WO2015124080A1 - Use of of zfp28 variation point in preparation of schizophrenia diagnostic kit - Google Patents

Abstract

Disclosed is a use of a ZFP28 variation point in the preparation of a schizophrenia diagnostic kit. An exome sequencing method is employed by the present invention to discover a new susceptibility gene ZFP28 of schizophrenia. The variation point of the ZFP28 gene is selected from c.1441T>C, c.961G>A, c.1052T>C, c.1081C>T, c.1511C>T, c.1170G>T, c.1208A>G and c.2017T>C, wherein the variation point c.1441T>C is in coseparation with schizophrenia. Also disclosed is the use of the ZFP28 gene in drug development, and the ZFP28 gene serves as a potential drug target.

Description

Use of the variant site of ZFP28 in the preparation of a kit for diagnosing schizophrenia Technical field

The present invention relates to the field of diagnosis, and more particularly to the use of a single nucleotide variation site of the ZFP28 gene for the preparation of a kit for diagnosing schizophrenia.

Background technique

Schizophrenia is a common serious illness that has not yet been fully elucidated. Patients exhibit special disorders of thought, emotion, perception, and behavior, and mental activities are incompatible with the environment. Epidemiological studies have shown that the lifetime prevalence of schizophrenia in the population is about 1%. The disease is mostly in the late adolescence and early adulthood. The incidence rate of males and females is comparable, but the average age of onset of men is earlier than that of females. In addition, there are racial and regional differences in the occurrence of the disease, and psychological factors such as psychology and society also have an impact on the onset.

There is evidence that genetic factors play an important role in the pathogenesis of schizophrenia with a heritability of 81%. The exploration of susceptibility genes for schizophrenia has been a hot topic in schizophrenia research.

Previous genetic analysis, including linkage analysis and association studies. Linkage analysis is a family-based approach to gene mapping. The basic principle is: according to the principle that the genes are arranged in a straight line on the chromosome, and the different genes are interlocked into a linkage group, that is, the positioning of the mapped gene with another gene or genetic marker on the same chromosome is used for localization. For example, in 2003, Williams N.M. et al. used 372 microsatellite markers for linkage analysis. The average distance between markers was 10 cM, and the 10q25.3-26.3, 17p11.2-25.1, and 22q11 regions were found to be linked to schizophrenia. Association research is based on the principle of linkage disequilibrium (LD). In the population, there is a significant difference between the frequency at which an allele of two or more loci on different loci are present on the same haplotype and the expected random frequency. Alleles at two loci in a linkage disequilibrium region are often passed together as they are passed on to the next generation. The association study was to compare the frequency distribution of alleles, genotypes and haplotypes between the patient group and the control group, and obtain the relative risk of the association between the genetic marker and the disease gene. Whether it is directly related to the disease, or finding a disease susceptibility gene in a linkage disequilibrium between the relevant polymorphic genetic markers. Genome-wide association studies (GWAS) analyze the relationship between genetic variation and disease in the genome without bias from the entire genome level. For example, O'Donovan M.C. and other GWAS studies of European populations found that ZNF804A is associated with schizophrenia.

Summary of the invention

According to some embodiments of the invention, there is provided the use of a ZFP28 gene variant site for the preparation of a kit for diagnosing schizophrenia. In some embodiments, the ZFP28 gene variant site is selected from one or more of the following: c. 1441T>C, c.961G>A, c.1052T>C, c.1081C>T, c.1511C>T, c .1170G>T, c.1208A>G and c.2017T>C. In a preferred embodiment, the ZFP28 gene variant site is c.1441T>C.

In the context of the present invention, c.1441T>C indicates that the 1441th nucleotide of the ZFP28 coding sequence is changed from T to C; c.961G>A indicates that the nucleotide of position 961 of the ZFP28 coding sequence is changed from G to A; This type of push.

According to some embodiments of the present invention, there is provided a kit for diagnosing schizophrenia comprising a primer pair for a ZFP28 gene variant site selected from one or more of the following: c. 1441T>C, c.961G>A, c.1052T>C, c.1081C>T, c.1511C>T, c.1170G>T, c.1208A>G and c.2017T>C.

