WO2015160977A1 - Compositions et méthodes de traitement des maladies cardiovasculaires à l'aide de smad3 - Google Patents

Compositions et méthodes de traitement des maladies cardiovasculaires à l'aide de smad3 Download PDF

Info

Publication number
WO2015160977A1
WO2015160977A1 PCT/US2015/026011 US2015026011W WO2015160977A1 WO 2015160977 A1 WO2015160977 A1 WO 2015160977A1 US 2015026011 W US2015026011 W US 2015026011W WO 2015160977 A1 WO2015160977 A1 WO 2015160977A1
Authority
WO
WIPO (PCT)
Prior art keywords
promoter
disease
gene
expression
vector
Prior art date
Application number
PCT/US2015/026011
Other languages
English (en)
Inventor
Maurizio Chiriva-Internati
Original Assignee
Kiromic, Llc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US14/508,642 external-priority patent/US20150098925A1/en
Application filed by Kiromic, Llc filed Critical Kiromic, Llc
Publication of WO2015160977A1 publication Critical patent/WO2015160977A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A61K48/0058—Nucleic acids adapted for tissue specific expression, e.g. having tissue specific promoters as part of a contruct
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475—Growth factors; Growth regulators
    • C07K14/495—Transforming growth factor [TGF]

Definitions

  • the present invention relates to methods and compositions for the treatment of cardiovascular diseases and other conditions.
  • the present invention relates to gene therapy using disease-specific promoters in treating cardiovascular diseases, and to modulating inflammation by controlling SMAD3.
  • the hallmark goal of gene therapy is to deliver a therapeutic gene which then acts to counteract a negative phenotype or disease within the patient or animal model. While there are many types of diseases to treat, each disease is somewhat different and there are a variety of delivery/expression strategies which can be undertaken. There are two primary types of gene expression approaches that may be used to drive gene expression, (i) constitutive and (ii) tissue specific. The issue is that many, perhaps all, therapeutic genes will likely have negative consequences when expressed, i.e., adverse reactions, especially if the genes are expressed at high levels. Nevertheless, the gene therapy agents must be safe, and not induce wide-spread unintended damage.
  • the first major expression approach is the "constitutive" approach, such as using the cytomegalovirus (CMV) immediate early promoter ("pr").
  • CMV cytomegalovirus
  • pr immediate early promoter
  • the treatment of genetic syndromes might be the most appropriate for this approach. Genetic syndromes result from a faulty protein which is important within a tissue or organ for normal function. For genetic syndromes the goal of gene therapy is simple; get that therapeutic gene and its protein delivered and expressed into as many cells of the patient, organ or tissue as possible to give back normal function. The strategy then is usually for maximum gene delivery and gene expression.
  • therapeutic genes actually have a physiological down-side because of their inherent function and adverse reactions when expressed at high levels.
  • therapeutic genes that have been used in the treatment of atherosclerosis, in particular, interleukin 10 (IL10, IL-10) (which, while strongly immuno-suppressive), is also associated with a number of adverse reactions which are manifested in the clinical setting and in some animal models.
  • IL10, IL-10 interleukin 10
  • adverse reactions include increased bacterial, fungal and viral infections, cancer, headache, and anemia (8-16).
  • the strongest therapeutic genes are also likely to be the most dangerous and they must be tightly regulated.
  • Some therapeutic genes may be appropriately expressed constitutively in a patient.
  • tissue-specific approach A major refinement of the constitutive approach is the "tissue-specific" approach.
  • the delivered transgene is expressed only within a specific cell type, thereby limiting its overall expression (17).
  • this approach represents an improvement over the constitutive approach, it appears to a modified version of the constitutive approach, but, limited to a specific cell type.
  • the third approach is a "disease-specific" approach (4).
  • the goal of the disease- specific approach is to limit the expression of the therapeutic transgene to the site of disease, in the cells which are changing towards the disease-associated phenotype.
  • This disease-specific approach gives the gene therapy an important safety feature for gene therapy against adverse reactions from the over-expression of a powerful therapeutic transgenes such as IL10.
  • IL10 a powerful therapeutic transgenes
  • the present invention provides methods of treating a cardiovascular disease in a subject comprising the step of administering to the subject a vector comprising a cDNA encoding a member of the transforming growth factor beta 1 (TGFpi) signaling pathway.
  • the vector may be under the control of a disease specific or a constitutive promoter.
  • the cardiovascular disease may be, for example, atherosclerosis, coronary artery disease, or hypertension.
  • the TGFpi signaling pathway member is selected from the group consisting of SMAD1, SMAD2, SMAD3, SMAD4, SMAD5, SMAD6, SMAD7, SMAD 8, RhoA, mDia, ROCK, MLC, LIMK, Cofilin, Rac/Cdc42, PAK, c-Abl, Par6, PKC, PI3K, Akt, mTOR, PP2A, p70 S6K, SARA, She, GRB2, Smurfl, Smurf2, TAK1/MLK1/MEKK1, MKK3, MKK6, MKK4, p38, JNK, SOS, Ras, Erkl, Erk2, or TMEPAI or combinations thereof.
  • the member of the TGFpi signaling pathway is SMAD3. In certain embodiments, the member of the TGFpi signaling pathway is more
  • the promoter is a disease-specific promoter.
  • the promoter may be a lectin- like oxidized low density lipoprotein receptor 1 (LOX-1) promoter.
  • the promoter is a constitutive promoter.
  • the promoter may be a cytomegalovirus (CMV) immediate early promoter.
  • CMV cytomegalovirus
  • the expression vector may be an adeno-associated virus (AAV) vector (derived from AAV).
  • AAV adeno-associated virus
  • the AAV vector may be an AAV2 or AAV8 vector.
  • the AAV vector may comprise an AAV8 capsid gene which can be wild-type or mutated.
  • the AAV8 capsid gene of the AAV vector comprises SEQ ID NO: 3; SEQ ID NO: 5; or (iii) SEQ ID NO: 7.
  • Figure 1 Structure of AAV vectors and experimental scheme.
  • A. is a cartoon showing the basic structure of the three AAV vectors used in this study.
  • B. shows the experimental scheme and data collected.
  • FIG. 2 More detailed structure of the AAV.LOXlpr-hlLlO vector plasmid. This figure shows in more detail the structure of the basic structure of the AAV2.LOXlpr- hlLlO vector plasmid used to generate the virus. Note that the relative positions of three responsive elements for Angll, Ox-LDL and PMA are shown within the promoter sequence. However, the full length LOXlpr is likely responsive to many other stimuli as well.
  • Figure 3 Physical characterization of animal groups. Data shown are mean +/- SE. A. shows the levels of total cholesterol. Note that cholesterol levels of all the animals on HCD had had significantly higher cholesterol levels than ND animals. B. shows the animal weights at the end of the experiment. The key at the bottom is used for both panels.
  • Figure 4 Expression of hILlO in animal groups. Relative expression of delivered hILlO genes compared to endogenous ⁇ -actin determined by real-time quantitative PCR from aorta of 6 mice in each group. For QRT-PCR the quantity of mRNA for each vector transgene was normalized to Pactin in the same sample. Data shown are mean +/- SE.
  • CMVpr-ILlO CMV promoter-ILlO
  • LOXlpr-ILlO LOXlpr-ILlO trended to be less than half the expression level of CMVpr-IL-10.
  • Disease-specific Expression of hILlO in various organs LOX-1 promoter is predominantly expressed in the aorta, the site of disease (57).
  • FIG. 5 Systolic blood velocity.
  • HRUS High resolution ultrasound
  • CMVpr-hlLlO- and LOXlpr-hlLlO-HCD-treated animals all had significantly lower blood velocity than the AAV/Neo-HCD-treated animals, similar to ND controls.
  • CMVpr-hlLlO-HCD- and LOXlpr-hlLlO-HCD-treated animals were statistically similar to each other.
  • HRUS was used to measure the cross sectional area of the thoracic region of the aortas in 8-10 animals from each animal group. Shown is a quantification of the cross-sectional area for the abdominal/thoracic region of the aorta. Note that both CMVpr-hlLlO- and LOXlpr-hlLlO-HCD-treated animals had a significantly larger cross sectional area than the AAV/Neo-HCD-treated animals, indicating significant efficacy. However, CMVpr- hlLlO-HCD- and LOXlpr-hlLlO-HCD-treated animals were statistically similar to each other.
  • FIG. 7 Analysis of the aortic wall thickness by HRUS.
  • HRUS was used to measure the wall thickness of the aorta. Shown is a quantification of the thoracic region of the aortas in 8-10 animals from each animal group. Note that both CMVpr-hlLlO- and LOXlpr-hlLlO-HCD-treated animals had a significantly thinner aortic wall than the AAV/Neo-HCD-treated animals, indicating significant efficacy. However, CMVpr- hILlO-HCD- and LOXlpr-hlLlO-HCD-treated animals were statistically similar to each other.
  • FIG. 8 Transduction of human primary placental umbilical cord vein rings in culture by AAV2 and modified AAV2-EYH. Vein rings were infected with 10 8 AAV2- CMV-EYH/eGFP virus in vitro. Photomicrographs were taken 2 days post-infection. Note that the smooth muscle cells are strongly targeted by the AAV2-EYH-modified capsid.
  • FIG. 9 Specific changes in the AAV8 capsid for improved transduction of arterial smooth muscle cells, including tasks 1 and 2. The indicated changes will be made in pDG8). Tyrosines at position 447 and 733 will be replaced by phenylalanines, while the EYH peptide (a peptide having seven amino acids), will be inserted after position 590. These modifications may enhance delivery of the AAV2/8(cvdl).LOXlpr-IL10 DNA into vascular smooth muscle cells.
  • FIG. 10 Delivery of hSTAT3 and dietary effects.
  • A Relative expression of hSMAD3 gene to Pactin by real-time quantitative PCR from aorta of 3 mice in each group. For qRT-PCR the quantity of RNA for each gene was normalized to Pactin in the same sample. Data shown are mean +/- SE.
  • B. shows a western blot analysis of protein from liver probed with anti-SMAD3 antibody. Note that both A and B show increased SMAD3 levels in the AAV/hSMAD3 -treated animals.
  • C shows the levels of total cholesterol. (HCD: High Cholesterol Diet).
  • FIG. 11 Structural Analysis of the aorta.
  • HRUS High resolution ultrasound
  • A. shows quantification of the cross-sectional area for the thoracic region of the aorta in 3-5 animals from each animal group by HRUS with representative captured images from the analysis just above. Note that the
  • AAV/hSMAD3-HCD animals had a larger cross sectional area than the AAV/Neo-HCD animals.
  • B. shows quantification of the wall thickness of the aorta (thoracic region). Note that the AAV/hSMAD3-HCD animals have a thinner wall thickness than the AAV/Neo- HCD animals.
  • C. shows quantification of blood flow velocities in the lumenal center of the abdominal region of the aorta in 3-5 animals from each group with representative captured images from the analysis just above. Note that the AAV/hSMAD3-HCD animals have a much lower blood velocity than the AAV/Neo-HCD animals (or hCGRP- treated).
  • FIG. 12 Macrophage burden of aortic tissue.
  • CD68 is a marker of macrophages and thus is a general marker of inflammation. Histologic sections of aorta from the indicated animal groups were analyzed for CD68 protein by
  • AAV/hSMAD3-HCD- treated animals displayed a much lower brown CD68 signal than the AAV/Neo-HCD- treated animals strongly suggesting lower inflammation.
  • B. shows a similar analysis with anti-ITGAM antibody, another marker of macrophages, with similar results to CD68.
  • C. shows a QRT-PCR analysis of EMR expression, another macrophage marker. Note, again, macrophage levels were significantly lower (p ⁇ 0.05) in hSMAD3 -treated animals than Neo-treated.
  • D. shows a QRT-PCR analysis of ITGAM expression. Note, again, macrophage levels trended lower in hSMAD3 -treated animals than Neo-treated.
  • AAV/Neo-treated HCD aorta displays much higher amounts of lipid accumulation (white areas) than the AAV/hSMAD3-treated-HCD animals.
  • FIG. 14 Immune response status of aortas is Th2.
  • A. shows a QRT-PCR analysis of IL-4 expression, a Th2 response cytokine. Note that IL-4 levels were significantly higher (p ⁇ 0.05) in hSMAD3 -treated animals than Neo-treated.
  • B. shows a QRT-PCR analysis of IL-10 expression, another Th2 response cytokine. Note, again, IL-10 levels trended higher in hSMAD3 -treated animals than Neo-treated.
  • C. shows a QRT-PCR analysis of IL-7 expression, a Thl response cytokine. Note that IL-7 levels were higher (p ⁇ 0.05) in hSMAD3 -treated animals than Neo-treated, however, overall, the changes were very minor.
  • D. shows a QRT-PCR analysis of IL-12 expression, another Thl response cytokine. Note IL-12 levels trended lower in hSMAD3-treated animals than Neo-treated.
  • FIG. 15 Collagen (COL) and connective tissue growth factor (CTGF) expression in aortas and liver.
  • A. shows a QRT-PCR analysis of COL1A2 expression in the aortas, a major marker of fibrosis. Note that COL1A2 levels were essentially the same in the aortas of both hSMAD3 -treated animals and Neo-treated.
  • B. shows a QRT-PCR analysis of COL2A1 expression in the aortas, another marker of fibrosis. Note that COL2A12 levels were significantly lower in the aortas of both hSMAD3 -treated animals than Neo- treated.
  • C. shows a QRT-PCR analysis of COL1A2 expression in the liver.
  • COL1 A2 levels trended lower in both hSMAD3 -treated animals than Neo-treated. No significant change is seen in any experimental group.
