- GFP/Oct4 lox/lox MEFs were infected with dox-inducible GETM or with OS KM in combination with FUW-M2rtTA-2A-puro and FUW-Zeo-Cre or with FUW-Zeo-TetO empty vector.
- MEFs underwent 20 days of dox treatment, followed by 10 days without dox. Puromycin and Zeocin were added during the entire course of the experiment. Clones from all plates were picked on day 30 and genomic DNA was purified.
- Immunocytochemistry - Cells were fixed in 4 % paraformaldehyde in PBS for 20 minutes, rinsed three times with PBS, blocked for 1 hour with PBS containing 0.1 % Triton X-100 and 5 % FBS, and incubated overnight in PBS containing 0.1 % Triton X- 100 and 1 % FBS with one of the following antibodies (1:200 dilution): anti-Esrrb (Perseus Proteomics, #PP-H6705-00), anti-Utfl (Abeam, ab24273), anti-Elf5 (Santa Cruz, SC-9645), anti-Cdx2 (Biogenex, CDX2-88), anti-Tnnt2 (Abeam, ab8295), anti- Krtl8 (Santa Cruz, SC-51582) and Anti-Acta2 (Abeam, ab5694).
- anti-Esrrb Perseus Proteomics, #PP-H6705-00
- Quantitative PCR analysis was performed in duplicates using 1/100 of the reverse transcription reaction in a StepOnePlus (Applied Biosystems) with SYBR green Fast qPCR Mix (Applied Biosystems). Specific primers flanking an intron were designed for the different genes (see Table 1 below).
- RNA sequencing analysis Total RNA was isolated using Rneasy Kit (QIAGEN) and sent to the "Technion Genome Center", Israel, for library preparation and sequencing. The raw and the processed data have assigned a GEO accession number: GSE64684.
- adapter sequences were removed by Trim Galore (version 0.3.7, ://www .bioinformatics.babraham.ac.uk/projects/trim_galore/), using the command "trim_galore -a $adseq -length 15" where $adseq is the appropriate adapter sequence.
- the remaining reads were further filtered to remove very low quality reads, using the fastq_quality_filter program of the FASTX package, with a quality threshold of 20 at 90 percent or more of the read's positions.
- Mus_musculus/Ensembl/GRCm38/Sequence/Bowtie2Index/genome clean.fastq Quantification and normalization were done with the Cufflinks package (v2.2.1). Quantification was done with cuffquant, using the genome bias correction (-b parameter), multi-mapped reads assignment algorithm (-u parameter) and masking for genes of type IG, TR, pseudo, rRNA, tRNA, miRNA, snRNA and snoRNA (-M parameter). Normalization was done with cuffnorm (using output format of Cuffdiff).
- Methylation analysis The bisulfite treatment of genomic DNA was performed using the EZ-DNA methylation Gold kit (Zymo Research) according to the manufacturer's instructions. Primer sequences for Elf5 (Ng et al., 2008) and Nanog (Hattori et al., 2007) were used as previously described. Amplified products were purified using a gel clean-up system (Macherey-Nagel), cloned into the pMini vector (New England Biolabs), and sequenced using pMini forward primers. CpG methylation was analyzed using Sequencer software. For each promoter sequence, ten randomly selected clones were sequenced.
- ChlP-Sequencing and data analysis pipeline for H2A X deposition analysis - Native chromatin immunoprecipitation (N-ChIP) assay was performed as previously described (Xiao et al. 2009). 10 millions of ESCs, MEFs or TSCs were used for each ChIP and massive parallel sequencing (ChlP-Seq) experiment. Cell fractionation and chromatin pellet isolation were performed as described (Xiao et al. 2009). Chromatin pellets were briefly digested with MNase (New England BioLabs) and the mononucleosomes were monitored by electrophoresis. 5 ⁇ g anti-H2A.X antibodies (generated by Xiao lab) were used per ChIP experiment.
- Co-purified DNA molecules were isolated and quantified (100-200 ng for sequencing).
- Co-purified DNA from ChIP and whole cell extraction (WCE) input genomic DNA were subjected to library construction, cluster generation and next-generation sequencing (Illumina HiSeq 2000).
- the output sequencing reads were filtered and pre-analyzed with Illumina standard workflow.
- the qualified tags in fastq format
- these aligned reads were used for peak calling with the RSEG algorithm (0.4.8) (Song and Smith, 2011).
- ChlP-Seq reads of endogenous TSC endo #l (parental cells) were used as baseline for H2A.X deposition to run the RSEG (mode 3). Output results were filtered according to the enrichment scores and domain size (between 5kb to 200kb). Output results were filtered according to the enrichment scores and domain size mentioned above.
- Hemorrhagic lesion formation A total of 5 x 10 6 iTSCs were re-suspended in 100 ⁇ CM containing FGF4 and were injected subcutaneously into male athymic nude mice. 7 days following infection, lesions were dissected, fixed overnight in 4 % paraformaldehyde, embedded in paraffin, and sectioned (4 ⁇ ). Sections were stained with hematoxylin and eosin and analyzed by a certified pathologist.
- Nuclei were washed and re- suspended in isolation buffer supplemented with Hoechst-33258 and PI (10 ⁇ g / ml each). Nuclei were sorted based on low Hoechst (quenching by presence of BrdU in DNA) and PI (Gl phase) fluorescence. For whole-genome sequencing, nuclei from untreated cells were isolated and stained with PI (10 ⁇ g / ml) to sort Gl phase nuclei. All nuclei were sorted into 96-well skirted PCR plates (4Titude) containing 5 ⁇ ⁇ freeze medium (Pro-Freeze CDM Freeze Medium (Lonza) containing 15 % DMSO) using a MoFLo Atrios sorter (Beckman Coulter).
- DNA fragmentation and library construction were performed as previously published (Falconer et al., 2012), with the following modifications. All enzymatic reactions were performed using the Bravo Liquid Handling Platform (Agilent). Reaction volumes were reduced while enzyme and buffer concentrations were kept constant. All DNA purification steps were performed using AMPure XP magnetic beads (Agencourt AMPure, Beckman Coulter). A double purification using a 1.2x volume of beads was performed after adapter ligation and the PCR reactions consisted of 17 cycles. For Strand-seq, nascent DNA strands were nicked using Hoechst + UV treatment prior to PCR.
- Illumina sequencing Libraries were pooled for sequencing and 270- to 320-bp sized fragments were purified using 2 % E-Gel Agarose gels (Invitrogen). DNA quality was assessed and quantified on a High Sensitivity dsDNA kit (Agilent) on the Agilent 2100 Bio-Analyzer and on the Qubit 2.0 Fluorometer (Life Technologies). For sequencing, clusters were generated on the CBot (Illumina) and single-end 50 bp reads were generated using the HiSeq2500 sequencing platform (Illumina).
- Bioinformatics analysis Sequencing reads were demultiplexed and subsequently aligned to the mouse reference genome (assembly GRCm38/mmlO) using Bowtie2 (version 2.0.5, Langmead and Salzberg, 2012). Indexed and aligned bam files were further analyzed as previously described (Falconer et al., 2012) using the BAIT software package (Hills et al., 2013). Sister chromatid exchanges were flagged by the BAIT software and confirmed visually. Aneuploidies were identified as chromosomes showing more than 1.3x (trisomy) or less than 0.7x (monosomy) coverage compared to the average coverage in that single cell library.
- Chimeric embryo or placenta formation - Blastocyst injections were performed using CB6F1 host embryos. After priming with Pregnant mare's serum gonadotropin (PMSG) and Human Chorionic Gonadotropin (hCG) hormones and mating with CB6F1 males, embryos were obtained at 0.5 dpc (1-cell stage) or 3.5 dpc (blastocyst stage). Embryos were cultured in Evolve® KSOMaa (Zenith Biotech, Guilford, CT) until 8-cell stage or blastocysts were formed.