In some embodiments, the kit may also contain genomic DNA extraction reagents and/or PCR reaction system reagents as needed. Any suitable DNA extraction reagents and PCR reaction system reagents known in the art can be used in the kits of the present invention. In some embodiments, the PCR reaction system reagents include dNTPs, DNA polymerases, PCR reaction buffers. In a specific embodiment, PCR amplification is performed on a fragment comprising about 300 bp upstream and downstream of the mutation site. However, the skilled person understands that the detection of the mutation site can be carried out by performing amplification in an appropriate region including the upstream and downstream of the mutation site, including but not limited to the range of 300 bp in the upstream and downstream of the mutation site, in the range of 250 bp, and in the range of 220 bp. In the range of 200 bp, 180 bp, 150 bp, 120 bp, and 100 bp. The principle of primer design is as follows: the primer length is 15-30 bp, preferably 15-25 bp; the G+C content is 40-48%, preferably 43-46%; there is no complementary sequence between the primer and the primer, no hairpin structure is formed; primer Tm The value is between 40 and 60 ° C, and the Tm values of the upstream and downstream primers do not differ by more than 2 ° C; ensure that the comprehensive score of each primer reaches 90 or more. Therefore, primer pairs for each variant site are not limited to the primer pairs used in the specific examples.

In a specific embodiment, the sequence of the primer pair is selected from one or more of the following: SEQ ID No. 115 and SEQ ID No. 116, SEQ ID No. 117 and SEQ ID No. 118, SEQ ID No. 119 and SEQ ID No. 120, SEQ ID No. 121 and SEQ ID No. 122.

In a specific embodiment, primer pairs for c.1441T>C or c.1511C>T are set forth in SEQ ID No. 117 and SEQ ID No. 118.

In a specific embodiment, primer pairs for c.961G>A, c.1052T>C, c.1081C>T, c.1170G>T or c.1208A>G are as SEQ ID No. 115 and SEQ ID No.116 is shown.

In a specific embodiment, primer pairs for c.2017T>C are set forth in SEQ ID No. 119 and SEQ ID No. 120.

In a preferred embodiment, the primer pair is a primer pair for c.1441T>C. Primer pairs are set forth in SEQ ID No. 117 and SEQ ID No. 118.

In another embodiment, a 220 bp fragment comprising a variant site c.1441T>C is PCR amplified, the primer pairs being as set forth in SEQ ID No. 121 and SEQ ID No. 122. A mutation of A>C was introduced into the forward primer (SEQ ID No. 121), making GCGC a HhaI restriction endonuclease recognition site. Therefore, the amplicon containing the mutation site can be cleaved by HhaI into two segments of 198 bp and 22 bp, while the wild-type amplicon cannot be cleaved, and identification can be achieved without sequencing. Therefore, when the sub-induction of A>C mutation is introduced When the amount is tested, the kit may also contain a HhaI restriction enzyme.

In another embodiment, the use of the ZFP28 gene in drug development is provided. The ZFP28 gene serves as a potential drug target. In another embodiment, the use of a ZFP28 gene variant site selected from one or more of the following for the preparation of a medicament for the treatment of schizophrenia is provided: c. 1441T>C, c.961G>A, c.1052T>C , c.1081C>T, c.1511C>T, c.1170G>T, c.1208A>G and c.2017T>C.

DRAWINGS

Figure 1: A sample of schizophrenia family in Ji Ning Tu, Inner Mongolia, 7 schizophrenia patients (solid) and 10 normal people (open). Squares represent males and circles represent females. The arrow indicates that the patient is a proband:

Figure 2: Schematic diagram of PCR amplicons and their cleavage sites. The base in italicized bold indicates a missense mutation site (c. 1441T>C, p.Cys481Arg). At the time of primer design, a mutation of A>C was introduced into the forward primer, making GCGC a HhaI restriction endonuclease recognition site. Therefore, the amplicon containing the mutation site can be cleaved by HhaI into two segments of 198 bp and 22 bp, and the wild-type amplicon cannot be cleaved, thereby achieving discrimination.

Figure 3: Electrophoretic detection of DNA integrity, 1% agarose gel. M: DNA marker; 53 and 60 are two unrelated normal controls.

