CN103834730A - Purpose of ZFP28 variation point in preparation of diagnosis schizo kit - Google Patents
Purpose of ZFP28 variation point in preparation of diagnosis schizo kit Download PDFInfo
- Publication number
- CN103834730A CN103834730A CN201410057496.6A CN201410057496A CN103834730A CN 103834730 A CN103834730 A CN 103834730A CN 201410057496 A CN201410057496 A CN 201410057496A CN 103834730 A CN103834730 A CN 103834730A
- Authority
- CN
- China
- Prior art keywords
- seq
- zfp28
- test kit
- pcr
- schizoid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a purpose of a ZFP28 variation point in preparation of a diagnosis schizo kit; an exome sequencing method is employed to discover a novel susceptibility gene ZFP28 of the schizo. The variation point of the ZFP28 gene is selected from c.1441T and gt; C, c.961 G and gt; A, c.105T and gt; C, c.1081 C and gt; T, c.1511 C and gt; T, c. 1170 Gand gt; T, c.1208 A and gt; G and c. 2017 T and gt; C; wherein the variation point c.1441 T and gt; C is coseparation with the schizo. The invention also provides the purpose of the ZFP28 gene in medicine exploitation, and the ZFP28 gene serves as a potential medicine target.
Description
Technical field
The present invention relates to diagnostic field, the purposes in schizoid test kit is diagnosed in preparation in the single nucleotide variations site that relates more specifically to ZFP28 gene.
Background technology
Schizophrenia (Schizophrenia) is the heavy mental disorder that a kind of common cause of disease is illustrated not yet completely, and it is inharmonious that patient shows as the obstacle of the aspects such as special thinking, emotion, consciousness and behavior and cerebration and environment.Epidemiological study shows that the lifetime prevalence of schizophrenia in crowd is about 1%.This disease mostly is postpuberal phase and the early stage morbidity of growing up, and the sickness rate of masculinity and femininity is suitable, but the male sex's average age of onset compared with women early.In addition, the difference that has race and region of this disease, the environmental factors such as psychological, social also has impact for morbidity.
Evidence suggests, inherited genetic factors plays an important role in schizoid morbidity, and heredity grade is up to 81%.It is the focus of schizophrenia research to the exploration of schizophrenia tumor susceptibility gene always.
Genetic analysis in the past, comprises linkage analysis and association study.Linkage analysis is the method for the assignment of genes gene mapping based on family.Its ultimate principle is: be arranged in a linear on karyomit(e) according to gene, different genes mutual linking becomes the principle of linkage group, and on the gene that is positioned of application and same karyomit(e), the mutually chain feature of another gene or genetic marker positions.Such as, the people such as Williams N.M. in 2003 use 372 microsatellite markers to carry out linkage analysis, and the mean distance between mark is 10cM, finds that 10q25.3-26.3,17p11.2-25.1 and 22q11 region and schizophrenia exist chain.Association study is the principle based on linkage disequilibrium (linkage disequilibrium, LD).In crowd, on different genes seat, certain allelotrope in two or more sites appears at the phenomenon that has notable difference between frequency on same haplotype and the random frequency of expection.The allelotrope in two sites in linkage disequilibrium region often transmits together in the time passing to the next generation.Association study is in the difference of allelotrope, genotype and haplotype frequency distribution by polymorphic markers between comparison patient's group and control group, obtain this genetic marker relative risk associated with disease gene, whether directly relatedly with disease analyze this site, or the diseases predisposing gene in searching and linkage disequilibrium region, relevant polymorphic markers place.The relation of genome-wide association study (GWAS) heritable variation and disease from whole genome aspect zero deflection ground analyzing gene group.If O'DonovanM.C. etc. is in Europe descendants crowd's GWAS research, find that ZNF804A and schizophrenia exist dependency.
Summary of the invention
According to certain embodiments of the present invention, provide the purposes of ZFP28 genovariation site in the schizoid test kit of preparation diagnosis.In some embodiments, ZFP28 genovariation site is selected from one or more as follows: c.1441T>C, c.961G>A, c.1052T>C, c.1081C>T, c.1511C>T, c.1170G>T, c.1208A>G and c.2017T>C.In a preferred implementation, ZFP28 genovariation site is for c.1441T>C.
In the context of the invention, c.1441T>C represent that the 1441st Nucleotide of ZFP28 encoding sequence becomes C from T; C.961G>A represent that the 961st Nucleotide of ZFP28 encoding sequence becomes A from G; The rest may be inferred.
According to certain embodiments of the present invention, provide a kind of for diagnosing schizoid test kit, it contains the primer pair for ZFP28 genovariation site, and described ZFP28 genovariation site is selected from one or more as follows: c.1441T>C, c.961G>A, c.1052T>C, c.1081C>T, c.1511C>T, c.1170G>T, c.1208A>G and c.2017T>C.
