WO2015122578A1

WO2015122578A1 - New nephroselmis sp. novel strain kge2 and method for increasing fatty acid content within relevant novel stain

Info

Publication number: WO2015122578A1
Application number: PCT/KR2014/005699
Authority: WO
Inventors: 최재영; 박영태; 윤현식; 송경근
Original assignee: 한국과학기술연구원
Priority date: 2014-02-11
Filing date: 2014-06-26
Publication date: 2015-08-20
Also published as: KR101680048B1; KR20150094287A

Abstract

The present invention relates to a new Nephroselmis sp. novel strain and a method for increasing fatty acid content within a strain using the same. The novel strain of the present invention has a fast growth rate and contains a high content of lipids and fatty acids, and thus can be useful in the production of biodiesel. Also, since the novel strain of the present invention is separated from the acid mine and has a resistance to heavy metals, the activity thereof can be maintained even in waste water. Furthermore, the novel strain of the present invention has an advantage of being able to grow using minerals in the waste water by maintaining the activity in harsh environments such as waste water. In addition, in the case of culturing the strain with mine drainage and waste water, the novel strain of the present invention can maximally increase the content of the fatty acid, and thus is available in biodiesel production, and can be used to produce alternative energy.

Description

Novel strain KGE2 of novel neproselmis and method for increasing fatty acid content in the strain

The present invention relates to a novel strain of genus neproselmis and a method for increasing the fatty acid content in the strain using the same.

[Description of National Support R & D]

This research is supported by the Ministry of Environment's next-generation eco-innovation technology development project (project name: algae culture wastewater advanced treatment technology for advanced treatment of livestock wastewater and biodiesel production, task specific number: 1485010802). It is done.

The use of fossil fuels due to the high industrialization is a major cause of global warming by emitting a large amount of greenhouse gases. In addition, oil is being depleted due to excessive use of fossil fuels. Therefore, many researchers at home and abroad are developing alternative energy as an alternative means of fossil fuel. Alternative energy sources may include renewable energy, including solar, bio, wind, hydro, ocean, waste, geo, fuel cell and hydrogen. Among them, bioenergy can be used as a raw material for biodiesel, and the yield per unit area is much higher than that of other raw materials.

Conventional bioenergy sources are mainly beans, sugar cane and the like. However, the production efficiency of the biodiesel for the vast area required for cultivation thereof is low, and thus faces difficulties. Therefore, the study of microalgae as biomass is needed for stable and economic production of biodiesel.

However, to date, microalgae research for biofuel production has been limited to microalgae inhabiting the ocean, which may cause problems with the transport of large volumes of microalgae that are not dried from the ocean and must be injected with artificial minerals. There was a problem.

It is an object of the present invention to provide novel strains and methods of increasing the fatty acid content in such strains.

One aspect of the present invention to achieve the above object provides a Nephroselmis sp. KGE2 strain.

One aspect of the invention also provides a method of increasing the fatty acid content in a strain, comprising culturing the strain and wastewater together.

The novel strain of the present invention can be usefully used for biodiesel production, including fast growth rate and high content of lipids and fatty acids. In addition, the novel strains of the present invention are isolated from acidic mines, and because of their resistance to heavy metals, they can maintain their activity even in wastewater. In addition, the novel strain of the present invention has the advantage that it can grow using minerals in the wastewater to maintain its activity in harsh environments such as wastewater.

In addition, the novel strains of the present invention can increase the content of fatty acids to the maximum when incubated with the mine drainage and wastewater, and can be used to produce alternative energy, which is available for biodiesel production. In addition, the novel strains of the present invention comprise a high content of lipids and thus high content of fatty acids such as palmitic acid, palmitoleic acid, oleic acid, linoleic acid (18: 2n6t), or g-linoleic acid. (18: 3n6) is contained in high content, and can be used usefully.

Figure 1 is a micrograph (1500 magnification) of the nephlocell miss genus KGE 2 (Nephroselmis sp.KGE2).