Figure 4: Results of PCR-RFLP analysis of variant sites (c.1441T>C). The amplicon containing the mutation site can be cleaved by HhaI into two segments of 198 bp and 22 bp, while the wild-type amplicon (220 bp) cannot be cleaved. M: DNA marker.

Figure 5: Location of the eight variant sites.

Figures 6A-6H: Sequencing map of de novo heterozygous mutations. The ID on the left side of the patient is the experimental number; 6A: c.1441T>C, p.Cys481Arg; 6B-6D: c.961G>A, p.Val321Ile; 6E: c.1052T>C, p.Val351Ala; 6F:c .1170G>T,p.Glu390Asp;6G:c.1208A>G,p.Lys403Arg;6H:c.2017T>C,p.Tyr673His.

Figure 7A: Conservative analysis of the mutation site (c. 1441T > C). ZFP28 contains eight exons encoding the KRAB box and the C2H2 motif, respectively. The arrow indicates the mutation site; each C2H2 motif contains two Cys and two His, and the mutation site is located in one of the two Cys of the third C2H2 motif.

Figure 7B: Conservative analysis of the mutation site (c. 1441T > C). Three-dimensional structure of the C2H2 motif (available from http://www.rcsb.org/pdb/, ID: 1ZAA), two His and two Cys and one Zn ion form a complex that assists in the formation of two beta sheets And an alpha helix.

Figure 7C: Conservative analysis of the mutation site (c. 1441T > C). The three-dimensional structure of the ZFP28 fragment (420-583), the PDB format file was obtained from ESyPred3D Web Server 1.0. WT: wild type; MT: mutant; all three-dimensional images were observed using VMD 1.9.1 software.

Figures 8A-8C: Distribution of ZFP28 in mouse brain tissue. 8A: cortex, I–VI indicates molecular layer, outer granular layer, outer cone layer, inner granular layer, multi-functional cell layer; 8B: hippocampus, CA1 indicates hippocampal CA1 region, DG: dentate gyrus; 8C: cortex, I –III denotes a molecular layer, a Purkinje cell layer, and a granular layer. Ruler: 50 μm.

detailed description

1. Collection of clinical samples and clinical data

1.1 The schizophrenia family sample (7 schizophrenia patients and 10 normal people, Inner Mongolia Ji Ning Tu Mutai) was collected by the Mental Health Center of the First Affiliated Hospital of Shanxi Medical University (Fig. 1).

1.2 schizophrenia sporadic samples (2564 cases) from Kangning Hospital of Changchun City, Baicheng Weinan Neuropsychiatric Hospital, Erdaowan Psychiatric Hospital, Harbin Puning Hospital, Baicheng District Social Psychiatric Hospital, Siping City Social Psychiatric Hospital, Jilin City Psychiatric Hospital, Tonghua Psychiatric Hospital, Jilin Sixth People's Hospital, Liaotong Mental Health Center, Qiqihar Angxi District Psychiatric Hospital, Changchun Psychological Hospital, Changchun Sixth Hospital, Beijing Huilongguan Hospital and the First Affiliated Hospital of Shanxi Medical University Hospital mental health center.

1.3 A total of 1005 normal control samples.

1.4 All subjects were Han Chinese in the north, signed informed consent, and agreed to conduct genetic studies and related research on their blood samples. The study was approved by the Ethics Committee of the Chinese Academy of Medical Sciences and Peking Union Medical College.

2. Inclusion and exclusion criteria for schizophrenia samples:

All patients were diagnosed by two deputy directors and physicians using the Diagnostic and Statistical Manual of Mental Disorders VI (DSM-VI). At the same time, the DSM-IV Structured Clinical Interview for DSM-IV (SCID) was used as a standardized clinical diagnostic tool.

Exclusion criteria: patients who did not meet the inclusion criteria, other patients who met the DSM-IV criteria; patients who met the diagnostic criteria for alcohol dependence in DSM-IV; patients who met the diagnostic criteria for affective disorder and schizoaffective disorder in DSM-IV; Mental disorder caused by brain organic disease or physical illness; suffering from serious physical or neurological diseases; physical examination and laboratory examination found abnormal biochemical indicators or EEG, abnormal electrocardiogram; severe excitement, impulsivity does not cooperate Patients; patients with a tendency to commit suicide spontaneously; pregnant or lactating women; patients who have participated in other scientific treatments within one month.

