WO2015103351A1 - Novel maize ubiquitin promoters - Google Patents

Novel maize ubiquitin promoters Download PDF

Info

Publication number
WO2015103351A1
WO2015103351A1 PCT/US2014/072917 US2014072917W WO2015103351A1 WO 2015103351 A1 WO2015103351 A1 WO 2015103351A1 US 2014072917 W US2014072917 W US 2014072917W WO 2015103351 A1 WO2015103351 A1 WO 2015103351A1
Authority
WO
WIPO (PCT)
Prior art keywords
plant
transgene
promoter
transgenic
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2014/072917
Other languages
English (en)
French (fr)
Inventor
Sandeep Kumar
Manju Gupta
Terry R. Wright
Susan M. Jayne
Doug A. Smith
Diaa ALABED
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Corteva Agriscience LLC
Original Assignee
Dow AgroSciences LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to RU2016131302A priority Critical patent/RU2016131302A/ru
Priority to CN201480076356.1A priority patent/CN106029882A/zh
Priority to MX2016008756A priority patent/MX362667B/es
Priority to CA2935381A priority patent/CA2935381A1/en
Priority to AU2014373769A priority patent/AU2014373769B2/en
Priority to JP2016543695A priority patent/JP2017500875A/ja
Application filed by Dow AgroSciences LLC filed Critical Dow AgroSciences LLC
Priority to EP14876153.9A priority patent/EP3090046A4/en
Priority to KR1020167020540A priority patent/KR20160099103A/ko
Publication of WO2015103351A1 publication Critical patent/WO2015103351A1/en
Priority to IL246514A priority patent/IL246514A0/en
Anticipated expiration legal-status Critical
Priority to PH12016501293A priority patent/PH12016501293A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01HNEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H6/00Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy
    • A01H6/46Gramineae or Poaceae, e.g. ryegrass, rice, wheat or maize
    • A01H6/4636Oryza sp. [rice]
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01HNEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H6/00Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy
    • A01H6/46Gramineae or Poaceae, e.g. ryegrass, rice, wheat or maize
    • A01H6/4678Triticum sp. [wheat]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8274Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for herbicide resistance
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/146Genetically Modified [GMO] plants, e.g. transgenic plants

Definitions

  • sequence listing is submitted electronically via EFS- Web as an ASCII formatted sequence listing with a file named "75663_ST25.txt", created on December 30, 2014, and having a size of 13.4 kilobytes and is filed concurrently with the specification.
  • sequence listing contained in this ASCII formatted document is part of the specification and is herein incorporated by reference in its entirety.
  • This invention is generally related to the field of plant molecular biology, and more specifically, to the field of expression of transgenes in plants.
  • plant species are capable of being transformed with transgenes to introduce agronomically desirable traits or characteristics.
  • Plant species are developed and/or modified to have particular desirable traits.
  • desirable traits include, for example, improving nutritional value quality, increasing yield, conferring pest or disease resistance, increasing drought and stress tolerance, improving horticultural qualities (e.g., pigmentation and growth), imparting herbicide resistance, enabling the production of industrially useful compounds and/or materials from the plant, and or enabling the production of pharmaceuticals.
  • Transgenic plant species comprising multiple transgenes stacked at a single genomic locus are produced via plant transformation technologies.
  • Plant transformation technologies result in the introduction of a transgene into a plant cell, recovery of a fertile transgenic plant that contains the stably integrated copy of the transgene in the plant genome, and subsequent transgene expression via transcription and translation of the plant genome results in transgenic plants that possess desirable traits and phenotypes.
  • mechanisms that allow the production of transgenic plant species to highly express multiple transgenes engineered as a trait stack are desirable.
  • transgene within particular tissues or organs of a plant are desirable. For example, increased resistance of a plant to infection by soil- borne pathogens might be accomplished by transforming the plant genome with a pathogen- resistance gene such that pathogen-resistance protein is robustly expressed within the roots of the plant.
  • pathogen- resistance gene such that pathogen-resistance protein is robustly expressed within the roots of the plant.
  • Zea mays Ubi-1 promoter regulatory elements including promoters, upstream-promoters, 5'-UTRs, and introns. Further described are constructs and methods utilizing gene regulatory elements.
  • a promoter comprises a polynucleotide sequence.
  • a promoter polynucleotide sequence comprises an up stream-promoter, a 5 '-untranslated region (5'- UTR) or leader sequence, and an intron.
  • a promoter polynucleotide sequence comprises the Ubiquitin-1 gene (Ubi-1).
  • a promoter polynucleotide sequence comprises the Ubi-1 gene of Zea mays (Z. mays).
  • a construct includes a gene expression cassette comprising a promoter polynucleotide sequence that was obtained from the Ubi-1 gene of Z. mays.
  • the Ubi-1 promoter polynucleotide sequence from Z. mays comprises an upstream- promoter region, 5'- UTR or leaders sequence, and an intron.
  • a construct includes a gene expression cassette comprising a promoter polynucleotide sequence obtained from Z. mays Ubi-1 gene fused to an intron from the gene encoding Yellow Fluorescent Protein from the Phialidium species (PhiYFP).
  • a construct includes a gene expression cassette comprising a promoter polynucleotide sequence obtained from Z.
  • a gene expression cassette includes a gene promoter regulatory element operably linked to a transgene or a heterologous coding sequence.
  • a gene expression cassette includes at least one, two, three, four, five, six, seven, eight, nine, ten, or more transgenes.
  • Methods of growing plants expressing a transgene using novel gene promoter regulatory elements are disclosed herein.
  • Methods of culturing plant tissues and cells expressing a transgene using the novel gene promoter regulatory element are also disclosed herein.
  • methods as disclosed herein include constitutive gene expression in plant leaves, roots, calli, and pollen.
  • Methods of purifying a polynucleotide sequence comprising the novel gene promoter regulatory element are also disclosed herein.
  • FIG. 1 shows a schematic novel promoter comprising the Zea mays c.v. B73 Ubi-1 gene.
  • the promoter is comprised of an upstream element, a 5'-UTR or leader sequence, and an intron.
  • the upstream element is located 5' upstream of the Transcription Start Site (TSS), indicated by the long arrow.
  • TTS Transcription Start Site
  • the upstream element is comprised of regulatory elements, such as a TATA box, indicated by the short arrow, and a heat shock element, indicated by the star.
  • FIG. 2 shows the plasmid map for vector pDAB105714 comprising the PCR amplified promoter sequence of Z. mays c.v. LLN37 Ubi-1 gene.
  • FIG. 3 shows the polynucleotide sequence of Z. mays c.v. B73 Ubi-1 control promoter (SEQ ID NO: 1) with the upstream-promoter region underlined, the 5'-UTR/leader sequence shaded, and the intron region in lower case.
  • FIG. 4 shows the polynucleotide sequence of Z. mays c.v. LLN37 Ubi-1 promoter (SEQ ID NO: 2) with the upstream-promoter region underlined, the 5 '-UTR/leader sequence shaded, and the intron region in lower case.
  • FIG. 5 shows the polynucleotide sequence alignment of the upstream-promoter regions of Z. mays c.v. LLN37 (SEQ ID NO: 4) compared to the Z. mays c.v. B73 control upstream-promoter sequence (SEQ ID NO: 3).
