CN1727478A

CN1727478A - Schizophrenia associated gene

Info

Publication number: CN1727478A
Application number: CN 200510016884
Authority: CN
Inventors: 鞠桂芝; 尉军; 孙世龙; 刘树铮; 于雅琴; 史杰萍; 谢林; 张萱; 郭英君; 许琪
Original assignee: Jilin University
Current assignee: Jilin University
Priority date: 2005-06-16
Filing date: 2005-06-16
Publication date: 2006-02-01
Anticipated expiration: 2025-06-16
Also published as: CN100348722C

Abstract

A gene PPARD associated with schizophrenia has 85569 bp for its sequence length and features that its mononucleotide polymorphic rs2076169 base T is mutated to C, so associating with the schizophrenia. Said gene PPARD and its coding protein can be used to research the genetic mechanism and genetic diagnosing method of schizophrenia and to develop the medicines for treating schizophrenia.

Description

Schizophrenia associated gene

Technical field

The present invention relates to one and remarkable related tumor susceptibility gene is arranged with schizophrenia.

Background technology

Schizophrenia is one of the most serious mental disorder.In China, schizoid lifelong morbidity is up to 0.7%.Big so ill colony brings heavy economical load not only for family and society, but also the safety and stablization of serious threat society.Therefore, determine the schizoid cause of disease, set up and prevent and treat method effectively that having become medical circle and even entire society needs the urgent problem that solves.Schizophrenia and inherited genetic factors have substantial connection, and range disease of multifactorial inheritance.The human genome system scan finds, except that No. 19, No. 21 and Y chromosome, all may contain the schizophrenia tumor susceptibility gene on all the other karyomit(e)s.Utilize chain and correlating method to locate the focus that schizoid tumor susceptibility gene has become molecule genetics research.StraubRE etc. report the earliest the 6p zone may exist the schizophrenia tumor susceptibility gene (Straub RE, et al.NatGenet, 1995,11:287-293).People such as Schwab SG also find No. 10 and No. 6 karyomit(e) exist the schizophrenia tumor susceptibility gene (Schwab SG, et al.Mol Psychiatry, 2000,5:638-649).But in this chromosomal region, do not find to determine the special tumor susceptibility gene relevant so far with schizophrenia.

Summary of the invention

One of purpose of the present invention is to disclose schizophrenia associated gene in No. 6 chromosomal region; Two of purpose is to propose a kind of method of judging schizoid Susceptible population by this tumor susceptibility gene hereditary property, is beneficial to instruct schizoid prevention and treatment.

This result of study shows that PPARD is schizoid tumor susceptibility gene, and sequence length is 85569bp.Because the single nucleotide polymorphism rs2076169 base T in this site sports C, thereby is associated with schizoid susceptibility.The PPARD gene is positioned at the 6p21.1 chromosomal region, is a member of peroxidase activated form vegetation acceptor (PPAR) family by the albumen of this coded by said gene.PPARs is a nuclear hormone receptor, in conjunction with size and the quantity of peroxidase vegetation by cell control peroxysome.PPARs mediates multiple bioprocesses, and may participate in the generation of several chronic diseases, comprises diabetes, obesity, arteriosclerosis and cancer.This albumen is effective inhibitor of PPAR-δ and the ligand-mediated transcriptional activity of PPAR-γ, and its function may be as the synthesis of transcribing inhibition and nuclear receptor signal.Find that in colon cancer cell PPARD genetic expression raises, this expression raises and can be suppressed by APC (adenomatosis polyposis coli), and APC is that a kind of tumor suppressor protein is relevant with the APC/beta signal path.The gene knockout experiment of mouse shows that PPARs all plays an important role to the propagation of callosal myelin formation, lipid metabolism and epidermic cell.