  • D, E, and F show an analogous Q- RT-PCR analysis of COL1A1, COL2A1, and CTGF expression, respectively, but this time in the liver. Note that all three genes are significantly down-regulated by hSMAD3 delivery compared to Neo control, fully consistent with lower fibrosis.
  • the methods and systems of the present invention provide for an expression vector containing a disease-specific promoter linked to a gene encoding a therapeutic agent, such as a protein, microR A, siR A or other therapeutic molecule, e.g., other oligonucleotide.
  • a therapeutic agent such as a protein, microR A, siR A or other therapeutic molecule, e.g., other oligonucleotide.
  • a variety of different promoters may be used with the present invention, provided that the promoter preferentially expresses the gene linked to it at the site of the disease and not more globally within the body.
  • disease-specific transcriptional promoters are one approach to give such reduced and selective expression.
  • Such disease-specific gene expression should direct expression to the site of disease where it is most needed and, at the same time, limit overall production.
  • the disease- specific expression of a therapeutic agent can lower the possibility of significant adverse reactions (17-23).
  • the present invention provides for an expression vector for treating a variety of conditions including cardiovascular diseases, e.g., atherosclerosis.
  • the expression vector may be an adeno-associated virus (AAV) vector (derived from AAV).
  • AAV adeno-associated virus
  • the disease-specific promoter is the promoter of the LOX-1 gene (LOX-1 promoter, LOX1 promoter, or LOXlpr) (17, 4).
  • the therapeutic agent may be
  • Interleukin 10 IL10
  • the present expression vector contains a disease-specific promoter.
  • a disease-specific promoter can ensure that the expression of a gene under its control is substantially limited to diseased tissues or tissues surrounding diseased tissues.
  • the promoter of any gene, which is up-regulated during a disease may be used as a disease-specific promoter in the present invention. Under normal conditions (a non- disease state), the gene, under the control of its promoter, is expressed at a low level which may or may not be detectable.
  • the promoter is activated by disease-associated stimuli (e.g., blood sheer stress, dislipidemia, immune cell trafficking, other activations, etc.), and the promoter/gene is strongly up-regulated.
  • a disease-specific promoter also is an inherent safeguard against the adverse effects of a therapeutic agent under its control. Once the disease becomes diminished, the disease- stimulus will be eliminated or reduced (e.g., after the gene therapy). In response, the expression of the therapeutic agent, under the control of the disease-specific promoter, should be down-regulated, resulting in a nature negative feedback.
  • Lectin- like oxidized low density lipoprotein receptor 1 (LOX1, LOX-1, oxidized LDL receptor 1, OLR1) is a scavenger receptor which is expressed when cells become activated, and binds many ligands.
  • LOX1 is also one of the receptors which recognize oxidized low density lipoprotein (Ox-LDL). Moreover, it is expressed in many cell types, including endothelial cells, smooth muscle cells, and macrophages, the major cell types believed involved in atherosclerosis (23-28). It is heavily expressed within atherosclerotic plaque.
  • LOX-1 is also considered one of the earliest markers of activated endothelium, which predates the initiation of atherosclerosis (17, 24). LOX1 appears to be transcriptionally up-regulated during atherogenesis. Many agents, such as Ox-LDL and Angll, induce its up-regulation.
  • the LOX-1 transcriptional promoter (the promoter of the LOX1 gene, LOXlpr) is used as a disease-specific promoter of the expression vector for expressing therapeutic genes to counter a cardiovascular disease (e.g., to counter atherogenesis).
  • the LOX-1 promoter can be from human or from other species (4, 17).
  • the promoter may be a constitutive promoter— for example, the promoter may be largely or constantly active, and may be without specificity for particular cell types.
  • the promoter may be a cytomegalovirus (CMV) immediate early promoter (pr).
  • CMV cytomegalovirus
  • pr immediate early promoter
  • Such a promoter may be useful where there is less concern about a therapeutic gene leading to adverse reactions if expressed at high levels in many cell types, and/or where a compatible disease-specific or tissue-specific promoter is unknown or unsuitable.
  • the present expression vector contains a promoter comprising/consisting of (or consisting essentially of) a nucleotide sequence about 60% to about 100%, about 70% to about 100%, about 80% to about 100%, about 85% to about 100%, about 90% to about 100%, about 95% to about 100%, about 98% to about 100%, about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 100%) identical to the nucleotide sequence of SEQ ID NO: 1.
  • Non-limiting examples of the disease-specific promoters also include the promoters of the gene of Apoliporotein E (apoE), superoxide dismutase 2 (SOD2), carcinoembryonic antigen, HER-2/neu, DF3/MUC (Dachs, et al. 1997. Oncol. Res.
  • apoE Apoliporotein E
  • SOD2 superoxide dismutase 2
  • carcinoembryonic antigen HER-2/neu
  • DF3/MUC DF3/MUC
  • Promoters that may also be used in the present invention include the promoters disclosed in Eyster et al, Gene expression signatures differ with extent of atherosclerosis in monkey iliac artery, Menopause, 2011, 18(10): 1087-95. Wilcox et al., Local expression of inflammatory cytokines in human atherosclerotic plaques, J Atheroscler Thromb. 1994; 1 Suppl l :S10-3. The disclosures of both are incorporated herein by reference in their entirety.
  • the promoter may be wild-type or a mutant. Mutants can be created by introducing one or more nucleotide substitutions, additions or deletions. For example, mutations can be introduced by standard techniques, such as site-directed mutagenesis and PCR-mediated mutagenesis.
  • the expression level of a therapeutic gene (encoding a therapeutic agent) in the tissue involved in the condition being treated may be lower than the expression level of the therapeutic gene under the control of a constitutive promoter.
  • the expression level of a therapeutic gene (encoding, e.g., IL-10) in the blood vessel may be about 90%>, about 80%>, about 70%>, about 60%>, about 50%>, about 40%), about 30%>, about 20%>, less than about 90%>, less than about 80%>, less than about 70%), less than about 60%>, less than about 50%>, less than about 40%>, less than about 30%), or less than about 20%>, of the expression level of the therapeutic gene under the control of a constitutive promoter (e.g., the cytomegalovirus (CMV) immediate early promoter).
  • a constitutive promoter e.g., the cytomegalovirus (CMV) immediate early promoter
  • the expression level of a therapeutic gene (encoding a therapeutic agent) in the tissue not involved in the condition being treated may be lower than the expression level of the therapeutic gene under the control of a constitutive promoter.
  • the expression level of a therapeutic gene (encoding, e.g., IL-10) in the tissue not involved in the condition being treated may be about 90%, about 80%, about 70%, about 60%, about 50%, about 40%, about 30%, about 20%), about 10%>, about 5%, about 2%, about 1%, less than about 90%>, less than about 80%), less than about 70%>, less than about 60%>, less than about 50%>, less than about 40%), less than about 30%>, less than about 20%>, less than about 10%>, less than about 5%o, less than about 2%, less than about 1%, of the expression level of the therapeutic gene under the control of a constitutive promoter (e.g., the cytomegalovirus (CMV) immediate early promoter).
  • a constitutive promoter e.g., the cyto
  • the level of a protein may be determined by any suitable assays, including, but not limited to, using antibodies specific to the protein in Western blot, enzyme-linked immunosorbent assay (ELISA), flow cytometry, immunocytochemistry or
  • Gene expression levels may be assayed by any suitable methods, including, but not limited to, measuring mR A levels and/or protein levels. Levels of mR A can be quantitatively measured by RT-PCR, Northern blot, next-generation sequencing, etc.
  • the vectors of the present application may further comprise a heterologous gene under the control of the promoter.
  • the gene may be a therapeutic gene encoding a therapeutic agent.
  • therapeutic agents refer to any molecules or compounds that assist in the treatment or prevention of a disease.
  • the therapeutic agent that may be expressed under the control of the disease- specific promoters can be a protein, a polypeptide, a polynucleotide (e.g., a small interfering RNA (siRNA), a microRNA (miRNA), a ribozyme or an antisense molecule), an antibody or antigen-binding portion thereof, or any other molecules.
  • the therapeutic agent may be cytokines, immunoglobulins (e.g., IgG, IgM, IgA, IgD or IgE), integrins, albumin or any other potentially, therapeutically relevant molecule.
  • the choice of the particular molecule is determined by the pathology of a particular disease.
  • Non-limiting examples of the therapeutic agents include Interleukin 1 (IL-1), IL-2, IL-3, IL-4, IL-5, IL- 6, IL-7, IL-8, IL-9, IL-10, IL-11 IL-12, GM-CSF and G-CSF.
  • therapeutic agents for treating atherosclerosis include agents which down-regulate the immune system, agents which control dyslipidemia (eg. high cholesterol), and agents which down-regulate anti-reactive oxygen species (anti-ROS).
  • the present therapeutic agents may include transforming growth factor beta 1 (TGFpi), SMAD3, interleukin 10 (IL-10), STAT3, Netrin-1, angiotensin II type 2 receptor (AT2R), an anti-reactive oxygen species (anti-ROS) agent (e.g., peroxiredoxin 6 (PRDX6) which is an anti-thiol-ROS protein), apolipoprotein Al Milano (ApoAl milano) which affects dyslipidemia.
  • TGFpi transforming growth factor beta 1
  • IL-10 interleukin 10
  • STAT3 Netrin-1
  • angiotensin II type 2 receptor AT2R
  • an anti-ROS agent e.g., peroxiredoxin 6 (PRDX6) which is an anti-thiol-ROS protein
  • PRDX6 anti-reactive oxygen species
  • apolipoprotein Al Milano ApoAl milano
  • the therapeutic agent may be encoded by a gene that is downstream from an alternative therapeutic agent in the alternative agent's signal transduction pathway.
  • the anti-inflammatory abilities of TGFpi may work through a number of signal transduction pathways, including Ras-ERK, TAK1-JNK Rho- Rac-cdc42, and mothers against decapentaplegic homo logs (SMADs) 2, 3, 4 and others.
  • the therapeutic agent is SMAD2, SMAD3, or SMAD4, or any other member of a signal transduction pathway involving TGFpi .
  • the therapeutic agent is SMADl, SMAD5, SMAD6, SMAD7, or SMAD 8.
  • the therapeutic agent is specifically the human homolog of such agents, e.g. hSMAD3.
  • the therapeutic agent may be a member of a TGFpi signaling pathway, such as SMADl, SMAD2, SMAD3, SMAD4, SMAD5, SMAD6, SMAD7, SMAD 8, RhoA, mDia, ROCK, MLC, LIMK, Cofilin, Rac/Cdc42, PAK, c-Abl, Par6, PKC, PI3K, Akt, mTOR, PP2A, p70 S6K, SARA, She, GRB2, Smurfl, Smurf2, TAK1/MLK1/MEKK1, MKK3, MKK6, MKK4, p38, JNK, SOS, Ras, Erkl, Erk2, or TMEPAI.
  • SMADl SMAD2, SMAD3, SMAD4, SMAD5, SMAD6, SMAD7, SMAD 8, RhoA, mDia, ROCK, MLC, LIMK, Cofilin, Rac/Cdc42, PAK, c-Abl
  • the therapeutic agent is human SMAD3 whose cDNA corresponds to GenBank Accession No. BC050743. In another embodiment, the therapeutic agent is human SMAD3 whose cDNA corresponds to GenBank Accession No. BC000414.
  • the present methods and systems may lower the blood (serum or plasma) cholesterol level of a subject by from about 5% to about 90%, from about 10% to about 80%, from about 15% to about 70%, from about 20% to about 60%o, from about 10%> to about 20%>, from about 5% to about 15%, from about 20%> to about 30%o, from about 30%> to about 40%>, from about 40%> to about 50%>, from about 50%o to about 60%o, from about 60%> to about 70%>, from about 30%> to about 50%>, about 10%o, about 15%o, about 20%>, about 30%>, about 40%>, or about 50%>, compared to the blood (serum or plasma) cholesterol level had the present system not been delivered (or compared to the blood (serum or plasma) cholesterol level in a control sample where the present method has not been employed).
  • the therapeutic agent is a SMAD, including, but not limited to, SMAD1, SMAD2, SMAD3, SMAD4, SMAD5, SMAD6, SMAD7, and SMAD 8.
  • the therapeutic agent is SMAD3.
  • the therapeutic agent may be any agent described herein.
  • the present methods and systems may decrease fibrosis.
  • the present methods and systems may decrease the mR A or protein level of COL2A1 (collagen 2A1) in the aorta of a subject by from about 5% to about 90%o, from about 10%> to about 80%>, from about 15% to about 70%>, from about 20%o to about 60%o, from about 10%> to about 20%>, from about 5% to about 15%, from about 20% to about 30%, from about 30% to about 40%, from about 20% to about 40%, from about 40% to about 50%, from about 50% to about 60%, from about 60% to about 70%, from about 30% to about 50%, about 10%, about 15%, about 20%, about 30%, about 35%o, about 40%, or about 50%, compared to the mRNA or protein level of COL2A1 in the aorta had the present system not been delivered (or compared to the mRNA or protein level of COL2A1 in a control sample where the present method has not been employed).
  • the therapeutic agent is a SMAD, including, but not limited to, SMAD 1 , SMAD2, SMAD3, SMAD4, SMAD5, SMAD6, SMAD7, and SMAD 8.
  • the therapeutic agent is SMAD3.
  • the therapeutic agent may be any agent described herein.