  • FIG. 6 shows the polynucleotide sequence alignment of the 5'-UTR/leader regions of Z. mays c.v. LLN37 (SEQ ID NO: 6) compared to the Z. mays c.v. B73 control 5'-UTR/leader sequence (SEQ ID NO: 5).
  • FIG. 7 shows the polynucleotide sequence alignment of the intron regions of Z. mays c.v. LLN37 (SEQ ID NO: 8) compared to the Z. mays c.v. B73 control intron sequence (SEQ ID NO: 7).
  • FIG. 8 shows a vector map of binary expression construct, pDAB 105748, comprising the control entry vector, pDAB105742 (Z. mays c.v. B73), inserted into destination vector, pDAB10197.
  • FIG. 9 shows a vector map of binary expression construct, pDAB 105747, comprising the entry vector, pDAB105741 (Z. mays c.v. LLN37), inserted into destination vector, pDAB10197.
  • FIG. 10 shows PhiYFP gene expression in T 0 plant calli for binary expression constructs pDAB 105748 (Z. mays c.v. B73) and pDAB 105747 (Z. mays c.v. LLN37).
  • FIG. 11 shows PhiYFP gene expression in T plant pollen for binary expression constructs pDAB105748 (Z. mays c.v. B73), pDAB105747 (Z. mays c.v. LLN37), and a negative control.
  • backcrossing refers to a process in which a breeder crosses hybrid progeny back to one of the parents, for example, a first generation hybrid Fl with one of the parental genotypes of the Fl hybrid.
  • intron refers to any nucleic acid sequence comprised in a gene (or expressed nucleotide sequence of interest) that is transcribed but not translated. Introns include untranslated nucleic acid sequence within an expressed sequence of DNA, as well as a
  • a construct described herein may also contain sequences that enhance translation and/or mRNA stability such as introns.
  • An example of one such intron is the first intron of gene II of the histone H3 variant of Arabidopsis thaliana or any other commonly known intron sequence.
  • Introns may be used in combination with a promoter sequence to enhance translation and/or mRNA stability.
  • the terms "5 '-untranslated region” or “5'-UTR” refers to an untranslated segment in the 5' terminus of pre-mRNAs or mature mRNAs.
  • a 5'-UTR typically harbors on its 5' end a 7-methylguanosine cap and is involved in many processes such as splicing, polyadenylation, mRNA export towards the cytoplasm, identification of the 5' end of the mRNA by the translational machinery, and protection of the mRNAs against degradation.
  • 3 '-untranslated region refers to an untranslated segment in a 3' terminus of the pre-mRNAs or mature mRNAs.
  • this region harbors the poly- (A) tail and is known to have many roles in mRNA stability, translation initiation, and mRNA export.
  • polyadenylation signal refers to a nucleic acid sequence present in mRNA transcripts that allows for transcripts, when in the presence of a poly- (A) polymerase, to be polyadenylated on the polyadenylation site, for example, located 10 to 30 bases downstream of the poly-(A) signal.
  • a poly- (A) polymerase a poly- (A) polymerase
  • Many polyadenylation signals are known in the art and are useful for the present invention.
  • An exemplary sequence includes AAUAAA and variants thereof, as described in Loke J., et al., (2005) Plant Physiology 138(3); 1457-1468.
  • isolated refers to a biological component (including a nucleic acid or protein) that has been separated from other biological components in the cell of the organism in which the component naturally occurs (i.e., other chromosomal and extra- chromosomal DNA).
  • purified in reference to nucleic acid molecules does not require absolute purity (such as a homogeneous preparation). Instead, “purified” represents an indication that the sequence is relatively more pure than in its native cellular environment. For example, the “purified” level of nucleic acids should be at least 2-5 fold greater in terms of concentration or gene expression levels as compared to its natural level.
  • the claimed DNA molecules may be obtained directly from total DNA or from total RNA.
  • cDNA clones are not naturally occurring, but rather are preferably obtained via manipulation of a partially purified, naturally occurring substance (messenger RNA).
  • messenger RNA messenger RNA
  • the construction of a cDNA library from mRNA involves the creation of a synthetic substance (cDNA).
  • Individual cDNA clones may be purified from the synthetic library by clonal selection of the cells carrying the cDNA library.
  • the process which includes the construction of a cDNA library from mRNA and purification of distinct cDNA clones yields an approximately 10 6 - fold purification of the native message.
  • a promoter DNA sequence may be cloned into a plasmid.
  • Such a clone is not naturally occurring, but rather is preferably obtained via manipulation of a partially purified, naturally occurring substance, such as a genomic DNA library.
  • purification of at least one order of magnitude preferably two or three orders, and more preferably four or five orders of magnitude, is favored in these techniques.
  • nucleic acid molecules and proteins that have been “purified” include nucleic acid molecules and proteins purified by standard purification methods.
  • the term “purified” also embraces nucleic acids and proteins prepared by recombinant DNA methods in a host cell (e.g., plant cells), as well as chemically-synthesized nucleic acid molecules, proteins, and peptides.
  • recombinant means a cell or organism in which genetic recombination has occurred. It also includes a molecule (e.g., a vector, plasmid, nucleic acid, polypeptide, or a small RNA) that has been artificially or synthetically (i.e., non-naturally) altered by human intervention. The alteration may be performed on the molecule within, or removed from, its natural environment or state.
  • a molecule e.g., a vector, plasmid, nucleic acid, polypeptide, or a small RNA
  • the alteration may be performed on the molecule within, or removed from, its natural environment or state.
  • the term "expression” refers to the process by which a polynucleotide is transcribed into mRNA (including small RNA molecules) and/or the process by which the transcribed mRNA (also referred to as "transcript") is subsequently translated into peptides, polypeptides, or proteins.
  • Gene expression may be influenced by external signals, for example, exposure of a cell, tissue, or organism to an agent that increases or decreases gene expression.
  • Gene expression of a gene may also be regulated anywhere in the pathway from DNA to RNA to protein. Regulation of gene expression occurs, for example, through controls acting on transcription, translation, RNA transport and processing, degradation of intermediary molecules, such as mRNA, or through activation, inactivation, compartmentalization, or degradation of specific protein molecules after they have been made, or by combinations thereof. Gene expression may be measured at the RNA level or the protein level by any method known in the art, including, without limitation, Northern blot, RT-PCR, Western blot, or in vitro, in situ, or in vivo protein activity assay(s).
  • HBGS HBGS
  • dsRNA double- stranded RNA
  • TGS and PTGS have been difficult to achieve, because it generally relies on the analysis of distinct silencing loci.
  • a single transgene locus may be described to trigger both TGS and PTGS, owing to the production of dsRNA corresponding to promoter and transcribed sequences of different target genes.
  • nucleic acid molecule refers to a polymeric form of nucleotides, which may include both sense and anti-sense strands of RNA, cDNA, genomic DNA, and synthetic forms, and mixed polymers thereof.
  • a “nucleotide” may refer to a ribonucleotide, deoxyribonucleotide, or a modified form of either type of nucleotide.
  • a nucleic acid molecule is usually at least ten bases in length, unless otherwise specified. The terms may refer to a molecule of RNA or DNA of indeterminate length. The terms include single- and double- stranded forms of DNA.