2 is a genus of Neplocell. The schematic of KGE 2 is shown.

Figure 3 after the treatment of the mine drainage and livestock wastewater at various weight ratios, the degree of growth of KGE 2 in neproselmis.

Figure 4 after treating the mine drainage and livestock wastewater in various weight ratios, genus Neproselmis. The content of fatty acids in KGE 2 is shown.

Figure 5 is a table after measuring the amount of fatty acids in KGE 2 in neproselmis after treating mine drainage and livestock wastewater in various weight ratios.

The present invention relates to a four-cell Pro miss in KGE2 (Nephroselmis sp. KGE2) strain in one aspect. Nephroselmis sp. KGE2 strain, which is one aspect of the present invention, was isolated and identified for the first time by the present inventors. The present inventors have for the separation of the identified new strains termed four pro-cell misses in KGE2 (Nephroselmis sp. KGE2) strains, July 30, the date in 2013 the deposit to deposit the Korea Research Institute of Bioscience and Biotechnology Microbial Resource Center number (KCTC 12456BP) Was granted. KGE stands for KIST Gangneung Enviromental.

The strain of one aspect of the present invention may include the nucleotide sequence of SEQ ID NO: 3.

A strain in one aspect of the invention may comprise at least 30% by weight lipids relative to the total weight of the dry strain. In general microalgae, the content of lipids is difficult to exceed 20%. However, the present invention contains 30% or more lipids, and a large amount of fatty acids can be actively utilized as biomass. Nephroselmis sp. KGE2 strains of the present invention from the above point of view is 30.2% by weight, 30.4% by weight, 30.6% by weight, 30.8% by weight, 31% by weight, 31.2% by weight At least 31.4 wt%, at least 31.6 wt%, at least 31.8 wt%, 32 wt%, 32.2 wt%, 32.4 wt%, 32.6 wt%, 32.8 wt%, or at least 33 wt% lipid.

In one strain of the present invention, the strain may be Accession No. KCTC 12456BP.

A strain of one aspect of the present invention may include a high content of lipids and fatty acids as described above, and in particular, palmitoleic acid, heptadikenoic acid (Palmitoleic acid) Heptadecenoic acid, oleic acid (Oleic acid), may include one or more fatty acids selected from the group consisting of Linolelaidic acid (Linolelaidic acid). Among them, palmitic acid is particularly suitable for fueling tropical climates because of its high oxidation stability and high cetane number (easily fuel ignition).

In another aspect, the present invention relates to a culture solution of the strain KGE2 of the genus Neproselmis. The culture solution includes a product obtained by culturing the strain KGE2 of the genus Neproselmis, and has a constitution included in a conventional culture solution.

The present invention relates to a culturing method comprising the step of culturing the genus KGE2 strain of neproselmis in another aspect. Specifically, the culture method may include the step of culturing neproselmis genus KGE2 strain at 25 to 30 ℃, pH 6 to 8 conditions, the growth rate of the new strain of the present invention may be high under the conditions. . In view of the above, the strain may be incubated at a temperature of 25.5 to 29.5 ° C, 26 to 29 ° C or 26.5 to 28.5 ° C, and may be cultured at pH 6.2 to 7.8, pH 6.4 to 7.6 or pH 6.4 to 7.4. have. More specifically, in the culture method of one aspect of the present invention, the culture method in a medium containing KH ₂ PO ₄ , CaCl ₂ , MgSO ₄ , NaNO ₃ , K ₂ HPO ₄ , NaCl and H ₃ BO ₃ , It may comprise the step of culturing the genus KGE2 strain of neproselmis.

In the culture method of one aspect of the present invention, the medium may further include one or more elements selected from the group consisting of ZnSO ₄ , MnCl ₂ , MoO ₃ , CuSO ₄ and Co (NO ₃ ) ₂ .

The present invention relates to a method of In another aspect, the four Pro cell misses in KGE2 (Nephroselmis sp. KGE2) increasing the fatty acid content in the, four Pro cell misses in KGE2 strain which comprises the culture with the strain and mine drainage and waste water .