In some embodiments, test kit can also contain extracting genome DNA reagent and/or PCR reaction system reagent as required.Any suitable DNA extraction reagent well known in the art and PCR reaction system reagent all can be used for test kit of the present invention.In some embodiments, PCR reaction system reagent comprises dNTP, archaeal dna polymerase, PCR reaction buffer.In a concrete embodiment, the fragment that comprises the about 300bp of mutational site upstream and downstream is carried out to pcr amplification.But technician understands, in the upstream and downstream appropriate area that comprises mutational site, increase, all can realize the detection to mutational site, include but not limited within the scope of the upstream and downstream 300bp of mutational site, within the scope of 250bp, within the scope of 220bp, within the scope of 200bp, within the scope of 180bp, within the scope of 150bp, within the scope of 120bp, within the scope of 100bp.The principle of design of primers is as follows: primer length is at 15-30bp, preferably 15-25bp; G+C content 40-48%, preferably 43-46%; Between primer inside and primer, without complementary sequence, form without hairpin structure; Primer Tm value is between 40 to 60 ℃, and the Tm value of upstream and downstream primer differs and is no more than 2 ℃; The comprehensive grading of guaranteeing each primer reaches more than 90 points.Therefore, be not limited to primer pair used in specific examples for the primer pair of each variant sites.
In a concrete embodiment, the sequence of described primer pair is selected from following one or more pairs of: SEQ ID No.115 and SEQ ID No.116, SEQ ID No.117 and SEQ ID No.118, SEQ ID No.119 and SEQ ID No.120, SEQ ID No.121 and SEQ ID No.122.
In a concrete embodiment, for primer pair c.1441T>C or c.1511C>T as shown in SEQ ID No.117 and SEQ ID No.118.
In a concrete embodiment, for primer pair c.961G>A, c.1052T>C, c.1081C>T, c.1170G>T or c.1208A>G as shown in SEQ ID No.115 and SEQ ID No.116.
In a concrete embodiment, for primer pair c.2017T>C as shown in SEQ ID No.119 and SEQ ID No.120.
In a preferred implementation, described primer pair is the primer pair for c.1441T>C.Primer pair is as shown in SEQ ID No.117 and SEQ ID No.118.
In another embodiment, the fragment of the long 220bp c.1441T>C including variant sites is carried out to pcr amplification, primer pair is as shown in SEQ ID No.121 and SEQ ID No.122.In forward primer (SEQ ID No.121), introduce the sudden change of A>C, make GCGC become HhaI restriction enzyme enzyme recognition site.Therefore, can be cut into two sections of 198bp and 22bp by HhaI containing the amplicon in mutational site, and wild-type amplification can not be cut, and does not need order-checking also can realize discriminating.Therefore,, in the time that the inferior measurement with introducing A>C sudden change detects, test kit can also contain HhaI restriction enzyme.
In another embodiment, provide the purposes of ZFP28 gene in drug development.ZFP28 gene is as potential drug target.In another embodiment, provide and be selected from the purposes of following one or more ZFP28 genovariation sites in the schizoid medicine of preparation treatment: c.1441T>C, c.961G>A, c.1052T>C, c.1081C>T, c.1511C>T, c.1170G>T, c.1208A>G and c.2017T>C.
Accompanying drawing explanation
Fig. 1: Jining, Inner Mongol soil is herded your platform schizophrenia families sample, 7 schizophreniacs (solid) and 10 normal peoples (hollow).The square expression male sex, the circular women that represents.Arrow represents that patient is propositus:
Fig. 2: pcr amplification and restriction enzyme site schematic diagram thereof.The base of italic overstriking represents missense mutation site (c.1441T>C, p.Cys481Arg).When design of primers, in forward primer, introduce the sudden change of A>C, make GCGC become HhaI restriction enzyme enzyme recognition site.Therefore, can be cut into two sections of 198bp and 22bp by HhaI containing the amplicon in mutational site, and wild-type amplification can not be cut, and differentiates thereby realize.
Fig. 3: electrophoresis detection DNA integrity, 1% sepharose.M:DNA mark; 53 and 60 is two incoherent normal controls.
Fig. 4: variant sites (c.1441T>C) PCR-RFLP analytical results.Can be cut into two sections of 198bp and 22bp by HhaI containing the amplicon in mutational site, and wild-type amplification (220bp) can not be cut.M:DNA mark.
Fig. 5: the distributing position of 8 variant sites.
The sequencer map of Fig. 6 A-6H:de novo heterozygous mutant.The ID in patient left side is experiment numbers; 6A:c.1441T>C, p.Cys481Arg; 6B-6D:c.961G>A, p.Val321Ile; 6E:c.1052T>C, p.Val351Ala; 6F:c.1170G>T, p.Glu390Asp; 6G:c.1208A>G, p.Lys403Arg; 6H:c.2017T>C, p.Tyr673His.