  • the present methods and systems may decrease the mRNA or protein level of COL1A2 (collagen 1A2), COL2A1 (collagen 2A1) and/or connective tissue growth factor (CTGF) in the liver of a subject by from about 5% to about 90%, from about 10% to about 80%, from about 10% to about 40%, from about 15% to about 70%, from about 20%) to about 60%), from about 10% to about 20%, from about 5% to about 15%, from about 20% to about 30%, from about 30% to about 40%, from about 40% to about 50%, from about 50%> to about 60%>, from about 60%> to about 70%>, from about 30%> to about 50%, from about 50% to about 80%, about 10%, about 15%, about 20%, about 25%, about 30%, about 40%, about 45%, about 50%, about 60%, about 65%, about 70%, or about 75%, compared to the mRNA or protein level of COL1A2, COL2A1 or CTGF in the liver had the present system not been delivered (or compared to the mRNA or protein level of
  • the therapeutic agent is a SMAD, including, but not limited to, SMAD1, SMAD2, SMAD3, SMAD4, SMAD5, SMAD6, SMAD7, and SMAD 8.
  • the therapeutic agent is SMAD3.
  • the therapeutic agent may be any agent described herein.
  • Non-limiting examples of therapeutic agents also include a cytokine, a chemokine, an immunomodulatory molecule, a prodrug converting enzyme, an angiogenesis inhibitor, an angiogenesis promoter, a toxin, an antitumor agent, a mitosis inhibitor protein, an antimitotic agent, a transporter protein, tissue factor, enzymes, blood derivatives, hormones, lymphokines, interleukins, interferons, tumor necrosis factors, growth factors, neurotransmitters or their precursors or synthetic enzymes, trophic factors (such as BDNF, CNTF, NGF, IGF, GMF, alpha-FGF, beta-FGF, NT3, NT5, and
  • trophic factors such as BDNF, CNTF, NGF, IGF, GMF, alpha-FGF, beta-FGF, NT3, NT5, and
  • HARP/pleiotrophin apolipoproteins (such as ApoAI, ApoAIV, ApoE, dystrophin or a minidystrophin), the CFTR protein associated with cystic fibrosis, intrabodies, tumor- suppressing genes such as p53, Rb, RaplA, DCC, k-rev, coagulation factors such as factors VII, VIII, IX, DNA repair factors, suicide agents which cause cell death, cytosine deaminase, and pro-apoptic agents.
  • tumor- suppressing genes such as p53, Rb, RaplA, DCC, k-rev
  • coagulation factors such as factors VII, VIII, IX
  • DNA repair factors suicide agents which cause cell death, cytosine deaminase, and pro-apoptic agents.
  • the therapeutic gene encoding the therapeutic agent may be from human or other species.
  • the therapeutic gene may be wild-type or a mutant. Mutants can be created by introducing one or more nucleotide substitutions, additions or deletions. For example, mutations can be introduced by standard techniques, such as site-directed mutagenesis and PCR-mediated mutagenesis. When the therapeutic agent is a protein, conservative amino acid substitutions may be made at one or more predicted non-essential amino acid residues. A "conservative amino acid substitution" is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art.
  • amino acids with basic side chains e.g., lysine, arginine, histidine
  • acidic side chains e.g., aspartic acid, glutamic acid, asparagine, glutamine
  • uncharged polar side chains e.g., glycine, serine, threonine, tyrosine, cysteine
  • nonpolar side chains e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan
  • beta- branched side chains e.g., threonine, valine, isoleucine
  • aromatic side chains e.g., tyrosine, phenylalanine, tryptophan, histidine
  • mutations can be introduced randomly along all or part of the coding sequence, such as by saturation mutagenesis, and the resultant mutants can be screened for biological activity to identify mutants that retain activity.
  • the encoded protein can be expressed recombinantly and the activity of the protein can be determined.
  • TGFpi transforming growth factor beta 1
  • IL-10 interleukin 10
  • Such successful disease-specific gene expression should direct expression to the site of disease where it is most needed and, at the same time, limit overall production.
  • the disease-specific expression of IL-10 can be contemplated to lower the possibility of significant adverse reactions as has been reported to occur (22, 27).
  • the therapeutic agent comprises or consists of the nucleotide sequence of SEQ ID NO: 2.
  • the therapeutic agent comprises or consists of a nucleotide sequence about 60% to about 100%, about 70%> to about 100%, about 80%> to about 100%, about 85% to about 100%, about 90% to about 100%, about 95% to about 100%, about 98% to about 100%, about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%>, or about 100% identical, to the nucleotide sequence of SEQ ID NO:2.
  • the therapeutic agent may be a small interfering RNA (siR As) or small-hairpin RNA (shRNA).
  • the siRNA or shRNA may reduce or inhibit expression of a therapeutic target.
  • SiRNAs may have 16-30 nucleotides, e.g., 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.
  • the siRNAs may have fewer than 16 or more than 30 nucleotides.
  • the therapeutic agent is an antisense polynucleotide.
  • the antisense polynucleotide may bind to a therapeutic target.
  • An antisense oligonucleotide can be, for example, about 7, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, or more nucleotides in length.
  • the therapeutic agent is a ribozyme.
  • the therapeutic agent may be an antibody or antigen-binding portion thereof that is specific to a therapeutic target.
  • the antibody or antigen-binding portion thereof may be the following: (a) a whole immunoglobulin molecule; (b) an scFv; (c) a Fab fragment; and (d) an F(ab')2 etc.
  • the antibody or antigen-binding portion thereof may be monoclonal, polyclonal, chimeric and humanized.
  • vector refers to a polynucleotide capable of
  • the present vectors can be, for example, a plasmid vector, a single- or double-stranded phage vector, or a single- or double-stranded RNA or DNA viral vector.
  • Such vectors include, but are not limited to, chromosomal, episomal and virus-derived vectors, e.g., vectors derived from bacterial plasmids, bacteriophages, yeast episomes, yeast chromosomal elements, and viruses such as baculoviruses, papova viruses, SV40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses, and vectors derived from combinations thereof, such as those derived from plasmid and bacteriophage genetic elements, cosmids and phagemids.
  • Expression vectors can be used to replicate and/or express the nucleotide sequence encoding a therapeutic agent in a target mammalian cell.
  • Viral vectors include, but are not limited to, adeno-associated virus, adenovirus, vaccinia virus, alphavirus, retrovirus and herpesvirus vectors.
  • the vector is an adeno-viral associated virus (AAV) vector.
  • AAV adeno-viral associated virus
  • the promoter can function in a disease-specific manner within the AAV vector due to the lack of strong promoter elements within the AAV inverted terminal repeats (35, 36). See also, e.g., Walsh et al, 1993, Proc. Soc. Exp. Biol. Med. 204:289-300; U.S. Pat. No.
  • AAV has been known to be an effective vector since 1984 (31, 32, 33-38), including delivering the IL10 gene in mouse atherogenesis models (26, 27).
  • AAV serotypes may be used, including, but not limited to, AAVl, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVl 1, etc.
  • the present vector may comprise wild-type or mutant AAV capsid (e.g., AAV2, AAV8, etc.) encoded by the AAV cap open reading frame (ORF).
  • AAV capsid e.g., AAV2, AAV8, etc.
  • ORF AAV cap open reading frame
  • the mutant AAV capsid may have at least one tyrosine residue mutated (e.g., deleted, substituted with other amino acid residue(s), or having amino acid residue(s) inserted adjacent to the tyrosine). In another embodiment, there is an insertion of at least one amino acid residues into the cap ORF or the capsid gene.
  • the mutant AAV capsid may have a combination of two or more of the above mutations.
  • the AAV2 capsid may have Tyrosine-444 replaced by
  • AAV8 capsid may have Tyrosine-447 replaced by phenylalanine, and/or Tyrosine-733 replaced by phenylalanine.
  • SEQ ID NO: 4 shows the amino acid sequence of AAV8 capsid with both tyrosine residues at positions 447 and 733 being substituted with phenylalanine residues.
  • SEQ ID NO: 3 shows the nucleotide sequence of AAV8 capsid with both tyrosine residues at positions 447 and 733 being substituted with phenylalanine residues.
  • a 7-amino acid peptide having the sequence EYHHYNK (SEQ ID NO: 13) (refered to as "EYH” peptide herein), is inserted into the AAV capsid.
  • the AAV2 capsid may have the peptide having the sequence EYHHYNK inserted after amino acid position 588.
  • the AAV8 capsid may have the peptide having the sequence EYHHYNK inserted after amino acid position 590 (e.g., see SEQ ID NO: 5 for the nucleotide sequence of this embodiment; and SEQ ID NO: 6 for its amino acid sequence).
  • the AAV capsid may have a combination of two or more of the above modifications.
  • SEQ ID NO: 7 shows the modified AAV8 capsid nucleotide sequence
  • SEQ ID NO: 8 shows the modified AAV8 capsid amino acid sequence
  • EYHHYNK 7-amino acid peptide
  • the present vector may comprise one or more of the following sequences: SEQ
  • Adenoviruses are described in, e.g., Rosenfeld et al, 1991, Science 252:431-434; Rosenfeld et al, 1992, Cell 68: 143-155; Mastrangeli et al, 1993, J. Clin. Invest. 91 :225- 234; Kozarsky and Wilson, 1993, Curr. Opin. Genetics Develop. 3:499-503; Bout et al, 1994, Human Gene Therapy 5:3-10; PCT Publication No. WO 94/12649; and Wang et al, 1995, Gene Therapy 2:775-783).
  • U.S. Patent No. 7,244,617 are described in, e.g., Rosenfeld et al, 1991, Science 252:431-434; Rosenfeld et al, 1992, Cell 68: 143-155; Mastrangeli et al, 1993, J. Clin. Invest. 91 :225- 234; Kozarsky and Wilson, 1993, Curr. Opin. Genetics Develop
  • the present expression vector is a lentivirus (including human immunodeficiency virus (HIV)), which is a sub-type of retrovirus.
  • HIV human immunodeficiency virus
  • Plasmids that may be used as the present expression vector include, but are not limited to, pGL3, pCDM8 (Seed, 1987, "An LFA-3 cDNA encodes a phospholipid-linked membrane protein homologous to its receptor CD2", Nature. 840-842) and pMT2PC (Kaufman et al, 1987, "Translational efficiency of polycistronic mRNAs and their utilization to express heterologous genes in mammalian cells", EMBO J. 6: 187-193). Any suitable plasmid may be used in the present invention.
  • vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., episomal mammalian vectors).
  • Other vectors e.g., non- episomal mammalian vectors
  • Gene Therapy refers to therapy performed by the administration to a subject of an expressed or expressible nucleic acid. Accordingly, the present invention provides for a method for treating or preventing a condition including cardiovascular diseases comprising administering to a patient in need thereof an effective amount of the present expression vector.
  • composition described for administration by gene therapy can also be useful, apart from gene therapy approaches, for in vitro or ex vivo manipulations.
  • Gene therapy vectors can be administered to a subject systemically or locally by, for example, intravenous injection (See, e.g., U.S. Pat. No. 5,328,470) or by stereotactic injection (See, e.g., Chen et al, 1994, Proc Natl Acad Sci. 91 :3054-57).
  • a pharmaceutical preparation of the gene therapy vector can comprise a gene therapy vector in an acceptable diluent, or can comprise a slow release matrix in which the gene delivery vehicle is embedded.
  • the pharmaceutical preparation can include one or more cells which produce the gene delivery system.
  • Gene therapy involves introducing a gene construct to cells in tissue culture or in vivo.
  • Methods for introduction of polynucleotides of the invention to cells in vitro include, but are not limited to, electroporation, lipofection, calcium phosphate -mediated transfection, and viral infection.
  • the method of transfer includes the transfer of a selectable marker to the cells. The cells are then placed under selection to isolate those cells that have taken up and are expressing the transferred gene. Those cells are then delivered to a subject.
  • the polynucleotides of the invention can be introduced into the target tissue as an implant, for example, in a polymer formulation (See, e.g., U.S. Pat. No. 5,702,717).
  • the polynucleotides of the invention can be targeted to the desired cells or tissues.
  • an expression vector can be delivered directly into a subject.
  • the polynucleotides of the invention can be injected directly into the target tissue or cell derivation site.
  • a subject's cells are first transfected with an expression construct in vitro, after which the transfected cells are administered back into the subject (i.e., ex vivo gene therapy).
  • the polynucleotides of the invention can be delivered in vivo or ex vivo to target cells.
  • Several methods have been developed for delivering the polynucleotides of the invention to target cells or target tissues.
  • a vector is introduced in vivo such that it is taken up by a cell and directs the expression of the therapeutic agent of the invention.
  • a vector can remain episomal or can chromosomally integrate.
  • an expression vector is administered directly in vivo, where the vector is expressed to produce the encoded product.
  • This can be accomplished by any of numerous methods known in the art, e.g., by placing a nucleic acid of the invention in an appropriate expression vector such that, upon administration, the vector becomes intracellular and expresses a therapeutic agent.
  • Such vectors can be internalized by using, for example, a defective or attenuated retroviral vector or other viral vectors that can infect mammalian cells (See, e.g., U.S. Pat. No. 4,980,286).
  • an expression construct comprising a nucleic acid of the invention can be injected directly into a target tissue as naked DNA.