- PMSG Pregnant mare's serum gonadotropin
- hCG Human Chorionic Gonadotropin
- 8-cell stage or blastocysts were injected with ESCs or iTSCs with a flat tip microinjection pipette with an internal diameter of 16 ⁇ (Origio Inc, Charlottesville, VA) in drop of Evolve® w/HEPES KSOMaa (Zenith) medium under mineral oil.
- Each 8-cell stage embryo or blastocyst was injected with 10-20 ESCs or iTSCs.
- blastocysts were transferred to 2.5 dpc pseudopregnant CD1 females (20 blastocysts per female).
- 8-cell stage embryos were grown in Evolve® KSOMaa (Zenith Biotech, Guilford, CT) until the blastocyst stage and then also transferred to 2.5 dpc pseudopregnant CDl females. Chimeric embryos or placentas were isolated at embryonic day (E) 13.5.
- Gapdh F- 5' ACCTGCCAAGTATGATGACATCA 3'
- transgenic F- 5' TGTCCATTCAAGCAGACGAG 3'
- Myc e Table 2 Summary of the various tests and the examined TSC and iTSC clones.
- fibroblasts were converted into induced trophoblast stem cell-like cells (iTSCs), which are the embryonic precursors of the placenta and therefore also have a high therapeutic potential in treating placental dysfunction diseases.
- iTSCs induced trophoblast stem cell-like cells
- transcription factors with a known role in the development of the trophoblast lineage and in reprogramming at large were screened for.
- Tfap2c, Tead4, Handl, Dppal, Gata3, Ets2, Elf5, Cdx2, Eomes, Myc, Utfl and Esrrb were cloned into doxycycline (dox) -inducible lentiviral vectors and then were used to infect mouse embryonic fibroblasts (MEFs) to initiate the conversion process ( Figure 1).
- dox doxycycline
- MEFs mouse embryonic fibroblasts
- the present inventors aimed at narrowing down the number of transcription factors (i.e. transgenes) needed for the conversion process.
- the five 12F-iTSC colonies were analyzed for their transgene integrations by quantitative real time PCR (qRT-PCR) ( Figure 4).
- Factors that are present in all iTSC clones are the most essential ones and considered as "indispensible factors" for the fibroblasts into iTSCs reprogramming process.
- 3 factors, Gata3, Tfap2c and Eomes were present in all clones analyzed.
- Myc was shown to be a global gene amplifier in ESCs, in cancer and during reprogramming (Lin et al., 2012; Nie et al., 2012; Soufi et al., 2012), Myc was added to the reprogramming cocktail to boost the conversion rate. Indeed, ectopic expression of Myc together with the three TSC key factors, Gata3, Eomes and Tfap2c (hereinafter denoted as 4 factors, 4F or GETM), facilitated the reprogramming process ( Figures 5 and 6).
- iTSC clones were also generated from inbred strains such as C57BL/6 ( Figure 12) and adult tail tip fibroblasts (TTFs) expressing the ESC and TSC marker, Sox2 ((Adachi et al., 2013), Figure 13).
- MESENCHYMAL-TO-EPITHELIAL (MET) IS AN EARLY PHENOMENON DURING GENERATION OF iTSCs FROM FIBROBLASTS BY EXTOPIC
- MET Mesenchymal-to-epithelial transition
- EMT epithelial-to-mesenchymal transition
- the levels of upregulated epithelial markers such as Cdhl and Dsp, and downregulated mesenchymal markers such as Foxc2, Fnl, and Mmp3 were similar between ESCs and TSCs
- the expression levels of the epithelial markers, Krtl8 and Ocln, and the mesenchymal markers, Twistl, Zeb2, Cdh2 and Snail were similar between TSCs and induced cells and different from ESCs.
- MET is an early and robust phenomenon occurring during the conversion to iTSCs that cannot serve as a predictive marker for cells destined to become iTSCs and that the ectopic expression of GET or GETM in mesenchymal cells induces epithelial morphology with characteristics resembling blastocyst-derived TSCs.
- RNA-Seq RNA-sequencing
- the transcriptome of the parental MEFs and ESCs were monitored as negative controls.
- the various iTSC clones clustered together with the blastocyst-derived TSC clones and were far away from the MEF and ESC controls, as indicated by hierarchical clustering analysis.
- one of the blastocyts-derived TSC lines, TSC blast #l clustered closer to the three induced TSC clones, 4F-iTSC#l, 3F-iTSC#3, 3F-iTSC#4 than to the other blastocyst-derived TSC line, TSC blast B6 #l ( Figure 20A).
- Single-cell sequencing libraries were made from nine cell lines: ESCs, parental MEFs, three 3F- iTSC clones (3F-iTSC#l, 3F-iTSC#3 and 3F-iTSC B6 #4), two 4F-iTSC clones (4F- iTSC#l and 4F-iTSC#5), and two blastocyst-derived TSC clones (TSC blast#1 , TSC blast" B6#1 ), that were cultured for at least 20 passages.
- SCEs sister chromatid exchanges
- iTSCs exhibit a methylation pattern and H2A.X deposition comparable to blastocyst- derived TSCs
- a high level of nuclear resetting refers to the erasure of all epigenetic marks
- the DNA methylation status of one TSC-specific locus, the Elf5 promoter, and one ESC-specific locus, the Nanog promoter were determined by bisulfite sequencing.
- the genomic DNA of two iTSC clones (3F-iTSC#3 and 4F-iTSC#l), two blastocyst-derived TSC clone (TSC blast #l and TSC blast"B6 #l), the parental MEFs and ESCs were subjected to bisulfite conversion and the specific loci were sequenced.
- H2A.X Genome-wide organization of histone variant H2A.X is cell type-dependent. Abnormal H2A.X deposition is frequently observed in iPSC clones generated by OSKM factors that failed to support "all-iPSC" mice development in tetraploid complementation experiments (Wu et al., 2014). In contrast, iPSCs that are generated with other reprogramming factors, such as, Sall4, Nanog, Esrrb and Lin28 (SNEL), support the development of "all-iPSC” mice and show normal H2A.X deposition (Buganim et al., 2014), suggesting that H2A.X deposition can faithfully predict the quality of the converted cells.
- SNEL reprogramming factor
- H2A.X deposition patterns of the iTSC clones was determined and compared to those of blastocyst-derived TSCs. Specifically, ChlP-seq for H2A.X was effected on two 3F-iTSC clones (3F-iTSC#l and 3F-iTSC B6 #4), two 4F-iTSC clones (4F-iTSC#l and 4F-iTSC#4) and two blastocyst- derived TSC clones (TSC blast #l and TSC blast"B6 #l). The distribution of H2A.X in mESCs and the parental MEFs was monitored as controls.
- HMM Hidden- Markov-Model
- iTSCs have restored key epigenetic landscape signatures of TSCs during the conversion process, as assessed by DNA methylation on specific loci and genome-wide H2A.X reorganization. iTSCs function similarly to blastocyst-derived TSCs
- iTSCs Integrated Cells acquiring a high degree of reprogramming state should exhibit all the functions of their corresponding cells as can be seen in the case of high quality iPSCs and ESCs.
- iTSCs were subjected to three gold-standard TSC tests.
- iTSCs were assessed for multipotency and capability of differentiating into trophoblast lineages represented in the placenta.
- an iTSC clone, 4F- iTSC#5 was cultured on gelatin without Fgf4 and heparin for 10 days, a time period that allows proper differentiation in vitro ( Figure 25 A).