Fig. 7 A: mutational site (c.1441T>C) conservative Analysis.ZFP28 contains 8 exons, respectively encoded K RAB box and C2H2 motif.Arrow indication mutational site; Each C2H2 motif contains two Cys and two His, and mutational site is positioned at one of two Cys of the 3rd C2H2 motif.
Fig. 7 B: mutational site (c.1441T>C) conservative Analysis.C2H2 motif tomograph (available from http://www.rcsb.org/pdb/, ID:1ZAA), two His and two Cys and a Zn ion form mixture, its auxiliary two beta lamellas and α spiral of forming.
Fig. 7 C: mutational site (c.1441T>C) conservative Analysis.The tomograph of ZFP28 fragment (420-583), PDB formatted file is available from ESyPred3D Web Server1.0.WT: wild-type; MT: saltant type; All 3-D views are observed with VMD1.9.1 software.
The distribution situation of Fig. 8 A-8C:ZFP28 in mouse brain tissue.8A: cortex, I – VI represents molecular layer, external granular layer, external pyramidal layer, internal granular layer, multi-functional cellular layer; 8B: hippocampus, CA1 represents Hippocampal CA 1, DG: dentate gyrus; 8C: cortex, I – III represents molecular layer, Purkinje cell layer and granular layer.Scale: 50 μ m.
Embodiment
1. the collection of clinical sample and clinical data
1.1 schizophrenia families samples (7 schizophreniacs and 10 normal peoples, Jining, Inner Mongol soil is herded that platform) gather (Fig. 1) by the first mental health center of affiliated hospital of Mountain Western Medicine S University.
1.2 schizophrenia are distributed sample (totally 2564 examples) and are come from the healthy and free from worry hospital in Changchun, Baicheng City Taonan neuropsychopathy institute, two Dao Wan mental hospital, Puning, Harbin City hospital, social spirit specialized hospital of Baicheng Prefecture, Siping City social spirit specialized hospital, Jilin mental hospital, Tonghua City lunatic asylum, Jilin Sixth Man people hospital, mental health center of Liao Tong city, Angangxi District, Qiqihar mental hospital, Changchun psychology hospital, Changchun the 6th hospital, Beijing Back Long View hospital and the first mental health center of affiliated hospital of Mountain Western Medicine S University.
1.3 normal control samples totally 1005 examples.
1.4 all research objects are Han nationality, and signature Informed Consent Form agrees to its blood sample to carry out genetics and correlative study.This research is via the Chinese Academy of Medical Sciences, the approval of Beijing Union Medical College Ethics Committee.
2. schizophrenia sample is included in and exclusion standard:
All patients all use Americanism medical diagnosis on disease and statistic handbook VI(Diagnostic and Statistical Manual of Mental Disorders VI, DSM-VI through two above doctors of deputy director) make a definite diagnosis.Use the clinical talks scale of DSM-IV fixed pattern (Structured Clinical Interview for DSM-IV simultaneously; SCID) as stdn clinical diagnosis instrument.
Exclusion standard: do not meet inclusive criteria, other meets the patient of DSM-IV standard; Meet the patient of yeast for brewing rice wine dependence Case definition in DSM-IV; Meet the patient of affective disorder and schizoaffective disorder Case definition in DSM-IV; Various brain organic diseases or physical disease caused by mental disorder; Suffer from serious physical disease or nervous system disorders; Physical examination and laboratory examination find that there is abnormal biochemical indicator or electroencephalogram, electrocardiographic abnormality person; Serious excitement, disoperative patient gets excited; There is the patient of serious suicide self inflicted injury tendency; Gestation or lactating women; In one month, participated in the patient of other scientific research treatment.
3. normal control sample is included in and exclusion standard:
Contrast collection from healthy blood donor, male or female.All contrasts are all evaluated through family history investigation, epidemiology questionnaire, self-appraisal depression scale (IUNG), simple and clear investigation of health conditions table (SF-36), EPQ (EPQ), choose in range of normal value individual.
Exclusion standard: spiritedness or nervous system disorders family history; Be subject to serious injury of head or had maternal infuries; Childhood or infantile period occur what hyperthermia was fainted from fear; Childhood adopted or move in single-parent family.
With FlexiGene DNA test kit (Cat#51206, Qiagen), with reference to supplier's specification sheets, 3ml whole blood is extracted to DNA.Use NanoDrop2000 micro-spectrophotometer to measure DNA concentration, detect 260nm and the OD of 280nm place value and DNA output.
Adopt PowerPlex16 system (Cat#DC6531, Promega) to carry out with reference to supplier's specification sheets.
Embodiment 3.CNV detects
Adopt Affymetrix Genome-Wide Human Mapping SNP6.0 chip (Cat#901015, Affymetrix), with reference to supplier's specification sheets, 250ng DNA sample is carried out to CNV detection.Chip results adopts
3000(Cat#00-00212, Affymetrix) scanning, with Command Console Software3.1(Affymetrix) obtain raw data, and adopt Genotyping Console Software(Affymetrix) read SNP loci gene type.Quality Control (QC) standard: SNP recall rate (call rate) (DM algorithm): Affymetrix SNP6.0 chip QC recall rate is greater than 86%.