Specifically, the wastewater includes both wastewater or domestic wastewater including livestock manure. In addition, the mine drainage may specifically include acid mine drainage, but is not limited thereto. In the present specification, the livestock manure may mean manure of livestock containing a large amount of N, P.

In a method for increasing fatty acid content in a strain, which is an aspect of the present invention, the wastewater is at least one selected from the group consisting of wastewater and domestic wastewater including livestock manure.

In the method for increasing the fatty acid content in the strain of one aspect of the present invention, the weight ratio between the acid mine drainage and the wastewater may be 0.5 to 2.5: 1. Within this range the production of fatty acids is the best. In view of the above, the weight ratio between the mine drainage and the wastewater may be 0.6 to 2.4: 1, 0.7 to 2.3: 1, 0.8 to 2.2: 1, 0.9 to 2.1: 1 or 1 to 2: 1.

In a method for increasing fatty acid content in a strain of one aspect of the present invention, the strain may be Accession No. KCTC 12456BP.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as being limited by these examples.

[실험예 1]Experimental Example 1

신균주의 분리 및 배양Isolation and Culture of Mycobacteria

The samples were collected from the acid mine drainage area of Heungil Taebong, Mojeon-myeon, Gangneung-si, Gangwon-do. Sampling was carried out in the sterilized water sample pack (1L), the soil, water quality and cold storage using an ice box to the laboratory. The collected sample was partially separated and washed and centrifuged three times using sterilized DIW to obtain a new strain. The isolated new strain sample was observed by magnification 1500 times through an optical microscope.

The new strain was placed in BBM liquid medium having the composition shown in Table 1 and cultured for 2 weeks. The BBM liquid medium can provide an environment in which microalgae can be optimized for growth. The microelement stock solution and the composition of solution 1 and solution 2 constituting the composition of the BBM liquid medium are shown in Table 2. A 36-watt fluorescent lamp was used as a light source, and after two weeks of culture, an independent colony was collected and first spreaded evenly using platinum on an alar plate (15 g / L) containing BBM. After 8 days, the cultured colonies were second plated onto an alar plate containing BBM. After 12 days, the cultured colonies were harvested and the microalgae were dispersed in a Erlenmeyer flask containing a liquid medium containing BBM. And microalgae are incubated using a constant temperature shaker with a fluorescent lamp. At this time, the culture conditions were a temperature 25 ± 1 ℃, the stirring speed 150rpm.

Table 1

Ingredient	content
KH ₂ PO ₄	175 mg / L
CaCl ₂ * H ₂ O	25 mg / L
MgSO ₄ * 7H ₂ O	75 mg / L
NaNO ₃	250 mg / L
K ₂ HPO ₄	75 mg / L
NaCl	25 mg / L
H ₃ BO ₃	11.42 mg / L
Microelement stock solution	1 ml
Solution
1	1 ml
Solution
2	1 ml

TABLE 2

Microelement stock solution		Solution		1		Solution 2
Ingredient	content	Ingredient	content	Ingredient	content
ZnSO ₄ * 7H ₂ O	8.82 g / L	Na ₂ EDTA	50 g / L	FeSO ₄	4.98 g / L
MnCl ₂ * 4H ₂ O	1.44 g / L
MoO ₃	0.71 g / L	KOH	3.1 g / L	H ₂ SO ₄	1 ml / L
CuSO ₄ * 5H ₂ O	1.57 g / L
Co (NO ₃ ) ₂ * 6H ₂ O	0.49 g / L

[실험예 2]Experimental Example 2

분리균주의 배양Cultivation of isolated strain

Using the BBM medium of the composition shown in Table 1, 10 mL of the new strain of the present invention was put in a 250 mL Erlenmeyer flask at 25 ° C., pH 7 and incubated for 14 days in a constant temperature shaker with a fluorescent lamp. Stirring was maintained at 150 rpm and roughness 50 μmol / m 2 -sec.

