WO2015174441A1 - Procédé de criblage d'agent prophylactique ou thérapeutique pour le diabète - Google Patents

Procédé de criblage d'agent prophylactique ou thérapeutique pour le diabète Download PDF

Info

Publication number
WO2015174441A1
WO2015174441A1 PCT/JP2015/063724 JP2015063724W WO2015174441A1 WO 2015174441 A1 WO2015174441 A1 WO 2015174441A1 JP 2015063724 W JP2015063724 W JP 2015063724W WO 2015174441 A1 WO2015174441 A1 WO 2015174441A1
Authority
WO
WIPO (PCT)
Prior art keywords
nrf1
mafg
mice
amount
activity
Prior art date
Application number
PCT/JP2015/063724
Other languages
English (en)
Japanese (ja)
Inventor
山本　雅之
晃 宇留野
祐樹 古澤
Original Assignee
持田製薬株式会社
国立大学法人東北大学
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 持田製薬株式会社, 国立大学法人東北大学 filed Critical 持田製薬株式会社
Publication of WO2015174441A1 publication Critical patent/WO2015174441A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy

Definitions

  • the present invention relates to a preventive or therapeutic agent for diabetes and a screening method thereof.
  • Diabetes is a chronic metabolic disease characterized by a persistent hyperglycemic state caused by insufficient insulin action.
  • insulin secretion failure is due to dysfunction of the pancreatic ⁇ -cells that secrete insulin.
  • ⁇ cells are destroyed by autoimmunity, resulting in insulin secretion failure.
  • Insulin resistance is a state in which insulin secretion is sufficient but blood glucose level does not decrease, and it means that insulin does not work well in the main tissues where insulin acts, such as skeletal muscle, adipose tissue and liver .
  • Insulin acts to promote sugar uptake and glycogen synthesis in skeletal muscle, sugar uptake and fat synthesis in adipose tissue, and suppression of gluconeogenesis in the liver. If there is insulin resistance, these responses in each tissue are blunted. In type 2 diabetes, both insulin secretion failure and insulin resistance are involved. Environmental factors such as obesity, overeating, lack of exercise, and stress cause insulin resistance and lead to a hyperglycemic state. Hyperglycemia promotes excessive insulin secretion from ⁇ cells, exhausting ⁇ cells. In addition, glucose toxicity due to hyperglycemia damages ⁇ cells and worsens insulin resistance. As the disease progresses, insulin secretion decreases due to ⁇ -cell dysfunction, which in combination with insulin resistance leads to a further hyperglycemic state.
  • diabetes In the treatment of diabetes, the goal is to lower the blood glucose level to the normal range.
  • the mechanism of action is roughly divided into insulin secretion promotion, insulin resistance improvement, and sugar absorption suppression.
  • Existing diabetes treatments include insulin, ⁇ -glycosidase inhibitors (voglibose, acarbose, etc.), fast-acting insulin secretagogues (nateglinide, mitiglinide, etc.), sulfonylureas (glimepiride, gliclazide, etc.), GLP-1 receptor Agonists (such as liraglutide and exenatide), DPP-4 inhibitors (such as sitagliptin and vildagliptin), biguanides (such as metformin), thiazolidine drugs (such as pioglitazone), SGLT2 inhibitors (such as ipragliflozin) are used .
  • ⁇ -glycosidase inhibitors voglibose,
  • ⁇ -Glycosidase inhibitors delay postprandial hyperglycemia by delaying sugar absorption from the intestines.
  • Fast-acting insulin secretagogues, sulfonylureas and GLP-1 receptor agonists stimulate ⁇ cells and promote insulin secretion.
  • DPP-4 inhibitors promote insulin secretion by inhibiting the degradation of incretins (GLP-1 and GIP). Biguanides mainly inhibit gluconeogenesis in the liver and improve insulin resistance.
  • Thiazolidine drugs promote glucose uptake, glycogen synthesis, and fat synthesis in skeletal muscle and adipose tissue, suppress sugar release from the liver, and improve insulin resistance.
  • CNC cap-'n'-collar family transcription factors including NF-E2p45, Nrf1 (NF-E2-related factor 1), Nrf2, Nrf3, Bach1 and Bach2 have multiple cellular functions. These factors commonly bind to an antioxidant / electrophile response element (ARE / EpRE) and activate or repress transcription.
  • Nrf2 has been found to play a pivotal role in cellular responses to oxidative and electrophilic stress. Nrf2 also contributes to glucose metabolism in cancer cells. Importantly, Nrf2 also regulates glucose metabolism levels and body weight levels in obese and diabetic model mice.
  • GWAS genome-wide association analysis
  • Nrf3 has been found to be associated with lipid distribution in human obesity.
  • Nrf1 another CNC family factor, also binds to ARE / EpRE and exerts transactivation activity (Non-patent Document 1).
  • the phenotype of the Nrf1 knockout mouse (Non-patent document 2; Non-patent document 3; Non-patent document 4; Non-patent document 5; and Patent document 1) is completely different from the phenotype of the Nrf2 knockout mouse.
  • Nrf1 knockout mice are embryonic lethal due to insufficient red blood cell production (Non-patent Document 2). This is thought to be important because Nrf1 and Nrf2 use the same consensus sequence ARE / EpRE for specific transcriptional regulation but have different cellular functions.
  • Nrf1 regulates lipid metabolism-related genes
  • Patent Document 5 Patent Document 1
  • This finding led to the thought that Nrf1 could also play an important role in the metabolism of various cells.
  • An interesting problem that arises here is the difference in the contribution of Nrf1 and Nrf2 to cellular metabolic regulation.
  • embryonic lethal mortality in Nrf1 global knockout mice (Non-Patent Document 2) and severe liver dysfunction in Nrf1 liver-specific conditional knockout mice (Non-Patent Document 5) elucidate the extremely important role Nrf1 plays in metabolism. Is hindering. Differences in the contribution of Nrf1 and Nrf2 to the pathophysiology and molecular basis of the cells that make the difference remain unclear.
  • Nrf1 body mass index
  • rs3764400 a single nucleotide polymorphism (SNP)
  • SNP single nucleotide polymorphism
  • Nrf1 function In order to address the contribution of Nrf1 to metabolic regulation, we investigated Nrf1 function using Nrf1 gene mutant mice with different expression levels. For this purpose, three Nrfl overexpressing transgenic mouse lines were established by using the MafG gene regulatory domain (MGRD). An Nrf1 knockout mouse strain was also used (Non-patent Document 1). Analysis on these mice clearly demonstrated that Nrf1 attenuates glucose metabolism and concomitantly decreases body weight levels. Therefore, Nrf1 was found to be a strong metabolic regulator. Furthermore, the present inventors have found that Nrf1 is a target in the prevention or treatment of diabetes because mice develop diabetes due to overexpression of Nrf1, and the present invention has been completed. That is, the present invention provides the following preventive or therapeutic agents for diabetes, screening methods for preventive or therapeutic agents for diabetes, transgenic non-human animals, and the like.
  • a preventive or therapeutic agent for diabetes comprising an Nrf1 inhibitor.
  • the Nrf1 inhibitor is (a) a siRNA or shRNA against a polynucleotide encoding Nrf1, and (b) a nucleotide sequence complementary or substantially complementary to the nucleotide sequence of the polynucleotide encoding Nrf1 An antisense polynucleotide containing a part, (c) a low molecular or high molecular compound that inhibits Nrf1 activity, (d) a ribozyme for a polynucleotide encoding Nrf1, and (e) acting as a dominant negative for Nrf1
  • the prophylactic or therapeutic agent according to the above [1-1] which is one or more selected from the group consisting of a mutant of Nrf1 or a polynucleotide encoding the same, and (f) an aptamer to Nrf1.
  • Nrf1 inhibitor is an siRNA comprising a sense strand consisting of the nucleotide sequence of SEQ ID NO: 33 and an antisense strand consisting of the nucleotide sequence of SEQ ID NO: 34
  • siRNA comprising a sense strand consisting of the nucleotide sequence of SEQ ID NO: 33 and an antisense strand consisting of the nucleotide sequence of SEQ ID NO: 34
  • Diabetes prevention or treatment [2-1] A method for preventing or treating diabetes, comprising administering a therapeutically effective amount of an Nrf1 inhibitor to a subject in need of prevention or treatment of diabetes.
  • the Nrf1 inhibitor is (a) a siRNA or shRNA against the polynucleotide encoding Nrf1, and (b) a nucleotide sequence complementary or substantially complementary to the nucleotide sequence of the polynucleotide encoding Nrf1
  • An antisense polynucleotide containing a part (c) a low molecular or high molecular compound that inhibits Nrf1 activity, (d) a ribozyme for a polynucleotide encoding Nrf1, and (e) acting as a dominant negative for Nrf1 Any one of [2-1] to [2-3] above, which is one or more selected from the group consisting of a mutant of Nrf1 or a polynucleotide encoding the same, and (f) an aptamer to Nrf1 The method according to item.
  • Nrf1 inhibitor is an siRNA comprising a sense strand consisting of the nucleotide sequence of SEQ ID NO: 33 and an antisense strand consisting of the nucleotide sequence of SEQ ID NO: 34 4.
  • siRNA comprising a sense strand consisting of the nucleotide sequence of SEQ ID NO: 33 and an antisense strand consisting of the nucleotide sequence of SEQ ID NO: 34 4.
  • [3-1] A screening method for a prophylactic or therapeutic agent for diabetes using inhibition of Nrf1 activity as an index.
  • (i) Measure the amount of binding between Nrf1 and MafG when Nrf1 and MafG are contacted in the presence of the test compound, and (ii) Nrf1 and MafG in the absence of the test compound. Measuring the binding amount of Nrf1 and MafG when contacted with (iii) and comparing the binding amount of Nrf1 and MafG in the case of (i) and (ii), The method according to [3-1] or [3-2] above.
  • a test compound in which the binding amount of Nrf1 and MafG in the case of (i) is lower than the binding amount of Nrf1 and MafG in the case of (ii) is selected as a compound that inhibits Nrf1 activity
  • the amount of Nrf1-labeled fusion protein in the cell when not contacted with (iii) and comparing the amount of Nrf1-labeled fusion protein in the case of (i) and (ii) above [ The method according to [3-1] or [3-7]. [3-9] A test compound in which the amount of Nrf1-labeled fusion protein in the case of (i) is lower than the amount of Nrf1-labeled fusion protein in the case of (ii) is selected as a compound that inhibits Nrf1 activity. The method according to [3-8] above.
  • Transgenic non-human animals [4-1] A transgenic non-human animal having at least one copy of a recombinant DNA containing a gene encoding Nrf1 and a MafG regulatory domain and being a diet-induced obesity (DIO) model. [4-2] The non-human animal according to [4-1], wherein the recombinant DNA has 4 copies. [4-3] The non-human animal according to [4-1] or [4-2] above, wherein the non-human animal is a mouse or a rat. [4-4] Use of the non-human animal according to any one of [4-1] to [4-3] as a diabetes model mouse.
  • An agent for preventing or treating diabetes comprising contacting a test compound with the non-human animal according to any one of [4-1] to [4-3] above, which has developed diabetes. Screening method.
  • the blood glucose level of the non-human animal according to any one of [4-1] to [4-3] above in contact with the test compound is measured, and the measured blood glucose level is the test compound.
  • a method for screening a prophylactic or therapeutic agent for diabetes comprising selecting the test compound as a candidate compound for the prophylactic or therapeutic agent for diabetes when the blood glucose level in the non-human animal that does not contact is lowered.
  • the present invention can provide a method for screening a prophylactic or therapeutic agent effective against diabetes using inhibition of Nrf1 activity as an index.
  • the present invention can provide a prophylactic or therapeutic agent effective for diabetes obtained by the screening method.
  • FIG. 1 It is a figure which shows regulatory SNP in a human NRF1 gene.
  • A Schematic diagram of a reporter construct of a chimeric DNA of 5′-flanking region of human NRF1 gene and luciferase cDNA. SNP rs3764400 with the T allele and the risk C allele for obesity is 1.8 kb upstream of the transcription start site (TSS) of the NRF1 gene.
  • TSS transcription start site
  • B It is a figure which shows the transcriptional activity of the NRF1 gene in a human liver cancer cell line. Data are relative firefly luciferase activity normalized by Renilla luciferase activity and represent mean ⁇ SEM.
  • A Schematic diagram of construction for systemic expression of Nrf1-FLAG under the control of MafG regulatory domain (MGRD).
  • B shows the expression levels of Nrf1 mRNA in the liver, skeletal muscle (SkM), white adipose tissue (WAT), brown adipose tissue (BAT), and brain of three strains of Nrf1-Tg mice. Data represent mean ⁇ SEM.
  • Nrf1 proliferating cell nuclear antigen
  • Tub ⁇ -tubulin proteins in WT and Nrf1-Tg mouse liver nuclei (Nrf1 and PCNA) or cytosol (Nrf1 and Tub) It is a figure which shows an expression level.
  • D Transgenic rescue from embryonic lethality of Nrf1-deficient mice by MGRD-Nrf1 transgene.
  • FIG. 2 shows a mating strategy for creating transgenic rescue mice (left panel).
  • ND normal diet
  • HFD high fat diet
  • FIG. 5 shows that Nrf1 induces insulin resistance in non-obese mice.
  • FIG. 5 shows that Nrf1 exacerbates insulin signals in the liver and SkM.
  • A Immunoblot analysis of liver and SkM phosphorylated Akt (Ser-473) and total Akt. After overnight fasting, WT mice and Nrf1-Tg (strain 1) mice that received HFD were administered insulin (Ins) or saline as vehicle (Veh).
  • p-Akt phosphorylated Akt (Ser-473);
  • t-Akt total Akt.
  • a to E Metabolomic analysis of the liver of a WT mouse and the liver of an Nrf1-Tg mouse subjected to HFD.
  • FIG. 6 shows plasma ⁇ -hydroxybutyric acid levels and plasma ammonia levels.
  • FIG. 3 shows that Nrf1 heterozygous knockout improves glucose metabolism in diet-induced obesity model mice and diabetes model mice.
  • Data are expressed as mean ⁇ SEM (for A) or as a scatter plot for each mouse (black or white dots) and the median for each group (black line) (for B and C).
  • Nrf1, MafG, Lipin1 and PGC-1 ⁇ 1.1.
  • Nrf1 “Nrf1” nuclear factor erythroid 2-related factor 1
  • CNC cap'n'collar