- Figure 25 A the iTSCs differentiated into giant multinucleated cells, associated with primary trophoblast cells
- trophoblast-lineage markers such as Tpbpa (specific for spongiotrophoblast cells) and Cga (specific for syncytiotrophoblast cells (Anson-Cartwright et al., 2000)) were elevated as well during differentiation.
- undifferentiated TSC markers such as Bmp4, Cdx2 and Eomes were downregulated during differentiation (Figure 25C).
- trophoblast giant cells One of the roles of trophoblast giant cells is to invade the maternal blood vessels during the development of the placenta (Rolich and Cross, 2001).
- the formation of a transient hemorrhagic lesion under the skin of nude mice by transplanted blastocyst- derived TSCs is considered as one of the hallmarks of TSCs as it recapitulates the invading properties of the trophoblast giant cells (Kibschull et al., 2004).
- iTSCs Similar to blastocyst-derived TSCs, when injected subcutaneously into nude mice, iTSCs formed lesions that reached their maximal size 5-8 days following injection, and thereafter began to resorb (Figure 26A).
- H&E hematoxylin and eosin
- the ability of the iTSCs to function properly in their native environment was evaluated. It has been shown that blastocyst-derived TSCs can contribute to the formation of the placenta when injected into the blastocyst or into an 8- cell stage embryo (Niwa et al., 2005; Tanaka et al., 1998). To assess the ability of the iTSCs to contribute to the formation of the placenta tdTomato-iTSCs (3F-iTSC B6/R26_ tdTomato #4) were first injected into 8-cell stage embryo and the localization of the injected cells was followed at the blastocyst stage.
- the injected H2b-GFP iTSCs were negative for Nanog, positive for Cdx2 and localized to the extraembryonic region similarly to blastocyst-derived TSCs ( Figures 29A-B).
- many of the injected H2b-GFP-positive blastocyst-derived TSCs or iTSCs lose the expression of Cdx2 during blastocyst maturation ( Figure 29B), proposing an explanation for the low contribution efficiency of blastocyst-derived TSCs to developing placenta seen, following blastocyst injection (Cambuli et al., 2014).
- this observation suggests an active mechanism inside the blastocyst to shot off any cell that is wrongly localized in the blastocyst.
- double-positive cells i.e., cells that are positive for H2b-GFP (green) and Tfap2c (red) were detected in 13.5 placentas. Importantly, a comparable contribution was seen following the injection of a blastocyst-derived TSC line, TS C blast - H2b - GFP #l (data not shown).
- pluripotent genes such as OSKM can induce a hyperdynamic chromatin state (Buganim et al., 2013) or a transient pluripotency phase (Bar-Nur et al., 2015) that can be utilized to force differentiation to various cell types such as cardiomyocytes and neuronal progenitors (Efe et al., 2011; Kim et al., 2011).
- ESCs and TSCs share the expression of several key genes (e.g.
- Sox2, Sall4, Utfl, Esrrb) and Gata3 was shown to induce pluripotency in other combinations of factors (Montserrat et al., 2013; Shu et al., 2013).
- the possibility that the conversion to iTSCs occurs via a pluripotent stage was examined.
- the present inventors tried to obtain iTSCs with ectopic expression of OSKM in cells that grew under culture conditions of TSCs. As a control, the cells were cultured also under mESC culture conditions. MEFs that harbor the Nanog-GFP and Oct4-GFP reporters were chosen as a starting population of cells because Nanog and Oct4 are expressed solely and specifically in pluripotent cells (Figure 15).
- Transduced MEFs were exposed to dox for 13 days after which it was removed for 6 days to allow proper stabilization of the core circuitry of the cells.
- mTSC medium differentiated cells
- mESC medium stable iPSCs
- Nanog-GFP or Oct4-GFP reporters were detected in the dish of both culture conditions.
- the number of GFP-positive cells was significantly lower when the TSC culture conditions were used as compared to cells that grew under mESC culture conditions, suggesting that reprogramming with TSC culture conditions is suboptimal for acquiring a stable pluripotent state and that the acquisition of pluripotent state is not beneficial for the formation of iTSCs.
- the present inventors tried to obtain iPSCs by using the TSC reprogramming factors, GETM, instead of OSKM.
- the cells were cultured either under TSC culture conditions, or under mESC culture conditions (i.e. medium containing serum and LIF), or under optimal mESC culture conditions (i.e. medium containing LIF and 2i, GSK3P and Mek 1/2 inhibitors) to facilitate pluripotency.
- mESC culture conditions i.e. medium containing serum and LIF
- optimal mESC culture conditions i.e. medium containing LIF and 2i, GSK3P and Mek 1/2 inhibitors
- Nanog or Oct4 are activated during the reprogramming process to iTSCs.
- the presence of Nanog-GFP or Oct4- GFP-positive cells during the reprogramming process might suggest that these cells acquire a short and transient pluripotent state.
- the above experiments were repeated, but this time the reprogrammable cells were analyzed every three days by flow cytometry.
- Figure 34 shows that GFP-positive cells were undetectable during the 12 days of the reprogramming process. Supporting that is the observation that even an early and robust marker for pluripotency such as Fbxol5 was not activated following GETM induction (Figure 35).
- iTSC colonies could be obtained when JAK inhibitor (JAKi), that blocks Stat3 phosphorylation, was added to the reprogramming medium ( Figure 36) or even when Oct4 was looped out from the starting MEFs (i.e., Sox2-GFP MEFs harboring Oct4 lox/lox homozygous alleles, (Kehler et al., 2004)) using lentiviral vector encoding for Cre ( Figure 37A-C).
- JAK inhibitor JAK inhibitor
- Cre lentiviral vector encoding for Cre
- the inventors sought to establish a reporter knock-in system that is marked by two early predictive markers (Utfl and Esrrb) of the reprogramming to pluripotency process and one late iPSCs marker (Nanog) (Buganim, Y., et al. (2012) Cell 150, 1209-1222, Buganim, Y., et al. (2013) Nat Rev Genet 14, 427-439). As Utfl and Esrrb are also expressed in TSCs ( Okuda, A., et al. (1998) The EMBO journal 17, 2019-2032; Luo, J., et al.
- this system may be employed in the conversion model to iTSCs as well.
- TSC marker Elf5 was selected.
- the mESC line KH2 was chosen as it contains the dox-inducible activator M2rtTA, in the Rosa26 locus and a flip-in system in the collagen (Collal) locus(Stadtfeld, M., et al. (2010) Nature 465, 175-181).
- the system was generated in ESC line as opposed to an established iPSC line in order to avoid commitment to the four "Yamanaka factors", and because the quality of the parental line is crucial for the success of the sequential targeting method.
- Reporter genes have been introduced into the 3'UTR of the targeted genes using the conventional homologous recombination technique with a targeting vector containing a self-cleaving 2A peptide to retain as much as possible the normal expression of the targeted alleles. 2A-like peptide sequences separate different protein coding sequences in a single ORF transcription unit.
- the previously characterized CRISPR/Cas9 technique was utilized (for details about the technique see (Wang, H., et al. (2013) Cell 153, 910-918; Yang, H., et al. (2013) Cell) and positive cells were sorted out by FACS.
- the complete KH2 system contains one specific late reporter for iPSCs (Nanog-2A-EGFP), one specific late reporter for iTSCs (Elf5-2A-EYFP-NLS) and two early reporters for both iPSCs and iTSCs (Utfl-2A-tdTomato and Esrrb-2A- EBFP) ( Figures 39).
- this method of sequential targeting in the KH2 line was established for three of the reporters (Nanog-2A- EGFP, Utfl-2A-tdTomato and Esrrb-2A-EBFP) Figures 40A-F).