  • a nucleic acid molecule may include either or both naturally-occurring and modified nucleotides linked together by naturally occurring and/or non-naturally occurring nucleotide linkages.
  • Nucleic acid molecules may be modified chemically or biochemically, or may contain non- natural or derivatized nucleotide bases, as will be readily appreciated by those of ordinary skill in the art. Such modifications include, for example, labels, methylation, substitution of one or more of the naturally-occurring nucleotides with an analog, internucleotide modifications (e.g., uncharged linkages, such as, methyl phosphonates, phosphotriesters, phosphoramidates, carbamates, etc.;
  • nucleic acid molecule also includes any topological conformation, including single- stranded, double- stranded, partially duplexed, triplexed, hairpinned, circular, and padlocked conformations.
  • RNA is made by sequential addition of ribonucleotide-5' -triphosphates to the 3' terminus of the growing chain with a requisite elimination of the pyrophosphate.
  • discrete elements e.g., particular nucleotide sequences
  • upstream relative to a further element if they are bonded or would be bonded to the same nucleic acid in the 5' direction from that element.
  • discrete elements may be referred to as being "downstream” relative to a further element if they are or would be bonded to the same nucleic acid in the 3' direction from that element.
  • base position refers to the location of a given base or nucleotide residue within a designated nucleic acid.
  • a designated nucleic acid may be defined by alignment with a reference nucleic acid.
  • hybridization refers to a process where oligonucleotides and their analogs hybridize by hydrogen bonding, which includes Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding, between complementary bases.
  • nucleic acid molecules consist of nitrogenous bases that are either pyrimidines, such as cytosine (C), uracil (U), and thymine (T), or purines, such as adenine (A) and guanine (G).
  • the terms “specifically hybridizable” and “specifically complementary” refer to a sufficient degree of complementarity such that stable and specific binding occurs between an oligonucleotide and a DNA or RNA target. Oligonucleotides need not be 100% complementary to the target sequence to specifically hybridize. An oligonucleotide is specifically hybridizable when binding of the oligonucleotide to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA, and there is sufficient degree of complementarity to avoid nonspecific binding of an oligonucleotide to non-target sequences under conditions where specific binding is desired, for example, under physiological conditions in the case of in vivo assays or systems.
  • Hybridization conditions resulting in particular degrees of stringency will vary depending upon the nature of the chosen hybridization method and the composition and length of the hybridizing nucleic acid sequences. Generally, the temperature of hybridization and the ionic strength (especially Na + and/or Mg 2+ concentration) of a hybridization buffer will contribute to the stringency of hybridization, though wash times also influence stringency. Calculations regarding hybridization conditions required for attaining particular degrees of stringency are discussed in Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989.
  • stringent conditions encompasses conditions under which hybridization will only occur if there is less than 50% mismatch between the hybridization molecule and the DNA target.
  • Stringent conditions include further particular levels of stringency.
  • “moderate stringency” conditions are those under which molecules with more than 50% sequence mismatch will not hybridize;
  • conditions of "high stringency” are those under which sequences with more than 20% mismatch will not hybridize;
  • conditions of "very high stringency” are those under which sequences with more than 10% mismatch will not hybridize.
  • stringent conditions can include hybridization at 65 °C, followed by washes at 65°C with O.lx SSC/0.1% SDS for 40 minutes. The following are representative, non- limiting hybridization conditions:
  • specifically hybridizable nucleic acid molecules may remain bound under very high stringency hybridization conditions. In an embodiment, specifically hybridizable nucleic acid molecules may remain bound under high stringency hybridization conditions. In an embodiment, specifically hybridizable nucleic acid molecules may remain bound under moderate stringency hybridization conditions.
  • oligonucleotide refers to a short nucleic acid polymer.
  • Oligonucleotides may be formed by cleavage of longer nucleic acid segments or by polymerizing individual nucleotide precursors. Automated synthesizers allow the synthesis of oligonucleotides up to several hundred base pairs in length. Because oligonucleotides may bind to a complementary nucleotide sequence, they may be used as probes for detecting DNA or RNA. Oligonucleotides composed of DNA (oligodeoxyribonucleotides) may be used in Polymerase Chain Reaction, a technique for the amplification of small DNA sequences. In Polymerase Chain Reaction, an oligonucleotide is typically referred to as a "primer" which allows a DNA polymerase to extend the oligonucleotide and replicate the complementary strand.
  • PCR Polymerase Chain Reaction
  • sequence information from the ends of the region of interest or beyond needs to be available, such that oligonucleotide primers may be designed.
  • PCR primers will be identical or similar in sequence to opposite strands of the nucleic acid template to be amplified. The 5' terminal nucleotides of the two primers may coincide with the ends of the amplified material.
  • PCR may be used to amplify specific RNA sequences or DNA sequences from total genomic DNA and cDNA transcribed from total cellular RNA, bacteriophage, or plasmid sequences, etc. See generally Mullis et ah, Cold Spring Harbor Symp. Quant. Biol., 51:263 (1987); Erlich, ed., PCR Technology, (Stockton Press, NY, 1989).
  • the term "primer” refers to an oligonucleotide capable of acting as a point of initiation of synthesis along a complementary strand when conditions are suitable for synthesis of a primer extension product.
  • the synthesizing conditions include the presence of four different deoxyribonucleotide triphosphates (i.e., A,T,G, and C) and at least one polymerization-inducing agent or enzyme such as Reverse Transcriptase or DNA polymerase. These reagents are typically present in a suitable buffer that may include constituents which are co-factors or which affect conditions, such as pH and the like at various suitable temperatures.
  • a primer is preferably a single strand sequence, such that amplification efficiency is optimized, but double stranded sequences may be utilized.
  • the term "probe” refers to an oligonucleotide or polynucleotide sequence that hybridizes to a target sequence.
  • the probe hybridizes to a portion of the target situated between the annealing site of the two primers.
  • a probe includes about eight nucleotides, about ten nucleotides, about fifteen nucleotides, about twenty nucleotides, about thirty nucleotides, about forty nucleotides, or about fifty nucleotides. In some embodiments, a probe includes from about eight nucleotides to about fifteen nucleotides.
  • a probe In the Southern blot assay procedure, the probe hybridizes to a DNA fragment that is attached to a membrane.
  • a probe includes about ten nucleotides, about 100 nucleotides, about 250 nucleotides, about 500 nucleotides, about 1,000 nucleotides, about 2,500 nucleotides, or about 5,000 nucleotides. In some embodiments, a probe includes from about 500 nucleotides to about 2,500 nucleotides.
  • a probe may further include a detectable label, such as, a radioactive label, a biotinylated label, a fluorophore (e.g., Texas-Red ® , fluorescein isothiocyanate, etc.,).
  • the detectable label may be covalently attached directly to the probe oligonucleotide, such that the label is located at the 5' end or 3' end of the probe.
  • a probe comprising a fluorophore may also further include a quencher dye (e.g., Black Hole QuencherTM, Iowa BlackTM, etc.).
  • sequence identity or “identity” may be used interchangeably and refer to nucleic acid residues in two sequences that are the same when aligned for maximum correspondence over a specified comparison window.
  • percentage of sequence identity refers to a value determined by comparing two optimally aligned sequences (e.g., nucleic acid sequences or amino acid sequences) over a comparison window, wherein the portion of a sequence in the comparison window may comprise additions, substitutions, mismatches, and/or deletions (i.e., gaps) as compared to a reference sequence in order to obtain optimal alignment of the two sequences.