3. Normal control sample inclusion and exclusion criteria:

The control was collected from healthy blood donors, regardless of gender. All controls were assessed by family history survey, epidemiological questionnaire, self-reported depression scale (IUNG), concise health status questionnaire (SF-36), and Eysenck Personality Questionnaire (EPQ). Individuals within the normal range were selected. .

Exclusion criteria: family history of mental or neurological disease; severe head trauma or birth trauma; overheating convulsions in childhood or infancy; adopted or living in a single-parent family when childhood.

Example 1. Genomic DNA extraction

DNA was extracted from 3 ml of whole blood using a FlexiGene DNA kit (Cat# 51206, Qiagen) according to the supplier's instructions. DNA concentration was measured using a NanoDrop 2000 micro spectrophotometer, and OD values at 260 nm and 280 nm as well as DNA yield were examined.

Example 2. Paternity test

The PowerPlex 16 system (Cat# DC6531, Promega) was used with reference to the supplier's instructions.

Example 3. CNV detection

CNV detection was performed on 250 ng DNA samples using the Affymetrix Genome-Wide Human Mapping SNP 6.0 chip (Cat# 901015, Affymetrix) following the supplier's instructions. Chip result

Scanner 3000 (Cat#00-00212, Affymetrix) scan, raw data was obtained with Command Console Software 3.1 (Affymetrix), and SNP locus genotypes were read using Genothyping Console Software (Affymetrix). Quality Control (QC) Standard: SNP call rate (DM algorithm): Affymetrix SNP 6.0 chip QC detection rate is greater than 86%.

Example 4. Exome sequencing

The starting genomic DNA was used in an amount ranging from 1 to 10 μg and quantified using the QUBIT DNA BR kit.

1. Genomic DNA Fragmentation: Genomic DNA was randomly fragmented using a Covaris ultrasound system. Covaris S220 was set up such that the fragmentation profile was 200-300 bp to meet exon capture sequencing requirements.

Target base pair (peak)	150bp	200bp	300bp	400bp	500bp
						Duty Factor	10%	10%	10%	10%	5%
Power (Peak Incident Power, W)	175	175	140	140	105
						Cycles (Cycles Per Burst)	100	200	200	200	200
Time (s)	360	180	80	55	80

2. End repair: 100 μl reaction system was configured as follows:

Reagent	Volume (μl)
		Ds cDNA	50
End Repair Control	10
		End Repair Mix	40

37 ° C, 30 min. The final product was purified using AMPure XP Beads.

3.3' adenylation: 30 μl of reaction system was prepared as follows:

Reagent	Volume (μl)
		A‐Tailing Control	2.5
A‐Tailing Mix	12.5
		End repaired DNA	15

37 ° C, 30 min.

4. Connector connection: Configure the 37.5 μl reaction system as follows:

Reagent	Volume (μl)
		DNA ligase Mix	2.5
Lectase Control	2.5
		DNA Connector Index	2.5
3' adenylated DNA	30

37 ° C, 10 min. The product was recovered in the range of 300-450 bp using the MinElute Gel Extraction kit. The strip was dissolved in 25 μl of water.

5. Pre-Capture LM-PCR: The DNA needs to be enriched before liquid phase capture, and the LM-PCR system is prepared as follows:

Reagent	Volume (μl)
		Phusion High-Fidelity PCR Master Mix(2x)	25
TS-PCR Oligo 1,100 μM (final concentration 2 μM)	1
		TS-PCR Oligo 2, 100 μM (final concentration 2 μM)	1
PCR water	18
		Gel-purified linker-ligated DNA	5
total capacity	50

PCR program: 98 ° C, 30 s; 8 cycles of 98 ° C 10 s, 60 ° C 30 s, 72 ° C 30 s; 72 ° C 5 min. The PCR product was purified using Qiagen QIAquick PCR Purification Kit (Cat# 28106).