The present invention carries out the drawing of single nucleotide polymorphisms (SNP) linkage disequilibrium in the 6p21 district by the linkage disequilibrium analytical procedure and analyzes, by NCBI (http://www.ncbi.nlm.nih.gov/mapviewer) database, obtain all candidate genes in the 6p21, and obtain the PPARD gene order.By Http:// www.ncbi.nlm.nih.gov/SNPAnd Http:// snp.cshl.org/Database, selection contains the single nucleotide polymorphism rs2076169 of restriction enzyme site on the PPARD gene.The following nucleotide sequence that is depicted as this single nucleotide polymorphism.Adding the blackboard branch and be respectively primer sequence, is the base that exchange takes place in the square frame, and line place then is the restriction enzyme site of Hinf I restriction enzyme identification, the cutting part of restriction endonuclease shown in the arrow.Specifying information is as follows.SNP：rs2076169 Gene bank accession number：AY442342，Base change：C/TGGTAACATAAGATTGTCTCACGGCTAACTTGATTTCTTCATAAATGTATCTGGTTCTGTGTATTTGTGAGGTGGTGATTCAATAAAATAATCTGTGA

TGATGGGTGTGAAGTTAGGAAGGACCCACAAATATCACTGGAAAAACAAATGTCTGTCCTTTTTTCTCAGAGCCCGCTTTGAGCCTTGAGAAACAAGAAACCCAGACCTCAGGTAAGACGATGGCTCAGCC

The core families of forming with 255 schizophreniacs of Han nationality in area, Northeast China and their healthy father and mother parents (Trios) is a research object.The patient all is admitted to hospital in the period of 2000-2004, and the 10th edition (ICD-10) is diagnosed as schizophrenia by international disease classification standard.This research based on family is that the allelotrope that passes to ill children with the father and mother parents is " case ", is " contrast " with the allelotrope that does not transmit.Due to illness example and contrast allelotrope can be avoided crowd's stratification problem all from same gene pool.

Family member extracts anticoagulation 5ml by peripheral vein, extracts genomic dna with star general micro-amounts of liquids DNA extraction test kit (Ningbo).Step is as follows: 1. blood sampling 100 μ l, join in the 1.5ml centrifuge tube, and add 1 * TE damping fluid of 100ul then, shake up; 2. vibration on one side is Yi Bian add the B1 reagent of 200 μ l, abundant mixing; 3. the B2 reagent that in vibration, adds 200 μ l, fully mixing; 4. mixing solutions is moved into centrifugal in the rotating centrifugal post (14000rpm, minute); 5. in the rotating centrifugal post, add centrifugal (14000rpm, 1 minute) behind the B3 reagent of 400 μ l; 6. repeat above-mentioned steps; 7. void column centrifugal (14000rpm, 2 minutes) moves into the rotating centrifugal post in the clean 1.5ml centrifuge tube, adds the B4 reagent centrifugal (14000rpm, 1 minute) of 100 μ l; Liquor capacity in the centrifuge tube is 100 μ l at this moment, contains the genomic dna that has extracted.The model of using U.S. BECKMAN company to produce is Du ^640 uv-spectrophotometric instrument, get two wave bands of wavelength 260nm, 280nm respectively, record OD260nm and the OD280nm value of its corresponding DNA, and then pass through formula, calculate dna content, formula is: dna content=50mg/ml * OD260nm * extension rate, calculate DNA purity by formula in addition, and formula is: DNA purity=OD260nm/OD280nm.

According to corresponding base sequence synthetic primer.Rs2076169 is GGTAACATAAGATTGTCTCACGG and GGCTGAGCCATCGTCTTACCTG.The PCR reaction system is 20 μ l, wherein contains 10mM Tris-HCl (pH 8.3), 50mM KCl, 1.5mMMgCl ₂, 0.001% (w/v) gelatin, 200 μ M of each dNTP, each 0.4 μ M of upstream and downstream primer, Taq archaeal dna polymerase (Promega) 1.0U, dna profiling 30-50ng.The pcr amplification condition is: 1. 2. 96 ℃ of 45s of 94 ℃ of 5min, 60 ℃ of 60s, 3 circulations of 72 ℃ of 60s; 3. 95 ℃ of 45s, 58 ℃ of 60s, 5 circulations of 72 ℃ of 60s; 4. 94 ℃ of 45s, 56 ℃ of 60s, 32 circulations of 72 ℃ of 60s; 5. 72 ℃ of 10min.Getting PCR product 5 μ l 1.5% agarose gel electrophoresis, is the molecular weight standard product with DNAmarker DL2000.The fragment length that is increased is 233bp.