  • an expression vector can be introduced intracellularly using microparticle bombardment, for example, by using a Biolistic gene gun (Dupont).
  • an expression construct comprising a nucleic acid of the invention can be coated with lipids, or cell- surface receptors, or transfecting agents, such that encapsulation in liposomes, microparticles, or microcapsules facilitates access to target tissues and/or entry into target cells.
  • an expression construct comprising a nucleic acid of the invention is linked to a polypeptide that is internalized in a subset of cells or is targeted to a particular cellular compartment.
  • the linked polypeptide is a nuclear targeting sequence which targets the vector to the cell nucleus.
  • the linked polypeptide is a ligand that is internalized by receptor- mediated endocytosis in cells expressing the respective receptor for the ligand (See, e.g., Wu and Wu, 1987, J. Biol. Chem. 262:4429-4432).
  • nucleic acid-ligand complexes can be formed such that the ligand comprises a fusogenic viral peptide which disrupts endosomes, thereby allowing the nucleic acid to avoid lysosomal degradation.
  • a nucleic acid of the invention can be targeted in vivo via a cell-specific receptor resulting in cell-specific uptake and expression (See, e.g., International Patent Publications WO 92/06180, WO 92/22635, WO 92/20316, WO 93/14188, and WO 93/2022.
  • a nucleic acid of the invention is introduced intracellularly and, by homologous recombination, can transiently or stably be incorporated within the host cell DNA, which then allows for its expression, (Koller and Smithies, 1989, Proc Natl Acad Sci. 86:8932-8935; Zijlstra et al, 1989, Nature 342:435-438).
  • the expression vector is introduced into a cell prior to administration in vivo of the resulting recombinant cell.
  • introduction can be carried out by any method known in the art, including, but not limited to, transfection, electroporation, microinjection, infection with a viral or bacteriophage vector comprising the polynucleotides, cell fusion, chromosome -mediated gene transfer, microcell-mediated gene transfer, and spheroplast fusion.
  • Numerous techniques are known in the art for the introduction of foreign genes into cells (See, e.g., Maniatis et al, 1989; Current Protocols in Molecular Biology, John Wiley & Sons, 2000; Loeffler and Behr, 1993, Meth.
  • the resulting recombinant cells can be delivered to a subject by various methods known in the art, and the skilled artisan would appreciate appropriate modes of administration.
  • intravenous administration may be the preferred mode of administration for recombinant hematopoietic stem cells.
  • the number of recombinant cells to be administered to a subject can be determined by one skilled in the art, and would include a consideration of factors such as the desired effect, the disease state, and the mode of administration.
  • the present expression vectors, compositions and methods may be used to treat or prevent a cardiovascular disease, such as atherosclerosis, stenosis, restenosis,
  • LVH left ventricular hypertrophy
  • myocardial infarction acute coronary syndrome
  • stroke transient ischemic attack
  • impaired circulation heart disease, cholesterol and plaque formation
  • ischemia ischemia reperfusion injury
  • peripheral vascular disease myocardial infection, cardiac disease (e.g, risk stratification of chest pain and interventional procedures), cardiopulmonary resuscitation, kidney failure, thrombosis (e.g., venous thrombosis, deep vein thrombosis, portal vein thrombosis, renal vein thrombosis, jugular vein thrombosis, cerebral venous sinus thrombosis, arterial thrombosis, etc.), thrombus formation, thrombotic event or complication, Budd-Chiari syndrome, Paget-Schroetter disease, coronary heart disease, coronary artery disease, need for coronary revascularization, peripheral artery disease, a pulmonary circulatory disease, pulmonary embolism, a cerebrovascular disease,
  • Conditions that may also be treated using the present compositions and methods include diseases which are more prominent due to aging or increased inflammation, such as stroke, arthritis, and dementia.
  • Schwarz et al. Identification of differentially expressed genes induced by transient ischemic stroke, Brain Res Mol Brain Res. 2002; 101(l-2):12-22.
  • Simopoulou et al Lectin-like oxidized low density lipoprotein receptor 1 (LOX-1) expression in human articular chondrocytes. Clin Exp Rheumatol. 2007, 25(4):605-12.
  • Non-limiting examples of the conditions the present expression vectors, compositions and methods may be used to treat or prevent include rheumatoid arthritis, adenosine deaminase deficiency, hemophilia, cystic fibrosis, and hyperproliferative disorders (e.g., cancer etc.), bone resorption, osteoporosis, osteoarthritis, periodontitis, hypochlorhydia and neuromyelitis optica, insulin resistance, glucose intolerance, diabetes mellitus, hyperglycemia, hyperlipidemia, dyslipidemia, hypercholesteremia,
  • hypertriglyceridemia hyperinsulinemia, diabetic dyslipidemia, HIV-related
  • the present invention provides for a pharmaceutical composition comprising a therapeutically effective amount of the present expression vector.
  • the present agents or pharmaceutical compositions may be administered by any route, including, without limitation, oral, transdermal, ocular, intraperitoneal,
  • intravenous, ICV, intracisternal injection or infusion subcutaneous, implant, sublingual, subcutaneous, intramuscular, intravenous, rectal, mucosal, ophthalmic, intrathecal, intraarticular, intra-arterial, sub-arachinoid, bronchial and lymphatic administration.
  • the present composition may be administered parenterally or systemically.
  • compositions of the present invention can be, e.g., in a solid, semi-solid, or liquid formulation.
  • Intranasal formulation can be delivered as a spray or in a drop;
  • inhalation formulation can be delivered using a nebulizer or similar device;
  • topical formulation may be in the form of gel, ointment, paste, lotion, cream, poultice, cataplasm, plaster, dermal patch aerosol, etc.; transdermal formulation may be administered via a transdermal patch or iontorphoresis.
  • Compositions can also take the form of tablets, pills, capsules, semisolids, powders, sustained release formulations, solutions, emulsions, suspensions, elixirs, aerosols, chewing bars or any other appropriate compositions.
  • composition may be administered locally via implantation of a membrane, sponge, or another appropriate material on to which the desired molecule has been absorbed or encapsulated.
  • a membrane, sponge, or another appropriate material on to which the desired molecule has been absorbed or encapsulated may be implanted into any suitable tissue or organ, and delivery of the desired molecule may be via diffusion, timed release bolus, or continuous administration.
  • one or more of compound of the present invention may be mixed with a pharmaceutical acceptable excipient, e.g., a carrier, adjuvant and/or diluent, according to conventional pharmaceutical compounding techniques.
  • a pharmaceutical acceptable excipient e.g., a carrier, adjuvant and/or diluent
  • compositions encompass any of the standard pharmaceutical carriers, such as a phosphate buffered saline solution, water, and emulsions, such as an oil/water or water/oil emulsion, and various types of wetting agents.
  • the compositions can additionally contain solid pharmaceutical excipients such as starch, cellulose, talc, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, magnesium stearate, sodium stearate, glycerol monostearate, sodium chloride, dried skim milk and the like.
  • Liquid and semisolid excipients may be selected from glycerol, propylene glycol, water, ethanol and various oils, including those of petroleum, animal, vegetable or synthetic origin, e.g., peanut oil, soybean oil, mineral oil, sesame oil, etc.
  • Liquid carriers particularly for injectable solutions, include water, saline, aqueous dextrose, and glycols.
  • carriers, stabilizers, preservatives and adjuvants see Remington's Pharmaceutical Sciences, edited by E. W. Martin (Mack Publishing Company, 18th ed., 1990). Additional excipients, for example sweetening, flavoring and coloring agents, may also be present.
  • the pharmaceutically acceptable excipient may be selected from the group consisting of fillers, e.g. sugars and/or sugar alcohols, e.g. lactose, sorbitol, mannitol, maltodextrin, etc.; surfactants, e.g. sodium lauryle sulfate, Brij 96 or Tween 80;
  • disintegrants e.g. sodium starch glycolate, maize starch or derivatives thereof; binder, e.g. povidone, crosspovidone, polyvinylalcohols, hydroxypropylmethylcellulose;
  • lubricants e.g. stearic acid or its salts
  • flowability enhancers e.g. silicium dioxide
  • sweeteners e.g. aspartame
  • colorants e.g. colorants.
  • Pharmaceutically acceptable carriers include any and all clinically useful solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like.
  • the pharmaceutical composition may contain excipients for modifying, maintaining or preserving, for example, the pH, osmolarity, viscosity, clarity, color, isotonicity, odor, sterility, stability, rate of dissolution or release, adsorption or penetration of the composition.
  • excipients include, but are not limited to, amino acids (such as glycine, glutamine, asparagine, arginine or lysine); antimicrobials;
  • antioxidants such as ascorbic acid, sodium sulfite or sodium hydrogen sulfite
  • buffers such as borate, bicarbonate, Tris HCl, citrates, phosphates, other organic acids
  • bulking agents such as mannitol or glycine
  • chelating agents such as ethylenediamine tetraacetic acid (EDTA), ethylene glycol tetraacetic acid (EGTA)
  • complexing agents such as caffeine, polyvinylpyrrolidone, beta cyclodextrin or hydroxypropyl beta cyclodextrin
  • fillers monosaccharides; disaccharides and other carbohydrates (such as glucose, mannose, or dextrins); proteins (such as serum albumin, gelatin or
  • immunoglobulins coloring; flavoring and diluting agents; emulsifying agents;
  • hydrophilic polymers such as polyvinylpyrrolidone
  • low molecular weight polymers such as polyvinylpyrrolidone
  • polypeptides comprising polypeptides; salt forming counterions (such as sodium); preservatives (such as benzalkonium chloride, benzoic acid, salicylic acid, thimerosal, phenethyl alcohol, methylparaben, propylparaben, chlorhexidine, sorbic acid or hydrogen peroxide);
  • salt forming counterions such as sodium
  • preservatives such as benzalkonium chloride, benzoic acid, salicylic acid, thimerosal, phenethyl alcohol, methylparaben, propylparaben, chlorhexidine, sorbic acid or hydrogen peroxide
  • solvents such as glycerin, propylene glycol or polyethylene glycol
  • sugar alcohols such as mannitol or sorbitol
  • suspending agents such as pluronics, PEG, sorbitan esters, polysorbates such as polysorbate 20, polysorbate 80, triton, tromethamine, lecithin, cholesterol, tyloxapal
  • stability enhancing agents such as pluronics, PEG, sorbitan esters, polysorbates such as polysorbate 20, polysorbate 80, triton, tromethamine, lecithin, cholesterol, tyloxapal
  • stability enhancing agents such asucrose or sorbitol
  • tonicity enhancing agents such as alkali metal halides (in one aspect, sodium or potassium chloride, mannitol sorbitol)
  • delivery vehicles diluents; excipients and/or pharmaceutical adjuvants.
  • Oral dosage forms may be tablets, capsules, bars, sachets, granules, syrups and aqueous or oily suspensions. Tablets may be formed form a mixture of the active compounds with fillers, for example calcium phosphate; disintegrating agents, for example maize starch, lubricating agents, for example magnesium stearate; binders, for example microcrystalline cellulose or polyvinylpyrrolidone and other optional ingredients known in the art to permit tabletting the mixture by known methods.
  • capsules for example hard or soft gelatin capsules, containing the active compound, may be prepared by known methods. The contents of the capsule may be formulated using known methods so as to give sustained release of the active compounds.
  • the active compounds may be formulated into granules with or without additional excipients.
  • the granules may be ingested directly by the patient or they may be added to a suitable liquid carrier (e.g. water) before ingestion.
  • the granules may contain disintegrants, e.g. an effervescent pair formed from an acid and a carbonate or bicarbonate salt to facilitate dispersion in the liquid medium.
  • disintegrants e.g. an effervescent pair formed from an acid and a carbonate or bicarbonate salt to facilitate dispersion in the liquid medium.
  • Intravenous forms include, but are not limited to, bolus and drip injections.
  • intravenous dosage forms include, but are not limited to, Water for Injection USP; aqueous vehicles including, but not limited to, Sodium Chloride Injection, Ringer's Injection, Dextrose Injection, Dextrose and Sodium Chloride Injection, and Lactated Ringer's Injection; water-miscible vehicles including, but not limited to, ethyl alcohol, polyethylene glycol and polypropylene glycol; and non-aqueous vehicles including, but not limited to, corn oil, cottonseed oil, peanut oil, sesame oil, ethyl oleate, isopropyl myristate and benzyl benzoate.
  • aqueous vehicles including, but not limited to, Sodium Chloride Injection, Ringer's Injection, Dextrose Injection, Dextrose and Sodium Chloride Injection, and Lactated Ringer's Injection
  • water-miscible vehicles including, but not limited to, ethyl alcohol, polyethylene glycol and polyprop
  • compositions include formulations in sustained or controlled delivery, such as using liposome or micelle carriers, bioerodible microparticles or porous beads and depot injections.