6. Quantification and quality control after amplification of the library: The purity of the PCR product was quantified by NanoDrop, and the A260/A280 range was 1.7-2.0; the accurate quantification of the PCR product by QUBIT required the yield ≥1 μg; the negative control sample of PCR should be Negative; Agilent DNA 1000chip assay should have a peak that meets the target size of 300-00 bp.

7. Roche NimbleGen EZ Library Capture: Prepare the reaction system according to the following table:

By absorbing the biotin-labeled EZ-library, the hybridized DNA library is adsorbed together, and the DNA library without hybridization will be washed away. The captured DNA does not need to be eluted from Dynabeads M-270, and can be used together as a downstream PCR. The template was amplified and finally resuspended in water with 50 μl of PCR.

8. Post-Capture LM-PCR: The DNA sample needs to be re-enriched after liquid phase capture, and the LM-PCR system is prepared according to the following table.

Reagent	Volume (μl)
		Phusion High-Fidelity PCR Master Mix(2x)	50
TS-PCR Oligo 1, final concentration 2μM	2
		TS-PCR Oligo 2, final concentration 2μM	2

PCR water	26
		Capture DNA bound to beads	20
total capacity	100

PCR program: 98 ° C, 30 s; 18 cycles of 98 ° C 10 s, 60 ° C 30 s, 72 ° C 30 s; 72 ° C 5 min. The PCR product was purified using Qiagen QIAquick PCR Purification Kit (Cat# 28106).

9. Amplified captured DNA: NanoDrop quantifies the purity of the PCR product, requiring A260/A280 ranging from 1.7 to 2.0; accurate quantification of the PCR product using the QUBIT DNA BR ASSAY kit requires a yield of ≥500 ng; The Agilent DNA 1000chip assay should have a peak of 300-450 bp.

10. Calculate the difference multiples before and after enrichment by qPCR, and select 4 quality control genes for detection, that is, prepare qPCR system according to the following table.

Reagent	Volume (μl)
		SYBR Green Master(2X)-KAPA	7.5
NSC forward primer (2μM)	0.3
		NSC reverse primer (2μM)	0.3
PCR water	5.9
		DNA template (5ng/μl)	1
total capacity	15

q-PCR program: 95 ° C, 30 s; 40 cycles of 95 ° C for 10 s, 60 ° C for 30 s.

11. Library Quality Control: The 2100 Bioanalyzer High Sensitivity DNA chip was used to determine whether the size of the fragmented PCR product fragment meets the requirements for subsequent sequencing.

The constructed library was subjected to absolute quantification of the molar concentration by the molar concentration of the q-PCR standard to ensure the accuracy of the amount of the library, and the Illumina recommended KAPA quantification kit (Cat# KK4602) was used.

12. High-throughput sequencing using Hiseq-2000, sequencing fragment length 2x 100bp.

Example 5. PCR and Sanger sequencing

Primer design

The standard sequence of the screened genes was downloaded using NCBI (www.ncbi.nlm.nih.gov) and primer design was performed using software primer 5.0. A total of 52 pairs of primers were designed for 52 genes to be verified (Table 1).

2. PCR amplification (20 μl system):

The PCR product was sent for gene sequencing.

Table 1. PCR primers

Table 2. Eight exon PCR primers for the ZFP28 gene

Example 6. PCR restriction fragment length polymorphism detection (PCR-RFLP)

1. The missense mutation (c.1441T>C, p.Cys481Arg) in ZFP28 was further detected by PCR-RFLP. PCR amplification of a fragment consisting of about 300 bp upstream and downstream of the mutation site, primer sequence 5'-3':

F: AAACAGGCATCTATGCAGGAA (SEQ ID No. 117);

R: TGAGTGGCAAGCTGAGAACTG (SEQ ID No. 118). The PCR product was separated by electrophoresis and recovered using a rapid agarose gel DNA recovery kit (Cat# CW2302, Kangwei).