- the engineered KH2 ESC line expresses the three reporters and gives rise to adult mice using the tetraploid complementation assay, indicating that the cells retained their high quality. Moreover, the expression of the three reporters is specific to the germ cells in the gonad, demonstrating the specificity of the reporters to pluripotent genes (Figure 40D). As a last step in the establishment of the reporter system the EYFP-NLS reporter is introduced into the Elf5 3'UTR locus.
- the EYFP-NLS reporter is introduced into the 3'UTR of the Elf5 locus.
- the conventional homologous recombination technique with donor plasmid that contains neomycin resistance to select for targeted correctly clones is used, as opposed to the sorting approach that was used to introduce the other three reporters that are expressed in ESCs.
- the CRISPR/Cas9 technique is employed. Correctly targeted KH2 clone that harbors all the four reporters is used to generate secondary inducible somatic cell systems.
- iPSCs and iTSCs are based on de novo transduction of fibroblasts with viral constructs that results in genetically heterogeneous population of infected cells.
- primary virus-transduced fibroblasts the previously characterized technique to generate clonal dox-inducible secondary somatic cell systems is employed(Wernig, M. et al. (2008) Nat Biotechnol 26, 916-924).
- Secondary inducible systems are somatic tissues that are composed of genetically homogeneous cells carrying identical dox-inducible proviral insertions known to achieve reprogramming in primary fibroblasts.
- the genetically engineered KH2 lines that harbor the four fluorescent proteins are injected into blastocysts to generate chimeric embryos.
- E13.5 embryos are sacrificed and MEFs carrying the M2rtTA activator are isolated following puromycin selection.
- the surviving MEFs are then infected with either dox-inducible single polycistronic lentiviral vector encoding for OSKM, (STEMCA), to generate iPSC colonies, or with a TSC-cocktail of transcription factors, to generate iTSCs.
- a single iPSC colony that expresses the three fluorescent reporters, Nanog-2A-EGFP/Utfl-2A-tdTomato/Esrrb-2A-EBFP and a single iTSC colony that expresses the three fluorescent reporters, Utfl-2A-tdTomato/Esrrb- 2A-EBFP/Elf5-2A-EYFP-NLS, are isolated and used to generate secondary systems. It has been shown that a single factor, Oct4, is sufficient to convert TSCs into iPSCs(21). This observation is exploited to generate secondary systems for the iTSC conversion model by initially producing iPSCs from the iTSCs that are then injected into blastocysts.
- An excisable retroviral construct encoding for Oct4 is used to convert the isolated iTSC colony into iPSCs.
- Secondary dox-inducible adult somatic tissues such as tail tip fibroblasts (TTFs) and Keratinocytes (Krts) are isolated as well from adult chimeric mice as described in (Wernig, M. et al. (2008) Nat Biotechnol 26, 916-924). These secondary inducible somatic cell systems are employed to sort out solely reprogrammable cells from different origins.
- the isolated secondary inducible MEFs, TTFs and Krts are exposed to dox to initiate the reprogramming process.
- Cells that are exposed to dox for six days (early time point) are collected and single cells are sorted based on the different combinations of reporters (i.e single-positive tdTomato cells, single-positive EBFP cells or double-positive tdTomato/EBFP cells).
- Single cells from each combination of reporters are plated into one 96-well plate (one single cell per well) that contains unmarked feeder cells (in total eighteen 96-well plates, i.e., three combination of reporters X three different cell types X two conversion models). These unmarked feeder cells are important for cell-cell interaction to enable proliferation of the individual single/double positive-cell.
- dox is removed from the medium for ten days and the eighteen 96-well plates are analysed by the CytationTM 3 Cell Imaging Multi-Mode Reader system to examine whether the forming colonies could activate the late marker Nanog in the case of the iPSC model or Elf5 in the iTSC model of conversion (EGFP and EYFP-NLS respectively).
- the CytationTM 3 is a cell imaging multi-mode microplate reader that combines automated digital microscopy and conventional microplate detection. CytationTM 3 includes both high sensitivity filter- based detection and a flexible quadruple monochromator based system for unmatched versatility and performance. This experiment allows examining the predictive capability of the early reporter genes (Esrrb and Utfl) to enrich the reprogrammable cells population. The combination of reporters that exhibits the highest predictive capability (i.e., the highest number of single cells that could form iPSC or iTSC colonies and activated all three reporters) are utilized for the entire study. In accordance with the method of the invention it is possible to use either a quadruple fluorescent knock-in reporter system or the triple-positive system. In addition, analyzing these cells is instructive as sorting based on these reporters enrich the population of reprogrammable cells.
- Esrrb and Utfl early reporter genes
- RNA-Seq RNA-Seq
- Fluidigm BioMark RNA-FISH
- sm-mRNA-FISH Single-cell techniques
- Analyzing the transcriptome of a reprogrammable cell at the single-cell level, as opposed to population level, is crucial also in a system where reprogrammable cells are sorted out using fluorescent reporters because even in an enriched population there is a high variation in gene expression between individual cells (Buganim, Y., et al. (2012) Cell 150, 1209-1222). This cell-to-cell variation is the basis for identifying sub- populations with unique characteristics.
Abstract
La présente invention concerne une méthode de génération d'une cellule souche trophoblastique induite (iTSC) à partir d'une cellule. Par conséquent, l'invention concerne une méthode consistant à exprimer, à l'intérieur de ladite cellule, au moins un facteur de transcription exogène choisi dans le groupe constitué par Gata3, Eomes et Tfap2c, dans des conditions qui permettent la génération d'une iTSC à partir de ladite cellule, ce qui permet de générer l'iTSC à partir de ladite cellule, à condition que la méthode ne consiste pas à exprimer, à l'intérieur de ladite cellule, Eomes, Cdx2, Elf5, cMyc et Klf4. L'invention concerne également des constructions d'acides nucléiques, des cellules isolées et des iTSC.