Initial gene group DNA amount ranges is 1-10 μ g, quantitative with QUBIT DNA BR test kit.
1. genomic DNA fragment: genomic dna is carried out to random fragmentation by Covaris ultrasonic apparatus.Covaris S220 arranges as follows, makes fragmentation be distributed as 200-300bp to meet exon trapping order-checking requirement.
| Target base pair (peak value) | 150bp | 200bp | 300bp | 400bp | 500bp |
| Duty factor (Duty Factor) | 10% | 10% | 10% | 10% | 5% |
| Power (Peak Incident Power, W) | 175 | 175 | 140 | 140 | 105 |
| Circulation (Cycles Per Burst) | 100 | 200 | 200 | 200 | 200 |
| Time (s) | 360 | 180 | 80 | 55 | 80 |
2. end reparation: press following proportional arrangement 100 μ l reaction systems:
| Reagent | (μ l) for volume |
| ds?cDNA | 50 |
| End?Repair?Control | 10 |
| End?Repair?Mix | 40 |
37℃，30min。Latter end fills product AMPure XP Beads and carries out purifying.
3.3' end adenosine acidifying: press following proportional arrangement 30 μ l reaction systems:
| Reagent | (μ l) for volume |
| A‐Tailing?Control | 2.5 |
| A‐Tailing?Mix | 12.5 |
| The DNA that end is repaired | 15 |
37℃，30min。
4. joint connects: press following proportional arrangement 37.5 μ l reaction systems:
| Reagent | (μ l) for volume |
| DNA ligase Mix | 2.5 |
| Ligase enzyme Control | 2.5 |
| DNA joint Index | 2.5 |
| The DNA of 3' end adenosine acidifying | 30 |
37℃，10min。Product reclaims the band within the scope of 300-450bp with MinElute Gel Extraction test kit, by 25 μ l water dissolution.
5.Pre-Capture LM-PCR: liquid phase needs DNA to carry out enrichment before catching, according to following preparation LM-PCR system:
| Reagent | (μ l) for volume |
| Phusion?High-Fidelity?PCR?Master?Mix(2x) | 25 |
| TS-PCR Oligo1,100 μ M ( |
1 |
| TS-PCR Oligo2,100 μ M ( |
1 |
| PCR water | 18 |
| The DNA that the joint of gel-purified connects | 5 |
| Cumulative volume | 50 |
PCR program: 98 ℃, 30s; 98 ℃ of 10s of 8 circulations, 60 ℃ of 30s, 72 ℃ of 30s; 72 ℃ of 5min.Qiagen QIAquick PCR Purification test kit (Cat#28106) purifying for PCR product.
After amplified library quantitatively and Quality Control: with NanoDrop, PCR product is carried out to purity quantitative, requires A260/A280 scope 1.7-2.0; PCR product is carried out to QUBIT accurate quantitative analysis, require output >=1 μ g; The negative control sample of PCR should be negative; Agilent DNA1000chip detects, and should have the peak that meets target sizes 300-00bp.
7.Roche NimbleGen EZ catches in library: according to following table preparation feedback system:
With adsorbing with biotin labeled EZ-library, the DNA library of hybridization is together adsorbed, and does not have the DNA library in hybridization to be washed off, and the DNA catching need not elute from Dynabeads M-270, can be together as downstream PCR amplification template, finally use 50 μ l PCR waters resuspended for subsequent use.
8.Post-Capture LM-PCR: liquid phase needs after catching the enrichment again of DNA sample, according to following table preparation LM-PCR system.
| Reagent | (μ l) for volume |
| Phusion?High-Fidelity?PCR?Master?Mix(2x) | 50 |
| TS-PCR Oligo1, |
2 |
| TS-PCR Oligo2, |
2 |
| PCR water | 26 |
| Be combined in the capture dna on pearl | 20 |
| Cumulative volume | 100 |
PCR program: 98 ℃, 30s; 98 ℃ of 10s of 18 circulations, 60 ℃ of 30s, 72 ℃ of 30s; 72 ℃ of 5min.Qiagen QIAquick PCR Purification test kit (Cat#28106) purifying for PCR product.
9. that PCR product is carried out to purity is quantitative for the DNA:NanoDrop catching of amplification, requires A260/A280 scope between 1.7-2.0; PCR product is carried out to accurate quantitative analysis with QUBIT DNA BR ASSAY test kit, require output >=500ng; Agilent DNA1000chip detects, and should have the peak of 300-450bp.
10. calculate the difference multiple before and after enrichment by qPCR, select 4 Quality Control genes to detect, according to following table preparation qPCR system.
| Reagent | (μ l) for volume |
| SYBR?Green?Master(2X)-KAPA | 7.5 |
| NSC forward primer (2 μ M) | 0.3 |
| NSC reverse primer (2 μ M) | 0.3 |
| PCR water | 5.9 |
| (5ng/ μ l) for |
1 |
| Cumulative volume | 15 |
Q-PCR program: 95 ℃, 30s; 95 ℃ of 10s of 40 circulations, 60 ℃ of 30s.