  • Nrf1 is regarded as an important regulator for various biological processes including metabolism. Nrf1 moves from the cytoplasm into the nucleus and forms a heterodimer with the Maf protein, thereby binding to the ARE (Antioxidant response element) sequence and activating the target gene.
  • the target gene of Nrf1 is, for example, a gene such as Lipin1 and PGC-1 ⁇ .
  • Nrf1 is not particularly limited, and examples thereof include those derived from humans and those derived from mice.
  • the gene and amino acid sequence of human Nrf1 are registered in GenBank as Accession No. NM_003204 (gene) (SEQ ID NO: 1) and Accession No. NP_003195 (protein) (SEQ ID NO: 2), respectively.
  • the gene and amino acid sequence of mouse Nrf1 are registered in GenBank as Accession No. NM_008686 (gene) (SEQ ID NO: 3) and Accession No. NP_032712 (protein) (SEQ ID NO: 4), respectively.
  • Nrf1 is used in the meaning of including mutants thereof as long as they have substantially the same activity as them.
  • the mutant include one or more of the amino acid sequences of Nrf1 (for example, 1 to 30, 1 to 29, 1 to 28, 1 to 27, 1 to 26, 1 to 25).
  • Pieces, 1-24 pieces, 1-23 pieces, 1-22 pieces, 1-21 pieces, 1-20 pieces, 1-19 pieces, 1-18 pieces, 1-17 pieces, 1-16 pieces, 1-15 pieces 1 to 14, 1 to 13, 1 to 12, 1 to 11, 1 to 10, 1 to 10 (1 to several), 1 to 8, 1 to 7, 1 to (6, 1-5, 1-4, 1-3, 1-2, or 1) amino acids are deleted, substituted, inserted and / or added.
  • the smaller the number of amino acids deleted, substituted, inserted or added the better.
  • Two or more of the amino acid residue deletions, substitutions, insertions and additions may occur simultaneously.
  • Nrf1 target gene transcriptional activity indicates that their activities are qualitatively (eg, physiologically or pharmacologically) equivalent. Therefore, Nrf1 target gene transcriptional activity, ARE binding activity, heterodimer forming ability with Maf protein, etc. are equivalent (eg, about 0.01 to 100 times, preferably about 0.1 to 10 times, more preferably 0.5 to 2 times). However, the quantitative factors such as the degree of activity and the molecular weight of the protein may be different.
  • Nrf1 generally refers to the Nrf1 protein, but may refer to the Nrf1 gene depending on the context.
  • MafG is one of the small Maf group factors. It is a transcription factor with a basic leucine zipper (bZip) structure consisting of a basic region involved in DNA recognition and a leucine zipper necessary to form heterodimers. is there. MafG forms a heterodimer with Nrf1 and binds to the ARE sequence of the target gene.
  • bZip basic leucine zipper
  • MafG is not particularly limited, and examples thereof include those derived from humans and those derived from mice.
  • the gene and amino acid sequence of human MafG are registered in GenBank as Accession No. NM_002359 (gene) (SEQ ID NO: 13) and Accession No. NP_002350 (protein) (SEQ ID NO: 14), respectively.
  • the gene and amino acid sequence of mouse MafG are registered in GenBank as Accession No. NM_010756 (gene) (SEQ ID NO: 15) and Accession No. NP_034886 (protein) (SEQ ID NO: 16), respectively.
  • MafG is used in the meaning of including mutants thereof as long as they have substantially the same activity as them.
  • the mutant include one or more of the amino acid sequences of Nrf1 (for example, 1 to 30, 1 to 29, 1 to 28, 1 to 27, 1 to 26, 1 to 25).
  • Pieces, 1-24 pieces, 1-23 pieces, 1-22 pieces, 1-21 pieces, 1-20 pieces, 1-19 pieces, 1-18 pieces, 1-17 pieces, 1-16 pieces, 1-15 pieces 1 to 14, 1 to 13, 1 to 12, 1 to 11, 1 to 10, 1 to 10 (1 to several), 1 to 8, 1 to 7, 1 to (6, 1-5, 1-4, 1-3, 1-2, or 1) amino acids are deleted, substituted, inserted and / or added.
  • the smaller the number of amino acids deleted, substituted, inserted or added the better.
  • Two or more of the amino acid residue deletions, substitutions, insertions and additions may occur simultaneously.
  • substantially the same quality of activity examples include transcription promotion activity of target genes, MARE (Maf recognition sequence) binding activity, ARE binding activity, homodimer formation ability, heterodimer formation ability with CNC family transcription factors, and the like.
  • MARE Micro recognition sequence
  • ARE binding activity homodimer formation ability, heterodimer formation ability with CNC family transcription factors, and the like.
  • transcriptional activity of target gene, MARE binding activity, ARE binding activity, homodimer formation ability, heterodimer formation ability with CNC family transcription factors, etc. are equivalent (eg, about 0.01 to 100 times, preferably about 0.1 to 10 times) More preferably, it is 0.5 to 2 times), but quantitative factors such as the degree of activity and the molecular weight of the protein may be different.
  • MafG generally refers to a MafG protein, but may refer to a MafG gene depending on the context.
  • Lipin1 is a protein belonging to the Lipin family together with Lipin2, Lipin3, and the like. Lipin1 is known to have two functions of regulating lipid metabolism due to differences in subcellular localization. First, Lupin1 has phosphatidate phosphatase activity on the endoplasmic reticulum membrane. Second, Lipin1 also acts as a coactivator of the PPAR ⁇ / PGC-1 ⁇ regulatory pathway in the nucleus, positively regulating the oxidative metabolism of fatty acids.
  • Lipin1 is not particularly limited, and examples thereof include those derived from humans and those derived from mice.
  • the gene and amino acid sequence of human Lipin1 are registered in GenBank as Accession No. NM_145693 (gene) (SEQ ID NO: 5) and Accession No. NP_663731 (protein) (SEQ ID NO: 6), respectively.
  • the gene and amino acid sequence of mouse Lipin1 are registered in GenBank as Accession No. NM_172950 (gene) (SEQ ID NO: 7) and Accession No. NP_766538 (protein) (SEQ ID NO: 8), respectively.
  • Lipin1 is used in the meaning of including mutants thereof as long as they have substantially the same activity as them.
  • the mutant include one to a plurality (for example, 1 to 30, 1 to 29, 1 to 28, 1 to 27, 1 to 26, 1 to 25) in the amino acid sequence of Lipin1.
  • Pieces, 1-24 pieces, 1-23 pieces, 1-22 pieces, 1-21 pieces, 1-20 pieces, 1-19 pieces, 1-18 pieces, 1-17 pieces, 1-16 pieces, 1-15 pieces 1 to 14, 1 to 13, 1 to 12, 1 to 11, 1 to 10, 1 to 10 (1 to several), 1 to 8, 1 to 7, 1 to (6, 1-5, 1-4, 1-3, 1-2, or 1) amino acids are deleted, substituted, inserted and / or added.
  • the smaller the number of amino acids deleted, substituted, inserted or added the better. Two or more of the amino acid residue deletions, substitutions, insertions and additions may occur simultaneously.
  • substantially the same activity examples include phosphatidic acid phosphatase activity, coactivator activity of PPAR ⁇ / PGC-1 ⁇ regulatory pathway, and the like.
  • Substantially homogeneous indicates that their activities are qualitatively (eg, physiologically or pharmacologically) equivalent. Therefore, the phosphatidic acid phosphatase activity and the coactivator activity of the PPAR ⁇ / PGC-1 ⁇ regulatory pathway are equivalent (eg, about 0.01 to 100 times, preferably about 0.1 to 10 times, more preferably 0.5 to 2 times). However, quantitative factors such as the degree of these activities and the molecular weight of the protein may be different.
  • Lipin1 generally means Lipin1 protein, but it may mean Lipin1 gene depending on the context.
  • PGC-1 ⁇ peroxisome proliferator-activated receptor ⁇ coactivator 1 ⁇
  • ERR ⁇ estrogen-related receptor ⁇
  • nuclear respiratory factor 1 peroxisome proliferator-activated receptor ⁇ coactivator 1 ⁇
  • PGC-1 ⁇ knockout mice show altered expression of mitochondrial oxidative metabolic genes and high-fat diet-induced fatty liver.
  • PGC-1 ⁇ is not particularly limited, and examples thereof include those derived from humans and those derived from mice.
  • the gene and amino acid sequence of human PGC-1 ⁇ are registered in GenBank as Accession No. NM_133263 (gene) (SEQ ID NO: 9) and Accession No. NP_573570 (protein) (SEQ ID NO: 10), respectively.
  • the gene and amino acid sequence of mouse PGC-1 ⁇ are registered in GenBank as Accession No. NM_133249 (gene) (SEQ ID NO: 11) and Accession No. NP_573512 (protein) (SEQ ID NO: 12), respectively.
  • PGC-1 ⁇ has substantially the same activity as that of the PGC-1 ⁇ , it is used in a meaning including its mutants.
  • the mutant include one to a plurality (for example, 1 to 30, 1 to 29, 1 to 28, 1 to 27, 1 to 26, 1 to 1) in the amino acid sequence of the above PGC-1 ⁇ . ⁇ 25, 1-24, 1-23, 1-22, 1-21, 1-20, 1-19, 1-18, 1-17, 1-16, 1 ⁇ 15, 1-14, 1-13, 1-12, 1-11, 1-10, 1-9 (1 to several), 1-8, 1-7, (1-6, 1-5, 1-4, 1-3, 1-2, or 1) amino acids deleted, substituted, inserted and / or added proteins It is done. In general, the smaller the number of amino acids deleted, substituted, inserted or added, the better. Two or more of the amino acid residue deletions, substitutions, insertions and additions may occur simultaneously.
  • Examples of the activity of substantially the same quality include co-activation activity of ERR ⁇ and nuclear respiratory factor 1 and the like. Substantially homogeneous indicates that their activities are qualitatively (eg, physiologically or pharmacologically) equivalent. Therefore, it is preferable that the co-activation activity of ERR ⁇ and nuclear respiratory factor 1 is equivalent (eg, about 0.01 to 100 times, preferably about 0.1 to 10 times, more preferably 0.5 to 2 times). Quantitative factors such as the degree of activity and the molecular weight of the protein may be different.
  • PGC-1 ⁇ generally means a PGC-1 ⁇ protein, but it may mean a PGC-1 ⁇ gene depending on the context.
  • the present invention provides a preventive or therapeutic agent for diabetes containing Nrf1 inhibitor.
  • the present invention also provides a method for preventing or treating diabetes, comprising administering a therapeutically effective amount of an Nrf1 inhibitor to a subject in need of prevention or treatment of diabetes.
  • the preventive or therapeutic agent comprising the Nrf1 inhibitor of the present invention is characterized by having an insulin resistance improving action.
  • the preventive or therapeutic agent comprising the Nrf1 inhibitor of the present invention is characterized by having both an insulin resistance improving action and a ⁇ cell protecting action.
  • Nrf1 is a strong metabolic regulator by analysis of mice genetically overexpressing Nrf1, and found that mice develop diabetes due to overexpression of Nrf1.
  • analysis of diabetic model mice and the like that genetically suppressed Nrf1 expression revealed that suppression of Nrf1 resulted in improved glucose metabolism, and found that the onset of diabetes was suppressed.
  • the present invention provides an Nrf1 inhibitor as an insulin resistance improving agent.
  • a pharmaceutical composition containing an Nrf1 inhibitor is used as a pharmaceutical composition for improving insulin resistance.
  • an Nrf1 inhibitor is used in the production of a pharmaceutical composition for improving insulin resistance.
  • the present invention provides a method for improving insulin resistance comprising administering to a subject in need of improvement of insulin resistance a therapeutically effective amount of an Nrfl inhibitor.
  • the improvement in insulin resistance can be confirmed by, for example, a decrease in blood glucose level and a decrease in HOMA-IR in an insulin resistance test described in Example 1 (method 1.4.) Described later.
  • the present invention provides an Nrf1 inhibitor as a ⁇ -cell protective agent.
  • a pharmaceutical composition containing an Nrf1 inhibitor is used as a pharmaceutical composition for protecting ⁇ cells.
  • an Nrf1 inhibitor is used in the production of a pharmaceutical composition for protecting ⁇ cells.
  • the present invention provides a ⁇ -cell protection method comprising administering to a subject in need of ⁇ -cell protection a therapeutically effective amount of an Nrf1 inhibitor.
  • [Beta] cell protective action refers to inhibiting the decrease in the amount and / or activity of ⁇ cells.
  • the amount of ⁇ -cells can be confirmed by the method described in Example 1 (Method 1.7., Result 2.5.) described later (insulin staining of pancreatic slices) and the like.
  • the activity of ⁇ cells is confirmed, for example, by the method described in Example 1 (Method 1.4.) described later, that sugar-stimulated insulin secretion (GSIS) is maintained.
  • Nrf1 inhibitor or the ⁇ -cell protecting pharmaceutical composition containing the same exerts an effect on suppression of the onset of type 2 diabetes, that is, prevention, when used in the stage of impaired glucose tolerance, which can be said to be a pre-diabetic stage.
  • Nrf1 inhibitor used in the present invention refers to a substance that inhibits Nrf1 activity.
  • Nrf1 activity includes, for example, the above-described transcription promoting activity of Nrf1 target gene, ARE binding activity of Nrf1, Nrf1-Maf heterodimer forming ability and the like.
  • siRNA, shRNA, antisense polynucleotide, peptide, protein, enzyme and the like can be used in addition to a low molecular compound or a high molecular compound.
  • Nrf1 inhibitor refers to a substance having an activity of inhibiting at least one of the Nrf1 activities. Inhibition of Nrf1 activity includes, for example, (1) inhibiting Nrf1 expression, (2) inhibiting Nrf1 translocation from the cytoplasm to the nucleus, (3) inhibiting Nrf1-Maf heterodimer formation, ( 4) Inhibiting the binding of Nrf1 to ARE, and (5) Promoting the transition of Nrf1 from the nucleus to the cytoplasm.
  • “Inhibiting Nrf1 expression” means any event in a series of events (for example, transcription (production of mRNA), translation (production of protein)) from the Nrf1 gene until protein is produced. Inhibiting the expression means inhibiting the production of the protein.
  • “Inhibiting Nrf1 translocation from the cytoplasm to the nucleus” refers to inhibiting Nrf1 degradation by regulating Nrf1 degradation, and inhibiting Nrf1 phosphorylation to inhibit nuclear translocation. And so on.
  • Nrf1-Maf heterodimer formation means inhibiting Nrf1-Maf heterodimer formation by inhibiting Nrf1 translocated into the nucleus from binding to Maf, and Maf homodimer formation. By promoting, it means inhibiting the formation of Nrf1-Maf heterodimer, and the like.
  • Nrf1 transferred into the nucleus inhibits formation of a heterodimer with Maf and inhibits Nrf1 from binding to the ARE sequence