In the reaction system behind pcr amplification, add an amount of corresponding restriction enzyme and enzyme cutting buffering liquid thereof, put 37 ℃ of incubators 5 hours.Through 3.5% agarose gel electrophoresis, judge genotype according to restriction enzyme mapping.There are 3 kinds of genotype, the homozygous genotype that cuts is wherein arranged fully, the homozygous genotype of Qie Kaiing not, existing incision has the not heterozygous genes type of incision again.

Set up Pedigree and SPSS SNP gene type database (referring to table 1 and table 2), use the check of goodness of fit chi square test and transmission disequilibrium, use the UNPHASED analysis software and carry out monoploid transmission chi square test, utilize SPSS software administration data.

Table 1 Pedigree database format

Number	Patient	Father	Mother	Sex	State	Hinf I
Number	Patient	Father	Mother	Sex	State	Hinf I	ABC18 ABC18 ABC18 ABC19 ABC19 ABC19 ABC20 ABC20 ABC20	1 2 3 1 2 3 1 2 3	2 0 0 2 0 0 2 0 0	3 0 0 3 0 0 3 0 0	1 1 2 2 1 2 1 1 2	2 1 1 2 1 1 2 1 1	1/2 2/2 1/2 2/2 2/2 2/2 1/2 1/1 2/2

Table 2 SPSS database format

(Transmitted disequi1ibrium test TDT) shows: SNP rs2076169 and the remarkable related (x of schizophrenia in the transmission disequilibrium check ²=14.961, P=0.00011).In 466 father and mother of 233 familys, 154 is heterozygote, and these heterozygosis father and mother pass to ill children (referring to table 3) with 101 C allelotrope and 53 T allelotrope respectively.Because the transmission of C allelotrope is too much, illustrate to contain the allelic monoploid of C or karyomit(e) may carry the mutational site that determines the schizophrenia susceptibility.

Table 3 PPARD gene and schizoid relation

SNP	Restriction enzyme	Allelotrope		Transmit allelotrope		P
		Allelotrope		Transmit allelotrope			Main allelotrope	Inferior equipotential gene	Main allelotrope	Inferior equipotential gene
		Rs2076169	Hinf I	T	C		Main allelotrope	Inferior equipotential gene	Main allelotrope	Inferior equipotential gene	53	101	0 .00011

Annotate: transmit allelotrope and refer to that the heterozygosis father and mother pass to ill children's allelotrope number

Judge the method for schizoid Susceptible population by PPARD gene base mutation characteristic according to the present invention, can carry out the examination of method as follows to the crowd who does not show the schizophrenia clinical symptom, the rs2076169 base is that the individuality of C is schizoid Susceptible population.The Rs2076169 base is that the individuality of T is difficult for taking place schizophrenia.Risk factor should be reduced in daily life to schizophrenia Susceptible population as far as possible,, schizoid sickness rate can be reduced as the stimulation of environmental factors.This is an important use of the present invention.

According to the present invention, can adopt schizoid patient and to carry out gene therapy as gene engineering method specific aims such as gene knockouts.In addition, having of disease gene may cause the damaged of protein structure and function or change, hinders or disturb the interaction of biomacromolecule in the specific biochemical pathway.Just because of the base mutation of PPARD gene may cause protein expression and dysfunction.The present invention further detects protein function, and the development of new medicine is carried out based on the individuation pharmacological agent of genetic background and established crucial basis, and will bring very considerable society and economy benefit.

Embodiment

Carry out the gene type assay of single nucleotide polymorphism rs2076169 by extracting experimenter's genomic dna, the individuality that its rs2076169 base is C is schizoid Susceptible population.