2. Design primers for PCR on a fragment of about 220 bp in length including the mutation site. The design idea is shown in Figure 2. The italicized bases indicate missense mutation sites (c.1441T>C, p.Cys481Arg). At the time of primer design, a mutation of A>C was introduced into the forward primer, making GCGC a HhaI restriction endonuclease recognition site. Therefore, the amplicon containing the mutation site can be cleaved by HhaI into two segments of 198 bp and 22 bp, and the wild-type amplicon cannot be cleaved, thereby achieving discrimination. Primer sequence 5'-3':

F: GAAGCCCTATGAGTGCATTGCG (SEQ ID No. 121)

R: CCTTGGTATGGACTTCCTAAA (SEQ ID No. 122).

PCR amplification using 20 μl reaction system:

PCR program: 98 ° C for 30 s; 30 cycles of 98 ° C for 5 s, 54 ° C for 10 s, 72 ° C for 10 s; 72 ° C for 5 min. The PCR product was digested with HhaI enzyme (Cat# R0139S, NEB) for 1 h at 37 °C. The PCR product was identified by 3% agarose gel; the band position was indicated by a 50 bp DNA scale (Cat# MD108, Tiangen).

Example 7. Immunohistochemistry

In this embodiment, rabbit supersensitive secondary antibody (Cat# PV-9001, Nakasugi Jinqiao) was used to polymerize the monovalent Fab fragment of the secondary antibody antibody molecule and the enzyme, instead of the secondary antibody and the third antibody in the traditional method, directly amplifying the antigen and antibody. The combined signal not only retains the ability of the antibody to specifically bind to the antigen, but also effectively avoids steric hindrance caused by excessive polymerization molecules.

The mice were anesthetized by intraperitoneal injection of 10% chloral hydrate at a ratio of 4 μl/g; the rats were perfused with normal saline for 3 min until the blood was cleaned; the hearts were perfused with 4% PFA (Cat# P6148, Sigma) for 5 min; the whole brain was dissected and used. 4% PFA soaked, 70% ethanol soaked; paraffin embedded; cut the embedded tissue block (sagittal and coronal) into 4um slices; baked slices; dewaxed; placed in 0.01M sodium citrate high temperature and high pressure 3 min, naturally cooled to room temperature; H ₂ O ₂ (3%) deionized water for 10 minutes; PBS rinse for 2 minutes × 3 times; add primary antibody (anti-ZFP28, Abcam ab108526), incubate for 1-2 hours at room temperature; Rinse in PBS for 2 minutes × 3 times; add reagent 1 (Zhongshan Jinqiao, Polymer Helper PV9001), incubate for 10-20 minutes at room temperature, rinse with PBS for 2 minutes × 3 times; add reagent 2 (Zhongshan Jinqiao, poly-HRP anti-rabbit IgG) , PV9001), incubate for 10-20 minutes at room temperature, rinse with PBS for 2 minutes × 3 times; DAB solution develops color; DAPI stains the core.

Experimental result

1. Genomic DNA quality testing: The results of partial genomic DNA electrophoresis are shown in Figure 3. Sample concentration, total amount, integrity, etc. are all qualified and can be used in the next experiment.

2. Demographic data of the family of the Ningtu Mutai in Inner Mongolia: The family consists of 17 members from 3 generations, including 7 patients with schizophrenia and 10 normal persons.

Table 3. Basic information about family members.

3. Paternity test

The results showed that there were 7 STR loci in III6 and II8. According to the paternity test criteria, there was no father-female relationship between II8 and III6, and III6 was no longer considered in subsequent experiments.

4.CNV analysis (Copy number variantion)

Considering the important role of CNV in schizophrenia, Affymetrix SNP array 6.0 was used to detect the presence of CNV in the family when performing exome sequencing. Because schizophrenia is consistent with the autosomal dominant inheritance pattern in this family, 5 patients (III3, II3, II6, II7, and I2), 4 normal subjects (III4, II2, II4, and I1), and 2 no CNV analysis was performed on relevant normal controls. According to the autosomal dominant pattern, no CNV was found that was co-segregated with the disease.

5. Exome sequencing

Exome sequencing was performed by selecting 7 samples (4 patients III3, II3, II7 and I2, 3 normal humans III4, II4 and I1) and 2 unrelated normal controls (numbers 53, 60) in the family. Each sample obtained more than 10Gb of data, and the exon region has a sequencing depth of 82X–140X, which exceeds 4X coverage. It is 90.52%. The sequencing results were compared with the NCBI hg19 standard genomic sequence using BWA software to obtain mutation information (including SNP and Indels).