  • Nrf1-Maf It means inhibiting the binding of the heterodimer to the ARE sequence, inhibiting the binding of the Nrf1-Maf heterodimer to the ARE sequence by promoting Maf homodimer formation, and the like.
  • Nrf1 “Promoting the transition of Nrf1 from the nucleus to the cytoplasm” means that Nrf1 that has migrated into the nucleus returns to the cytoplasm, thereby inhibiting Nrf1 from continuing to exert transcription-promoting activity in the nucleus. , Etc.
  • Nrf1 inhibitors specifically include (a) siRNA or shRNA against a polynucleotide encoding Nrf1, (b) an antisense polynucleotide containing a base sequence complementary to or substantially complementary to the base sequence of the polynucleotide encoding Nrf1, or a part thereof, (c) a low molecular weight compound or a high molecular weight compound that inhibits Nrf1 activity, (d) a ribozyme against a polynucleotide encoding Nrf1, (e) a mutant of Nrf1 that acts dominantly negatively on Nrf1 or a polynucleotide encoding the same, and (f) One or two or more substances selected from the group consisting of aptamers to Nrf1.
  • the “low molecular weight compound” means an organic or inorganic substance having a molecular weight of 10,000 or less (preferably a molecular weight of 5,000 or less, more preferably a molecular weight of 2,000 or less, particularly preferably a molecular weight of 700 or less).
  • the “polymer compound” means an organic substance having a molecular weight exceeding 10,000 (preferably a molecular weight of 50,000 or more, more preferably a molecular weight of 100,000 or more).
  • Nrf1 activity can be measured by a known method or a method analogous thereto.
  • the transcription promoting activity of the Nrf1 target gene among the Nrf1 activities is determined by, for example, isolating the promoter region of the target gene of Nrf1 according to a conventional method by observing the transcriptional activation ability of Nrf1, and a reporter gene (for example, Luminescence, fluorescence, chromogenic genes (such as luciferase, GFP, galactosidase, etc.) are linked, and the activity of the reporter gene can be observed for measurement.
  • Nrf1 activity can be taken as an indicator of stabilization of Nrf1 protein.
  • Nrf1 activity can be measured by expressing a fusion protein of Nrf1 and a reporter gene and observing the activity of the reporter gene (for example, Patent Document 1, Example 3 described later, and the like).
  • Nrf1-Maf heterodimer formation ability can be determined by examining the ability of Nrf1 and Maf to form heterodimer, for example, by using Biacore or ELISA as described in the method of Example 2 described later. It can be measured by an assay system that evaluates the interaction.
  • ITC isothermal titration calorimetry
  • DELFIA dissociation enhanced lanthanide fluorescence immunoassay
  • APHA chemically amplified luminescence proximity homogeneous assay
  • SPA scintillation proximity assay
  • FRET fluorescence resonance energy transfer
  • TR-FRET fluorescence resonance energy transfer
  • FP fluorescence polarization
  • EFC enzyme fragment complementation
  • the ARE binding activity of Nrf1 can be measured by observing the binding of Nrf1 to ARE by a ChIP assay or the like.
  • the measurement by ChIP assay can be performed by a known method or a method analogous thereto (for example, Cell Vol.103 pp843-852 (2000)).
  • it can be measured by an assay system that evaluates the binding of the Nrf1-MafG heterodimer to the ARE sequence by Biacore or ELISA, as in the method of Example 2 described later.
  • ITC isothermal titration calorimetry
  • DELFIA dissociation enhanced lanthanide fluorescence immunoassay
  • APHA chemically amplified luminescence proximity homogeneous assay
  • SPA scintillation proximity assay
  • FRET fluorescence resonance energy transfer
  • TR-FRET fluorescence resonance energy transfer
  • FP fluorescence polarization
  • EFC enzyme fragment complementation
  • siRNA or shRNA against a polynucleotide encoding Nrf1 Double-stranded RNA that has RNAi action on the Nrf1-encoding polynucleotide has low toxicity and suppresses translation of the Nrf1-encoding gene And can suppress the expression of Nrf1, and therefore can be suitably used as a substance that inhibits the expression of Nrf1.
  • double-stranded RNA having RNAi action on a polynucleotide encoding Nrf double-stranded RNA containing a part of RNA encoding Nrf1 (eg, siRNA for a polynucleotide encoding Nrf1) (Small (short) interfering RNA), shRNA (small (short) hairpin RNA) and the like.
  • Such double-stranded RNA can be obtained by known methods (eg, Nature, 411, 494, 2001; Special Tables 2002-516062; U.S. Patent Application Publication No. 2002/086356; Nature Genetics, 24 Volume, 180-183, 2000; Genesis, 26, 240-244, 2000; Nature, 407, 319-320, 2002; Genes & Dev., 16, 948-958, 2002 Proc. Natl. Acad. Sci. USA., 99, 5515-5520, 2002; Science, 296, 550-553, 2002; Proc. Natl. Acad. Sci.
  • the length of the double-stranded RNA having RNAi action used in the present invention is usually 17 to 30 bases, preferably 19 to 27 bases, more preferably 20 to 22 bases.
  • dTdT may be added to each C-terminus of the sense strand and antisense strand of siRNA.
  • it may have an overhang arrangement suitable from a functional viewpoint with reference to known information.
  • siRNA that is an Nrf1 inhibitor examples include Nrf1 siRNA described in Example 3 (Mol. Cell. Biol., 31, 4500-4512, 2011) described later. Further, as known siRNA, for example, “Nrf1 siRNA (h): sc-43575 (Santa Cruz)”, “Nrf1 siRNA (m): sc-43576 (Santa Cruz)” (J. Biol. Chem., 282, 22052-22061 (2007), “NFE2L1 Trilencer-27 Human siRNA: SR303155 (OriGene)”, “Nfe2l1 Trilencer-27 Mouse siRNA: SR419737 (OriGene)”.
  • Known shRNAs include, for example, ⁇ Nrf1 shRNA Plasmid (h): sc-43575-SH (Santa Cruz) '', ⁇ Nrf1 shRNA Plasmid (m): sc-43576-SH (Santa Cruz) '', ⁇ NFE2L1 Human shRNA: TR311195 (OriGene) ”and“ NFE2L1 Mouse shRNA: TR501459 (OriGene) ”.
  • an antisense polynucleotide containing a nucleotide sequence complementary to or substantially complementary to the nucleotide sequence of a polynucleotide encoding Nrf1 or a part thereof, preferably a polynucleotide (preferably DNA) encoding Nrf1 (hereinafter referred to as an anti-antibody)
  • these DNAs have a base sequence complementary to or substantially complementary to the base sequence of “sometimes abbreviated as“ DNA used in the present invention ”” or a part thereof.
  • the antisense polynucleotide has a base sequence complementary to or substantially complementary to the base sequence of the DNA used in the present invention or a part thereof, and has an action capable of suppressing the expression of the DNA. As long as it is any antisense polynucleotide, antisense DNA is preferred.
  • the base sequence substantially complementary to the DNA used in the present invention is, for example, the entire base sequence of the base sequence complementary to the DNA used in the present invention (that is, the complementary strand of the DNA used in the present invention) or Examples include base sequences having homology of about 70% or more, preferably about 80% or more, more preferably about 90% or more, and most preferably about 95% or more with a partial base sequence.
  • the nucleotide sequence of the portion encoding the N-terminal site of Nrf1 for example, the start codon
  • an antisense polynucleotide directed to RNA degradation by RNaseH it is about 70% or more, preferably about 80% or more, more preferably about 90%, with the complementary strand of the entire base sequence of DNA used in the present invention including introns.
  • Each of the antisense polynucleotides having a homology of at least%, most preferably at least about 95% is preferred.
  • the antisense polynucleotide is usually composed of 10 to 40 bases, preferably 15 to 30 bases.
  • phosphate residues (phosphates) of each nucleotide that constitutes antisense DNA are converted to chemically modified phosphate residues such as phosphorothioate, methylphosphonate, and phosphorodithionate. May be substituted.
  • the sugar (deoxyribose) of each nucleotide may be substituted with a chemically modified sugar structure such as 2′-O-methylation, and the base part (pyrimidine, purine) is also chemically modified. Any one may be used as long as it hybridizes to the DNA used in the present invention.
  • These antisense polynucleotides can be produced using a known DNA synthesizer or the like.
  • the antisense polynucleotide of the present invention may be altered or contain modified sugars, bases and bonds, and may be provided in special forms such as liposomes, microspheres, or applied by gene therapy. Can be provided in an added form.
  • the additional form includes polycationic substances such as polylysine that acts to neutralize the charge of the phosphate group skeleton, lipids that enhance interaction with cell membranes and increase nucleic acid uptake ( Examples include hydrophobic ones such as phospholipid and cholesterol.
  • Preferred lipids for addition include cholesterol and derivatives thereof (eg, cholesteryl chloroformate, cholic acid, etc.).
  • nucleic acids can be attached via bases, sugars, intramolecular nucleoside linkages.
  • examples of the other group include a cap group specifically arranged at the 3 'end or 5' end of a nucleic acid, which prevents degradation by nucleases such as exonuclease and RNase.
  • capping groups include, but are not limited to, hydroxyl protecting groups known in the art, including glycols such as polyethylene glycol and tetraethylene glycol.
  • the compound (including salt form) that inhibits Nrf1 activity is not particularly limited as long as it can inhibit Nrf1 activity as described above. , (1) a compound that inhibits Nrf1 expression, (2) a compound that inhibits Nrf1 translocation from the cytoplasm to the nucleus, (3) a compound that inhibits Nrf1-Maf heterodimer formation, (4) Nrf1 to ARE Compounds that inhibit binding, and (5) compounds that promote the transition of Nrf1 from the nucleus to the cytoplasm.
  • the compound that inhibits the expression of Nrf1 is not particularly limited as long as it can inhibit the expression of Nrf1, but, for example, (i) an mRNA encoding Nrf1 from a gene (DNA) encoding Nrf1 And (ii) a compound that inhibits the translation of mRNA encoding Nrf1 into Nrf1. (i) Any compound that inhibits transcription from Nrf1-encoding gene (DNA) to Nrf1-encoding mRNA may be used as long as it inhibits transcription from Nrf1-encoding gene (DNA) to mRNA. For example, a compound that binds to a factor involved in transcription from a gene (DNA) encoding Nrf1 to mRNA and inhibits transcription can be mentioned.
  • the compound that inhibits the translation of Nrf1-encoding mRNA into Nrf1 is not particularly limited as long as it inhibits the translation of Nrf1-encoding mRNA into Nrf1, but for example, encodes Nrf1 Examples thereof include compounds that bind to factors involved in translation from mRNA to Nrf1 and inhibit translation.
  • the compound that inhibits the transfer of Nrf1 from the cytoplasm to the nucleus is not particularly limited as long as it can inhibit the transfer of Nrf1 from the cytoplasm to the nucleus, but for example, (i) degradation of Nrf1 And (ii) compounds that change the phosphorylation state of Nrf1. (i) The compound that regulates Nrf1 degradation is not particularly limited as long as it inhibits the transfer to the nucleus by regulating Nrf1 degradation. And compounds that act and promote the decomposition of Nrf1.
  • the compound that changes the phosphorylation state of Nrf1 is not particularly limited as long as it inhibits translocation to the nucleus by changing the phosphorylation state of Nrf1, but for example, phosphorylation of Nrf1 Examples include compounds that act on the factors involved and change the phosphorylation state of Nrf1.
  • Nrf1-Maf heterodimer formation is not particularly limited as long as it can inhibit Nrf1-Maf heterodimer formation.
  • Nrf1 binds to Maf.
  • compounds that inhibit (ii) compounds that inhibit Nrf1-Maf heterodimer formation by promoting Maf homodimer formation, and the like.
  • the compound that inhibits the binding of Nrf1 to Maf is not particularly limited as long as it inhibits the binding of Nrf1 to Maf.For example, it binds to the binding region of Nrf1 and Maf, Examples thereof include compounds that inhibit Nrf1 from binding to Maf, and compounds that cause Nrf1 structural change by binding to Nrf1 and inhibit Nrf1 from binding to Maf.
  • a compound that inhibits Nrf1-Maf heterodimer formation by promoting Maf homodimer formation is not particularly limited as long as it inhibits Nrf1-Maf heterodimer formation by promoting Maf homodimer formation. However, for example, compounds that promote the formation of Maf homodimer by increasing the expression of Maf can be mentioned.
  • the compound that inhibits the binding of Nrf1 to ARE is not particularly limited as long as it can inhibit the binding of Nrf1 to ARE.
  • Nrf1-Maf heterodimer formation is inhibited.
  • a compound that inhibits Nrf1-Maf heterodimer from binding to the ARE sequence (iii) a compound that promotes the formation of Maf homodimer, and the like.
  • Examples of (i) a compound that inhibits Nrf1-Maf heterodimer formation include (3) the compound that inhibits Nrf1-Maf heterodimer formation.
  • the compound that inhibits the binding of the Nrf1-Maf heterodimer to the ARE sequence is not particularly limited as long as it inhibits the binding of the Nrf1-Maf heterodimer to the ARE sequence.
  • the compound that promotes the formation of Maf homodimer is not particularly limited as long as it promotes the formation of Maf homodimer, and examples thereof include compounds that promote the formation of Maf homodimer by increasing the expression of Maf. It is done.
  • the compound that promotes the transfer of Nrf1 from the nucleus to the cytoplasm is not particularly limited as long as it can promote the transfer of Nrf1 from the nucleus to the cytoplasm, but for example, (i) degradation of Nrf1 And (ii) compounds that change the phosphorylation state of Nrf1. (i) The compound that regulates the degradation of Nrf1 is not particularly limited as long as it promotes the transition to the cytoplasm by regulating the degradation of Nrf1, but for example, it is a factor involved in the regulation of Nrf1 degradation. And compounds that act and promote the decomposition of Nrf1.