  • the present compound(s) or composition may be administered as a single dose, or as two or more doses (which may or may not contain the same amount of the desired molecule) over time, or as a continuous infusion via implantation device or catheter.
  • the pharmaceutical composition can be prepared in single unit dosage forms. Appropriate frequency of administration can be determined by one of skill in the art and can be administered once or several times per day (e.g., twice, three, four or five times daily).
  • the compositions of the invention may also be administered once each day or once every other day.
  • the compositions may also be given twice weekly, weekly, monthly, or semi-annually.
  • treatment is typically carried out for periods of hours or days, while chronic treatment can be carried out for weeks, months, or even years.
  • compositions of the invention can be carried out using any of several standard methods including, but not limited to, continuous infusion, bolus injection, intermittent infusion, inhalation, or combinations of these methods.
  • continuous infusion bolus injection
  • intermittent infusion inhalation
  • one mode of administration that can be used involves continuous intravenous infusion.
  • the infusion of the compositions of the invention can, if desired, be preceded by a bolus injection.
  • kits according to the invention include package(s) (e.g., vessels) comprising agents or compositions of the invention.
  • the kit may include an expression vector of the present invention.
  • the expression vector may be present in unit dosage forms.
  • Examples of pharmaceutical packaging materials include, but are not limited to, bottles, tubes, inhalers, pumps, bags, vials, containers, syringes, bottles, and any packaging material suitable for a selected formulation and intended mode of
  • Kits can contain instructions for administering agents or compositions of the invention to a patient. Kits also can comprise instructions for uses of the present agents or compositions. Kits also can contain labeling or product inserts for the present expression vectors or compositions. The kits also can include buffers for preparing solutions for conducting the methods. The instruction of the kits may state that the expression vector drives disease-specific expression of a therapeutic agent.
  • Subjects, which may be treated according to the present invention include all animals which may benefit from administration of the agents of the present invention. Such subjects include mammals, preferably humans, but can also be an animal such as dogs and cats, farm animals such as cows, pigs, sheep, horses, goats and the like, and laboratory animals (e.g., rats, mice, guinea pigs, and the like).
  • TGFpi transforming growth factor beta 1
  • IL10 interleukin 10
  • TGFpi transforming growth factor beta 1
  • IL10 interleukin 10
  • LOXl oxidized low density lipoprotein receptor 1
  • an adeno-associated virus vector (AAV2 backbone), using the AAV8 capsid, and containing the full length LOX1 promoter (LOXlpr; 2.4 kb), was generated and assayed for its ability to express human interleukin 10 (hILlO) for anti-atherosclerotic effect in low density lipoprotein receptor knockout (LDLR KO) mice on high cholesterol diet (HCD).
  • hILlO human interleukin 10
  • LDLR KO low density lipoprotein receptor knockout mice on high cholesterol diet
  • CMVpr cytomegalovirus immediate early
  • AAV2/8.LOXlpr-hIL10 and AAV2/8.CMVpr-hIL10 were found to give statistically equal efficacy in their down-regulation of atherogenesis as measured by aortic systolic blood velocity, aortic cross sectional area, and aortic wall thickness. This is a direct comparison of a constitutive promoter (CMVpr) with a disease-specific promoter (LOXlpr) in a therapeutic context.
  • CMVpr constitutive promoter
  • LOXlpr disease-specific promoter
  • the full length Loxl promoter (nt -2402 to +9) was amplified from human 293 cell by PCR using the primers: upstream 5'- ⁇ TGCA 7TCTTTCTTATTTGGGGGAAG-3 ' (SEQ ID NO: 14) and downstream 5'- ⁇ CGCGT ACT AAAAAT ATGTGAGCTTCTG-3 ' (SEQ ID NO: 15).
  • Nsi I and M I (underlined) sites were included in the primers to allow easy ligation in front of the hILlO gene within the gutted AAV2 plasmid dl3-97.
  • Construction and generation of AAV/Neo and AAV/CMVpr-hlLlO recombinant virus have been described previously (28, 37, 50).
  • CMVpr cytomegalovirus immediate early constitutive promoter
  • the virus stocks were generated and titered by dot blot hybridization as described previously (18, 32, 50). The titers were calculated to be about lxlO 9 encapsidated genomes per ml (eg/ml).
  • the low density lipoprotein receptor (LDLR) knockout mouse (B6;l29S7-Ldlr tmlHer /3) was used in these studies, and was purchased from Jackson Laboratories (Bar Harbor, ME, USA).
  • High cholesterol diet of 4% cholesterol and 10% Coco butter diet (Harlan Teklad, Madison, WI, USA) was then provided on the day of first injection and continuously maintained for twenty weeks. This high fat level HCD diet was used to ensure the development of atherosclerosis.
  • Another control group included mice fed a normal chow diet. All animals were weighed weekly starting at 16 weeks post-injection.
  • the Vevo 770 High-Resolution Imaging system (Visualsonics, Toronto, Canada) was used for ultrasound imaging, using an RMV 707B transducer, having a center frequency of 30 MHz. Animals were prepared as described earlier (50). Briefly, eight to ten mice from each group were anesthetized with 1.5% isoflurane (Isothesia, Abbot Laboratories, Chicago, USA), with supplemental oxygen and laid supine on a thermostatically heated platform. Their legs were taped to ECG electrodes for cardiac function monitoring. A shaver was used to remove abdominal hair along with a chemical hair remover (Church & Dwight Co, Inc., NJ, USA) and pre-warmed US gel (Medline Industries, Inc.,
  • the flow velocity, orientation of the abdominal aorta on ultrasound was accomplished by tilting the platform and the head of mouse down with the transducer probe towards the feet and tail of the mouse.
  • the described positioning ensured that the Doppler angle was less than 60° for accurate measurements of blood flow velocity in the pulse-wave Doppler (PW) mode within the aorta.
  • Measurements and data analysis was performed off-line on the longitudinal and transverse images using the customized version of Vevo770 Analytical Software. It took approximately 25-30 minutes to carry out the complete imaging for each mouse.
  • VAMU Veterans Animal Laboratory
  • VAV The Veterans Animal Laboratory
  • VSU The Veterans Animal Laboratory
  • hILlO gene expression analysis using real-time quantitative reverse transcription PCR (QRT-PCR) Six mice from each group were sacrificed and total aortic RNA was extracted with TRIzol extraction (Invitrogen Carlsbad, CA) according to the manufacturer's instructions.
  • cDNA was generated using random hexamer primers and RNase H-reverse transcriptase (Invitrogen, Carlsbad, CA). QRT-PCR was then performed using the Applied
  • Biosystems Fast 7900HT real-time PCR system (Applied Biosystems, Foster City, CA) as described (33).
  • the comparative threshold cycles (Ct) values were normalized for the Pactin reference gene and then compared with a calibrator by the 2 "AACt method.
  • AAV2/8.LOXlpr- IL10 was compared to AAV2/8.CMVpr-IL10 delivery in LDLR KO mice and then placed on high cholesterol diet (HCD).
  • An AAV/Neomycin resistance gene (Neo) vector was also used as a non-therapeutic, null control.
  • Vector structures are shown in Figure 1 A and the overall experimental scheme in Figure IB.
  • a more detailed view of the AAV.LOXlpr-hlLlO vector plasmid is shown in Figure 2.
  • mice were sacrificed to determine the success of gene delivery by analyzing hILlO mRNA expression in the aorta using qRT-PCR analysis.
  • This analysis utilized mRNA isolated from 6 mouse aortas from each group, harvested at week 20.
  • Representative results for LOXlpr- and CMVpr-hlLlO-treated mice are shown in Figure 3, and both vectors were observed to be highly expressed in aortas at a level of appropriately 0.1-0.2% that of ⁇ -actin.
  • CMVpr and LOXlpr were statistically similar, it is apparent that the LOXlpr expression trended lower, less than 50% than that of CMVpr.
  • both CMVpr- and LOXlpr- driven gene therapies (hIL-10) on HCD had markedly lower flow velocity than the Neo-HCD-treated group, and very similar to that of the ND fed control animals.
  • both CMVpr- and LOXlpr- treatments displayed an anti-atherosclerotic effect and were statistically similar in their degree efficacy.
  • FIG. 7 shows the quantified results for the thoracic region of the aorta.
  • the ND group had the thinnest aortic walls.
  • HRUS aortic systolic blood velocity, lumen size, and wall thickness
  • an AAV2/8.LOXlpr-hIL10 vector was effective in inhibiting atherogenesis in LDLR KO mice on HCD, and was statistically equal to the inhibition derived from an AAV2/8.CMV-IL10 vector delivery.
  • This is a direct comparison of a disease-specific promoter to a general expression promoter for determination of level of efficacy.
  • the cytomegalovirus immediate early promoter is perhaps the most used promoter in gene delivery experiments.
  • this study establishes that disease-specific promoters are still able to express therapeutic transgenes to efficacious levels. It has been shown that the 2.4 kb LOXl promoter fragment has significant activity and responsiveness to disease-associated stimuli as does the wt LOX- 1 promoter.
  • LOXl promoter activity is very low (44-48).
  • OxLDL plays a role as we enhanced this agent with the HCD, but other stimulations are also possible, such as angiotensin II.
  • the LOXl promoter has been recently reviewed (35).
  • the LOXlpr structure in Figure 2 shows that the DNA elements needed for Ox-LDL and Angll responsiveness represent only a small part of the full 2.4 kb promoter. This suggests some condensation of the LOX1 promoter might be undertaken to make this disease-specific promoter shorter and more useful for a wider variety of transgenes. This is important as the packaging of AAV genomes becomes more problematic as the size of the genome rises above 4.7 kb (61). However, additional disease-specific promoters and alterations to IL10 or other downstream genes besides STAT3, may be studied. This study also solidifies the usefulness and utility of adeno- associated virus vectors for cardiovascular gene therapy (37-40,59,60) as well as other diseases (34-37).
  • LOX1 gene expression approach For the safe design of vectors carrying such powerful genes we have pioneered the "disease-specific promoter” gene expression approach in gene therapy.
  • a disease-specific promoter will limit the expression and "adverse reactions" of IL10, yet provides adequate expression at the site of disease to give treatment.
  • the LOX1 gene is transcriptionally up-regulated early on in CVD (cardiovascular disease) in a number of cell types, including smooth muscle cells, predating and predicting the sites of future CVD.
  • AAV2 backbone adeno-associated virus vector
  • AAV8 capsid containing the full length LOX1 promoter (LOXlpr; 2.4 kb) driving expression of the human (h)IL10, for anti-atherosclerotic effect in low density lipoprotein receptor knockout (LDLR KO) mice on high cholesterol diet (HCD).
  • LOXlpr full length LOX1 promoter
  • HCD high cholesterol diet
  • the LOXlpr vector gave statistically equal efficacy to the CMVpr vector in down-regulating atherogenesis as measured by aortic cross sectional area, aortic wall thickness, and aortic systolic blood velocity, yet overall IL10 expression was significantly lower with the LOXlpr.
  • the disease-specific LOXlpr gives therapeutic expression of IL10, but while maintaining overall lower IL10 expression.
  • Atherosclerosis in a mouse model e.g., C57BL/6 LDLR KO mice
  • Task 3 for the titer needed for efficacy in a rabbit model (e.g., familial hypercholesterolemic WHHL rabbits).
  • the completion of these tasks will allow us to move on to toxicology analysis of our anti-atherosclerotic gene therapy agent before finally going to PHASE I clinical trials in patients.
  • Results may include the following:
  • the targets for arterial gene delivery include the smooth muscle cells which express LOX-1.
  • LOXlpr LOX1 transcriptional promoter
  • the first technology will be to improve the AAV serotype 8 (AAV8) capsid protein with two modifications to increase gene delivery into arteries. These are amino acid tyrosine modifications, for capsid survival, and EYH peptide insertion, for very high frequency infection of smooth muscle cells.
  • AAV8 AAV serotype 8
  • AAV gene expression by AAV can be stably maintained for many months. Moreover, AAV is efficiently taken up by cardiovascular tissues (28-34,27,29). Richter et al. (50) showed efficient transduction in carotid arteries and that smooth muscle cells (SMCs) were the primary target. We found similar results (see Figure 8), with uptake in the liver, lungs, kidneys, and blood vessels, via a single intravenous injection. In fact, AAV has the advantage of both high safety and long term expression.
  • EYH EYHHYNK
  • AAV2/EYH This enhancement with the AAV2/EYH modification motivated us to employ this AAV capsid in the proposed research instead of AAV8, which we had used most recently.
  • a series of tyrosine mutations within the AAV2 capsid gene which, when replaced by phenylalanine, was shown to allow for 10- to 50-fold higher transduction (69). The most important of these is at amino acid (aa) 730 (69). While AAV2 is the most used vector and, historically, the first AAV serotype to be used for gene delivery, we have used AAV8 extensively for arterial gene delivery (60-62).
  • AA V2/8.LOXlpr-hIL10 demonstrates that disease-limited expression of IL10 provides efficacy against atherogenesis, yet with significantly lower overall expression than when using the CMVpr.