11. library Quality Controls: judge and cut the requirement whether glue PCR product clip size meets follow-up order-checking with 2100Bioanalyzer High Sensitivity DNA chip.
By the volumetric molar concentration of q-PCR standard substance, the library building is carried out the absolute quantitation of volumetric molar concentration, to guarantee the accuracy of machine consumption on library, the KAPA quantification kit (Cat#KK4602) that adopts Illumina to recommend.
12. adopt Hiseq-2000 to carry out high-flux sequence, and order-checking fragment length is 2x100bp.
Embodiment 5.PCR and Sanger order-checking
1. design of primers
Use NCBI(www.ncbi.nlm.nih.gov) download the standard sequence of screening-gene, use software primer5.0 to carry out design of primers.Gene for 52 needs checkings designs 52 pairs of primers (table 1) altogether.
2.PCR increase (20 μ l system):
PCR product send gene sequencing.
Table 1.PCR primer
8 exon PCR primers of table 2.ZFP28 gene
Embodiment 6.PCR restriction fragment length polymorphism detects (PCR-RFLP)
Missense mutation (c.1441T>C, p.Cys481Arg) in 1.ZFP28 further detects with PCR-RFLP.The fragment that comprises the about 300bp of mutational site upstream and downstream is carried out to pcr amplification, primer sequence 5 '-3 ':
F：AAACAGGCATCTATGCAGGAA（SEQ?ID?No.117）；
R：TGAGTGGCAAGCTGAGAACTG（SEQ?ID?No.118）。PCR product, after electrophoretic separation, reclaims test kit (Cat#CW2302, health is) with quick sepharose DNA and reclaims.
2. to the fragment that is about 220bp including mutational site, design primer carries out PCR.Mentality of designing is shown in Fig. 2, and the base of italic overstriking represents missense mutation site (c.1441T>C, p.Cys481Arg).When design of primers, in forward primer, introduce the sudden change of A>C, make GCGC become HhaI restriction enzyme enzyme recognition site.Therefore, can be cut into two sections of 198bp and 22bp by HhaI containing the amplicon in mutational site, and wild-type amplification can not be cut, and differentiates thereby realize.Primer sequence 5 '-3 ':
F：GAAGCCCTATGAGTGCATTGCG（SEQ?ID?No.121）
R：CCTTGGTATGGACTTCCTAAA（SEQ?ID?No.122）。
Pcr amplification adopts 20 μ l reaction systems:
PCR program: 98 ℃ of 30s; 98 ℃ of 5s of 30 circulations, 54 ℃ of 10s, 72 ℃ of 10s; 72 ℃ of 5min.PCR product is cut 1h with 37 ℃ of enzymes of HhaI enzyme (Cat#R0139S, NEB).Getting PCR product identifies through 3% sepharose; With 50bp DNA scale (Cat#MD108, day root) indication pillar location.
The present embodiment adopts the anti-(Cat#PV-9001 of rabbit super quick two, Zhong Shan Golden Bridge), by the unit price Fab fragment of two anti-antibody molecules together with enzymatic polymerization, substituting two in traditional method resists with three anti-, directly amplify the signal of antigen-antibody combination, both retained the ability of antibodies specific conjugated antigen, effectively avoid again polymerizable molecular excessive and cause sterically hindered.
In 4 μ l/g ratio abdominal injection 10% chloral hydrate anesthesia mouse; Be cleaned totally to blood with Saline perfusion 3min; Use again 4%PFA(Cat#P6148, Sigma) cardiac perfusion 5min; Dissect Mouse Whole Brain, with 4%PFA immersion, change 70% alcohol immersion; Paraffin embedding; The tissue block of embedding (sagittal and crown) is cut into 4um section; Roasting sheet; Dewaxing; Section is placed in to 0.01M Trisodium Citrate High Temperature High Pressure 3min, naturally cools to room temperature; H
2o
2(3%) deionized water is hatched 10 minutes; PBS rinses 2 minutes × 3 times; Drip primary antibodie (anti-ZFP28, Abcam ab108526), incubated at room 1-2 hour; PBS rinses 2 minutes × 3 times; Drip reagent 1(Zhong Shan Golden Bridge, Polymer Helper PV9001), incubated at room 10-20 minute, PBS rinses 2 minutes × 3 times; Drip reagent 2(Zhong Shan Golden Bridge, the anti-rabbit igg of poly-HRP, PV9001), incubated at room 10-20 minute, PBS rinses 2 minutes × 3 times; The colour developing of DAB solution; DAPI dyes core.
Experimental result
1. genomic dna quality examination: portion gene group DNA electrophoresis result is shown in Fig. 3.Sample concentration, total amount, integrity etc. are all qualified, can be used for next step experiment.