  • the compound that changes the phosphorylation state of Nrf1 is not particularly limited as long as it promotes the transition to the cytoplasm by changing the phosphorylation state of Nrf1, but for example, phosphorylation of Nrf1 Examples include compounds that act on the factors involved and change the phosphorylation state of Nrf1.
  • Ribozyme against a polynucleotide encoding Nrf1 A polynucleotide having ribozyme activity against a polynucleotide encoding Nrf1 can suppress the expression of Nrf1, and therefore is preferably used as a substance that inhibits the expression of Nrf1. can do.
  • Such ribozymes can be obtained by known methods (eg, TRENDS in Molecular Medicine, 7, 221, 2001; FEBS Lett., 228, 228, 1988; FEBS Lett., 239, 285, 1988). Nucl. Acids. Res., 17, 7059, 1989; Nature, 323, 349, 1986; Nucl. Acids. Res., 19, 6751, 1991; Protein Eng.
  • RNA encoding Nrf1 examples include a portion (RNA fragment) adjacent to the cleavage site on the RNA encoding Nrf1 that can be cleaved by a known ribozyme.
  • the ribozymes include large ribozymes such as M1 RNA contained in Group I introns and RNaseP, and small ribozymes such as hammerhead and hairpin types (Protein Nucleic Acid Enzyme, 35, 2191, 1990).
  • hammerhead ribozymes include FEBS Lett., 228, 228, 1988; FEBS Lett., 239, 285, 1988; Protein Nucleic Acid Enzyme, 35, 2191, 1990; Nucl. Acids Res., 17, 7059, 1989, etc. can be referred to.
  • hairpin ribozymes see, for example, Nature, 323, 349, 1986; Nucl. Acids Res., 19, 6751, 1991; Chemistry and Biology, 30, 112, 1992, etc. You can refer to it.
  • Nrf1 mutants acting on dominant negative against Nrf1 or polynucleotides encoding the same Nrf1 mutants acting on dominant negative against Nrf1 or polynucleotides encoding the same inhibit Nrf1 activity Therefore, it can be suitably used as a substance that inhibits Nrf1 activity.
  • the term “mutant of a protein that acts dominantly negatively on Nrf1” means a protein having an action of inhibiting (disappearing or reducing) Nrf1 activity by its expression (Yoshikazu Multiratio) (See Seiko, Gene Function Inhibition Experiments, Yodosha, pp. 26-32, 2001).
  • aptamer against Nrf1 can inhibit Nrf1 activity and function, and therefore can be suitably used as a substance that inhibits Nrf1 activity.
  • Aptamers are obtained using a known method, for example, the SELEX (systematic evolution of ligands by exponential enrichment) method (Annual Review of Medicine 56, 555-583, 2005).
  • the structure of an aptamer can be determined using a known method, and an aptamer is produced according to a known method based on the structure.
  • a medicament comprising the above-mentioned Nrf1 inhibitor is used as a prophylactic or therapeutic agent for diabetes.
  • a medicament comprising the above-described Nrf1 inhibitor is used for a method for preventing or treating diabetes. Since the medicament of the present invention has a preventive or therapeutic effect on diabetes, it may be applied to a subject of diabetes (type 1 diabetes, type 2 diabetes, gestational diabetes, etc.) for treatment purposes, and considering prevention or recurrence of diabetes. It can also be applied for preventive purposes to those who must. Preferably applied for therapeutic purposes.
  • the “subject” is a human, non-human mammal (eg, rat, mouse, hamster, rabbit, sheep, pig, cow, cat, dog and monkey), and preferably a human.
  • glucose level glucose concentration in venous plasma
  • 75 g oral glucose tolerance test 75 gOGTT 2 hour value (venous plasma)
  • Glucose concentration at 200 mg / dl or higher Glucose concentration at any time is 200 mg / dl or higher.
  • the at least one symptom of diabetes can be prevented or treated by the preventive or therapeutic agent of the present invention and the preventive or therapeutic method of the present invention (“the preventive or therapeutic agent of the present invention”).
  • an Nrf1 inhibitor can be formulated according to conventional means and used as a pharmaceutical composition for preventing or treating diabetes.
  • an Nrf1 inhibitor can be formulated according to conventional means and used for a method for preventing or treating diabetes.
  • compositions for oral administration include solid or liquid dosage forms, specifically tablets (including dragees and film-coated tablets), pills, granules, powders, capsules (including soft capsules). Syrup, emulsion, suspension and the like.
  • Such a composition is produced by a method known per se, and contains a carrier, diluent or excipient usually used in the pharmaceutical field.
  • a carrier diluent or excipient usually used in the pharmaceutical field.
  • lactose, starch, sucrose, magnesium stearate and the like are used as carriers and excipients for tablets.
  • injections for example, injections, suppositories and the like are used, and injections are intravenous injections, subcutaneous injections, intradermal injections, intramuscular injections, intravenous injections, intraarticular injections. Includes dosage forms such as agents.
  • Such an injection is prepared according to a method known per se, for example, by dissolving, suspending or emulsifying the active ingredient in a sterile aqueous or oily liquid usually used for injections.
  • aqueous solution for injection for example, isotonic solutions containing physiological saline, glucose and other adjuvants are used, and suitable solubilizers such as alcohol (eg, ethanol), polyalcohol (eg, Propylene glycol, polyethylene glycol), nonionic surfactants (eg, polysorbate 80, HCO-50 (polyoxyethylene (50 mol) adduct of hydrogenated castor oil)) and the like may be used in combination.
  • alcohol eg, ethanol
  • polyalcohol eg, Propylene glycol, polyethylene glycol
  • nonionic surfactants eg, polysorbate 80, HCO-50 (polyoxyethylene (50 mol) adduct of hydrogenated castor oil)
  • oily liquid for example, sesame oil, soybean oil and the like are used, and benzyl benzoate, benzyl alcohol and the like may be used in combination as a solubilizing agent.
  • the prepared injection solution is usually filled in a suitable amp
  • compositions may contain other active ingredients (for example, other antidiabetic agents, etc.) as long as an undesirable interaction is not caused by blending with the above active ingredients. Moreover, you may use together with another active ingredient (for example, other antidiabetic agents etc.).
  • active ingredients for example, other antidiabetic agents, etc.
  • the dose of the active ingredient varies depending on its action, target disease, administration subject, symptom, administration route, etc., but for example, when administered orally, generally in adults (weight 60 kg)
  • the active ingredient is administered at about 0.1-100 mg, preferably about 1.0-50 mg, more preferably about 1.0-20 mg per day.
  • the dosage of the active ingredient varies depending on the target disease, administration subject, symptom, administration route, etc., but when administered in the form of an injection, it is generally an adult (with a body weight of 60 kg).
  • the antisense polynucleotide can be formulated and administered according to a method known per se.
  • an appropriate vector such as a retrovirus vector, an adenovirus vector, an adenovirus associated virus vector, etc., a human or non-human mammal (eg, Rats, mice, hamsters, rabbits, sheep, pigs, cows, cats, dogs, monkeys, etc.) orally or parenterally.
  • the antisense polynucleotide can be formulated as it is or with a physiologically recognized carrier such as an adjuvant for promoting intake, and can be administered by a gene gun or a catheter such as a hydrogel catheter. Alternatively, it can be aerosolized and locally administered into the trachea as an inhalant. Furthermore, for the purpose of improving pharmacokinetics, prolonging the half-life, and improving cellular uptake efficiency, the above-mentioned antisense polynucleotides are formulated (injection) alone or with a carrier such as liposome, and are administered intravenously, subcutaneously, joint space Of these, it may be administered to cancerous lesions.
  • a physiologically recognized carrier such as an adjuvant for promoting intake
  • RNA, ribozyme, mutant of the protein used in the present invention that acts dominant negatively on the protein used in the present invention or a polynucleotide encoding the same are the same as the above antisense polynucleotide.
  • the above antibodies, aptamers and the like can be administered per se or as an appropriate pharmaceutical composition.
  • the pharmaceutical composition used for the administration comprises the antibody or a salt thereof and a pharmacologically acceptable carrier, diluent or excipient.
  • Such compositions are provided as dosage forms suitable for oral or parenteral administration (eg, intravenous injection). Preferably it is provided as an inhalant.
  • Screening method for preventive or therapeutic agent for diabetes provides a method for screening the preventive or therapeutic agent for diabetes described above using inhibition of Nrf1 activity as an index.
  • the screening method of the present invention is a method comprising evaluating the inhibition of Nrf1 activity by a test compound and selecting a compound that inhibits Nrf1 activity.
  • the compound that inhibits Nrf1 activity selected by the screening method of the present invention is a candidate compound for the preventive or therapeutic agent for diabetes described in the present specification.
  • test compound examples include peptides, proteins, antibodies, non-peptidic compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, plasma and the like, and these compounds are novel.
  • a compound may be sufficient and a well-known compound may be sufficient.
  • the test compound may form a salt, and as the salt of the test compound, physiologically acceptable metal salts, ammonium salts, salts with organic bases, salts with inorganic acids, salts with organic acids, bases And salts with acidic or acidic amino acids.
  • the metal salt include alkali metal salts such as sodium salt and potassium salt; alkaline earth metal salts such as calcium salt, magnesium salt and barium salt; aluminum salt and the like.
  • Preferable examples of the salt with an organic base include, for example, trimethylamine, triethylamine, pyridine, picoline, 2,6-lutidine, ethanolamine, diethanolamine, triethanolamine, cyclohexylamine, dicyclohexylamine, N, N′-dibenzylethylenediamine. And the like.
  • Preferable examples of the salt with inorganic acid include salts with hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, phosphoric acid and the like.
  • salts with organic acids include formic acid, acetic acid, trifluoroacetic acid, propionic acid, phthalic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, malic acid, methanesulfonic acid And salts with benzoic acid, benzenesulfonic acid, p-toluenesulfonic acid and the like.
  • salts with basic amino acids include salts with arginine, lysine, ornithine and the like
  • salts with acidic amino acids include salts with aspartic acid and glutamic acid, for example. It is done.
  • Nrf1 a method for screening an agent for preventing or treating diabetes, which comprises using Nrf1.
  • a method for screening for a prophylactic or therapeutic agent for diabetes comprising using Nrf1 to select a compound that inhibits Nrf1 activity.
  • Nrf1 the amount of binding between Nrf1 and MafG when Nrf1 and MafG are contacted in the presence of the test compound is measured, and (ii) Nrf1 is not present in the absence of the test compound.
  • the amount of binding between Nrf1 and MafG when MafG is brought into contact is measured, and the amount of binding between Nrf1 and MafG is compared between (iii) and (ii). Then, a test compound in which the binding amount between Nrf1 and MafG in the case (i) is lower than the binding amount between Nrf1 and MafG in the case (ii) is selected as a compound that inhibits Nrf1 activity.
  • Contact means that Nrf1 and MafG are present in the same culture system or reaction system.
  • Culture conditions or reaction conditions can be performed under conditions that are usually used or conditions similar thereto.
  • the amount of binding can be measured by a known method or a method analogous thereto.
  • SPR surface plasmon resonance
  • ITC isothermal titration calorimetry
  • TRF time-resolved fluorescence
  • DELFIA DELFIA
  • ELISA ELISA
  • FCS fluorescence correlation spectroscopy
  • FCCS fluorescence cross correlation spectroscopy
  • APHA chemically amplified luminescence proximity homogenous assay
  • SPA scintillation proximity assay
  • FRET fluorescence resonance energy transfer
  • LANCE LANCE
  • the amount of binding can be measured using homogeneous assays such as time-resolved fluorescence resonance energy transfer (TR-FRET), fluorescence polarization (FP) or enzyme fragment complementation (EFC).
  • TR-FRET time-resolved fluorescence resonance energy transfer
  • FP fluorescence polarization
  • EFC enzyme fragment complementation
  • HTS High-throughput screening
  • the amount of binding is measured, for example, by immobilizing Nrf1 on a sensor chip and using MafG as an analyte.
  • the amount of binding may be measured, for example, by immobilizing MafG on a sensor chip and using Nrf1 as an analyte.
  • the amount of binding is measured by, for example, immobilizing Nrf1 on the bottom of a multi-well plate, adding MafG thereto, washing the well, and then using an antibody against MafG, using MafG against Nrf1 on the bottom of the well. This is done by confirming the binding of Alternatively, the amount of binding can be measured by, for example, immobilizing MafG on the bottom of a multi-well plate, adding Nrf1 to it, washing the well, and then confirming the binding of Nrf1 to MafG on the bottom of the well using an antibody against Nrf1 It may be done by doing.
  • the binding amount of Nrf1 and MafG in the case of (i) is 10% or more, 20% or more, 30% than the binding amount of Nrf1 and MafG in the case of (ii) (100%).
  • the test compound that decreases by 40% or more or 50% or more is selected as a compound that inhibits Nrf1 activity.
  • Nrf1 and MafG when contacting Nrf1 and MafG with an ARE sequence in an intron of Lipin1 and / or PGC-1 ⁇ in the presence of a test compound, (Ii) Measure the amount of Nrf1 and MafG binding to the ARE sequence when Nrf1 and MafG are contacted with the ARE sequence in the absence of the test compound; (iii) The amount of binding between Nrf1 and MafG and the ARE sequence in the cases (i) and (ii) is compared.