  • a percentage is calculated by determining the number of positions at which an identical nucleic acid or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and multiplying the result by 100 to yield the percentage of sequence identity.
  • Methods for aligning sequences for comparison are well known.
  • Various bioinformatics or computer programs and alignment algorithms, such as ClustalW and Sequencher, are also well known in the art and/or described in, for example: Smith and Waterman (1981) Adv. Appl. Math. 2:482; Needleman and Wunsch (1970) J. Mol. Biol. 48:443; Pearson and Lipman (1988) Proc. Natl. Acad. Sci. U.S.A.
  • NCBI National Center for Biotechnology Information
  • BLASTTM Basic Local Alignment Search Tool
  • Bethesda, MD National Center for Biotechnology Information
  • Blastn the "Blast 2 sequences" function of the BLASTTM (Blastn) program may be employed using the default parameters. Nucleic acid sequences with even greater similarity to the reference sequences will show increasing percentage identity when assessed by this method.
  • operably linked refers to a nucleic acid placed into a functional relationship with another nucleic acid.
  • “operably linked” may mean that linked nucleic acids are contiguous. Linking may be accomplished by ligation at convenient restriction sites. If such sites do not exist, synthetic oligonucleotide adaptors or linkers are ligated or annealed to the nucleic acid and used to link the contiguous polynucleotide fragment. However, elements need not be contiguous to be operably linked.
  • promoter refers to a region of DNA that is generally located upstream of a gene (i.e., towards the 5' end of a gene) and is necessary to initiate and drive transcription of the gene.
  • a promoter may permit proper activation or repression of a gene that it controls.
  • a promoter may contain specific sequences that are recognized by transcription factors. These factors may bind to a promoter DNA sequence, which results in the recruitment of RNA polymerase, an enzyme that synthesizes RNA from the coding region of the gene.
  • the promoter generally refers to all gene regulatory elements located upstream of the gene, including, 5'-UTR, introns, and leader sequences.
  • upstream-promoter refers to a contiguous polynucleotide sequence that is sufficient to direct initiation of transcription.
  • an upstream- promoter encompasses the site of initiation of transcription with several sequence motifs, which include a TATA Box, initiator (Intr) sequence, TFIIB recognition elements (BRE), and other promoter motifs (Jennifer, E.F. et al, (2002) Genes & Dev., 16: 2583-2592).
  • the upstream- promoter provides the site of action to RNA polymerase II, a multi-subunit enzyme with the basal or general transcription factors like, TFIIA, B, D, E, F, and H. These factors assemble into a transcription pre-initiation complex (PIC) that catalyzes the synthesis of RNA from a DNA template.
  • PIC transcription pre-initiation complex
  • the activation of the upstream-promoter is performed by the addition of regulatory DNA sequence elements to which various proteins bind and subsequently interact with the transcription initiation complex to activate gene expression. These gene regulatory element sequences interact with specific DNA-binding factors. These sequence motifs may sometimes be referred to as cis- elements. Such ds-elements, to which tissue-specific or development- specific transcription factors bind, individually or in combination, may determine the spatiotemporal expression pattern of a promoter at the transcriptional level. These ds-elements vary widely in the type of control they exert on operably linked genes. Some elements act to increase the transcription of operably-linked genes in response to environmental responses (e.g., temperature, moisture, and wounding).
  • environmental responses e.g., temperature, moisture, and wounding
  • ds-elements may respond to developmental cues (e.g., germination, seed maturation, and flowering) or to spatial information (e.g., tissue specificity). See, for example, Langridge et al. (1989) Proc. Natl. Acad. Sci. USA 86:3219-23. These ds-elements are located at a varying distance from the transcription start point. Some ds-elements (called proximal elements) are adjacent to a minimal core promoter region, while other elements may be positioned several kilobases 5' upstream or 3' downstream of the promoter (enhancers).
  • proximal elements are adjacent to a minimal core promoter region, while other elements may be positioned several kilobases 5' upstream or 3' downstream of the promoter (enhancers).
  • transformation encompasses all techniques in which a nucleic acid molecule may be introduced into a cell. Examples include, but are not limited to: transfection with viral vectors; transformation with plasmid vectors; electroporation; lipofection; microinjection (Mueller et al. (1978) Cell 15:579-85); Agwbacterium-mediated transfer; direct DNA uptake;
  • WHISKERSTM-mediated transformation and microprojectile bombardment. These techniques may be used for both stable transformation and transient transformation of a plant cell.
  • “Stable transformation” refers to the introduction of a nucleic acid fragment into a genome of a host organism resulting in genetically stable inheritance. Once stably transformed, the nucleic acid fragment is stably integrated in the genome of the host organism and any subsequent generation. Host organisms containing the transformed nucleic acid fragments are referred to as “transgenic” organisms.
  • Transient transformation refers to the introduction of a nucleic acid fragment into the nucleus or DNA-containing organelle of a host organism, resulting in gene expression without genetically stable inheritance.
  • transduce refers to a process where a virus transfers nucleic acid into a cell.
  • transgene refers to an exogenous nucleic acid sequence.
  • a transgene is a gene sequence (e.g., an herbicide-resistance gene), a gene encoding an industrially or pharmaceutically useful compound, or a gene encoding a desirable agricultural trait.
  • a transgene is an antisense nucleic acid sequence, wherein expression of the antisense nucleic acid sequence inhibits expression of a target nucleic acid sequence.
  • a transgene may contain regulatory sequences operably linked to the transgene (e.g., a promoter, intron, 5' -UTR, or 3'-UTR).
  • a nucleic acid of interest is a transgene.
  • a nucleic acid of interest is an endogenous nucleic acid, wherein additional genomic copies of the endogenous nucleic acid are desired, or a nucleic acid that is in the antisense orientation with respect to the sequence of a target nucleic acid in a host organism.
  • vector refers to a nucleic acid molecule as introduced into a cell, thereby producing a transformed cell.
  • a vector may include nucleic acid sequences that permit it to replicate in the host cell, such as an origin of replication. Examples include, but are not limited to, a plasmid, cosmid, bacteriophage, bacterial artificial chromosome (BAC), or virus that carries exogenous DNA into a cell.
  • a vector may also include one or more genes, antisense molecules, selectable marker genes, and other genetic elements known in the art.
  • a vector may transduce, transform, or infect a cell, thereby causing the cell to express the nucleic acid molecules and/or proteins encoded by the vector.
  • a vector may optionally include materials to aid in achieving entry of the nucleic acid molecule into the cell (e.g., a liposome).
  • an expression cassette refers to a segment of DNA that may be inserted into a nucleic acid or polynucleotide at specific restriction sites or by homologous recombination.
  • a segment of DNA comprises a polynucleotide containing a gene of interest that encodes a small RNA or a polypeptide of interest, and the cassette and restriction sites are designed to ensure insertion of the cassette in the proper reading frame for transcription and translation.
  • an expression cassette may include a polynucleotide that encodes a small RNA or a polypeptide of interest and may have elements in addition to the polynucleotide that facilitate transformation of a particular host cell.