2. Jining, Inner Mongol soil is herded your platform family demography data: this family comprises 3 generations totally 17 members, wherein 7 schizophreniacs, 10 normal peoples.
Table 3. kinsfolk essential information.
3. paternity test
Result shows that III6 and II8 have 7 STR sites inconsistent, according to paternity test standard, thinks that II8 and III6 do not exist father and daughter's relation, no longer considers III6 in subsequent experimental.
4.CNV analyzes (Copy number variantion)
Consider that CNV is mixed with very important effect in schizophrenia, in the time carrying out the order-checking of exon group, with whether having CNV in Affymetrix SNP array6.0 detection family.Because schizophrenia meets autosomal dominant inheritance pattern in this family, choose 5 patients (III3, II3, II6, II7 and I2), 4 normal peoples (III4, II2, II4 and I1), and two uncorrelated normal controls carry out CNV analysis.By autosomal dominant inheritance pattern analysis, not have to find and disease have be divided into from CNV.
5. exon group order-checking
7 samples (4 patient III3, II3, II7 and I2,3 normal people III4, II4 and I1) and 2 the uncorrelated normal controls (numbering 53,60) chosen in family carry out the order-checking of exon group.Each sample obtains the data volume that exceedes 10Gb, and the order-checking degree of depth of exon region is 82X – 140X, and the fraction of coverage that exceedes 4X is 90.52%.Sequencing result adopts BWA software and NCBI hg19 standard gene group sequence to compare, and obtains abrupt information (comprising SNP and Indels).
First get rid of the variation that exists (these variations think belong to common not pathogenic variation) in dbSNP database and 1000Genomes database; Get rid of same sense mutation and be arranged in the variation of intron; Finally retain those and only in patient, exist, but non-existent variation in normal people.Consider that the order-checking of exon group can not cover whole exon regions, be therefore not only retained in the variation existing in 4 patients, also retain the variation only existing in 3 patients.Finally always have 52 variant sites, all there is (table 4) in 7 sites wherein in 4 patients.
52 variant sites that table 4. is found at least 3 patients are summed up
SNV: single nucleotide variations; Indels: insertion or the disappearance of indivedual bases; NS: nonsynonymous mutation; S: same sense mutation; Chromosome position is based on hg19 and dbSNP Build137;-/-: do not obtain protein level according to abrupt information and change.
6.Sanger order-checking
All 52 variant sites are carried out to Sanger sequence verification in 4 patients.Finding that 5 genes are present in 4 patients, is respectively CD300LG(g.IVS2-2A>G), C17orf78(c244G>T), FBXL19(c.41C>T), ZFP28(c.1441T>C) and CNTN3(c.547A>T).These 5 variant sites are verified in 17 members of family, be the results are shown in Table 5.Discovery only have variation (c.1441T>C) in ZFP28 and disease to exist to be divided into from, this discloses the tumor susceptibility gene that ZFP28 is this family.
The distribution situation of five variations of table 5. in 17 members of family
7.PCR restriction fragment length polymorphism (PCR-RFLP)
Further with PCR-RFLP to variant sites (c.1441T>C) distribution situation in family verify.Owing to c.1441T>C can not causing generation or the loss in mutational site, therefore utilize the artificial primer restriction enzyme site of primer mispairing HhaI.Experimental result shows that this variant sites (c.1441T>C) exists and is divided into from (Fig. 4) with disease.
8. in Sporadic cases, the possible variant sites of ZFP28 is carried out to the examination of system
For further confirming that ZFP28 is schizophrenia tumor susceptibility gene, then in 2564 Sporadic cases, this variant sites (c.1441T>C) and other mutational site that may exist are carried out to system examination, filter out after dbSNP database, altogether in 10 patients, find 8 variant sites (comprising c.1441T>C), respectively that c.1441T>C (p.Cys481Arg) (M1), c.961G>A (p.Val321Ile) (M2), c.1052T>C (p.Val351Ala) (M3), c.1081C>T (p.Pro361Ser) (M4), c.1511C>T (p.Pro504Leu) (M5), c.1170G>T (p.Glu390Asp) (M6), c.1208A>G (p.Lys403Arg) (M7) and c.2017T>C (p.Tyr673His) (M8) (Fig. 5).In subsequent experimental, be referred to as M1 to M8.Wherein M2 occurs 3 times.
As shown in Figure 5, M1 and M5 are at exon 8(T>C) in, therefore corresponding primer is:
F：AAACAGGCATCTATGCAGGAA（SEQ?ID?No.117）；
R：TGAGTGGCAAGCTGAGAACTG（SEQ?ID?No.118）。
M2, M3, M4, M6, M7 are in exon 8-1, and therefore corresponding primer is:
F：AGGTGTAAGCCACTGTGC（SEQ?ID?No.115）；
R：CGGATAAGGGATGTGTTCT（SEQ?ID?No.116）。
M8 is in exon 8-2, and therefore corresponding primer is:
F：TTTAGGCAGAATATACACC（SEQ?ID?No.119）；
R：GAGCACATCTCACACATTA（SEQ?ID?No.120）。
Whether further analyze said mutation site exists too in its father and mother.Three people families (Triofamily) are paid a return visit, found that all mutational sites all do not exist in its father and mother.This explanation, these variations are brand-new (de novo) sudden change, further disclosing ZFP28 is a schizoid tumor susceptibility gene (Fig. 6 A-6H).