  • Task 1 is the generation of a new capsid, protein coat, a modification of AAV8, which gives higher transduction of smooth muscle cells in arteries. Our goal will be to improve gene delivery into umbilical cord blood vessels at least 5 fold above wild type AAV8 capsid vectors. This will give us a new, improved modified AAV8 vector for gene delivery into arteries. This improved CVD gene delivery vector will be referred to as AAV2/8(cvdl).LOXlpr-IL10.
  • Task 2 is to determine titer of AAV2/8(cvdl).LOXlpr- IL10 vector, generated in Task 1, needed for efficacy against HCD-induced atherosclerosis in LDLR KO mice.
  • Task 2 will determine the level of virus needed to test in the Phase II toxicology studies, as a prelude before advancing to clinical studies.
  • Task 3 is to determine titer of AAV2/8(cvdl).LOXlpr-IL10 vector, generated in Task 1, needed for efficacy against HCD-induced atherosclerosis in WHHL rabbits.
  • Taskl Modification of AA V8 by replacement of specific tyrosines and insertion of EYH peptide.
  • Task 1 encompass two modifications of the AAV8 capsid.
  • One modification will be the insertion of the EYH peptide, which improves infection to human vascular smooth muscle cells (see Figure 8). Smooth muscle cells are in abundance in the normal aorta, as well in the advanced atheroma.
  • LOX-1 is up-regulated in arterial smooth muscle cells by a variety of insults such as oxidized low density lipoprotein and pro-inflammatory cytokines (73-74). The other will be the removal of certain tyrosine amino acids which are targeted by the cells protease systems for premature AAV capsid degradation.
  • AAV8 capsid As we have the AAV2 capsid, by inserting the EYHHYNK (EYH) peptide, which promotes binding to and infection of human vascular smooth muscle cells (VSMCs) in culture (68-70).
  • EYH EYHHYNK
  • VSMCs vascular smooth muscle cells
  • GenScript GenScript to generate the modifications within the AAV8 helper plasmid pDG8. While the original work was done with AAV2 infection of cultured human VSMCs, we repeated the general AAV capsid modification in AAV8 by inserting the EYH peptide sequence, as a DNA sequence, into the AAV capsid gene at amino acid (AA) position 590 (75).
  • AAV8/Y447F/Y733F/590-EYH virus which include the enhanced green florescence protein (eGFP) and assay for its ability to transduce human VSMCs within human placental umbilical cord vein rings in culture.
  • eGFP enhanced green florescence protein
  • AAV2/8(cvdl) refers to the modified AAV2/8-Y730F-EYH capsid derived from Task 1.
  • Task 2 Test efficacy in LDLR KO mice.
  • the goal in Task 2 is to determine the amount, titer of, AAV2/8(cvdl).LOXlpr-IL10 (Kcardio-1) which is needed to give efficacy.
  • We will use the LDLR KO mouse model to determine this efficacious titer.
  • Our goal will be to inhibit atherosclerosis in the LDLR KO mouse model by 70% when placed on a high fat high cholesterol diet (HCD).
  • HCD high fat high cholesterol diet
  • the information on the virus amount needed for efficacy will then be utilized in the toxicology studies of Phase2. Methods are described in more detail in our previous publications (26-31,33,35,48,48,70-72).
  • C57BL/6 LDLR KO mice (18- 20grams) in each of the seven treatment groups will include: AAV2/8(cvdl) refers to the modified AAV2/Y730F/EYH vector capsid derived from Task 1.
  • Neo- and ILlO-gene treated animals will be fed a high-cholesterol diet (HCD) consisting of 4% cholesterol and 10% cocoa butter (Harlan Teklad, Madison, WI) on the day of the first injection. Mice fed normal chow diets will be included as controls. Animals will be weighed weekly.
  • HCD high-cholesterol diet
  • Mice fed normal chow diets will be included as controls. Animals will be weighed weekly.
  • qRT-PCR quantitative real-time reverse transcriptase- PCR
  • markers and cytokines by immunohistochemistry. Standard methods will be utilized to visualize and measure the respective targets described (28,29,54,64,63).
  • macrophage markers such as CD68, CD36, ITGAM, and EMR will be studied.
  • Plasma levels of total cholesterol in mice from respective treatment groups will be measured by VetScan VS2 (ABAXIS, Union City) at the Veterans Animal Laboratory (VAMU).
  • Task 3 Test efficacy in WHHL rabbits.
  • the goal in Task 3 is to determine the amount, titer of, AAV2/8(cvdl).LOXlpr-IL10 (Kcardio-1) which is needed to give efficacy.
  • Our goal will be to inhibit atherosclerosis in the WHHL rabbit model by 70% when placed on a high fat high cholesterol diet (HCD).
  • HCD high fat high cholesterol diet
  • WHHL rabbits will be infected at 2 months old before the development of atherosclerosis (HCD is not needed) and analyzed at 6 months when atherosclerosis is expected to cover about 35% of the aortic surface (.
  • the information on the virus amount needed for efficacy will then utilized at a 1 OX/weight, ten fold level in the toxicology studies in Phase II.
  • the animal goups will be: 1) AAV2/8(cvdl)/Neo-normal diet (ND), 2) AAV2/8(cvdl)/empty, 3)
  • Adeno-associated virus type 8 (AAV)/hSMAD3 was tail vein injected into low density lipoprotein receptor knockout (LDLR-KO) mice, and the mice were then placed on a high-cholesterol diet (HCD).
  • HCD high-cholesterol diet
  • the hSMAD3 delivery was associated with moderately lower plaque formation as measured by lower aortic systolic blood velocity, larger cross sectional area, and thinner wall thickness compared with NeoR gene -treated controls.
  • hSMAD3 delivery also resulted in fewer aortic macrophages by immunohistochemistry for CD68 and ITGAM, and quantitative reverse transcriptase polymerase chain reaction analysis of EMR and ITGAM. Overall, aortic cytokine expression showed an
  • Th2 response higher IL-4 and IL-10
  • Thl response IL-12
  • TGFpi is often associated with increased fibrosis
  • AAV/hSMAD3 delivery exhibited no increase of collagen 1 A2 and significantly lower 2A1 expression in the aorta compared with NeoR-delivery.
  • Connective tissue growth factor (CTGF) a mediator of TGFpi/SMAD3-induced fibrosis, was unchanged in hSMAD3 -delivered aortas. In the liver, all three of these genes were down-regulated by hSMAD3 gene delivery.
  • the human (h) SMAD3 and calcitonin gene-related protein (CGRP) cDNAs were ligated downstream from the cytomegalovirus immediate early promoter within the gutted AAV vector dl3-97 to generate AAV/hSMAD3 and AAV/hCGRP, respectively.
  • the AAV/Neo vector has been described previously (26).
  • AAV2/8 virus (AAV2 DNA in AAV8 virion) was produced using pDG8 helper (TransIT transfection of 6 ⁇ g each of pDG8 plus AAV vector plasmid into 10 cm plates of 293 cells), freeze-thawing the plates three times at 60 hours, the virus concentrated (pelleted) by ultracentrifugation, and titered by dot blot analysis by standard methodologies.
  • LDLR KO mice (B6;129S ' -Ldlr tmlHer I ) were purchased from Jackson Laboratories (Bar Harbor, ME, USA). Three groups of male mice, composed of ten animals each at 8 weeks old, were injected with AAV/Neo, AAV/hSMAD3 or AAV/hCGRP virus at a titer of 1 x 10 10 eg/ml via tail vein with 200 ⁇ virus per mouse, two booster injections were followed at an interval of 5-6 days. High cholesterol diet (HCD) of 4% cholesterol and 10% Coco butter diet (Harlan Teklad, Madison, Wis, USA) was provided from the first day of injection and maintained for the entire study period. Another group of mice fed with a normal diet was used as the control group. All experimental procedures conform to protocols approved by the Institutional Animal Care and Usage Committee of the Central Arkansas Veterans Health Care System at Little Rock.
  • the Vevo 770 High-Resolution Imaging system (Visualsonics, Toronto, Canada) with a RMV 707B transducer was used for all direct aortic examinations.
  • Each mouse was anesthetized with inhalation of 1.5% isoflurane (Isothesia, Abbot Laboratories, Chicago, USA) with oxygen and placed supine on a thermostatically heated platform to maintain a constant body temperature. All legs were taped to ECG electrodes for cardiac function monitoring.
  • Abdominal hair was removed using a chemical hair remover (Church & Dwight Co., Inc., NJ, USA), pre-warmed US gel (Medline Industries, Inc., Mundelein, USA) was spread over the skin as a coupling medium for the transducer. Image acquisition was started on B-mode; two levels of the vessel were visualized
  • mice were euthanized by C02 exposure and exsanguinations to collect blood. Entire aorta for immunohistochemistry analysis were prepared. The aorta was flushed with saline solution and fixed in 10% neutral-buffered formalin (Sigma, St Louis, MO, USA). After 24hrs, the fixed tissue was embedded by paraffin for sectioning. For real-time PCR analysis, the aorta sample were frozen in liquid nitrogen and stored in -80°C. Measurement of plasma cholesterol
  • Total plasma cholesterol of AAV/Neo and AAV/SMAD3 mice were measured by VetScan VS2 (Abaxis, Union City, CA, USA) at the Veterans Animal Laboratory (VAMU).
  • RNAs were extracted using Trizol reagent (Invitrogen Carlsbad, CA) and were treated with DNase I (Invitrogen, Carlsbad, CA). Then cDNA was synthesized using oligo(dT)18 primers and RNase H-reverse transcriptase (Invitrogen, Carlsbad, Calif) according to the manufacturer's instructions. The specific primers for qPCR analysis were synthesized by Integrated DNA Technologies, Inc. (Coralville, IA). Real- Time Quantitative PCR was performed using SYBR Green PCR Master Mix kit on the Applied Biosystems Fast 7900HT real-time PCR system (Applied Biosystems, Foster City, CA). The results were analyzed with SDS 2.3 software.
  • hSMAD3 gene can serve as a substitute for TGFpi, with lower frequency of systemic adverse effects than TGFpi .
  • AAV/hSMAD3 AAV serotype 8
  • HCD high cholesterol diet
  • High resolution ultrasound was then used to analyze the aortas of at least three animals per group.
  • Figure 11C shows that the systolic thoracic region aortic blood velocity was significantly lower (p ⁇ 0.05) in the hSMAD3/HCD-treated animals than the Neo/HCD-treated animals, consistent with less severe atherosclerosis.
  • CGRP calcitonin gene-related peptide
  • Figure 11A shows that the aortic cross-sectional area was significantly larger in the hSMAD3/HCD-treated animals than the Neo/HCD-treated animals by HRUS.
  • HRUS as shown in Figure 11B, indicated that aortic wall thickness was significantly lower in the hSMAD3/HCD-treated animals than the Neo/HCD-treated animals, consistent with less severe atherosclerosis.
  • the level of macrophage trafficking into the aortic wall was analyzed by immune - histochemistry using anti-CD68 as shown in Figure 12A and 12B, using anti-ITGAM antibody. For both macrophage markers, it is clear that there is a greater number of macrophages in the walls of the Neo/HCD-treated than the SMAD3/HCD-treated animals. Macrophage invasion of the aorta was also quantified by QRT-PCR for the expression of another macrophage marker, EMR. As shown in Figure 12C, the level of EMR in the SMAD3/HCD-treated animals was significantly lower (p ⁇ 0.05) than in Neo/HCD-treated animals.
  • FIG. 14A shows that Th2 cytokine IL-4 was significantly (p >0.05) higher in Neo/HCD-treated animals than in the SMAD3/HCD-treated animals.
  • IL-10 levels another Th2 cytokine, trended higher in the SMAD3/HCD-treated animals ( Figure 14B).
  • IL-7 a Thl cytokine
  • Hermonat PL, and Muzyczka N Use of adeno-associated virus as a mammalian DNA cloning vector: transduction of neomycin resistance into mammalian tissue culture cells. Proc. Natl. Acad. Sci. U.S.A. 81 :6466-6470, 1984.
  • Hermonat PL The first adeno-associated virus gene transfer experiment, 1983. In press Human Gene Therapy, 2014.
  • Hermonat PL Muzyczka N. (1984) Use of adeno-associated virus as a mammalian DNA cloning vector: transduction of neomycin resistance into mammalian tissue culture cells. Proc Natl Acad Sci USA 81 : 6466-6470.
  • Prud'homme G Pathobiology of transforming growth factor ⁇ in cancer, fibrosis and immunologic disease, and therapeutic considerations. Lab Invest 87: 1077-1091, 2007
  • Adenovirus-induced inflammation capsid-dependent induction of the C-C chemokine RANTES requires NF-kappa B. Hum Gene Ther. 2002 Feb 10;13(3):367-79.
  • Keddis M Leung N, Herrmann S, El-Zoghby Z, Sethi S. Adenovirus-induced interstitial nephritis following umbilical cord blood transplant for chronic lymphocytic leukemia. Am J Kid Dis. 59:886-890, 2012
  • LOXl promoter 2.4kb (derived from GenBank Accession No. AH00781.1) atgaggccca cctacattat gcagcgaaat ctactttcct ctgctgatta
  • Human ILIO coding (nucleotide) sequence (derived from GenBank Accession No.
  • SEQ ID NOs: 3 and 4 SEQ ID NO: 3 AAV8 capsid coding (nucleotide) sequence with Tyr447 and Tyr 733 mutated to Phe residues (bolded and in capital letters)
  • SEQ ID NO: 4 AAV8 capsid amino acid sequence with Tyr447 and Tyr 733 mutated to Phe residues (bolded and in capital letters) atggctgccgatggttatcttccagattggctcgaggacaacctc
  • SEQ ID NO: 5 AAV8 capsid coding (nucleotide) sequence with EYH modification (bolded and in capital letters) showing 7 additional amino acids (EYHHYNK) being inserted after position 590, as well as adjacent changes
  • SEQ ID NO: 6 AAV8 capsid amino acid sequence with EYH modification (bolded and in capital letters) showing 7 additional amino acids (EYHHYNK) being inserted after position 590, as well as adjacent changes atggctgccgatggttatcttccagattggctcgaggacaacctc
  • SEQ ID NO: 7 AAV8 capsid coding (nucleotide) sequence dual modifications: (1) Tyr447 and Tyr 733 mutated to Phe residues (bolded and in capital letters) (2) with EYH modification (bolded and in capital letters) showing 7 additional amino acids
  • SEQ ID NO: 8 AAV8 capsid amino acid sequence dual modifications: (1) Tyr447 and Tyr 733 mutated to Phe residues (bolded and in capital letters) (2) with EYH