  • a gene expression cassette may also include elements that allow for enhanced expression of a small RNA or a polynucleotide encoding a polypeptide of interest in a host cell. These elements may include, but are not limited to: a promoter, a minimal promoter, an enhancer, a response element, an intron, a 5'-UTR, a 3'-UTR, a terminator sequence, a polyadenylation sequence, and the like.
  • heterologous coding sequence is used to indicate any polynucleotide that codes for, or ultimately codes for, a peptide or protein or its equivalent amino acid sequence, e.g., an enzyme, that is not normally present in the host organism and may be expressed in the host cell under proper conditions.
  • heterologous coding sequences may include one or additional copies of coding sequences that are not normally present in the host cell, such that the cell is expressing additional copies of a coding sequence that are not normally present in the cells.
  • the heterologous coding sequences may be RNA or any type thereof (e.g., mRNA), DNA or any type thereof (e.g.
  • coding sequences include, but are not limited to, full-length transcription units that comprise such features as the coding sequence, introns, promoter regions, 5'-UTR, 3'-UTR, and enhancer regions.
  • Heterologous coding sequences also include the coding portion of the peptide or enzyme (i.e., the cDNA or mRNA sequence), the coding portion of the full-length transcriptional unit (i.e., the gene comprising introns and exons), "codon optimized” sequences, truncated sequences or other forms of altered sequences that code for the enzyme or code for its equivalent amino acid sequence, provided that the equivalent amino acid sequence produces a functional protein.
  • Such equivalent amino acid sequences may have a deletion of one or more amino acids, with the deletion being N-terminal, C-terminal, or internal. Truncated forms are envisioned as long as they have the catalytic capability indicated herein.
  • control refers to a sample used in an analytical procedure for comparison purposes.
  • a control can be "positive” or “negative”.
  • a positive control such as a sample from a known plant exhibiting the desired expression
  • a negative control such as a sample from a known plant lacking the desired expression.
  • plant includes plants and plant parts including, but not limited to, plant cells and plant tissues, such as leaves, calli, stems, roots, flowers, pollen, and seeds.
  • a class of plants that may be used in the present invention is generally as broad as the class of higher and lower plants amenable to mutagenesis including angiosperms, gymnosperms, ferns, and multicellular algae.
  • plant includes dicot and monocot plants.
  • dicotyledonous plants include tobacco, Arabidopsis, soybean, tomato, papaya, canola, sunflower, cotton, alfalfa, potato, grapevine, pigeon pea, pea, Brassica, chickpea, sugar beet, rapeseed, watermelon, melon, pepper, peanut, pumpkin, radish, spinach, squash, broccoli, cabbage, carrot, cauliflower, celery, Chinese cabbage, cucumber, eggplant, and lettuce.
  • monocotyledonous plants include corn, rice, wheat, sugarcane, barley, rye, sorghum, orchids, bamboo, banana, cattails, lilies, oat, onion, millet, and triticale.
  • plant material refers to leaves, calli, stems, roots, flowers or flower parts, fruits, pollen, egg cells, zygotes, seeds, cuttings, cell or tissue cultures, or any other part or product of a plant.
  • plant material includes cotyledon and leaf.
  • plant material includes root tissues and other plant tissues located underground.
  • selectable marker gene refers to a gene that is optionally used in plant transformation to, for example, protect plant cells from a selective agent or provide resistance/tolerance to a selective agent.
  • selectable marker gene is meant to encompass reporter genes.
  • selectable marker Only those cells or plants that receive a functional selectable marker are capable of dividing or growing under conditions having a selective agent.
  • selective agents may include, for example, antibiotics, including spectinomycin, neomycin, kanamycin, paromomycin, gentamicin, and hygromycin.
  • selectable markers include neomycin phosphotransferase (npt II), which expresses an enzyme conferring resistance to the antibiotic kanamycin, and genes for the related antibiotics neomycin, paromomycin, gentamicin, and G418, or the gene for hygromycin phosphotransferase (hpt), which expresses an enzyme conferring resistance to hygromycin.
  • Other selectable marker genes may include genes encoding herbicide resistance including bar or pat (resistance against glufosinate ammonium or
  • phosphinothricin acetolactate synthase
  • ALS acetolactate synthase
  • IMIs imidazolinones
  • TPs triazolopyrimidines
  • POBs pyrimidinyl oxybenzoates
  • sulfonylamino carbonyl triazolinones that prevent the first step in the synthesis of the branched- chain amino acids
  • reporter genes that may be used as a selectable marker gene include the visual observation of expressed reporter gene proteins, such as proteins encoding ⁇ -glucuronidase (GUS), luciferase, green fluorescent protein (GFP), yellow fluorescent protein (YFP), DsRed, ⁇ -galactosidase,
  • chloramphenicol acetyltransferase (CAT), alkaline phosphatase, and the like.
  • CAT chloramphenicol acetyltransferase
  • marker-positive refers to plants that have been transformed to include a selectable marker gene.
  • detectable marker refers to a label capable of detection, such as, for example, a radioisotope, fluorescent compound, bioluminescent compound, a
  • detectable markers include, but are not limited to, the following: fluorescent labels (e.g., FITC, rhodamine, lanthanide phosphors), enzymatic labels (e.g., horseradish peroxidase, ⁇ -galactosidase, luciferase, alkaline phosphatase), chemiluminescent, biotinyl groups, predetermined polypeptide epitopes recognized by a secondary reporter (e.g., leucine zipper pair sequences, binding sites for secondary antibodies, metal binding domains, epitope tags).
  • fluorescent labels e.g., FITC, rhodamine, lanthanide phosphors
  • enzymatic labels e.g., horseradish peroxidase, ⁇ -galactosidase, luciferase, alkaline phosphatase
  • biotinyl groups e.g., predetermined polypeptide epitopes recognized by a secondary reporter
  • a detectable marker may be attached by spacer arms of various lengths to reduce potential steric hindrance.
  • detecting is used in the broadest sense to include both qualitative and quantitative measurements of a specific molecule, for example, measurements of a specific polypeptide.
  • Plant promoters used for basic research or biotechnological applications are generally unidirectional, directing the constitutive expression of a transgene that has been fused to its 3' end (downstream). It is often necessary to robustly express transgenes within plants for metabolic engineering and trait stacking. In addition, multiple novel promoters are typically required in transgenic crops to drive the expression of multiple genes. Disclosed herein is a constitutive promoter that can direct the expression of a transgene that has been fused at its 3' end.
  • transgenic products is becoming increasingly complex, which requires robustly expressing transgenes and stacking multiple transgenes into a single locus.
  • each transgene requires a unique promoter for expression wherein multiple promoters are required to express different transgenes within one gene stack.
  • this method frequently leads to repeated use of the same promoter to obtain similar levels of expression patterns of different transgenes for expression of a single polygenic trait.
  • Multi-gene constructs driven by the same promoter are known to cause gene silencing resulting in less efficacious transgenic products in the field.
  • Excess of transcription factor (TF)- binding sites due to promoter repetition can cause depletion of endogenous TFs leading to transcriptional inactivation.
  • the silencing of transgenes is likely to undesirably affect performance of a transgenic plant produced to express transgenes. Repetitive sequences within a transgene may lead to gene intra locus homologous recombination resulting in polynucleotide rearrangements.