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US201462022296P | 2014-07-09 | 2014-07-09 | |
US62/022,296 | 2014-07-09 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2016005985A2 true WO2016005985A2 (fr) | 2016-01-14 |
WO2016005985A3 WO2016005985A3 (fr) | 2016-03-03 |
Family
ID=53872114
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/IL2015/050715 WO2016005985A2 (fr) | 2014-07-09 | 2015-07-09 | Méthode pour reprogrammer des cellules |
Country Status (1)
Country | Link |
---|---|
WO (1) | WO2016005985A2 (fr) |
Cited By (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105624194A (zh) * | 2016-02-16 | 2016-06-01 | 广东省农业科学院农业生物基因研究中心 | 一种条件性诱导Cas9表达的猪滋养层细胞系及其建立方法和应用 |
WO2019180247A1 (fr) * | 2018-03-22 | 2019-09-26 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Procédé de reprogrammation de cellules somatiques |
WO2022174129A1 (fr) * | 2021-02-15 | 2022-08-18 | Arizona Board Of Regents On Behalf Of The University Of Arizona | Eomes recombinante qui restaure l'activité anticancéreuse de cellules immunitaires |
WO2022264132A1 (fr) | 2021-06-13 | 2022-12-22 | Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. | Procédé de reprogrammation de cellules humaines |
EP4058565A4 (fr) * | 2019-11-13 | 2024-01-10 | Univ Monash | Méthode pour reprogrammer des cellules |
EP4183873A4 (fr) * | 2020-07-17 | 2024-04-24 | Univ Tohoku | Cellules de type cellules souches trophoblastiques capables de se différencier en cellules constituant le placenta, et leur procédé de production |
Citations (36)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US3791932A (en) | 1971-02-10 | 1974-02-12 | Akzona Inc | Process for the demonstration and determination of reaction components having specific binding affinity for each other |
US3839153A (en) | 1970-12-28 | 1974-10-01 | Akzona Inc | Process for the detection and determination of specific binding proteins and their corresponding bindable substances |
US3850752A (en) | 1970-11-10 | 1974-11-26 | Akzona Inc | Process for the demonstration and determination of low molecular compounds and of proteins capable of binding these compounds specifically |
US3850578A (en) | 1973-03-12 | 1974-11-26 | H Mcconnell | Process for assaying for biologically active molecules |
US3853987A (en) | 1971-09-01 | 1974-12-10 | W Dreyer | Immunological reagent and radioimmuno assay |
US3867517A (en) | 1971-12-21 | 1975-02-18 | Abbott Lab | Direct radioimmunoassay for antigens and their antibodies |
US3879262A (en) | 1972-05-11 | 1975-04-22 | Akzona Inc | Detection and determination of haptens |
US3901654A (en) | 1971-06-21 | 1975-08-26 | Biological Developments | Receptor assays of biologically active compounds employing biologically specific receptors |
US3935074A (en) | 1973-12-17 | 1976-01-27 | Syva Company | Antibody steric hindrance immunoassay with two antibodies |
US3984533A (en) | 1975-11-13 | 1976-10-05 | General Electric Company | Electrophoretic method of detecting antigen-antibody reaction |
US3996345A (en) | 1974-08-12 | 1976-12-07 | Syva Company | Fluorescence quenching with immunological pairs in immunoassays |
US4034074A (en) | 1974-09-19 | 1977-07-05 | The Board Of Trustees Of Leland Stanford Junior University | Universal reagent 2-site immunoradiometric assay using labelled anti (IgG) |
US4098876A (en) | 1976-10-26 | 1978-07-04 | Corning Glass Works | Reverse sandwich immunoassay |
US4666828A (en) | 1984-08-15 | 1987-05-19 | The General Hospital Corporation | Test for Huntington's disease |
US4683202A (en) | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
US4801531A (en) | 1985-04-17 | 1989-01-31 | Biotechnology Research Partners, Ltd. | Apo AI/CIII genomic polymorphisms predictive of atherosclerosis |
US4879219A (en) | 1980-09-19 | 1989-11-07 | General Hospital Corporation | Immunoassay utilizing monoclonal high affinity IgM antibodies |
US5011771A (en) | 1984-04-12 | 1991-04-30 | The General Hospital Corporation | Multiepitopic immunometric assay |
US5192659A (en) | 1989-08-25 | 1993-03-09 | Genetype Ag | Intron sequence analysis method for detection of adjacent and remote locus alleles as haplotypes |
US5272057A (en) | 1988-10-14 | 1993-12-21 | Georgetown University | Method of detecting a predisposition to cancer by the use of restriction fragment length polymorphism of the gene for human poly (ADP-ribose) polymerase |
US5281521A (en) | 1992-07-20 | 1994-01-25 | The Trustees Of The University Of Pennsylvania | Modified avidin-biotin technique |
US5464764A (en) | 1989-08-22 | 1995-11-07 | University Of Utah Research Foundation | Positive-negative selection methods and vectors |
US6630349B1 (en) | 1998-09-23 | 2003-10-07 | Mount Sinai Hospital | Trophoblast cell preparations |
US20030232410A1 (en) | 2002-03-21 | 2003-12-18 | Monika Liljedahl | Methods and compositions for using zinc finger endonucleases to enhance homologous recombination |
US6774279B2 (en) | 1997-05-30 | 2004-08-10 | Carnegie Institution Of Washington | Use of FLP recombinase in mice |
US20050026157A1 (en) | 2002-09-05 | 2005-02-03 | David Baltimore | Use of chimeric nucleases to stimulate gene targeting |
US20060014264A1 (en) | 2004-07-13 | 2006-01-19 | Stowers Institute For Medical Research | Cre/lox system with lox sites having an extended spacer region |
CA2588088A1 (fr) | 2004-11-04 | 2006-05-18 | Advanced Cell Technology, Inc. | Derivation de cellules souches embryonnaires |
WO2009071334A2 (fr) | 2007-12-07 | 2009-06-11 | Max-Delbrück-Centrum Für Molekulare Medizin (Mdc) | Mutagenèse médiée par des transposons dans des cellules souches spermatogoniales |
US7642091B2 (en) | 2005-02-24 | 2010-01-05 | Jau-Nan Lee | Human trophoblast stem cells and use thereof |
WO2011146121A1 (fr) | 2010-05-17 | 2011-11-24 | Sangamo Biosciences, Inc. | Nouvelles protéines se liant à l'adn et leurs utilisations |
WO2013049389A1 (fr) | 2011-09-27 | 2013-04-04 | Yale University | Compositions et procédés pour expression transitoire d'arn recombinant |
US8557972B2 (en) | 2009-12-21 | 2013-10-15 | University Of Washington Through Its Center For Commercialization | Compositions and methods for transfection of RNA and controlled stabilization of transfected RNA |
WO2013159103A1 (fr) | 2012-04-20 | 2013-10-24 | Whitehead Institute For Biomedical Research | Programmation et reprogrammation de cellules |
WO2014085593A1 (fr) | 2012-11-27 | 2014-06-05 | Children's Medical Center Corporation | Ciblage d'éléments régulateurs distaux bcl11a pour la réinduction d'hémoglobine fœtale |
US8771945B1 (en) | 2012-12-12 | 2014-07-08 | The Broad Institute, Inc. | CRISPR-Cas systems and methods for altering expression of gene products |
-
2015