[실험예 3]Experimental Example 3

분리균주의 동정 및 상동성 비교Identification and homology comparison of isolates

The sequencing of the new strain, Nephroselmis sp. KGE 2 (Nephroselmis sp. KGE2) was analyzed by 28s rRNA sequencing.

A portion of the microalgae was taken during the cultivation and centrifuged to use the sample for analysis. The microalgae were extracted using a DNA extraction kit (SolGent, Korea), and the extracted DNA was amplified by PCR. Primer 28S D1D2 was used.

Forward primer: 5'-AGCGGAGGAAAAGAAACTA-3 '(SEQ ID NO: 1)

Reverse primer: 5'-TACTAGA-AGGTTCGATTAGTC-3 '(SEQ ID NO: 2)

The resulting nucleotide sequence is described in SEQ ID NO: 3, using this to create a schematic diagram with reference to the NCBI information (Fig. 2).

[SEQ ID NO 3]

AGCGGAGGAAAAGAAACTAACAAGGATTCCCTCTAGTAACGGCGAGCGAACCGGGAAGAGCCCAACTTGAAAATCTGGCAGCTTCGCTGTCCGAATTGTAGTCTAAAGAAGCGTCCTCTGTAGCGGACCGGGCCCAAGTTCCCTGGAATGGGACGTCAGAGAGGGTGAGAGCCCCGTCGACCCCGGACCCTGCTACTCCACGAGGCGCTGTCGCCGAGTCGGGTTGTTTGGGAATGCAGCCCTAAATGGGTGGTAAATTCCATCTAAGGCTAAATACTGGCGAGAGACCGATAGCGAACAAGTACCGCGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAAGTGCTTGAAATTGTTGAGGGGGAAGCGAATGGAAGCAGAGGTGCGCCTCGGTTTTATGTGGGGGTTCGCGCCCCCGCCTATCAACGCGAGGCGCTGGTCAGCGTGGGTTAGCCTGGCGGGAAAAAAGCAGGGGTTGTTACCCTGTCCATATCGCCGGGCTGACCGAGGTCTGAAGGGCGCGCTTCGGCGAGCTTCGGCATCTGCGCCCTCAGGACGCTGGCTCAATGCTTCCATCCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTATGCGAGCCGGTGGGTGGCAAACCCATGAGGCGCAAGTAACCTGATTGGTGGGATTCCTTTTGGATGCACCATCGACCGACCATGATCTTCTGTGAAAGGTTTGAGTAGGAGTATACCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAGCAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATACTGACGTGCAAATCGTTCGTCAGACTTGGGTATAGGGGCGAAAGACTAATCGAACCTTCTAGTA

In addition, as a result of analyzing the homology by performing a Blast search in NCBI with the nucleotide sequence, Table 3 was obtained.

TABLE 3

Microalgal strain	Accession number	Length (nt ^a )	Closest relative and GenBank accession number	Similarity (%)
Nephroselmis sp. KGE2	HE861888	882	HE610144.1	89

Therefore, the present inventors named the isolated new strain KGE 2 ( Nephroselmis sp.KGE2) in neproselmis, deposited on August 19, 2013 at the Korea Biotechnology Research Institute microbial resource center and deposited the accession number KCTC 12456BP Granted.

[실험예 4]Experimental Example 4

배양액 조성에 따른 균주의 생장량 확인 Confirmation of growth amount of strain according to culture composition

The mixture of livestock wastewater and acid mine drainage and 10 mL of nephlosmith miss in a Erlenmeyer flask at 25 ° C. and pH 7 was added to KGE 2 { Nephroselmis sp. KGE2} [KCTC 12456BP] strains were added and cultured in a constant temperature shaker with a fluorescent lamp for 21 days. Stirring was maintained at 150 rpm and light quantity 120 photos μmol / m 2 -sec. EDTA was added to prevent iron precipitation.