9. the conservative Analysis of mutational site (c.1441T>C)
The albumen of people ZFP28 coding has 868 amino acid, comprises two Kruppel-spline structure territories and 15 C2H2 motifs that series connection repeats.In 5 ortholog species, the conservative Analysis of micro-point that suddenlys change is found, this site is very conservative.Mutational site is c.1441T>C(p.Cys481Arg) be arranged in the 3rd C2H2 motif (Fig. 7 A).Typical C2H2 motif structure is CX
2-4cX
3fX
5lX
2hX
3-5h, wherein halfcystine and Histidine (each 2) the very important effect (Fig. 7 B) of performance in the time forming C2H2 motif.Therefore, c.1441T>C (p.Cys481Arg) may cause protein structure to change, thereby destroys the combination (Fig. 7 C) of ZFP28 and DNA.
The distribution situation of 10.ZFP28 in mouse brain tissue: whether ZFP28 concentrates is expressed in Nao relevant to schizophrenia district in order to detect.Get the C57/BL mouse that grows up, check the distribution situation of ZFP28 in mouse brain with immunohistochemical methods.Result shows, ZFP28 concentrates and expresses at positions (Fig. 8 A-8C) such as cortex, hippocampus, cerebellum, olfactory bulbs, and that all these positions are all reported is relevant with schizophrenia.
The present invention uses the method for exon group order-checking to find a schizoid new tumor susceptibility gene ZFP28 for the first time, and this gene is positioned at 19q13.
Claims (10)
1. be selected from the purposes of following one or more ZFP28 genovariation sites in the schizoid test kit of preparation diagnosis: c.1441T>C, c.961G>A, c.1052T>C, c.1081C>T, c.1511C>T, c.1170G>T, c.1208A>G and c.2017T>C.
2. purposes according to claim 1, ZFP28 genovariation site is for c.1441T>C.
3. one kind for diagnosing schizoid test kit, comprise the primer pair for ZFP28 genovariation site, described ZFP28 genovariation site is selected from one or more as follows: c.1441T>C, c.961G>A, c.1052T>C, c.1081C>T, c.1511C>T, c.1170G>T, c.1208A>G and c.2017T>C.
4. according to claim 3 for diagnosing schizoid test kit, also comprise extracting genome DNA reagent and PCR reaction system reagent.
5. according to claim 4 for diagnosing schizoid test kit, described PCR reaction system reagent comprises dNTP, archaeal dna polymerase, PCR reaction buffer.
6. according to claim 3 for diagnosing schizoid test kit, the sequence of wherein said primer pair is selected from following one or more pairs of: SEQ ID No.115 and SEQ ID No.116, SEQ ID No.117 and SEQ ID No.118, SEQ ID No.119 and SEQ ID No.120, SEQ ID No.121 and SEQ ID No.122.
7. according to claim 3 for diagnosing schizoid test kit, wherein said primer pair is the primer pair for c.1441T>C.
8. according to claim 7 for diagnosing schizoid test kit, the sequence of wherein said primer pair is as shown in SEQ ID No.117 and SEQ ID No.118.
9. according to claim 7 for diagnosing schizoid test kit, wherein said primer pair is as shown in SEQ ID No.121 and SEQ ID No.122.