  • a test compound in which the amount of binding between Nrf1 and MafG and the ARE sequence in the case of (i) is lower than the amount of binding between Nrf1 and MafG and the ARE sequence in the case of (ii) is a test compound having Nrf1 activity. Select as a compound to inhibit.
  • Contact means that Nrf1, MafG and ARE sequences are present in the same culture system or reaction system.
  • Culture conditions or reaction conditions can be performed under conditions that are usually used or conditions similar thereto.
  • the ARE sequence in the intron of Lipin1 and / or PGC-1 ⁇ is preferably a base sequence described in the Examples below.
  • the amount of binding can be measured by a known method or a method equivalent thereto.
  • SPR surface plasmon resonance
  • ITC isothermal titration calorimetry
  • TRF time-resolved fluorescence
  • FCS fluorescence correlation spectroscopy
  • FCCS fluorescence cross correlation spectroscopy
  • APHA chemically amplified luminescence proximity homogenous assay
  • SPA scintillation proximity assay
  • FRET fluorescence resonance energy transfer
  • the amount of binding can be measured using homogeneous assays such as time-resolved fluorescence resonance energy transfer (TR-FRET), fluorescence polarization (FP) or enzyme fragment complementation (EFC). High-throughput screening (HTS) can be performed using these binding amount measurement techniques.
  • TR-FRET time-resolved fluorescence resonance energy transfer
  • FP fluorescence polarization
  • EFC enzyme fragment complementation
  • the amount of binding is measured by, for example, immobilizing an ARE sequence on a sensor chip and mixing Nrf1 and MafG as an analyte in equal amounts.
  • the amount of binding is measured by, for example, immobilizing an ARE sequence on the bottom of a multiwell plate, adding Nrf1 and MafG in an equal amount thereto, washing the well, and then antibody against Nrf1 or MafG. Is used to confirm the binding of the Nrf1-MafG heterodimer to the ARE sequence on the bottom surface of the well.
  • the amount of binding between Nrf1 and MafG and the ARE sequence in the case of (i) is 10% or more and 20% from the amount of binding between Nrf1 and MafG and the ARE sequence in the case of (ii) (100%).
  • a test compound that decreases by 30% or more, 40% or more, or 50% or more is selected as a compound that inhibits Nrf1 activity.
  • the compound that inhibits Nrf1 activity thus selected can be a candidate compound for a prophylactic or therapeutic agent for diabetes.
  • the method of screening for a compound that inhibits Nrf1 activity as described above is a method of screening for a compound that inhibits the ability to form Nrf1-MafG heterodimer or a compound that inhibits the ARE binding activity of Nrf1,
  • This is a screening method based on the function as a transcription factor.
  • Nrf1 inhibitor can be easily screened by such a screening method, and the present invention also provides such a method.
  • the method for screening a compound that inhibits the ability to form Nrf1-MafG heterodimer can be a more specific screening method that can be differentiated from other transcription factors that bind to ARE.
  • Nrf1-labeled fusion protein-expressing cells there is provided a method for screening a prophylactic or therapeutic agent for diabetes, comprising using Nrf1-labeled fusion protein-expressing cells.
  • a method for screening an agent for preventing or treating diabetes which comprises using a Nrf1-labeled fusion protein-expressing cell to select a compound that inhibits Nrf1 activity.
  • the amount of Nrf1-labeled fusion protein in the cell when not in contact with the cell is measured, and (iii) the amount of Nrf1-labeled fusion protein in the cases (i) and (ii) is compared.
  • a test compound in which the amount of Nrf1-labeled fusion protein in the case (i) is lower than the amount of Nrf1-labeled fusion protein in the case (ii) is selected as a compound that inhibits Nrf1 activity.
  • Contact means that the test compound and Nrf1-labeled fusion protein-expressing cells are present in the same culture system. Culture conditions can be performed under conditions that are usually used or conditions similar thereto.
  • Nrf1-labeled fusion protein refers to a fusion protein of Nrf1 and a labeled protein (eg, luminescent, fluorescent, chromogenic protein such as luciferase, GFP, galactosidase, etc.). Nrf1 in the fusion protein is preferably one lacking the CNC-bZip domain.
  • a labeled protein eg, luminescent, fluorescent, chromogenic protein such as luciferase, GFP, galactosidase, etc.
  • Nrf1-labeled fusion protein-expressing cells first, a test compound is brought into contact with Nrf1-labeled fusion protein-expressing cells.
  • the cells to be used are not particularly limited, but mammal-derived cells are preferable, and hepatocytes, liver cancer-derived cell lines, and the like are preferable.
  • the “Nrf1-labeled fusion protein cell” used in the screening method of the present invention can be prepared by a general genetic engineering technique.
  • the amount of Nrf1-labeled fusion protein is measured.
  • the cells are cultured, and the amount of Nrf1-labeled fusion protein in each case is measured.
  • the amount of Nrf1-labeled fusion protein can be measured by a known method or a method analogous thereto.
  • the activity of a labeled protein of the fusion protein is measured.
  • a compound that reduces the amount of Nrf1-labeled fusion protein is selected compared to the case where the test compound is not contacted (control).
  • a compound that decreases by 30% or more, 40% or more, or 50% or more is selected as a compound that inhibits Nrf1 activity.
  • the compound that inhibits Nrf1 activity thus selected can be a candidate compound for a prophylactic or therapeutic agent for diabetes.
  • a compound that inhibits the selected Nrf1 activity is administered to a non-human experimental animal (mouse, rat, etc.), and the compound that inhibits the selected Nrf1 activity is administered. Confirm anti-diabetic effect. Then, a compound that has been confirmed to have an antidiabetic effect is selected as a candidate compound for a prophylactic or therapeutic agent for diabetes.
  • the non-human experimental animal is preferably a diabetes model non-human experimental animal (for example, a diabetes model mouse). Diabetes model non-human experimental animals can be prepared or obtained by a known method or a method analogous thereto.
  • an index value of a substance having a correlation with a target disease in a non-human experimental animal contacted with a compound that inhibits Nrf1 activity is measured,
  • a candidate compound for the prevention or treatment of diabetes can be screened by confirming whether to diminish or eliminate the symptoms of diabetes based on the comparison result compared to the control.
  • a control is, for example, a non-human experimental animal that is not contacted with a compound that inhibits Nrf1 activity.
  • Examples of the contact method include administration, more specifically oral administration, intravenous injection, application, subcutaneous administration, intradermal administration, intraperitoneal administration, etc., depending on the symptoms of the non-human animal, the nature of the test compound, etc. In addition, it can be appropriately selected.
  • the dosage of the test compound can be appropriately selected according to the administration method, the properties of the test compound, and the like.
  • the blood glucose level of a non-human experimental animal contacted with a compound that inhibits Nrf1 activity is measured, and the measured blood glucose level is higher than the blood glucose level in a non-human experimental animal that does not contact a compound that inhibits Nrf1 activity.
  • the compound can be selected as a candidate compound for a prophylactic or therapeutic agent for diabetes.
  • the blood glucose level and plasma insulin concentration of a non-human experimental animal contacted with a compound that inhibits Nrf1 activity are measured, and the measured blood glucose level and plasma insulin concentration contact the compound that inhibits Nrf1 activity.
  • the compound can be selected as a candidate compound for a prophylactic or therapeutic agent for diabetes having an insulin resistance improving action.
  • a compound in which a certain amount of insulin is intraperitoneally administered to a non-human experimental animal contacted with a compound that inhibits Nrf1 activity, blood glucose level is measured after a certain time, and the measured blood glucose level inhibits Nrf1 activity can be selected as a candidate compound for a prophylactic or therapeutic agent for diabetes having an action to improve insulin resistance.
  • the jugular vein of a non-human experimental animal contacted with a compound that inhibits Nrf1 activity is cannulated, and a constant amount of insulin is continuously infused, and a glucose solution is continuously infused so that the blood glucose level is kept constant.
  • the compound When the measured infusion rate of the glucose solution is higher than the infusion rate in a non-human experimental animal not in contact with a compound that inhibits Nrf1 activity, the compound is used as a prophylactic or therapeutic agent for diabetes having an action to improve insulin resistance. Can be selected as a candidate compound.
  • the insulin positive area of the pancreatic islet in a pancreatic tissue section of a non-human experimental animal contacted with a compound that inhibits Nrf1 activity is measured, and the measured insulin positive area does not contact a compound that inhibits Nrf1 activity
  • the compound can be selected as a candidate compound for a prophylactic or therapeutic agent for diabetes having a ⁇ -cell protective action.
  • the ratio of TUNEL staining positive cells in pancreatic islets in a pancreatic tissue section of a non-human experimental animal contacted with a compound that inhibits Nrf1 activity is measured, and the ratio of the measured TUNEL staining positive cells inhibits Nrf1 activity Can be selected as a candidate compound for the prevention or treatment of diabetes having a ⁇ -cell protective action.
  • the blood glucose level, plasma insulin concentration, and insulin positive area of the islet in the pancreatic tissue section of a non-human experimental animal contacted with a compound that inhibits Nrf1 activity are measured, and the measured blood glucose level and plasma insulin are measured.
  • the compound can be selected as a candidate compound for a prophylactic or therapeutic agent for diabetes having an insulin resistance improving action and a ⁇ -cell protecting action.
  • any one of the above-mentioned methods for selecting as a candidate compound for the prevention or treatment of diabetes having an insulin resistance-improving action, and the selection as a candidate compound for the prevention or treatment of diabetes having the aforementioned ⁇ -cell protective action A compound selected by combining any of the methods described above can be selected as a candidate compound for a prophylactic or therapeutic agent for diabetes having an insulin resistance improving action and a ⁇ -cell protecting action.
  • Transgenic non-human animal The present invention relates to a transgenic non-human animal that has at least one copy of a recombinant DNA containing a gene encoding Nrf1 and a MafG regulatory domain and is a diet-induced obesity (DIO) model. provide.
  • DIO diet-induced obesity
  • Recombinant DNA containing a gene encoding Nrf1 and a MafG regulatory domain can be prepared, for example, by the method described in Examples below or a method analogous thereto.
  • the transgenic non-human animal of the present invention possesses at least 1 copy, preferably 1 to 5 copies, more preferably 4 copies of this recombinant DNA.
  • the transgenic non-human animal of the present invention can be obtained by introducing the recombinant DNA into the genome of a non-human animal using a gene recombination technique.
  • the non-human animals used in the present invention are experimental animals such as mice and rats, preferably mice.
  • a transgenic non-human animal can be produced by using a standard method, for example, a microinjection method using an initial fertilized egg, or an introduction method using ES cells.
  • the transgene can be confirmed by a known method or a method analogous thereto.
  • the “diet-induced obesity (DIO) model” is a non-human animal that has induced obesity by giving a high-fat diet or a high-fat and high-sucrose diet for a certain period of time.
  • the transgenic non-human animal of a preferred embodiment of the present invention induces insulin resistance and develops diabetes, it can be used as a diabetes model.
  • the present invention provides a method for screening a prophylactic or therapeutic agent for diabetes, which comprises contacting a test compound with a transgenic non-human animal that has developed diabetes.
  • an index value for example, blood glucose level, or insulin concentration in blood or other tissues
  • a candidate compound for a prophylactic or therapeutic agent for diabetes can be screened.
  • the blood glucose level of a non-human animal contacted with a test compound is measured, and when the measured blood glucose level is lower than the blood glucose level in a transgenic non-human animal that does not contact the test compound, the test The compound can be selected as a candidate compound for the prevention or treatment of diabetes.
  • Examples of the contact method include administration, more specifically oral administration, intravenous injection, application, subcutaneous administration, intradermal administration, intraperitoneal administration, etc., depending on the symptoms of the non-human animal, the nature of the test compound, etc. In addition, it can be appropriately selected.
  • the dosage of the test compound can be appropriately selected according to the administration method, the properties of the test compound, and the like.
  • test compound used can be selected as a candidate compound for the prevention or treatment of diabetes It is.
  • MGRD-Nrf1-FLAG is a cDNA of the mouse Nrf1 amplified by PCR from the MGRD vector (Yamazaki et al., (2012) Mol Cell Biol, 32, 808-816) and the pcDNA3.1 / V5-HisB mNrf1 vector (University of Built by Dundee, professor John Hayes).
  • Nrf1-Tg mice were backcrossed to C57BL / 6J mice, and the mice that were backcrossed for 3 to 4 generations were analyzed.