- 2015-07-09 WO PCT/IL2015/050715 patent/WO2016005985A2/fr active Application Filing
Patent Citations (41)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US3850752A (en) | 1970-11-10 | 1974-11-26 | Akzona Inc | Process for the demonstration and determination of low molecular compounds and of proteins capable of binding these compounds specifically |
US3839153A (en) | 1970-12-28 | 1974-10-01 | Akzona Inc | Process for the detection and determination of specific binding proteins and their corresponding bindable substances |
US3791932A (en) | 1971-02-10 | 1974-02-12 | Akzona Inc | Process for the demonstration and determination of reaction components having specific binding affinity for each other |
US3901654A (en) | 1971-06-21 | 1975-08-26 | Biological Developments | Receptor assays of biologically active compounds employing biologically specific receptors |
US3853987A (en) | 1971-09-01 | 1974-12-10 | W Dreyer | Immunological reagent and radioimmuno assay |
US3867517A (en) | 1971-12-21 | 1975-02-18 | Abbott Lab | Direct radioimmunoassay for antigens and their antibodies |
US3879262A (en) | 1972-05-11 | 1975-04-22 | Akzona Inc | Detection and determination of haptens |
US3850578A (en) | 1973-03-12 | 1974-11-26 | H Mcconnell | Process for assaying for biologically active molecules |
US3935074A (en) | 1973-12-17 | 1976-01-27 | Syva Company | Antibody steric hindrance immunoassay with two antibodies |
US3996345A (en) | 1974-08-12 | 1976-12-07 | Syva Company | Fluorescence quenching with immunological pairs in immunoassays |
US4034074A (en) | 1974-09-19 | 1977-07-05 | The Board Of Trustees Of Leland Stanford Junior University | Universal reagent 2-site immunoradiometric assay using labelled anti (IgG) |
US3984533A (en) | 1975-11-13 | 1976-10-05 | General Electric Company | Electrophoretic method of detecting antigen-antibody reaction |
US4098876A (en) | 1976-10-26 | 1978-07-04 | Corning Glass Works | Reverse sandwich immunoassay |
US4879219A (en) | 1980-09-19 | 1989-11-07 | General Hospital Corporation | Immunoassay utilizing monoclonal high affinity IgM antibodies |
US5011771A (en) | 1984-04-12 | 1991-04-30 | The General Hospital Corporation | Multiepitopic immunometric assay |
US4666828A (en) | 1984-08-15 | 1987-05-19 | The General Hospital Corporation | Test for Huntington's disease |
US4683202A (en) | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
US4683202B1 (fr) | 1985-03-28 | 1990-11-27 | Cetus Corp | |
US4801531A (en) | 1985-04-17 | 1989-01-31 | Biotechnology Research Partners, Ltd. | Apo AI/CIII genomic polymorphisms predictive of atherosclerosis |
US5272057A (en) | 1988-10-14 | 1993-12-21 | Georgetown University | Method of detecting a predisposition to cancer by the use of restriction fragment length polymorphism of the gene for human poly (ADP-ribose) polymerase |
US5464764A (en) | 1989-08-22 | 1995-11-07 | University Of Utah Research Foundation | Positive-negative selection methods and vectors |
US5487992A (en) | 1989-08-22 | 1996-01-30 | University Of Utah Research Foundation | Cells and non-human organisms containing predetermined genomic modifications and positive-negative selection methods and vectors for making same |
US5192659A (en) | 1989-08-25 | 1993-03-09 | Genetype Ag | Intron sequence analysis method for detection of adjacent and remote locus alleles as haplotypes |
US5281521A (en) | 1992-07-20 | 1994-01-25 | The Trustees Of The University Of Pennsylvania | Modified avidin-biotin technique |
US6774279B2 (en) | 1997-05-30 | 2004-08-10 | Carnegie Institution Of Washington | Use of FLP recombinase in mice |
US6630349B1 (en) | 1998-09-23 | 2003-10-07 | Mount Sinai Hospital | Trophoblast cell preparations |
US20050191742A1 (en) | 1998-09-23 | 2005-09-01 | Mount Sinai Hospital | Trophoblast cell preparations |
US20030232410A1 (en) | 2002-03-21 | 2003-12-18 | Monika Liljedahl | Methods and compositions for using zinc finger endonucleases to enhance homologous recombination |
US20050026157A1 (en) | 2002-09-05 | 2005-02-03 | David Baltimore | Use of chimeric nucleases to stimulate gene targeting |
US20060014264A1 (en) | 2004-07-13 | 2006-01-19 | Stowers Institute For Medical Research | Cre/lox system with lox sites having an extended spacer region |
CA2588088A1 (fr) | 2004-11-04 | 2006-05-18 | Advanced Cell Technology, Inc. | Derivation de cellules souches embryonnaires |
WO2006052646A2 (fr) | 2004-11-04 | 2006-05-18 | Advanced Cell Technology, Inc. | Derivation de cellules souches embryonnaires |
US7642091B2 (en) | 2005-02-24 | 2010-01-05 | Jau-Nan Lee | Human trophoblast stem cells and use thereof |
WO2009071334A2 (fr) | 2007-12-07 | 2009-06-11 | Max-Delbrück-Centrum Für Molekulare Medizin (Mdc) | Mutagenèse médiée par des transposons dans des cellules souches spermatogoniales |
US8557972B2 (en) | 2009-12-21 | 2013-10-15 | University Of Washington Through Its Center For Commercialization | Compositions and methods for transfection of RNA and controlled stabilization of transfected RNA |
WO2011146121A1 (fr) | 2010-05-17 | 2011-11-24 | Sangamo Biosciences, Inc. | Nouvelles protéines se liant à l'adn et leurs utilisations |
US8586526B2 (en) | 2010-05-17 | 2013-11-19 | Sangamo Biosciences, Inc. | DNA-binding proteins and uses thereof |
WO2013049389A1 (fr) | 2011-09-27 | 2013-04-04 | Yale University | Compositions et procédés pour expression transitoire d'arn recombinant |
WO2013159103A1 (fr) | 2012-04-20 | 2013-10-24 | Whitehead Institute For Biomedical Research | Programmation et reprogrammation de cellules |
WO2014085593A1 (fr) | 2012-11-27 | 2014-06-05 | Children's Medical Center Corporation | Ciblage d'éléments régulateurs distaux bcl11a pour la réinduction d'hémoglobine fœtale |
US8771945B1 (en) | 2012-12-12 | 2014-07-08 | The Broad Institute, Inc. | CRISPR-Cas systems and methods for altering expression of gene products |
Non-Patent Citations (91)
Title |
---|
"Animal Cell Culture", 1986 |
"Basic and Clinical Immunology", 1994, APPLETON & LANGE |
"Cell Biology: A Laboratory Handbook", vol. I-III, 1994 |
"Current Protocols in Immunology", vol. I-?I, 1994 |
"Current Protocols in Molecular Biology", 1989, GREENE PUBLISHING ASSOCIATES |
"Current Protocols in Molecular Biology", vol. I-ILL, 1994 |
"Enhancers and Eukaryotic Expression", 1983, COLD SPRING HARBOR PRESS |
"Genome Analysis: A Laboratory Manual Series", vol. 1-4, 1998, COLD SPRING HARBOR LABORATORY PRESS |
"Immobilized Cells and Enzymes", 1986, IRL PRESS |
"Methods in Enzymology", vol. 1-317, ACADEMIC PRESS |
"Nucleic Acid Hybridization", 1985 |
"Oligonucleotide Synthesis", 1984 |
"PCR Protocols: A Guide To Methods And Applications", 1990, ACADEMIC PRESS |
"Selected Methods in Cellular Immunology", 1980, W. H. FREEMAN AND CO. |