The mutations that exist in the dbSNP database and the 1000 Genomes database are first excluded (these variations are considered to be common non-pathogenic mutations); the synonymous mutations and the mutations in the introns are excluded; the last are those that exist only in the patient but in the normal population A variation that does not exist in it. Considering that exome sequencing does not cover all exon regions, not only the variation present in 4 patients, but also the variation present in only 3 patients is retained. Finally, there were a total of 52 variant sites, 7 of which were present in 4 patients (Table 4).

Table 4. Summary of 52 variant sites found in at least 3 patients

SNV: single nucleotide variation; Indels: insertion or deletion of individual bases; NS: non-synonymous mutation; S: synonymous mutation; chromosomal location based on hg19 and dbSNP Build 137; -/-: no protein obtained based on mutation information The level changes.

6.Sanger sequencing

Sanger sequencing was performed in 4 patients for all 52 variant sites. Five genes were found in four patients, namely CD300LG (g.IVS2-2A>G), C17orf78 (c244G>T), FBXL19 (c.41C>T), ZFP28 (c.1441T>C) and CNTN3. (c.547A>T). The five mutation sites were verified in 17 members of the family, and the results are shown in Table 5. It was found that only the variation in ZFP28 (c.1441T>C) was co-segregated with the disease, which revealed that ZFP28 is a susceptible gene for this family.

Table 5. Distribution of five variants in the family of 17 members

gene	CD300LG	C17orf78	FBXL19	CNTN3	ZFP28	Schizophrenia
							Reference base	A	G	C	T	T
Mutant base	G	T	T	A	C
							III1	A/A	G/G	C/C	T/T	T/T	-
III2	A/G	G/T	C/C	T/T	T/T	-
							III3	A/G	G/T	C/T	T/A	T/C	+
III4	A/A	G/G	C/C	T/T	T/T	-
							III5	A/G	G/T	C/T	T/T	T/C	+
III7	A/G	G/T	C/T	T/A	T/C	+
							II1	A/A	G/G	C/C	T/T	T/T	-
II2	A/G	G/T	C/T	T/T	T/T	-
							II3	A/G	G/T	C/T	T/A	T/C	+
II4	A/A	G/G	C/C	T/T	T/T	-
							II5	A/A	G/G	C/C	T/T	T/T	-
II6	A/G	G/T	C/T	T/A	T/C	+
							II7	A/G	G/T	C/T	T/A	T/C	+
II8	A/A	G/G	C/C	T/T	T/T	-
							I1	A/A	G/G	C/C	T/T	T/T	-
I2	A/G	G/T	C/T	T/A	T/C	+

7. PCR restriction fragment length polymorphism (PCR-RFLP)

The distribution of the mutation site (c.1441T>C) in the family was further verified by PCR-RFLP. Since c.1441T>C does not cause the production or loss of the mutation site, the primer mismatch is used as the primer cleavage site HhaI. The experimental results showed that the mutation site (c.1441T>C) was co-segregated with the disease (Fig. 4).

8. Systematic screening of possible variant sites of ZFP28 in sporadic cases

To further confirm that ZFP28 is a schizophrenia susceptibility gene, then systematically screen the mutation site (c.1441T>C) and other possible mutation sites in 2564 sporadic cases, and filter out the dbSNP database. A total of 8 mutation sites (including c.1441T>C) were found in 10 patients, respectively c.1441T>C(p.Cys481Arg)(M1), c.961G>A(p.Val321Ile)(M2), c.1052T>C(p.Val351Ala)(M3), c.1081C>T(p. Pro361Ser) (M4), c.1511C>T(p.Pro504Leu)(M5), c.1170G>T(p.Glu390Asp)(M6), c.1208A>G(p.Lys403Arg)(M7) and c. 2017T>C(p.Tyr673His)(M8) (Fig. 5). In subsequent experiments, they were referred to as M1 to M8, respectively. Among them, M2 appeared 3 times.