  • mice were subjected to HFD (HFD-60, 5.06 kcal / g, containing 62.2% calories from fat; OrientalOrYeast) for 10 weeks, starting from 6 weeks of age. All animal experiments were performed in accordance with “Rules on Animal Experiments at Tohoku University”.
  • HFD HFD-60, 5.06 kcal / g, containing 62.2% calories from fat; OrientalOrYeast
  • Plasma insulin levels were measured using a Mouse Insulin ELISA kit (Morinaga Institute of Science, Inc.) according to the manufacturer's instructions.
  • Plasma ⁇ -hydroxybutyric acid levels were measured by using ⁇ -Hydroxybutyrate (Ketone Body) Fluorometric Assay Kit (Cayman) according to the manufacturer's instructions.
  • GTT glucose tolerance test
  • ITT insulin tolerance test
  • Humulin-R Eli-Lilly; 0.75 or 1.5 U per kg of BW
  • mice were treated with human regular insulin (Humulin-R, Eli-Lilly; 1 kg per 1 kg of BW). 5 mU) was continuously infused per minute. Mice were also infused with 50% glucose at varying rates to maintain blood glucose levels at 120 mg / dL. Insulin resistance levels were determined by the glucose infusion rate when the blood glucose level was clamped.
  • RNA purification and mRNA quantification Extraction of total RNA using ISOGEN reagent (Nippon Gene Co., Ltd.) and reverse transcription (RT) reaction using PrimeScript RT Master Mix (Takara Bio Inc.) according to the manufacturer's instructions I went to.
  • the gene expression level was determined by quantitative real-time PCR using qPCR Mastermix (Eurogentec) or THUNDERBIRD qPCR Mix (Toyobo Co., Ltd.) with the ABI 7300 system using the primers described in the appendix.
  • the expression level of Gapdh was measured by qPCR method using Rodent GAPDH Control Reagents kit (Applied Biosystems).
  • the gene expression level was normalized by the gene expression level of Hprt (encoding hypoxanthine guanine phosphoribosyltransferase).
  • CE-TOF / MS analysis A liver sample (about 50 mg) was immersed in 500 ⁇ L of methanol containing methionine sulfone and CSA (50 ⁇ mol / L each) as internal standards. Samples were homogenized twice with Precellys-24 (Bertin Technologies) at 5,000 rpm for 30 seconds each. Then 500 ⁇ L of chloroform and 200 ⁇ L of H 2 O were added. After thoroughly mixing the sample and centrifuging at 2,300 ⁇ g for 5 minutes, the upper aqueous layer was filtered through a 5 kDa filter (Human Metabolome Technologies) to remove the protein. The filtered sample was dried under reduced pressure and the pellet was suspended in 25 ⁇ L H 2 O.
  • Extracted metabolites are measured by CE-TOF / MS (Agilent G7100 Series; Agilent Technologies) system with electrophoresis buffer (Human Metabolome Technologies), and Mass Spectrometer (Agilent G6200 Series TOF; Agilent Technologies) It carried out by. Metabolite content levels were quantified by using MasterHands software produced by Keio University.
  • liver organelle fractionation was performed. Freshly removed liver (approximately 1.0 g) is chopped into small clumps and placed in a glass round bottom homogenizer (Wheaton) with 0.25 mol / L sucrose and Complete-mini protease inhibitor cocktail (EDTA- free; Roche) in 1.5 mL ice cold Tris-HCl buffer (25 mmol / L; PH 8.0) and homogenized for 3-4 strokes. The homogenate was filtered through a 100 ⁇ m cell strainer (BD Falcon) to remove connective tissue.
  • Wheaton glass round bottom homogenizer
  • EDTA- free Complete-mini protease inhibitor cocktail
  • nuclei are removed from the filtered lysate by low speed centrifugation (4 ° C, 1,000 xg for 10 min). Prepared as a pellet. Thereafter, 1,000 ⁇ g supernatant was collected and mitochondria were prepared as pellets by high speed centrifugation (4 ° C., 8,000 ⁇ g for 10 minutes). Finally, 8,000 ⁇ g supernatant was collected and ER protein was collected as a pellet by ultra-high speed centrifugation (4 ° C., 105,000 ⁇ g for 60 minutes). The supernatant fraction was used as cytosolic protein. All organelle pellets were lysed with RIPA buffer. For immunoblot analysis for Akt, whole liver lysates were prepared as previously described (Hirotsu et al., (2012) Mol Cell Biol, 32, 2760-2770).
  • SNP rs3764400 regulates gene expression of NRF1 SNP rs3764400 has been shown to be associated with BMI with P values within 5 ⁇ 10 ⁇ 6 (Speliotes et al., (2010) Nat Genet, 42 , 937-948). Since rs3764400 is present 1.8 kb upstream of the NRF1 gene transcription start site (TSS) (FIG. 1A), it was first determined whether this SNP affects the transcriptional activity of the NRF1 gene.
  • TSS NRF1 gene transcription start site
  • the Luc activity of NRF1-C-luc is greatly increased compared to the Luc activity of NRF1-T-luc, being 2.2-fold in Hep3B cells and 4.0-fold in HepG2 cells ( Figure 1B).
  • rs3764400 associated with obesity is a regulatory SNP of the NRF1 gene and the expression level of the gene from the risk C allele is much higher than the expression level of the gene from the control T allele.
  • Nrf1 transgenic mice Since the risk C allele of rs3764400 increased the transcriptional activity of the NRF1 gene, it was hypothesized that increased Nrf1 expression affects metabolism and induces obesity. In this respect, loss-of-function analysis of Nrf1 does not provide interpretable information, although liver-specific Nrf1 conditioned knockout mice using albumin promoter-driven Cre recombinase exhibit severe liver dysfunction. Therefore, it was decided to create a transgenic mouse strain that overexpresses Nrf1, and to evaluate the contribution of Nrf1 to metabolic regulation through gain-of-function analysis.
  • MafG one of the small Maf (sMaf) proteins, is a key partner molecule for the CNC family of transcription factors and is widely expressed in mouse tissues, so it is a MafG regulatory domain (MGRD) (Yamazaki et al. (2012) Mol Cell Biol, 32, 808-816), Nrf1 tagged with 3XFLAG at the C-terminus was expressed in transgenic mice (FIG. 2A).
  • MGRD MafG regulatory domain
  • Nrf1-Tg Three Nrf1 transgenic (Nrf1-Tg) mouse strains were created that carry one copy (low copy number strain 5) and four copies (high copy number strains 1 and 6) transgene (data) Is not shown).
  • Nrf1 mRNA is expressed in all tissues examined, with the exception of high copy number lines 1 and 6 (high expression line), except in the case of BAT, low copy number line 5 (low expression line). ) Tended to be more advanced (FIG. 2B).
  • Nrf1 protein expression in the liver of Nrf1-Tg mice was also examined.
  • Strain 1 high expressing strain mice were used for this purpose. Immunoblot analysis revealed that Nrf1 is accumulated in much higher amounts in the nuclei of Nrf1-Tg mice than in WT mice (FIG. 2C).
  • Nrf1 protein expression in the cytosol was comparable between WT and Nrf1-Tg mice (FIG. 2C).
  • Nrf1 transgenic mouse strain 6 was crossed with Nrf1 knockout mice (Hirotsu et al., (2012) Mol Cell Biol, 32, 2760-2770).
  • Nrf1 knockout mice showed embryonic lethality
  • transgenic rescue mice (Nrf1 ⁇ / ⁇ :: Nrf1-Tg) were viable and breedable (data not shown).
  • these rescue mice show ALT levels comparable to WT mice ( Figure 2D), which is the result of liver-specific Nrf1 conditioned knockout mice (Hirotsu et al., (2012) Mol Cell Biol, 32, 2760-2770).
  • Nrf1 reduces body weight levels in mice
  • Nrf1-Tg mice fed with a high fat diet (HFD) started at 6 weeks of age and body weight levels were measured over 10 weeks. Feeding with HFD increased the body weight level of WT mice compared to feeding with normal diet (ND). In contrast, the body weight levels of Nrf1-Tg mice (both strains 1 and 6) that received HFD were significantly lower than those of WT mice that received HFD (FIG. 3B). The low copy number line 5 body weight levels were comparable to WT mice in both ND and HFD conditions (data not shown). These data indicate that increasing Nrf1 levels reduce the weight of mice in both ND and HFD conditions.
  • Nrf1 causes diabetes in diet-induced obese model mice
  • Nrf1 improves glucose tolerance in DIO model mice.
  • Fig. 3C blood glucose levels in the two strains of Nrf1-Tg mice increased strongly after feeding with HFD and reached approximately 400 mg / dL (FIG. 3C).
  • Nrf1-Tg mice Blood glucose levels in low copy number Nrf1-Tg mice (strain 5) after 10 weeks of HFD were slightly elevated compared to WT mice (compared to 183 ⁇ 11 mg / dL in WT littermates) , 240 ⁇ 20 in Nrf1-Tg).
  • Nrf1-Tg mice high copy number strains 1 and 6
  • Nrf1 is shown to induce insulin resistance. Therefore, these results demonstrate that increased expression of Nrf1 causes diabetes in DIO model mice.
  • Nrf1 induces insulin resistance in non-obese mice.
  • Nrf1 The effect of induction on glucose metabolism was examined.
  • a normoglycemic hyperinsulin clamp test was performed on Nrf1-Tg mice (high copy number strain 1) that received ND. It should be noted that in the Nrf1-Tg mice, the glucose infusion rate was greatly reduced compared to the WT mice (FIG. 4A, left panel). Clamped glucose levels were comparable between WT and Nrf1-Tg mice (FIG. 4A, right panel). Pancreatic sections revealed that the islets of Nrf1-Tg mice were much larger than those of WT mice (FIG. 4B, upper panel).
  • Nrf1-Tg mice the insulin-positive area quantified in pancreas sections was also increased compared to WT mice ( Figure 4B, lower panel), indicating that systemic insulin resistance was increased in Nrf1-Tg mice. It is suggested that insulin secretion is constitutively activated in response to sex.
  • Nrf1 expression level was evaluated in high copy number Nrf1-Tg mice (lines 1 and 6).
  • both blood glucose levels (FIG. 4C) and plasma insulin levels (FIG. 4D) were elevated compared to WT mice.
  • the blood glucose level in line 5 of the low copy number strain was comparable to the blood glucose level in WT mice, whereas the plasma insulin level in line 5 was clearly compared to the plasma insulin levels in WT mice. Rose.
  • Nrf1-Tg mice lines 1 and 6 were significantly higher than blood glucose levels in WT mice ( Figure 4E).
  • low copy number Nrf1-Tg mice line 5
  • AUC results were consistent with blood glucose results.
  • Nrf1 reduces expression levels of glycolytic genes in the liver
  • Nrf1-induced insulin resistance is the hypothesis that Nrf1 disrupts insulin signaling.
  • Insulin administration increased Akt phosphorylation (Ser-473) in the liver and SkM of WT mice given HFD ( Figure 5A), whereas in Nrf1-Tg mice, both in liver and SkM We found that phosphorylation of Akt worsens.
  • Slc2a2 expression is positively regulated by high glucose (Thorens et al., (1990) Proc Natl Acad Sci USA, 87, 6492-6496; and Asano et al., (1992) Diabetes, 41, 22-25) or negatively regulated by insulin (Postic et al., (1993) Biochem J 293 (Pt 1), 119-124), but in the liver of Nrf1-Tg, Slc2a2 Expression was reduced compared to WT liver (FIG. 5B). Therefore, these data indicate that Nrf1 suppresses the expression of insulin-regulated glycolysis-related genes and glucose transporter genes in the liver.
  • Nrf1-Tg mouse liver despite impaired insulin signaling (FIG. 5C). This indicates that Nrf1 suppresses the expression of gluconeogenesis-related genes regardless of the apparent insulin resistance conditions.
  • Nrf1 inhibits glycolytic pathway influx but increases TCA cycle influx as Nrf1-Tg mice have demonstrated downregulation of expression levels of both glycolysis-related genes and gluconeogenesis-related genes
  • capillary electrophoresis time-of-flight mass spectrometry CE-TOF / MS was used to examine glucose metabolite levels. Since suppression of Slc2a2 and Gck genes is predicted to reduce G6P in the liver of Nrf1-Tg, we first evaluated glucose-6-phosphate (G6P) levels. The results showed that the G6P level was significantly reduced in the liver of Nrf1-Tg mice given HFD compared to the liver of WT mice (FIG. 6A). In addition, fructose-6-phosphate (F6P) levels were also reduced (FIG. 6A). These data indicate that Nrf1 actually suppresses glucose entry into the glycolytic pathway through suppression of Slc2a2 gene expression and Gck gene expression.
  • fructose-1,6-diphosphate (F1,6P) levels were comparable between WT and Nrf1-Tg mice (FIG. 6A).
  • DHAP dihydroxyacetone phosphate
  • 3PG 3-phosphoglycerate
  • 2PG 2-phosphoglycerate
  • Phosphoenolpyruvate (PEP) levels were comparable between WT and Nrf1-Tg mice (FIG. 6A).
  • Nrf1 inhibited glycolytic pathway flux.
  • pyruvate levels are rather increased in the liver of Nrf1-Tg (FIG. 6A), and in the liver of Nrf1-Tg mice given HFD, the lactate level is lower than in the liver of WT mice Was found (FIG. 6B).
  • Nrf1-Tg mice the ratio of lactic acid to pyruvate in the liver was significantly reduced compared to the ratio of lactic acid to pyruvate in the liver of WT mice (FIG. 6B). At present, there is no definitive explanation of how these changes in pyruvate and lactate levels are induced.
  • Nrf1 increases the pyruvate level in the liver
  • the metabolites of the TCA cycle in the liver of Nrf1-Tg were also examined.
  • acetyl coenzyme A (CoA) levels and citrate levels were significantly increased, and isocitrate levels were also increased.
  • succinic acid levels, fumaric acid levels, and malic acid levels did not change significantly (FIG. 6C).
  • Nrf1 regulates ATP production and energy sufficiency In the livers of Nrf1-Tg mice, ATP levels and ADP levels were higher than those of WT mice (FIG. 6D). In contrast, AMP levels decreased slightly.
  • Nrf1 decreases the influx of glucose into the glycolytic pathway but increases the influx of the TCA cycle and in fact increases the cellular energy sufficiency.
  • Nrf1 changes metabolic parameters other than glucose metabolism
  • ⁇ -hydroxybutyric acid and ammonia are plasma metabolic parameters. investigated. Plasma ⁇ -hydroxybutyrate levels were measured to confirm excess acetyl-CoA in metabolic regulation. Plasma ⁇ -hydroxybutyrate levels in Nrf1-Tg mice treated with HFD are significantly higher than plasma ⁇ -hydroxybutyrate levels in WT mice treated with HFD. (FIG. 7A). To evaluate amino acid catabolism, plasma ammonia levels were also measured.
  • Nrf1-Tg mice Plasma ammonia levels were reduced in both ND-treated and HFD-treated Nrf1-Tg mice compared to WT mice, with the exception of high levels of amino acid catabolism (FIG. 7B). .
  • Nrf1 has been demonstrated to inhibit glucose entry into the glycolytic pathway, these data indicate that Nrf1 increases the use of acetyl-CoA from other nutrients, but glucose and amino acids. Supports the idea that the use of acetyl-CoA derived from catabolism does not increase.