"Transcription and Translation", 1984 |
"Vectors: A Survey of Molecular Cloning Vectors and Their Uses", 1988, BUTTERWORTHS |
AOI T ET AL.: "Generation of Pluripqtent Stem Cells from Adult Mouse Liver and-Stomach Cells", SCIENCE, 2008 |
AUSUBEL ET AL.: "Current Protocols in Molecular Biology", 1989, JOHN WILEY AND SONS |
BAR-NUR, O.; RUSS, H. A.; EFRAT, S.; BENVENISTY, N.: "Epigenetic memory and preferential lineage-specific differentiation in induced pluripotent stem cells derived from human pancreatic islet beta cells", CELL STEM CELL, vol. 9, 2011, pages 17 - 23, XP028381096, DOI: doi:10.1016/j.stem.2011.06.007 |
BEDELL, M. A.; JERKINS, N. A.; COPELAND, N. G.: "Mouse models of human disease. Part I: Techniques and resources for genetic analysis in mice", GENES AND DEVELOPMENT, vol. 11, 1997, pages 1 - 11 |
BERMINGHAM, J. J.; SCHERER, S. S.; O'CONNELL, S.; ARROYO, E.; KALLA, K. A.; POWELL, F. L.; ROSENFELD, M. G.: "Tst-l/Oct-6/SCIP regulates a unique step in peripheral myelination and is required for normal respiration", GENES DEV, vol. 10, 1996, pages 1751 - 62 |
BOLAND, M. J.; HAZEN, J. L.; NAZOR, K. L.; RODRIGUEZ, A. R.; GIFFORD, W.; MARTIN, G.; KUPRIYANOV, S.; BALDWIN, K. K.: "Adult mice generated from induced pluripotent stem cells", NATURE, vol. 461, 2009, pages 91 - 94 |
BUGANIM, Y. ET AL., CELL, vol. 150, 2012, pages 1209 - 1222 |
BUGANIM, Y. ET AL., NAT REV GENET, vol. 14, 2013, pages 427 - 439 |
CAPECCHI, SCIENCE, vol. 244, 1989, pages 1288 - 1292 |
CHANG ET AL.: "Somatic Gene Therapy", 1995, CRC PRESS |
CHEN ET AL., BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, vol. 431, 2013, pages 197 - 202 |
CHEN, Y.; WANG, K.; GONG, Y. G.; KHOO, S. K.; LEACH, R.: "Roles of CDX2 and EOMES in human induced trophoblast progenitor cells", BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, vol. 431, 2013, pages 197 - 202, XP028970948, DOI: doi:10.1016/j.bbrc.2012.12.135 |
CHIN, M. H.; MASON, M. J.; XIE, W.; VOLINIA, S.; SINGER, M.; PETERSON, C.; AMBARTSUMYAN, G.; AIMIUWU, O.; RICHTER, L.; ZHANG, J.: "Induced pluripotent stem cells and embryonic stem cells are distinguished by gene expression signatures", CELL STEM CELL, vol. 5, 2009, pages 111 - 123, XP055013700, DOI: doi:10.1016/j.stem.2009.06.008 |
COHEN S. ET AL., J. PATHOL., vol. 200, 2003, pages 47 - 52 |
DAVIS, R. L.; WEINTRAUB, H.; LASSAR, A. B.: "Expression of a single transfected cDNA converts .fibroblasts to myoblasts", CELL, vol. 51, 1987, pages 987 - 1000, XP027461749, DOI: doi:10.1016/0092-8674(87)90585-X |
EZASHI, T.; MATSUYAMA, H.; TELUGU, B. P.; ROBERTS, R. M.: "Generation of colonies of induced trophoblast cells during standard reprogramming of porcine fibroblasts to induced pluripotent stem cells", BIOLOGY OF REPRODUCTION, vol. 85, 2011, pages 779 - 787 |
F. CHOPLIN: "Quantitative Drug Design", 1992, PERGAMON PRESS |
FAWELL S ET AL., PROC NATL ACAD SCI USA, vol. 91, 1994, pages 664 - 668 |
FINGL ET AL.: "The Pharmacological Basis of Therapeutics", 1975, pages: L |
FRESHNEY: "Culture of Animal Cells - A Manual of Basic Technique", 1994, WILEY-LISS |
FUKUSHIGE, S.; IKE7DA,- J. E.: "Trapping of mammalian promoters by Cre-lox site-specific recombination", DNA RES, vol. 3, 1996, pages 73 - 50 |
GAFNI O ET AL., NATURE, vol. 504, no. 7479, 12 December 2013 (2013-12-12), pages 282 - 6 |
GENBACEV ET AL., STEM CELLS, vol. 29, 2011, pages 1427 - 1436 |
GENBACEV, O.; DONNE, M.; KAPIDZIC, M.; GORMLEY, M.; LAMB, J.; GILMORE, J.; LAROCQUE, N.; GOLDFIEN, G.; ZDRAVKOVIC, T.; MCMASTER M.: "Establishment of human trophoblast progenitor cell lines from the chorion", STEM CELLS, vol. 29, 2011, pages 1427 - 1436 |
GILBOA, BIOTECHNIQUES, vol. 4, no. 6, 1986, pages 504 - 512 |
GURDON, J. B.; MELTON, D. A.: "Nuclear reprogramming in cells", SCIENCE, vol. 322, 2008, pages 1811 - 1815 |
HAWLEY, R.G. ET AL., ONCOGENE, vol. 9, 1994, pages 1 - 12 |
HUANG, P.; HE, Z.; JI, S.; SUN, H.; XIANG, D.; LIU, C.; HU, Y.; WANG, X.; HUI, L.: "Induction of functional hepatocyte-like -cells from mouse fibroblasts by defined factors", NATURE, vol. 475, 2011, pages 386 - 389, XP055086662, DOI: doi:10.1038/nature10116 |
IEDA, M.; FU, J. D.; DELGADO-OLGUIN, P.; VEDANTHAM, V.; HAYASHI, Y.; BRUNEAU, B. G.; SRIVASTAVA, D.: "Direct reprogramming of fibroblasts into functional cardiomyocytes by defined factors", CELL, vol. 142, 2010, pages 375 - 386, XP055027656, DOI: doi:10.1016/j.cell.2010.07.002 |
IH PARK; ZHAO R; WEST JA ET AL.: "Reprogramming of human somatic -cells to pluripotency with defined factors", NATURE, vol. 451, 2008, pages 141 - 146, XP008153589, DOI: doi:10.1038/nature06534 |
JAMES, J. L.; SRINIVASAN, S.; ALEXANDER, M.; CHAMLEY, L. W.: "Can we fix it? Evaluating the potential of placental stem cells for the treatment of pregnancy disorders", PLACENTA, vol. 35, 2014, pages 77 - 84, XP028608339, DOI: doi:10.1016/j.placenta.2013.12.010 |
JAUNIAUX, E.; POSTON, L.; BURTON, G. J.: "Placental-related diseases of pregnancy: Involvement of oxidative stress and implications in human evolution", HUMAN REPRODUCTION UPDATE, vol. 12, 2006, pages 747 - 755 |
JING BIAN ET AL., CIRCULATION RESEARCH, vol. 100, 2007, pages 1626 - 1633 |
K TAKAHASHI; TANABE K; OHNUKI M ET AL.: "Induction of pluripotent stem cells from adult human fibroblasts by defined factors", CELL, vol. 131, 2007, pages 861 - 872, XP008155962, DOI: doi:10.1016/j.cell.2007.11.019 |
KEHLER ET AL., EMBO REPORTS, vol. 5, 2004, pages 1078 - 1083 |
KIDDER, METHODS MOL BIOL., vol. 1150, 2014, pages 201 - 12 |
L THEODORE ET AL., THE JOURNAL OF NEUROSCIENCE, vol. 15, no. 11, 1995, pages 7158 - 7167 |
LATOS; HEMBERGER, PLACENTA, vol. 35, 2014, pages 81 - 5 |
LEI ET AL., PLACENTA, vol. 28, no. 1, January 2007 (2007-01-01), pages 14 - 21 |
LUJAN, E.; CHANDA, S.; AHLENIUS, H.; SUDHOF, T. C.; WERNIG, M.: "Direct conversion of mouse fibroblasts to self-renewing, tripotent neural precursor cells", PROC NATL ACAD SCI USA, vol. 109, 2012, pages 2527 - 2532, XP002679170, DOI: doi:10.1073/PNAS.1121003109 |
LUO, J. ET AL., NATURE, vol. 388, 1997, pages 778 - 782 |
MARSHAK ET AL.: "Strategies for Protein Purification and Characterization - A Laboratory Course Manual", 1996, CSHL PRESS |
MENKE D., GENESIS, vol. 51, 2013, pages 618 |
ODA ET AL., METHODS ENZYMOL, vol. 419, 2006, pages 387 - 400 |
OKITA ET AL., SCIENCE, vol. 322, 2008, pages 949 - 953 |
OKUDA, A. ET AL., THE EMBO JOURNAL, vol. 17, 1998, pages 2019 - 2032 |
PERA, M. F.: "Stem cells: The dark side of induced pluripotency", NATURE, vol. 471, 2011, pages 46 - 47 |
PERBAL, B.: "A Practical Guide to Molecular Cloning", 1984 |
PERBAL: "A Practical Guide to Molecular Cloning", 1988, JOHN WILEY & SONS |