Table 4

Experimental group	Sample composition	BBM	MBR	Mine drainage	Mine drainage + EDTA	Distilled water
Comparative Example 1	olny MBR	0	10	0	0	90
Comparative Example 2	BBM	10	0	0	0	0
Example 1	MBR + 5% AMD	0	10	5	0	85
Example 2	MBR + 10% AMD	0	10	10	0	80
Example 3	MBR + 5% AMD + EDTA	0	10	0	5	85
Example 4	MBR + 10% AMD + EDTA	0	10	0	5	80

MBR: Primary treatment water that removes suspended solids by passing livestock wastewater through the membrane

AMD: Acid Mine Drainage

EDTA: Eethylene Diamine Tetra Acetic acid

After culturing each of the genus KGE2 strain of neproselmis under the conditions as shown in Table 4, the dry weight was measured to obtain the results as shown in Figure 3 below. As can be seen in Figure 3, when culturing the strain using the wastewater and mine drainage, it was confirmed that the growth of the strain is the best.

[실험예 5]Experimental Example 5

지질 함량 분석Lipid content analysis

After incubating the KGE2 strains of the genus Neproselmis for 21 days under the experimental conditions as shown in Table 4, the strains were recovered and centrifuged at 3500 rpm in a swing type centrifuge (Hanil, Korea). After freeze-drying the centrifuged microalgae using a freeze dryer for 3 days, 500mg of the sample was collected and placed in a container for lipid extraction (with a teflon liner inserted into a glass container and a lid capable of centrifugation), followed by solvent chloroforum 1.25. m and 2.5 ml of methanol were added using a glass pipette. Thereafter, the sample to which the solvent was added to the microalgae was mixed well with a high speed stirrer for 5 minutes and crushed using a sonicator for 30 minutes to start extraction. The crushed microalgae were extracted with stirring (30 ° C., 150 rpm) for one day with a constant temperature water shaker under conditions of 150 rpm and 30 ° C. 1.25ml of chloroforum was added to the extracted sample using a glass pipette, and further stirred in a constant temperature shaker for 2 hours. 1.25ml of distilled water was added to the extracted sample by using a micropipette and centrifuged to separate an organic layer and a water layer. The organic layer (primary extract) was transferred to a new container (with a centrifuged glass container and a Teflon liner inserted into the lid) using a paspice pipette, and centrifuged once more by adding 1.25 ml of distilled water to the remaining material. The organic layer (secondary extract) and the water layer were separated, and the organic layer was separated using a Paspan pipette, and the primary and secondary extracts were combined to obtain a lipid extract. 5 ml of NaCl (5%) was added to the lipid extract thus obtained, followed by centrifugation to transfer only the organic layer. The organic layer was evaporated using a rotary vacuum evaporator to separate pure lipids. Thereafter, the dry weight of the pure lipid extract, the weight of the cultured microalgae and its dry weight were measured, and these were substituted into

Equations

1 and 2 below to obtain Table 5 below.

[Equation 1]

Lipid content (%) = dry weight of lipid extract (g) / dry weight of microalgae (g) X 100

[Equation 2]

Lipid productivity (g / L) = microalgae production (g / L) X microalgal lipid content (%)

Table 5

	Experimental group	Microalgae Production (Biomass, g / L)	Lipid contents (%)	Lipid productivity (g / L)
KGE 2	Comparative Example 1	0.447 ± 0.062	29.89 ± 3.48	0.133 ± 0.018
	Comparative Example 2	0.411 ± 0.050	33.11 ± 1.04	0.136 ± 0.001
	Example 1	0.587 ± 0.025	22.19 ± 1.03	0.0.130 ± 005
	Example 2	0.580 ± 0.059	20.95 ± 1.49	0.121 ± 0.012
	Example 3	0.513 ± 0.034	20.78 ± 0.26	0.106 ± 0.007
	Example 4	0.535 ± 0.019	23.85 ± 2.71	0.084 ± 0.004

As can be seen in Table 5, it was confirmed that the best productivity of the strain when culturing the strain using the wastewater and mine drainage together.