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Toxicology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

Les méthodes et systèmes de la présente invention fournissent un vecteur d'expression contenant un promoteur spécifique d'une maladie lié à un gène codant pour un agent thérapeutique tel qu'une protéine, un micro-ARN, un ARNsi ou une autre molécule thérapeutique, par exemple un autre oligonucléotide. Une gamme de différents promoteurs peut être employée avec la présente invention, à la condition que tout promoteur spécifique d'une maladie exprime préférentiellement le gène lié à ce dernier au niveau du site de la maladie, et pas de façon plus globale dans le corps. Le promoteur spécifique d'une maladie peut être le promoteur du gène LOX1. L'invention concerne également des promoteurs constitutifs. L'agent thérapeutique peut être, par exemple, l'Interleukine 10 (IL10) ou un élément d'une voie de signalisation de facteur de croissance transformant bêta 1 (TGFpi), tel que l'homologue 3 mère contre décapentaplégique (SMAD3).
PCT/US2015/026011 2014-04-15 2015-04-15 Compositions et méthodes de traitement des maladies cardiovasculaires à l'aide de smad3 WO2015160977A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201461979789P 2014-04-15 2014-04-15
US61/979,789 2014-04-15
US14/508,642 US20150098925A1 (en) 2013-10-07 2014-10-07 Compositions and methods for treating cardiovascular diseases using disease-specific promoter
US14/508,642 2014-10-07