1. extracting genome DNA

The experimenter extracts anticoagulation 5ml by peripheral vein, extracts genomic dna with star general micro-amounts of liquids DNA extraction test kit (Ningbo).Step is as follows: 1. blood sampling 100 μ l, join in the 1.5ml centrifuge tube, and add 1 * TE damping fluid of 100ul then, shake up; 2. vibration on one side is Yi Bian add the B1 reagent of 200 μ l, abundant mixing; 3. the B2 reagent that in vibration, adds 200 μ l, fully mixing; 4. mixing solutions is moved into centrifugal in the rotating centrifugal post (14000rpm, minute); 5. in the rotating centrifugal post, add centrifugal (14000rpm, 1 minute) behind the B3 reagent of 400 μ l; 6. repeat above-mentioned steps; 7. void column centrifugal (14000rpm, 2 minutes) moves into the rotating centrifugal post in the clean 1.5ml centrifuge tube, adds the B4 reagent centrifugal (14000rpm, 1 minute) of 100 μ l; Liquor capacity in the centrifuge tube is 100 μ l at this moment, contains the genomic dna that has extracted.The model of using U.S. BECKMAN company to produce is Du ^640 uv-spectrophotometric instrument, get two wave bands of wavelength 260nm, 280nm respectively, record OD260nm and the OD280nm value of its corresponding DNA, and then pass through formula, calculate dna content, formula is: dna content=50mg/ml * OD260nm * extension rate, calculate DNA purity by formula in addition, and formula is: DNA purity=OD260nm/OD280nm.

2.PCR amplification purpose fragment

Use following primer sequence GGTAACATAAGATTGTCTCACGG and GGCTGAGCCATCGTCTTACCTG and carry out pcr amplification.The PCR reaction system is 20 μ l, wherein contains 10mMTris-HCl (pH 8.3), 50mM KCl, 1.5mMMgCl ₂, 0.001% (w/v) gelatin, 200 μ M of dNTP, each 0.4 μ M of upstream and downstream primer, Taq archaeal dna polymerase (Promega) 1.0U, dna profiling 30-50ng.The pcr amplification condition is: 1. 2. 96 ℃ of 45s of 94 ℃ of 5min, 60 ℃ of 60s, 3 circulations of 72 ℃ of 60s; 3. 95 ℃ of 45s, 58 ℃ of 60s, 5 circulations of 72 ℃ of 60s; 4. 94 ℃ of 45s, 56 ℃ of 60s, 32 circulations of 72 ℃ of 60s; 5. 72 ℃ of 10min.Getting PCR product 5 μ l 1.5% agarose gel electrophoresis, is the molecular weight standard product with DNAmarker DL2000.The fragment length that is increased is: 233bp.

3. digestion with restriction enzyme identified gene type

The reaction system that enzyme is cut is 20 μ l, wherein, and 10 μ l PCR products, restriction enzyme Hinf I 0.7 μ l, enzyme cutting buffering liquid 2 μ l, BSA 0.2 μ l.Put 37 ℃ of incubators 5 hours.Through 3.5% agarose gel electrophoresis, judge genotype according to restriction enzyme mapping.There are 3 kinds of genotype, the homozygous genotype (C/C) that cuts is wherein arranged fully, the homozygous genotype of Qie Kaiing (T/T) not, existing incision has the not heterozygous genes type (C/T) of incision again.

4. the result judges

The rs2076169 base is that the individuality of C is schizoid Susceptible population.The Rs2076169 base is that the individuality of T is difficult for taking place schizophrenia.

Claims

1. a schizophrenia associated gene is that sequence length is the PPARD gene of 85569bp, because the single nucleotide polymorphism rs2076169 base T of this gene sports C, thereby is associated with schizoid susceptibility.

2. a PPARD gene base mutation characteristic according to claim 1 is judged the method for schizoid Susceptible population, it is characterized in that carrying out the gene type assay of single nucleotide polymorphism rs2076169 by extracting experimenter's genomic dna, the individuality that its rs2076169 base is C is schizoid Susceptible population, the concrete practice is: (1) extracting genome DNA, and extract test kit with minim DNA and extract genomic dna; (2) pcr amplification purpose fragment, primer sequence are GGTAACATAAGATTGTCTCACGG and GGCTGAGCCATCGTCTTACCTG; (3) digestion with restriction enzyme identified gene type, the reaction system that enzyme is cut is 20 μ l, wherein, 10 μ l PCR products, restriction enzyme HinfI 0.7 μ l, enzyme cutting buffering liquid 2 μ l, BSA 0.2 μ l, put 37 ℃ of incubators 5 hours, and, judged genotype according to restriction enzyme mapping through 3.5% agarose gel electrophoresis; (4) result judges, the rs2076169 base is that the individuality of C is schizoid Susceptible population, and the rs2076169 base is that the individuality of T is difficult for taking place schizophrenia.