As shown in Figure 5, M1 and M5 are in exon 8 (T>C), so the corresponding primers are:

F: AAACAGGCATCTATGCAGGAA (SEQ ID No. 117);

R: TGAGTGGCAAGCTGAGAACTG (SEQ ID No. 118).

M2, M3, M4, M6, and M7 are in exon 8-1, so the corresponding primers are:

F: AGGTGTAAGCCACTGTGC (SEQ ID No. 115);

R: CGGATAAGGGATGTGTTCT (SEQ ID No. 116).

M8 is in exon 8-2, so the corresponding primers are:

F: TTTAGGCAGAATATACACC (SEQ ID No. 119);

R: GAGCACATCTCACACATTA (SEQ ID No. 120).

Further analysis of whether the above mutation sites are also present in their parents. A return visit to the Trio family revealed that all mutation sites did not exist in their parents. This suggests that these mutations are de novo mutations, further revealing that ZFP28 is a susceptibility gene for schizophrenia (Figures 6A-6H).

9. Conservative analysis of the mutation site (c.1441T>C)

The human ZFP28 encoded protein has a total of 868 amino acids, including two Kruppel-like domains and 15 tandem repeat C2H2 motifs. Conservative analysis of mutant microdots in five orthologous species found that this site is very conserved. The mutation site c.1441T>C (p.Cys481Arg) is located in the third C2H2 motif (Fig. 7A). The typical C2H2 motif structure is CX _2-4 CX ₃ FX ₅ LX ₂ HX _3-5 H, in which cysteine and histidine (2 each) play an important role in the formation of C2H2 motifs. 7B). Therefore, c.1441T>C(p.Cys481Arg) may cause changes in protein structure, thereby disrupting the binding of ZFP28 to DNA (Fig. 7C).

10. Distribution of ZFP28 in mouse brain tissue: To detect whether ZFP28 is concentrated in brain regions associated with schizophrenia. Adult C57/BL mice were used to visualize the distribution of ZFP28 in the rat brain by immunohistochemistry. The results showed that ZFP28 was concentrated in the cortex, hippocampus, cerebellum, olfactory bulb, etc. (Fig. 8A-8C), and all of these sites were reported to be associated with schizophrenia.

For the first time, the present invention uses a method of exome sequencing to discover a novel susceptibility gene ZFP28 of schizophrenia, which is located at 19q13.

Claims (10)

1. Use of one or more of the following ZFP28 gene variant sites in the preparation of a kit for diagnosing schizophrenia: c. 1441T>C, c.961G>A, c.1052T>C, c.1081C>T, c.1511C>T, c.1170G>T, c.1208A>G and c.2017T>C.
2. The use according to claim 1, wherein the ZFP28 gene mutation site is c.1441T>C.
3. A kit for diagnosing schizophrenia, comprising a primer pair for a ZFP28 gene mutation site selected from one or more of the following: c. 1441T>C, c.961G>A, c.1052T>C, c.1081C>T, c.1511C>T, c.1170G>T, c.1208A>G and c.2017T>C.
4. The kit for diagnosing schizophrenia according to claim 3, further comprising a genomic DNA extraction reagent and a PCR reaction system reagent.
5. The kit for diagnosing schizophrenia according to claim 4, wherein the PCR reaction system reagent comprises dNTP, DNA polymerase, and PCR reaction buffer.
6. The kit for diagnosing schizophrenia according to claim 3, wherein the sequence of the primer pair is selected from one or more of the following pairs: SEQ ID No. 115 and SEQ ID No. 116, SEQ ID No. 117 and SEQ ID No. 118, SEQ ID No. 119 and SEQ ID No. 120, SEQ ID No. 121 and SEQ ID No. 122.
7. The kit for diagnosing schizophrenia according to claim 3, wherein the primer pair is a primer pair for c.1441T>C.
8. The kit for diagnosing schizophrenia according to claim 7, wherein the sequence of the primer pair is as shown in SEQ ID No. 117 and SEQ ID No. 118.
9. The kit for diagnosing schizophrenia according to claim 7, wherein the primer pair is represented by SEQ ID No. 121 and SEQ ID No. 122.
10. The kit for diagnosing schizophrenia according to claim 9, further comprising a HhaI restriction enzyme.

Images