Publications (1)

Publication Number Publication Date
WO2015160977A1 true WO2015160977A1 (fr) 2015-10-22

Family

ID=54324548

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2015/026011 WO2015160977A1 (fr) 2014-04-15 2015-04-15 Compositions et méthodes de traitement des maladies cardiovasculaires à l'aide de smad3

Country Status (1)

Country Link
WO (1) WO2015160977A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11091524B1 (en) 2020-04-22 2021-08-17 Houston Gene Therapeutics Llc Compositions for treatment of vascular disease

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0894856A1 (fr) * 1997-08-01 1999-02-03 Smithkline Beecham Corporation Variante d'épissure de sMAD3 humaine
WO2004108922A2 (fr) * 2003-04-25 2004-12-16 The Trustees Of The University Of Pennsylvania Procedes et compositions pour abaisser le niveaux totaux de cholesterol et traitement des maladies cardiaques
US20080199434A1 (en) * 2006-11-13 2008-08-21 Board Of Trustees Of The University Of Arkansas Compositions and methods for the treatment of cardiovascular conditions
US20120135515A1 (en) * 2003-05-21 2012-05-31 Guang Qu Methods for producing preparations of recombinant aav virions substantially free of empty capsids

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0894856A1 (fr) * 1997-08-01 1999-02-03 Smithkline Beecham Corporation Variante d'épissure de sMAD3 humaine
WO2004108922A2 (fr) * 2003-04-25 2004-12-16 The Trustees Of The University Of Pennsylvania Procedes et compositions pour abaisser le niveaux totaux de cholesterol et traitement des maladies cardiaques
US20120135515A1 (en) * 2003-05-21 2012-05-31 Guang Qu Methods for producing preparations of recombinant aav virions substantially free of empty capsids
US20080199434A1 (en) * 2006-11-13 2008-08-21 Board Of Trustees Of The University Of Arkansas Compositions and methods for the treatment of cardiovascular conditions

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
D OBACZEWSKI ET AL.: "Transforming growth factor (TGF)-beta signaling in cardiac remodeling", J MOL CELL CARDIOL., vol. 51, 6 November 2010 (2010-11-06), pages 600 - 606, XP028292077 *
TSAI ET AL.: "TGF-beta through Smad3 signaling stimulates vascular smooth muscle cell proliferation and neointimal formation", AM J PHYSIOL HEART CIRC PHYSIOL., vol. 297, 12 June 2009 (2009-06-12), pages H540 - H549, XP055231379 *
ZHU ET AL.: "Comparison of efficacy of the disease-specific LOX1- and constitutive cytomegalovirus-promoters in expressing interleukin 10 through adeno-associated virus 2/8 delivery in atherosclerotic mice", PLOS ONE, vol. 9, 15 April 2014 (2014-04-15), pages 1 - 7, XP055231384 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11091524B1 (en) 2020-04-22 2021-08-17 Houston Gene Therapeutics Llc Compositions for treatment of vascular disease
US11274134B2 (en) 2020-04-22 2022-03-15 Houston Gene Therapeutics Llc Compositions for treatment of vascular disease

Similar Documents

Publication Publication Date Title
US11839646B2 (en) Antidotes for factor Xa inhibitors and methods of using the same
KR102445700B1 (ko) 안정한 슈도타입화된 렌티바이러스 입자 및 이의 용도
EP2414517A1 (fr) Antidotes pour des inhibiteurs du facteur xa et leurs procédés d'utilisation
EP2453910A1 (fr) Formulation de dose unique d'antidotes pour des inhibiteurs de facteur xa et procédés d'utilisation de celle-ci
WO2010056765A2 (fr) Antidotes pour des inhibiteurs de facteur xa et procédés d’utilisation de ceux-ci en combinaison avec des agents de coagulation sanguine
US20150098925A1 (en) Compositions and methods for treating cardiovascular diseases using disease-specific promoter
US20040005588A1 (en) Methods of treatment or prevention of autoimmune diseases with CpG-containing polynucleotide
Xu et al. Targeted therapy in cardiovascular disease: a precision therapy era
US20150216999A1 (en) Compositions and methods for treating cardiovascular diseases using smad3
Yokoyama et al. Deletion of LOX-1 protects against heart failure induced by doxorubicin
KR101354996B1 (ko) 임파구계 혈구계 세포에 유전자 도입을 위한 프로모터 및그의 이용 방법
US20160263247A1 (en) Compositions and methods for treating cardiovascular diseases using foxp3
WO2015160977A1 (fr) Compositions et méthodes de traitement des maladies cardiovasculaires à l'aide de smad3
US20230192784A1 (en) KLF Induced Cardiomyogenesis
CN111150748A (zh) 重组溶瘤病毒在制备治疗消化道癌药物中的用途
JP2022519949A (ja) ベータ－サラセミアの治療のための方法
CN111394320A (zh) 表达人组织因子融合蛋白的重组痘苗病毒及其应用
KR102013742B1 (ko) 목적 단백질의 위치 특이적 변형이 시공간적으로 조절되는 마우스, 이의 제조방법 및 그 용도
WO2016138213A1 (fr) Compositions et procédés pour traiter des maladies cardiovasculaires à l'aide de foxp3
RU2806568C1 (ru) Способ получения генно-модифицированных мышей, экспрессирующих миниген антитромбина III человека, с помощью микроинъекций TelN-линеаризованного фрагмента ДНК
CA3018337A1 (fr) Facteur tissulaire humain soluble recombine, son procede de production et utilisations associees
KR20180099537A (ko) 근섬유모세포의 병리적 활성이 초래하는 섬유증식성 질병 치료제
KR20110117600A (ko) Ｄｋｋ2 단백질 및 그의 용도
KR101647177B1 (ko) hCARP를 암호화하는 핵산을 포함하는 재조합 바이러스 및 이의 용도
KR20110138998A (ko) 티로신 수산화효소 3＇ｕｔｒ을 이용한 허혈 선택적 유전자 발현 시스템

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15780136

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15780136

Country of ref document: EP

Kind code of ref document: A1