[실험예 6]Experimental Example 6

지방산 추출 및 함량 분석Fatty Acid Extraction and Content Analysis

Fatty acid content and composition were determined by Lepage and Roy [Lepage, G., C.C. Roy (1984) Improved recovery of fatty acid through direct transesterification without prior extraction or purification, Journal of Lipid Research, 25, 1391-1396.

A fatty acid methyl ester mixture, FAME Quantitative Standard Mix 37 comps. [AccuStandard, USA] was used as a standard. Place a mass of microalgal lipid sample in a glass tube [11 mL, DH.GL28020, Daihan Scientific, Korea] with a Teflon stopper, and inject 2 mL of chloroform-methanol (2: 1, vol / vol) at room temperature. It was mixed for a minute with a vortex mixer (Vorex Genius 3. Ika, Italy).

1 mL (500 μg / L) of chloroform, 1 mL of methanol, and 300 μl of sulfuric acid containing nonadecanoic acid (Sigma Co., USA), an internal standard, are sequentially added to the glass tube, followed by a mixer for 5 minutes. Mixed into. The tube was placed in a constant temperature water bath and reacted at 100 ° C for 10 minutes. After the tube was cooled to room temperature, 1 mL of distilled water was injected, mixed vigorously with a mixer for 5 minutes, and centrifuged at 4,000 rpm for 10 minutes to separate layers. The lower layer (organic phase) was extracted with a disposable PP syringe (Norm-ject, Germany) and filtered with a disposable 0.22 μm PVDF syringe filter (Millex-Gv, Millipore, USA), followed by gas chromatography with an automatic injector [Model 7890 , Agilent, USA].

After culturing each of the Neproselmis genus KGE 2 for 21 days under the conditions as shown in Table 4, it was recovered and used, and the distribution of fatty acids for each case was plotted in FIG. As can be seen in Figure 4, the most stable strains of oleic acid (C 18: 1n9c) and palmitic acid (16: 0), which are fatty acids that can be used for biodiesel production of microalgae, are used together with wastewater and mine drainage. When cultured it was confirmed that the highest.

In addition, after incubating each of KGE 2 in neproselmis for 21 days under the conditions shown in Table 4, it was recovered and used, and the total amount of fatty acids (mg / L) for each case was compared as shown in FIG. 5. Results were obtained, and the total amount of fatty acids was rapidly increased when the strains were cultured using the mine drainage together. In addition, it can be seen that according to Table 4, the total amount of fatty acids is rapidly increased even under conditions in which lipid content and seismic productivity are deteriorated. Accordingly, the strain can be used as a biomass having excellent efficiency. there was.

As described above in detail the specific parts of the present invention, it is apparent to those skilled in the art that such specific description is merely a preferred embodiment, thereby not limiting the scope of the present invention. something to do. Thus, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

[Accession number]

Depositary: Korea Research Institute of Bioscience and Biotechnology

Accession number: KCTC12456BP

Deposit Date: 20130730

Claims

Nephroselmis sp.KGE2 strain.
The method of claim 1,

The strain has a deposit number of KCTC 12456BP.
The method of claim 1,

The strain comprises the sequence of SEQ ID NO: 3.
The method of claim 1,

Wherein said strain comprises at least 30% by weight lipids relative to the total weight of the dry strain.
Yes Pro cell misses in KGE2 (Nephroselmis sp. KGE2) a method of increasing the fatty acid content in the, four Pro cell misses in KGE2 strain, comprising culturing the strain together with drainage and mine waste water.
The method of claim 5,

Wherein said wastewater comprises at least one selected from the group consisting of wastewater comprising livestock manure and domestic wastewater.
The method according to claim 5 or 6,

Wherein the weight ratio between the mine drainage and the wastewater is from 0.5 to 2: 1.
The method according to claim 5 or 6,

The strain is Accession No. KCTC 12456BP.