  • tissue-specific, or organ- specific promoters drive gene expression in certain tissues such as in the kernel, root, leaf, callus, pollen, or tapetum of the plant.
  • Tissue and developmental- stage specific promoters drive the expression of genes, which are expressed in particular tissues or at particular time periods during plant development.
  • Tissue- specific promoters are required for certain applications in the transgenic plant industry and are desirable as they permit specific expression of heterologous genes in a tissue and/or in a selected developmental stages, indicating expression of the heterologous gene differentially in various organs, tissues, and/or at different times, but not others.
  • increased resistance of a plant to infection by soil-borne pathogens might be accomplished by transforming the plant genome with a pathogen-resistance gene such that a pathogen-resistance protein is robustly expressed within the plant.
  • a pathogen-resistance gene such that a pathogen-resistance protein is robustly expressed within the plant.
  • tissue-specific promoters such that the promoters would confine the expression of the transgenes encoding an agronomic trait in developing plant parts (i.e., roots, leaves, calli, or pollen).
  • the promoters described herein are promising tools for making commercial transgene constructs containing multiple genes. These promoters also provide structural stability in bacterial hosts and functional stability in plant cells, such as reducing transgene silencing, to enable transgene expression. Promoters with varying expression ranges may also be obtained by employing the methods described herein. Compared to transgene constructs using a single promoter multiple times, the diversified promoter constructs described in this application are more compatible for downstream molecular analyses of transgenic events. Use of the diversified promoters described herein may also alleviate rearrangements in transgenic multigene loci during targeting with zinc finger technology (SHUKLA et al. 2009).
  • the Zea mays Ubi- 1 promoter has been a biotech industry standard, predominantly used for stable, high transgenic expression in maize (CH ISTENSEN and QUAIL 1996; CHRISTENSEN et al. 1992; TOKI et al. 1992). Each transgene usually requires a specific promoter for sufficient expression. Multiple promoters are typically required to express different transgenes within one gene stack. This paradigm frequently leads to the repetitive use of the Z. mays Ubi- 1 promoter due to its desired high levels of protein expression and constitutive expression pattern.
  • Transcription initiation and modulation of gene expression in plant genes is directed by a variety of DNA sequence elements collectively arranged in a larger sequence called a promoter.
  • Eukaryotic promoters typically consist of a minimal core promoter and upstream regulatory sequences.
  • the core promoter is a minimal stretch of contiguous DNA sequence that is sufficient to direct accurate initiation of transcription.
  • Core promoters in plants generally comprise canonical regions associated with the initiation of transcription, such as CAAT and TATA boxes (consensus sequence TAT AW AW).
  • the TATA box element is usually located approximately 20 to 35 base pairs (bp) upstream of the transcription start site (TSS).
  • TTS transcription start site
  • the activation of the core promoter is accomplished by upstream regulatory sequences to which various proteins bind and subsequently interact with the transcription initiation complex to activate gene expression.
  • These regulatory elements comprise DNA sequences which determine the spatio-temporal expression pattern of a promoter.
  • the Z. mays Ubi-1 gene promoter is derived from the Z. mays inbred cell line B73.
  • the Z. mays Ubi-1 promoter is comprised of approximately 895bp of DNA sequence located 5' upstream of the TSS (i.e., the Upstream Element).
  • the Z. mays Ubi-1 promoter is comprised of about 1093bp of DNA sequence located 3' downstream of the TSS (see U.S. Patent No. 5,510,474).
  • the Z. mays Ubi-1 promoter is comprised of approximately 2 Kilo base pairs (kb) of total DNA sequence.
  • the Upstream Element of the Z. mays Ubi-1 promoter comprises a TATA box located approximately 30bp 5' upstream of the TSS (FIGS. 1 and 3).
  • the Upstream Element comprises two overlapping heat shock consensus elements located immediately 5' upstream of the TSS.
  • An 82bp 5'-UTR or leader sequence is located immediately 3' downstream of the TSS and is followed by an intron that extends from base 83 to 1093 (FIGS. 1 and 3).
  • this application describes a novel maize Ubi-1 promoter. Unlike the control Ubi-1 promoter derived from Z. mays genotype c.v. B73, the novel Ubi-1 promoter was derived from Z. mays genotype c.v. LLN37. Provided are constructs and methods using a Z. mays Ubi-1 promoter comprising a polynucleotide sequence. In an embodiment, a promoter may comprise a polynucleotide sequence from Z. mays c.v. B73 Ubi-1 gene as follows:
  • a promoter may comprise a polynucleotide sequence from Z. mays c.v.
  • a constitutive Z. mays Ubi-1 promoter comprising polynucleotide sequences of an upstream-promoter region, 5- UTR or leader region, and an intron to express transgenes in plants.
  • a promoter may comprise an upstream-promoter polynucleotide sequence from Z. mays c.v. B73 Ubi-1 gene as follows: GTGCAGCGTGACCCGGTCGTGCCCCTCTCTAGAGATAATGAGCATTGCATGTC
  • a promoter may comprise an upstream-promoter polynucleotide sequence from Z mays c.v. LLN37 Ubi-1 gene as follows:
  • Transgene expression may also be regulated by a 5' -UTR and/or intron region located 3' downstream of the upstream-promoter sequence.
  • a promoter comprising an up stream-promoter region operably linked to a 5'-UTR and/or intron can regulate transgene expression. While an upstream-promoter is necessary to drive transcription, the presence of a 5' -UTR and/or intron can increase expression levels resulting in the production of more mRNA transcripts for translation and protein synthesis. Addition of a 5'-UTR and/or intron to an upstream-promoter polynucleotide sequence can aid stable expression of a transgene.
  • a constitutive promoter comprising a upstream-promoter polynucleotide sequence may be followed by a 5-UTR or leader region to aid in the expression of transgenes in plants.
  • a promoter may comprise a 5' -UTR or leader polynucleotide sequence from Z. mays c.v. B73 Ubi-1 gene as follows:
  • a promoter may comprise a 5' -UTR or leader polynucleotide sequence from Z. mays c.v. LLN37 Ubi-1 gene as follows:
  • a constitutive promoter comprising an upstream-promoter polynucleotide sequence followed by a 5-UTR or leader region may also be followed by an intron to aid in expression of transgenes in plants.
  • a promoter may comprise an intronic polynucleotide sequence from Z. mays c.v. B73 Ubi-1 gene as follows:
  • a promoter may comprise an intronic polynucleotide sequence from Z mays c.v. LLN37 Ubi-1 gene as follows:
  • Transgene expression may also be regulated by a gene expression cassette.
  • a gene expression cassette comprises a promoter. In an embodiment, a gene expression cassette comprises an Ubi-1 promoter. In an embodiment, a gene expression cassette comprises an Ubi-1 promoter from a plant. In an embodiment, a gene expression cassette comprises an Ubi-1 promoter from Z. mays c.v. LLN37.
  • a gene expression cassette comprises a Z. mays c.v. LLN37 Ubi-1 promoter, wherein the promoter is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 100% identical to SEQ ID NO: 2.
  • a gene expression cassette comprises a constitutive promoter, such as the Z. mays c.v. LLN37 Ubi-1 promoter, that is operably linked to a reporter gene or a transgene.