  • Nrf1 +/ ⁇ mice are embryonic lethal, heterozygous Nrf1 knockout (Nrf1 +/ ⁇ ) mice were utilized for this purpose.
  • the body weight level of Nrf1 +/ ⁇ mice subjected to HFD was equivalent to that of Nrf1 + / + mice subjected to HFD (FIG. 8A).
  • Nrf1 +/- mice Blood glucose levels (Figure 8B) and plasma insulin levels (Figure 8C) in Nrf1 +/- mice that were fed HFD with constant feeding were compared to blood glucose levels and plasma insulin in Nrf1 + / + mice that were fed HFD. Slightly lower than the level.
  • Nrf1 is a risk factor for obesity.
  • three new lines of Nrf1-Tg mice that show increased expression of Nrf1 were established. In contrast to the situation inferred from human genomics, these Nrf1-Tg mice rather improved obesity in the mice.
  • closer examination of these Nrf1-Tg mice revealed that Nrf1 impairs insulin action and glucose utilization in the liver and SkM. These changes correlate well with the expression level of the transgenic Nrf1 protein, demonstrating that Nrf1 induction suppresses glucose metabolism and causes diabetes in mice. Therefore, Nrf1 was found to be a strong metabolic regulator.
  • Nrf1 Transgenic expression / induction of Nrf1 suppresses G6P and F6P levels in mouse liver. Since Nrf1 suppresses the expression levels of the Slc2a2 gene and the Gck gene, it is assumed that suppression of these enzyme levels results in suppression of the glycolytic pathway. However, in the livers of Nrf1-Tg and WT mice, the levels of other metabolites of the glycolytic pathway including F1,6P, DHAP, 3PG, 2PG, and PEP are all comparable.
  • Nrf1 induction represses other insulin regulatory genes and glycolysis-related enzyme genes Aldob, Pgk1, and Pklr, resulting in suppression of aldolase activity, phosphoglycerate kinase activity, and pyruvate kinase activity
  • Aldob, Pgk1, and Pklr a glycolysis-related enzyme gene that influences the rate of oxidation of the enzyme.
  • Nrf1 induction represses other insulin regulatory genes and glycolysis-related enzyme genes Aldob, Pgk1, and Pklr, resulting in suppression of aldolase activity, phosphoglycerate kinase activity, and pyruvate kinase activity
  • Nrf1 increases pyruvate levels and decreases lactate levels in the liver, but there is no reasonable explanation for this phenomenon.
  • Pyruvate and lactate levels are complexly regulated by multiple factors including the activity of the pyruvate dehydrogenase complex and lactate dehydrogenase, the entry of lactate from other tissues, the supply of pyruvate by amino acid catabolism (Sugden et al., (2003) Am J Physiol Endocrinol Metab, 284, E855-862; Gladden, (2008) Med Sci Sports Exerc, 40, 477-485; and Sookoian et al., (2012) World J Gastroenterol, 18, 3775-3781), elucidation of this phenomenon must be a challenge through the use of modern methods such as metabolic flux analysis using 13 C (Zamboni et al., (2009) Nat Protoc 4, 878- 892).
  • Nrf1 induces insulin resistance in mice. Overexpression of Nrf1 suppressed Akt phosphorylation after insulin administration to the liver and SkM. We have therefore found that insulin resistance in Nrf1-Tg mice is caused by impaired insulin signaling in the liver and SkM (FIG. 9). However, in our microarray gene expression analysis for the liver and SkM of Nrf1-Tg mice, we could not detect changes in the expression levels of the major components of the insulin signaling pathway (data not shown). These results suggest that Nrf1 induces insulin resistance in the liver and SkM via a pathway that is distinct from transcriptional repression of components of the insulin signaling pathway.
  • Nrf1 function may be perturbation of specific metabolic regulator levels. Indeed, in this study, we found that both plasma ⁇ -hydroxybutyrate levels and liver acetyl-CoA levels were elevated in Nrf1-Tg mice given HFD. Since ⁇ -hydroxybutyric acid is created by metabolism of acetyl-CoA in the liver, an increase in plasma ⁇ -hydroxybutyrate level that is dependent on the expression level of Nrf1 is thought to reflect an excess of acetyl-CoA in the liver ( McGarry et al., (1980) Annu Rev Biochem, 49, 395-420). Since fatty acid oxidation creates abundant acetyl-CoA, we speculate that Nrf1 overexpression enhances the accumulation of acetyl-CoA in the liver by increasing its utilization as a nutrient.
  • Nrf1 overexpression In contrast to Nrf1 overexpression, reducing Nrf1 expression improves glucose metabolism in DIO diabetic model mice. Indeed, Nrf1 heterozygous knockout mice in the DIO model showed reduced plasma insulin levels by lowering blood glucose levels.
  • Nrf1 and Nrf2 bind similarly to the same cis-acting regulatory element (ARE), it is not possible to elucidate how these two CNC family factors exert differential biological functions. interesting. Taken together, this study provides strong evidence that Nrf1 acts as a vital metabolic regulator.
  • Nrf1 and MafG purified protein were analyzed by ELISA (Enzyme-Linked ImmunoSorbent Assay) using Biacore 3000 (GE Healthcare) and MafG antibody (abcam).
  • ELISA Enzyme-Linked ImmunoSorbent Assay
  • Biacore 3000 GE Healthcare
  • MafG antibody abcam
  • ARE antioxidant response element
  • Lipin1 intron ARE sequence sense: CGCGGAGGCACACTTGCTGAGTCAGCACCCCGGGAGT (SEQ ID NO: 19) antisense: CTAGACTCCCGGGGTGCTGACTCAGCAAGTGTGCCTC (SEQ ID NO: 20)
  • PGC-1 ⁇ intron ARE sequence sense: CGCGGAGGGGAACATGCTGACTCAGCAGCTCCGAATA (SEQ ID NO: 21) antisense: CTAGTATTCGGAGCTGCTGAGTCAGCATGTTCCCCTC (SEQ ID NO: 22)
  • Nrf1 protein was immobilized as a ligand on Sensor Chip CM5 (GE Healthcare), and MafG protein was used as an analyte. As a result, a dose-dependent binding response of MafG was observed. Similarly, when MafG protein was immobilized as a ligand and Nrf1 protein was used as an analyte, a dose-dependent binding response of Nrf1 was observed.
  • the Lipin1 intron ARE sequence or the PGC-1 ⁇ intron ARE sequence is immobilized on the Sensor Chip SA (GE Healthcare), and equal amounts of Nrf1 and MafG proteins are mixed as ligands to provide an analyte. As a result, a dose-dependent binding response of Nrf1-MafG heterodimer is observed.
  • the binding response to the immobilized DNA probe is attenuated.
  • Nrf1 protein is immobilized on a 96-well plate and the amount of MafG protein bound is analyzed by ELISA using a MafG antibody, an increase in signal when Nrf1 is immobilized is observed.
  • the ARE sequence of Lipin1 intron or the ARE sequence of PGC-1 ⁇ intron is immobilized and equal amounts of Nrf1 and MafG proteins are added, an increase in the dose-dependent signal of Nrf1-MafG heterodimer is confirmed.
  • Nrf1 forms a heterodimer with MafG, binds to the ARE sequence of the target gene, and causes transcriptional activation. Nrf1 is also involved in gene expression related to lipid metabolism such as Lipin1 and PGC-1 ⁇ (Hirotsu et al., MCB, 32; 2760-2770), suggesting an effect on glycolipid metabolism.
  • an assay system that evaluates the direct interaction between Nrf1 and MafG and the binding of Nrf1-MafG heterodimer to the ARE sequence. This assay system reflects the function of endogenous Nrf1-MafG. By using this assay system, it is possible to screen for compounds that inhibit the transcriptional activity of Nrf1.
  • Primer 1.1 5'-TAA TAC GAC TCA CTA TAG GG-3 '(SEQ ID NO: 23)
  • Primer 1.2 5'-CTT TAT GTT TTT GGC GTC TTC CTT CCT CCG GTC CTT TG-3 '(SEQ ID NO: 24)
  • Primer 2.2 5'-GAC TCT AGA ATT ACA CGG CG-3 '(SEQ ID NO: 26)
  • sequence amplified by the following primers 3.1 and 3.2 using the mouse Nrf1 cDNA sequence as a template and the sequence amplified by the following primers 4.1 and 4.2 using pGL3-basic vector (Promega) as a template were joined together, and pcDNA3.1
  • a mouse Nrf1 and luciferase fusion protein (mNrf1 ⁇ CNC-bZip-Luc) expression vector lacking the CNC-bZip domain was generated.
  • Primer 3.1 5'-TAA TAC GAC TCA CTA TAG GG-3 '(SEQ ID NO: 27)
  • Primer 3.2 5'-CTT TAT GTT TTT GGC GTC TTC CAT CTG CTT GTC CAG GAA-3 '(SEQ ID NO: 28)
  • Primer 4.1 5'-TTC CTG GAC AAG CAG ATG GAA GAC GCC AAA AAC ATA AAG -3 '(SEQ ID NO: 29)
  • Primer 4.2 5'-GAC TCT AGA ATT ACA CGG CG-3 '(SEQ ID NO: 30)
  • the mouse liver cancer cell line Hepa1c1c7 was cultured in Dulbecco's modified Eagle medium (Wako) supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin (Gibco).
  • Wako Dulbecco's modified Eagle medium
  • Gibco penicillin-streptomycin
  • mNrf1-Luc expression vector or mNrf1 ⁇ CNC-bZip-Luc expression vector was linearized with restriction enzyme PvuI
  • Hepa1 cells were transfected using Lipofectamine 2000 transfection reagent (Invitrogen). The cells were cultured in a medium containing 1 mg / mL G-418 to select stably expressing cells, and a plurality of clonal cell lines were established.
  • Each cell line was seeded in a 24-well plate at a density of 5 ⁇ 10 4 cells / well per well, and after overnight culture, the following Control siRNA or Nrf1 siRNA (Tsuchiya et al., Mol Cell Biol. 31: 4500 -4512. (2011)) is transfected with Lipofectaminse2000 transfection reagent (Invitrogen) and incubated overnight.
  • Control siRNA or Nrf1 siRNA (Tsuchiya et al., Mol Cell Biol. 31: 4500 -4512. (2011)) is transfected with Lipofectaminse2000 transfection reagent (Invitrogen) and incubated overnight.
  • Nrf1 siRNA is transfected into a stable expression cell line into which an mNrf1-Luc expression vector or mNrf1 ⁇ CNC-bZip-Luc expression vector has been introduced, a significant decrease in luciferase activity is observed compared to the case where a control siRNA is introduced. It is done.
  • Nrf1 is degraded by the proteasome in the steady state, and it is thought that Nrf1 is released from its degradation system by activation stimulation, and the Nrf1 protein is stabilized, thereby activating transcription of the target gene. ing.
  • the endogenous stimuli and ligands that activate Nrf1 have not been clarified, but it has been reported that the addition of proteasome inhibitors stabilizes the Nrf1 protein and exhibits transcriptional activation (Zhang, Y. et al. al., (2006) Biochem. J. 399, 373-385).
  • RNA is prepared according to the Kit protocol. After measuring the body weight of the animal, RNA is administered at 3 mg / kg / 10 ml from the tail vein. Body weight, blood glucose level and plasma insulin concentration are measured 24 and 72 hours after RNA administration. The blood glucose level is measured using a glucose CII test Wako (Wako), and the plasma insulin concentration is measured using a mouse insulin measurement kit (Morinaga).
  • the Nrf1 siRNA administration group shows a decrease in blood glucose level 24 and 72 hours after RNA administration. A decrease in plasma insulin is also confirmed in the Nrf1 siRNA administration group. There is no difference in body weight between the control siRNA and Nrf1 siRNA administration groups.
  • Nrf1 knockdown confirmed a decrease in blood glucose and plasma insulin.
  • acquired inhibition of Nrf1 can improve insulin resistance, and inhibition of expression by a specific inhibitor of Nrf1 or siRNA or oligoDNA can be an effective means for improving the pathology of diabetes.
  • [SEQ ID NO: 1] This shows the base sequence of cDNA encoding human Nrf1 (Accession No. NM_003204).
  • [SEQ ID NO: 2] This shows the amino acid sequence of human Nrf1 (Accession No. NP_003195).
  • [SEQ ID NO: 3] This shows the base sequence of cDNA encoding mouse Nrf1 (Accession No. NM_008686).
  • [SEQ ID NO: 4] This shows the amino acid sequence of mouse Nrf1 (Accession No. NP_032712).
  • [SEQ ID NO: 5] This shows the base sequence of cDNA encoding human Lipin1 (Accession No. NM_145693).
  • [SEQ ID NO: 6] This shows the amino acid sequence of human Lipin1 (Accession No. NP_663731).
  • [SEQ ID NO: 7] This shows the base sequence of cDNA encoding mouse Lipin1 (Accession No. NM_172950).
  • [SEQ ID NO: 8] This shows the amino acid sequence of mouse Lipin1 (Accession No. NP_766538).
  • [SEQ ID NO: 9] This shows the base sequence of cDNA encoding human PGC-1 ⁇ (Accession No. NM_133263).
  • [SEQ ID NO: 10] This shows the amino acid sequence of human PGC-1 ⁇ (Accession No. NP_573570).
  • [SEQ ID NO: 11] This shows the base sequence of cDNA encoding mouse PGC-1 ⁇ (Accession No. NM_133249).
  • [SEQ ID NO: 12] This shows the amino acid sequence of mouse PGC-1 ⁇ (Accession No. NP_573512).
  • [SEQ ID NO: 13] This shows the base sequence of cDNA encoding human MafG (Accession No. NM_002359).
  • [SEQ ID NO: 14] This shows the amino acid sequence of human MafG (Accession No. NP_002350).
  • [SEQ ID NO: 15] This shows the base sequence of cDNA encoding mouse MafG (Accession No. NM_010756).
  • [SEQ ID NO: 16] This shows the amino acid sequence of mouse MafG (Accession No. NP_034886).
  • [SEQ ID NO: 17] This shows the base sequence of the primer used in EXAMPLE 1.
  • [SEQ ID NO: 18] This shows the base sequence of the primer used in EXAMPLE 1.
  • [SEQ ID NO: 19] This shows the base sequence of the sense strand of the ARE region in Lipin1 intron (Example 2).
  • [SEQ ID NO: 20] This shows the base sequence of the antisense strand of the ARE region in Lipin1 intron (Example 2).
  • [SEQ ID NO: 21] This shows the base sequence of the sense strand of the ARE region in PGC-1 ⁇ intron (Example 2).
  • [SEQ ID NO: 22] This shows the base sequence of the antisense strand of the ARE region in the PGC-1 ⁇ intron (Example 2).
  • [SEQ ID NO: 23] This shows the base sequence of the primer (primer 1.1) used in EXAMPLE 3.
  • [SEQ ID NO: 24] This shows the base sequence of the primer (primer 1.2) used in EXAMPLE 3.
  • [SEQ ID NO: 25] This shows the base sequence of the primer (primer 2.1) used in EXAMPLE 3.
  • [SEQ ID NO: 26] This shows the base sequence of the primer (primer 2.2) used in EXAMPLE 3.
  • [SEQ ID NO: 27] This shows the base sequence of the primer (primer 3.1) used in EXAMPLE 3.
  • [SEQ ID NO: 28] This shows the base sequence of the primer (primer 3.2) used in EXAMPLE 3.
  • SEQ ID NO: 29 This shows the base sequence of the primer (primer 4.1) used in EXAMPLE 3.
  • [SEQ ID NO: 30] This shows the base sequence of the primer (primer 4.2) used in EXAMPLE 3.
  • SEQ ID NO: 31 This shows the base sequence of the sense strand of Control siRNA used in EXAMPLE 3.
  • [SEQ ID NO: 32] This shows the base sequence of the antisense strand of Control siRNA used in EXAMPLE 3.
  • SEQ ID NO: 33 This shows the base sequence of the sense strand of Nrf1 siRNA used in EXAMPLE 3.
  • [SEQ ID NO: 34] This shows the base sequence of the antisense strand of Nrf1 siRNA used in EXAMPLE 3.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Veterinary Medicine (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