10. according to claim 9 for diagnosing schizoid test kit, also comprise HhaI restriction enzyme.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410057496.6A CN103834730A (en) | 2014-02-20 | 2014-02-20 | Purpose of ZFP28 variation point in preparation of diagnosis schizo kit |
| PCT/CN2015/072866 WO2015124080A1 (en) | 2014-02-20 | 2015-02-12 | Use of of zfp28 variation point in preparation of schizophrenia diagnostic kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410057496.6A CN103834730A (en) | 2014-02-20 | 2014-02-20 | Purpose of ZFP28 variation point in preparation of diagnosis schizo kit |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103834730A true CN103834730A (en) | 2014-06-04 |
Family
ID=50798622
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410057496.6A Pending CN103834730A (en) | 2014-02-20 | 2014-02-20 | Purpose of ZFP28 variation point in preparation of diagnosis schizo kit |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN103834730A (en) |
| WO (1) | WO2015124080A1 (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106191032A (en) * | 2015-05-06 | 2016-12-07 | 戴勇 | The Disease-causing gene model of dysnoesia disease and construction method thereof and application |
| CN115206420A (en) * | 2022-06-27 | 2022-10-18 | 南方医科大学南方医院 | Method for constructing schizophrenia abnormal gene-metabolism regulation network and application |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1381486A (en) * | 2001-04-18 | 2002-11-27 | 上海博德基因开发有限公司 | Polypeptide-human zinc finger protein-61.82 and polynucleotide for coding it |
| CN1635142A (en) * | 2003-12-26 | 2005-07-06 | 中国医学科学院基础医学研究所 | Reagent kit for forecasting susceptibility of intolerance type dementia preaecox and primer used thereby |
| CN1727478A (en) * | 2005-06-16 | 2006-02-01 | 吉林大学 | Schizophrenia associated gene |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20130317056A1 (en) * | 2012-05-24 | 2013-11-28 | Abbvie Inc. | Neuronal nicotinic agonists and methods of correlating comt snps |
-
2014
- 2014-02-20 CN CN201410057496.6A patent/CN103834730A/en active Pending
-
2015
- 2015-02-12 WO PCT/CN2015/072866 patent/WO2015124080A1/en active Application Filing
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1381486A (en) * | 2001-04-18 | 2002-11-27 | 上海博德基因开发有限公司 | Polypeptide-human zinc finger protein-61.82 and polynucleotide for coding it |
| CN1635142A (en) * | 2003-12-26 | 2005-07-06 | 中国医学科学院基础医学研究所 | Reagent kit for forecasting susceptibility of intolerance type dementia preaecox and primer used thereby |
| CN1727478A (en) * | 2005-06-16 | 2006-02-01 | 吉林大学 | Schizophrenia associated gene |
Non-Patent Citations (1)
| Title |
|---|
| 许琪: "精神分裂症遗传易感性研究进展", 《基础医学与临床》, no. 05, 20 October 2004 (2004-10-20) * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106191032A (en) * | 2015-05-06 | 2016-12-07 | 戴勇 | The Disease-causing gene model of dysnoesia disease and construction method thereof and application |
| CN106191032B (en) * | 2015-05-06 | 2019-07-19 | 戴勇 | The Disease-causing gene model and its construction method of dysnoesia disease and application |
| CN115206420A (en) * | 2022-06-27 | 2022-10-18 | 南方医科大学南方医院 | Method for constructing schizophrenia abnormal gene-metabolism regulation network and application |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2015124080A1 (en) | 2015-08-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR102184868B1 (en) | Using cell-free dna fragment size to determine copy number variations | |
| US20230295726A1 (en) | Salivary biomarkers of brain injury | |
| Elmore et al. | Identification of a genetic variant associated with abdominal aortic aneurysms on chromosome 3p12. 3 by genome wide association | |
| Karlsson et al. | MAGI1 copy number variation in bipolar affective disorder and schizophrenia | |
| CN104745679A (en) | Method and kit for non-invasive detection of EGFR (epidermal growth factor receptor) gene mutation | |
| KR20190053818A (en) | Multi-resolution analysis method of cell-free nucleic acid | |
| KR20140039278A (en) | Methods and compositions of predicting activity of retinoid x receptor modulator | |
| Holder-Espinasse et al. | Duplication of 10q24 locus: broadening the clinical and radiological spectrum | |
| CA3213399A1 (en) | Methods for determination of transplant rejection | |
| JP6679486B2 (en) | Genetic markers associated with suicide risk and methods of use thereof | |
| Mollon et al. | Impact of copy number variants and polygenic risk scores on psychopathology in the UK Biobank | |
| CN103834730A (en) | Purpose of ZFP28 variation point in preparation of diagnosis schizo kit | |
| JP2018516231A (en) | Method of treatment using gene predictor of response to treatment with CRHR1 antagonist | |
| CN113584156B (en) | HCN4 mutant gene, mutant and Brugada syndrome detection kit | |
| CN105838720A (en) | PTPRQ gene mutant and application thereof | |
| CN107400708A (en) | Purposes of the XRCC1 gene pleiomorphisms in rheumatic arthritis diagnoses validity | |
| JP2022520427A (en) | Saliva biomarker for brain injury | |
| CN106868128B (en) | Biomarker for auxiliary diagnosis of breast cancer and application thereof | |
| KR101598327B1 (en) | Composition for Ankylosing spondylitis risk prediction using DNA copy number variants and use thereof | |
| JP6516128B2 (en) | Test method and kit for determining antithyroid drug-induced agranulocytosis risk | |
| KR101668813B1 (en) | Composition, kit, and microarray for diagnosing chronic obstructive pulmonary disease and method for diagnosis of chronic obstructive pulmonary disease using the same | |
| CN110628897B (en) | KFS pathogenic gene new mutation and application thereof | |
| CN109097464B (en) | Application of SNP (single nucleotide polymorphism) site of CFAP43 gene | |
| CN106834476A (en) | A kind of breast cancer detection kit | |
| CN110144404B (en) | New mutation SNP site of breast cancer treatment gene TFR2 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20140604 |