  • a gene expression cassette comprises a constitutive promoter that is operably linked to a transgene, wherein the transgene may be an insecticidal resistance transgene, an herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, a DNA binding transgene, a selectable marker transgene, or combinations thereof.
  • a gene expression cassette comprising the constitutive promoter may drive expression of one or more transgenes or reporter genes.
  • a gene expression cassette comprising the constitutive promoter may drive expression of two or more transgenes or reporter genes.
  • a gene expression cassette comprises a Z. mays c.v. LLN37 Ubi-1 promoter, wherein the upstream-promoter sequence is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 100% identical to SEQ ID NO: 4.
  • a gene expression cassette comprises a constitutive promoter, such as the Z. mays c.v. LLN37 Ubi-1 upstream-promoter, that is operably linked to a reporter gene or a transgene.
  • a gene expression cassette comprises a constitutive upstream-promoter that is operably linked to a transgene, wherein the transgene may be an insecticidal resistance transgene, an herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, a DNA binding transgene, a selectable marker transgene, or
  • a gene expression cassette comprising the constitutive upstream-promoter may drive expression of one or more transgenes or reporter genes. In an embodiment, a gene expression cassette comprising the constitutive upstream-promoter may drive expression of two or more transgenes or reporter genes.
  • the upstream- promoter may comprise an intron. In an embodiment the upstream-promoter may comprise an intron sequence that is operably linked to a reporter gene or transgene. In another embodiment the upstream-promoter may comprise a 5'-UTR or leader sequence. In an embodiment the upstream- promoter may comprise a 5'-UTR or leader sequence that is operably linked to a reporter gene or transgene.
  • the upstream-promoter may comprise a 5'-UTR or leader sequence and an intron sequence.
  • the upstream-promoter may comprise a 5'- UTR or leader sequence and an intron sequence that are operably linked to a reporter gene or transgene.
  • a gene expression cassette comprises a Z. mays c.v. LLN37 Ubi-1 promoter, wherein the 5'-UTR or leader sequence is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 100% identical to SEQ ID NO: 6.
  • a gene expression cassette comprises a 5'-UTR or leader from a maize gene encoding an Ubiquitin-1 protein that is operably linked to a promoter, wherein the promoter is a Z. mays c.v. LLN37 Ubi-1 promoter, or a promoter that originates from a plant (e.g., Zea mays Ubiquitin-1 promoter), a virus (e.g., Cassava vein mosaic virus promoter), or a bacteria (e.g., Agwbacterium tumefaciens delta mas).
  • a gene expression cassette comprises a Z. mays c.v.
  • transgene can be an insecticidal resistance transgene, an herbicide tolerance transgene, a nitrogen use efficiency transgene, a water us efficiency transgene, a nutritional quality transgene, a DNA binding transgene, a selectable marker transgene, or combinations thereof.
  • a gene expression cassette comprises a Z. mays c.v. LLN37 Ubi-1 promoter, wherein the intronic sequence is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 100% identical to SEQ ID NO: 8.
  • a gene expression cassette comprises an intron from a maize gene encoding an Ubiquitin-1 protein that is operably linked to a promoter, wherein the promoter is a Z. mays c.v.
  • LLN37 Ubi-1 promoter or a promoter that originates from a plant (e.g., Zea mays Ubiquitin-1 promoter), a virus (e.g., Cassava vein mosaic virus promoter) or a bacteria (e.g., Agrobacterium tumefaciens delta mas).
  • a promoter that originates from a plant e.g., Zea mays Ubiquitin-1 promoter
  • a virus e.g., Cassava vein mosaic virus promoter
  • bacteria e.g., Agrobacterium tumefaciens delta mas
  • a gene expression cassette comprises an intron from a maize gene encoding an Ubiquitin protein that is operably linked to a transgene, wherein the transgene can be an insecticidal resistance transgene, an herbicide tolerance transgene, a nitrogen use efficiency transgene, a water us efficiency transgene, a nutritional quality transgene, a DNA binding transgene, a selectable marker transgene, or combinations thereof.
  • a vector may comprise a gene expression cassette as described herein.
  • a vector may be a plasmid, a cosmid, a bacterial artificial chromosome (BAC), a bacteriophage, a virus, or an excised polynucleotide fragment for us in direct transformation or gene targeting, such as a donor DNA.
  • BAC bacterial artificial chromosome
  • a cell or plant comprises a gene expression cassette as described herein.
  • a cell or plant comprises a vector comprising a gene expression cassette as disclosed in this application.
  • a vector may be a plasmid, a cosmid, a bacterial artificial chromosome (BAC), a bacteriophage, or a virus.
  • BAC bacterial artificial chromosome
  • a cell or plant comprising a gene expression cassette is a transgenic cell or a transgenic plant, respectively.
  • a transgenic plant may be a monocotyledonous or a dicotyledonous plant.
  • An embodiment of a transgenic monocotyledonous plant may be, but is not limited to maize, wheat, rice, sorghum, oats, rye, bananas, sugar cane, and millet.
  • An embodiment of a transgenic dicotyledonous plant may be, but is not limited to soybean, cotton, sunflower, or canola.
  • An embodiment also includes a transgenic seed from a transgenic plant, as described herein.
  • selectable markers also described as reporter genes, may be incorporated into a chosen expression vector to allow for identification and selection of transformed plants
  • transformants Many methods are available to confirm expression of selectable markers in transformed plants, including, for example, DNA sequencing and Polymerase Chain Reaction (PCR), Southern blotting, RNA blotting, immunological methods for detection of a protein expressed from the vector, such as, precipitated protein that mediates phosphinothricin resistance, or visual observation of other proteins such as reporter genes encoding ⁇ -Glucuronidase (GUS), Luciferase, Green Fluorescent Protein (GFP), Yellow Fluorescent Protein (YFP), DsRed, ⁇ - galactosidase, Chloramphenicol Acetyltransferase (CAT), alkaline phosphatase, and the like (See Sambrook, et al., Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor Press, N.Y., 2001, the content is incorporated herein by reference in its entirety).
  • GUS ⁇ -Glucuronidase
  • GFP Green Fluorescent Protein
  • YFP Yellow Fluorescent Protein
  • Selectable marker genes are utilized for selection of transformed cells or tissues.
  • Selectable marker genes include genes encoding antibiotic resistance, such as those encoding neomycin phosphotransferase II (NEO) and hygromycin phosphotransferase (HPT) as well as genes conferring resistance to herbicidal compounds.
  • Herbicide resistance genes generally code for a modified target protein insensitive to the herbicide or for an enzyme that degrades or detoxifies the herbicide in the plant before it can act. For example, resistance to glyphosate has been obtained by using genes coding for mutant target enzymes, 5-enolpyruvylshikimate-3- phosphate synthase (EPSPS). Genes and mutants for EPSPS are well known, and further described below.
  • herbicides may inhibit the growing point or meristem, including imidazolinone or sulfonylurea, and genes for resistance/tolerance of acetohydroxyacid synthase (AHAS) and acetolactate synthase (ALS).
  • Glyphosate resistance genes include mutant 5- enolpyruvylshikimate-3-phosphate synthase (EPSPs) and dgt-28 genes via the introduction of recombinant nucleic acids and/or various forms of in vivo mutagenesis of native EPSPs genes, aroA genes, and glyphosate acetyl transferase (GAT) genes, respectively.