La présente invention concerne : un agent prophylactique ou thérapeutique pour le diabète, qui comprend un inhibiteur de Nrf1 ; un procédé de criblage d'un agent prophylactique ou thérapeutique pour le diabète, qui implique l'utilisation de Nrf1 ; et un procédé de criblage d'un agent prophylactique ou thérapeutique pour le diabète, qui implique l'utilisation de cellules capables d'exprimer une protéine de fusion marquée par Nrf1. La présente invention concerne un agent prophylactique ou thérapeutique pour le diabète, qui a un nouveau mécanisme d'action.
PCT/JP2015/063724 2014-05-14 2015-05-13 Procédé de criblage d'agent prophylactique ou thérapeutique pour le diabète WO2015174441A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2014-100408 2014-05-14
JP2014100408 2014-05-14

Publications (1)

Publication Number Publication Date
WO2015174441A1 true WO2015174441A1 (fr) 2015-11-19

Family

ID=54479978

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2015/063724 WO2015174441A1 (fr) 2014-05-14 2015-05-13 Procédé de criblage d'agent prophylactique ou thérapeutique pour le diabète

Country Status (1)

Country Link
WO (1) WO2015174441A1 (fr)

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
HIROTSU,Y. ET AL.: "Transcription factor NF-E2- related factor 1 impairs glucose metabolism in mice.", GENES TO CELLS, vol. 19, no. 8, August 2014 (2014-08-01), pages 650 - 66 5, XP055237085 *
JOHNSEN,O. ET AL.: "Interaction of the CNC-bZIP factor TCF11/LCR-F1/Nrf1 with MafG: binding- site selection and regulation of transcription.", NUCLEIC ACIDS RES., vol. 26, no. 2, 1998, pages 512 - 520, XP055237094 *
TOKI,T. ET AL.: "Human small Maf proteins form heterodimers with CNC family transcription factors and recognize the NF-E2 motif.", ONCOGENE, vol. 14, no. 16, 1997, pages 1901 - 1910, XP055237090 *
ZHENG,H. ET AL.: "CNC-bZIP protein Nrf1-dependent regulation of glucose-stimulated in sulin secretion.", ANTIOXIDANTS & REDOX SIGNALING, 22 April 2015 (2015-04-22), pages 819 - 831, XP055237086 *

Similar Documents

Publication Publication Date Title
Wu et al. Novel mechanism of Foxo1 phosphorylation in glucagon signaling in control of glucose homeostasis
Ma et al. Low-dose metformin targets the lysosomal AMPK pathway through PEN2
Shan et al. Lkb1 controls brown adipose tissue growth and thermogenesis by regulating the intracellular localization of CRTC3
Braccini et al. PI3K-C2γ is a Rab5 effector selectively controlling endosomal Akt2 activation downstream of insulin signalling
Alapatt et al. Liver retinol transporter and receptor for serum retinol-binding protein (RBP4)
Shavlakadze et al. A growth stimulus is needed for IGF-1 to induce skeletal muscle hypertrophy in vivo
Sasako et al. Hepatic Sdf2l1 controls feeding-induced ER stress and regulates metabolism
JP6478908B2 (ja) 熱ショックタンパク質（ＨＳＰ）９０−βを調節することによる代謝症候群の治療方法
JP2010517511A (ja) 抗糖尿病化合物のスクリーニング方法
US20220031706A1 (en) Trpc ion channel inhibitors for use in therapy
WO2021075536A1 (fr) Traitement contre le diabète utilisant un agent de migration des cellules souches
US20080242608A1 (en) Methods and compositions for treating and preventing neurologic disorders
US20170355997A1 (en) Methods and compositions for treating or preventing pruritis
Son et al. Development of CIDEA reporter mouse model and its application for screening thermogenic drugs
Zhang et al. WDFY2 potentiates hepatic insulin sensitivity and controls endosomal localization of the insulin receptor and IRS1/2
TWI359271B (en) Pharmaceutical composition for insulin resistance
JP6442403B2 (ja) 代謝調節のための方法および組成物
US10188650B2 (en) Treatment of neurological disorders
Flaherty III et al. Chronic UCN2 treatment desensitizes CRHR2 and improves insulin sensitivity
WO2015174441A1 (fr) Procédé de criblage d'agent prophylactique ou thérapeutique pour le diabète
Chi et al. FAM3B (PANDER) functions as a co‐activator of FOXO1 to promote gluconeogenesis in hepatocytes
JP6854515B2 (ja) 解糖系代謝制御物質のスクリーニング方法及び解糖系代謝制御剤
US20130171158A1 (en) Treatment of abnormalities of glucose metabolism with an antagonist of inhibitor of differentiation 1
US20230312728A1 (en) Methods and Compositions for Diabetes Treatment and Beta-Cell Regeneration
Rosahl et al. BACE1–but not BACE2–function is critical for metabolic disorders induced by high-fat diets in C57BL/6N mice

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15792391

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15792391

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: JP