RABINOVICH; WEISSMAN, METHODS MOL BIOL., vol. 969, 2013, pages 3 - 28 |
RICHARD BEHRINGER; MARINA GERTSENSTEIN; KRISTINA VINTERSTEN NAGY; ANDRAS NAGY: "Manipulating the Mouse Embryo: A Laboratory Manual" |
ROBERTS, R. M.; FISHER, S. J.: "Trophoblast stem cells", BIOLOGY OF REPRODUCTION, vol. 84, 2011, pages 412 - 421 |
SAMBROOK ET AL.: "Molecular Cloning: A laboratory Manual", 1989 |
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRINGS HARBOR LABORATORY |
SANTIAGO ET AL., PROC NATL ACAD SCI USA, vol. 105, 2008, pages 5809 - 5814 |
STADTFELD ET AL., SCIENCE, vol. 322, 2008, pages 945 - 949 |
STADTFELD, M. ET AL., NATURE, vol. 465, 2010, pages 175 - 181 |
TAKAHASHI, K.; YAMANAKA, S.: "Induction ,of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors", CELL, vol. 126, 2006, pages 663 - 676 |
THOMSON JA ET AL., SCIENCE, vol. 282, 1998, pages 1145 - 7 |
VEGA ET AL.: "Gene Targeting", 1995, CRC PRESS |
VIERBUCHEN, T.; OSTERMEIER, A.; PANG, Z. P.; KOKUBU, Y.; SUDHOF, T. C.; WERNIG, M.: "Direct conversion of fibroblasts to functional neurons by_ defined factors", NATURE, vol. 463, 2010, pages 1035 - 1041, XP055023150, DOI: doi:10.1038/nature08797 |
WALTHER W ET AL., MOL. BIOTECHNOL, vol. 28, 2004, pages 121 - 8 |
WANG, H. ET AL., CELL, vol. 153, 2013, pages 910 - 918 |
WATSON ET AL.: "Recombinant DNA", SCIENTIFIC AMERICAN BOOKS |
WEI, W. ET AL., MOL CELL BIOL., vol. 23, 2003, pages 2859 - 2870 |
WERNIG, M. ET AL., NAT BIOTECHNOL, vol. 26, 2008, pages 916 - 924 |
WOLFF JA; BUDKER V, ADV. GENET, vol. 54, 2005, pages 3 - 20 |
WU, T.; WANG, H.; HE, J.; KANG, L.; JIANG, Y.; LIU, J.; ZHANG, Y.; KOU, Z.; LIU, L.; ZHANG, X.: "Reprogramming of trophoblast stem cells into pluripotent stem cells", STEM CELLS, vol. 29, 4 October 2011 (2011-10-04), pages 755 - 763, XP055052764, DOI: doi:10.1002/stem.617 |
XIE, H.; YE, M.; FENG, R.; GRAF, T.: "Stepwise reprogramming of B cells into macrophages", CELL, vol. 117, 2004, pages 663 - 676 |
YAMANAKA S, CELL STEM CELL, vol. 1, no. 1, 2007, pages 39 - 49 |
YANG, H. ET AL., CELL, 2013 |
YU, B.; HE, Z. Y.; YOU, P.; HAN, Q. W.; XIANG, D.; CHEN, F.; WANG, M. J.; LIU, C. C.; LIN, X. W.; BORJIGIN, U.: "Reprogramming fibroblasts into bipotential hepatic stem cells by defined factors", CELL STEM CELL, vol. 13, 2013, pages 328 - 340, XP055194339, DOI: doi:10.1016/j.stem.2013.06.017 |
ZHANG, K.; LIU, G. H.; YI, F.; MONTSERRAT, N.; HISHIDA, T.; ESTEBAN, C. R.; IZPISUA BELMONTE, J. C.: "Direct conversion of human fibroblasts into retinal pigment epithelium-like cells by defined factors", PROTEIN & CELL, 2014 |
ZHOU, CELL STEM CELL, vol. 4, no. 6, 2009, pages 581 |
ZUO, B. ET AL., BIOL OPEN., vol. 1, 2012, pages 1118 - 1127 |
Cited By (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105624194A (zh) * | 2016-02-16 | 2016-06-01 | 广东省农业科学院农业生物基因研究中心 | 一种条件性诱导Cas9表达的猪滋养层细胞系及其建立方法和应用 |
WO2019180247A1 (fr) * | 2018-03-22 | 2019-09-26 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Procédé de reprogrammation de cellules somatiques |
EP4058565A4 (fr) * | 2019-11-13 | 2024-01-10 | Univ Monash | Méthode pour reprogrammer des cellules |
EP4183873A4 (fr) * | 2020-07-17 | 2024-04-24 | Univ Tohoku | Cellules de type cellules souches trophoblastiques capables de se différencier en cellules constituant le placenta, et leur procédé de production |
WO2022174129A1 (fr) * | 2021-02-15 | 2022-08-18 | Arizona Board Of Regents On Behalf Of The University Of Arizona | Eomes recombinante qui restaure l'activité anticancéreuse de cellules immunitaires |
WO2022264132A1 (fr) | 2021-06-13 | 2022-12-22 | Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. | Procédé de reprogrammation de cellules humaines |
Also Published As
Publication number | Publication date |
---|---|
WO2016005985A3 (fr) | 2016-03-03 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Benchetrit et al. | Direct induction of the three pre-implantation blastocyst cell types from fibroblasts | |
EP2989199B1 (fr) | Cellules souches pluripotentes naïves isolées et leurs procédés de génération | |
Le et al. | Enhanced telomere rejuvenation in pluripotent cells reprogrammed via nuclear transfer relative to induced pluripotent stem cells | |
WO2016005985A2 (fr) | Méthode pour reprogrammer des cellules | |
US20220088137A1 (en) | Methods for detecting and modulating the embryonic-fetal transition in mammalian species | |
JP2013514779A (ja) | 脱メチル化および細胞の再プログラミングを促進するためのシチジンデアミナーゼ関連薬剤の使用 | |
AU2006313518A2 (en) | Reprogramming and genetic modification of cells | |
CN103562376A (zh) | 复壮细胞的方法 | |
Sesé et al. | SMYD2 is induced during cell differentiation and participates in early development | |
JP7307481B2 (ja) | 始原生殖細胞/始原生殖細胞様細胞の維持増幅及び分化誘導方法 | |
Luo et al. | Offspring production of ovarian organoids derived from spermatogonial stem cells by defined factors with chromatin reorganization | |
ES2964036T3 (es) | Método para expandir la pluripotencialidad y la diferenciación potencial de células pluripotentes | |
Dey et al. | Auxiliary pluripotency-associated genes and their contributions in the generation of induced pluripotent stem cells | |
EP2501803B1 (fr) | Méthodes permettant d'augmenter la pluripotence | |
US11814650B2 (en) | Method for expanding stemness and differentiation potential of pluripotent cells | |
WO2015006590A1 (fr) | Génération de cellules germinales mâles | |
Dey et al. | Krishna Kumar Haridhasapavalan, Pradeep Kumar Sundaravadivelu, Vishalini Venkatesan, Ranadeep Gogoi 2, S. Sudhagar 2, Rajkumar P. Thummer | |
Venkatesan et al. | Chandrima Dey1, a, Khyati Raina1, a, Madhuri Thool1, 2, a, Poulomi Adhikari1, 4, 5, Krishna Kumar Haridhasapavalan1, Pradeep Kumar Sundaravadivelu1 | |
Salazar-Roa et al. | Transient exposure to miR-203 expands the differentiation capacity of pluripotent stem cells | |
WO2022264132A1 (fr) | Procédé de reprogrammation de cellules humaines | |
Salazar-Roa et al. | A novel microRNA-based strategy to expand the differentiation potency of stem cells | |
Aguirre Maclennan | Generation of induced pluripotent stem (iPS) cells from the endangered Tasmanian devil | |
WO2012131387A1 (fr) | Substrat cellulaire pour reprogrammation nucléaire | |
JIANMING | The role of Kruppel-like factors in embryonic stem cells | |
Chou et al. | A novel blastocyst-derived stem cell line reveals an active role for growth factor signaling in the induction of stem cell pluripotency |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 15750821 Country of ref document: EP Kind code of ref document: A2 |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
122 | Ep: pct application non-entry in european phase |
Ref document number: 15750821 Country of ref document: EP Kind code of ref document: A2 |