  • Resistance genes for other phosphono compounds include BAR genes from Streptomyces species, including
  • Streptomyces hygroscopicus and Streptomyces viridichromo genes and pyridinoxy or phenoxy proprionic acids and cyclohexones (ACCase inhibitor-encoding genes).
  • Exemplary genes conferring resistance to cyclohexanediones and/or aryloxyphenoxypropanoic acid include genes of acetyl coenzyme A carboxylase (ACCase)— Accl -SI, Accl-S2 and Accl-S3.
  • herbicides can inhibit photosynthesis, including triazine (psbA and ls+ genes) or benzonitrile (nitrilase gene).
  • selectable marker genes include, but are not limited to genes encoding: neomycin phosphotransferase II; cyanamide hydratase; aspartate kinase; dihydrodipicolinate synthase; tryptophan decarboxylase; dihydrodipicolinate synthase and desensitized aspartate kinase; bar gene; tryptophan decarboxylase; neomycin phosphotransferase (NEO); hygromycin phosphotransferase (HPT or HYG); dihydrofolate reductase (DHFR); phosphinothricin acetyltransferase; 2,2-dichloropropionic acid dehalogenase; acetohydroxyacid synthase; 5- enolpyruvyl-shikimate-phosphate synthase (aroA); haloarylnitrilase; acetyl-coenzy
  • An embodiment also includes genes encoding resistance to: chloramphenicol;
  • methotrexate methotrexate
  • hygromycin spectinomycin
  • bromoxynil glyphosate
  • phosphinothricin methotrexate
  • selectable marker genes are not meant to be limiting. Any reporter or selectable marker gene is encompassed by the present invention.
  • Selectable marker genes are synthesized for optimal expression in plant.
  • a coding sequence of a gene has been modified by codon optimization to enhance expression in plants.
  • a selectable marker gene may be optimized for expression in a particular plant species or alternatively may be modified for optimal expression in dicotyledonous or monocotyledonous plants. Plant preferred codons may be determined from the codons of highest frequency in the proteins expressed in the largest amount in the particular plant species of interest.
  • a selectable marker gene is designed to be expressed in plants at a higher level resulting in higher transformation efficiency. Methods for plant optimization of genes are well known.
  • the disclosed methods and compositions may be used to express polynucleotide gene sequences within the plant genome. Accordingly, genes encoding herbicide tolerance, insect resistance, nutrients, antibiotics, or therapeutic molecules may be expressed by the novel promoter.
  • the constitutive promoter regulatory element of the subject disclosure is combined or operably linked with one or more genes encoding polynucleotide sequences that provide resistance or tolerance to glyphosate, 2, 4-D glufosinate, or another herbicide, provides resistance to select insects or diseases and/or nutritional enhancements, improved agronomic characteristics, proteins, or other products useful in feed, food, industrial, pharmaceutical or other uses.
  • the transgenes may be "stacked" with two or more nucleic acid sequences of interest within a plant genome.
  • Stacking may be accomplished, for example, via conventional plant breeding using two or more events, transformation of a plant with a construct which contains the sequences of interest, re-transformation of a transgenic plant, or addition of new traits through targeted integration via homologous recombination.
  • polynucleotide sequences of interest include, but are not limited to, those examples provided below:
  • a Plant Disease Resistance Genes Plant defenses are often activated by specific interaction between the product of a disease resistance gene (R) in the plant and the product of a corresponding avirulence (Avr) gene in the pathogen.
  • R disease resistance gene
  • Avr avirulence
  • a plant variety can be transformed with cloned resistance gene to engineer plants that are resistant to specific pathogen strains. Examples of such genes include, the tomato Cf-9 gene for resistance to Cladosporium fulvum (Jones et al., 1994 Science 266:789), tomato Pto gene, which encodes a protein kinase, for resistance to Pseudomonas syringae pv. tomato (Martin et al., 1993 Science 262: 1432), and Arabidopsis RSSP2 gene for resistance to Pseudomonas syringae (Mindrinos et al., 1994 Cell 78: 1089).
  • DNA molecules encoding ⁇ -endotoxin genes can be purchased from American Type Culture Collection (Rockville, Md.), under ATCC accession numbers 40098, 67136, 31995 and 31998.
  • a lectin such as, nucleotide sequences of several Clivia miniata mannose-binding lectin genes (Van Damme et al., 1994 Plant Molec. Biol. 24:825).
  • a vitamin binding protein such as avidin and avidin homologs which are useful as larvicides against insect pests. See U.S. Patent No. 5,659,026.
  • An enzyme inhibitor e.g., a protease inhibitor or an amylase inhibitor.
  • examples of such genes include a rice cysteine proteinase inhibitor (Abe et al., 1987 J. Biol. Chem.
  • G An insect-specific peptide or neuropeptide which, upon expression, disrupts the physiology of the affected pest (J. Biol. Chem. 269:9). Examples of such genes include an insect diuretic hormone receptor (Regan, 1994), an allostatin identified in Diploptera punctata (Pratt, 1989), and insect-specific, paralytic neurotoxins (U.S. Patent No. 5,266,361).
  • Examples of such genes include, a callas gene (PCT published application
  • chitinase-encoding sequences which can be obtained, for example, from the ATCC under accession numbers 3999637 and 67152
  • tobacco hookworm chitinase (Kramer et al., 1993 Insect Molec. Biol. 23:691)
  • parsley ubi4-2 polyUbiquitin gene (Kawalleck et al., 1993 Plant Molec. Biol. 21:673).
  • K A molecule that stimulates signal transduction.
  • Examples of such molecules include nucleotide sequences for mung bean calmodulin cDNA clones (Botella et al., 1994 Plant Molec. Biol. 24:757) and a nucleotide sequence of a maize calmodulin cDNA clone (Griess et al., 1994 Plant Physiol. 104: 1467).
  • M A membrane permease, a channel former or a channel blocker, such as a cecropin- ⁇ lytic peptide analog (Jaynes et al., 1993 Plant Sci. 89:43) which renders transgenic tobacco plants resistant to Pseudomonas solanacearum.
  • N A viral-invasive protein or a complex toxin derived therefrom.
  • the accumulation of viral coat proteins in transformed plant cells imparts resistance to viral infection and/or disease development effected by the virus from which the coat protein gene is derived, as well as by related viruses.
  • Coat protein-mediated resistance has been conferred upon transformed plants against alfalfa mosaic virus, cucumber mosaic virus, tobacco streak virus, potato virus X, potato virus Y, tobacco etch virus, tobacco rattle virus and tobacco mosaic virus. See, for example, Beachy et al. (1990) Ann. Rev. Phytopathol. 28:451.
  • R A developmental-arrestive protein produced in nature by a plant, such as the barley ribosome-inactivating gene that provides an increased resistance to fungal disease (Longemann et al., 1992). Bio/Technology 10:3305.
  • RNA interference in which an RNA molecule is used to inhibit expression of a target gene.
  • An RNA molecule in one example is partially or fully double stranded, which triggers a silencing response, resulting in cleavage of dsRNA into small interfering RNAs, which are then incorporated into a targeting complex that destroys homologous mRNAs. See, e.g., Fire et al., U.S. Patent No. 6,506,559; Graham et al, U.S. Patent No. 6,573,099.
  • A Genes encoding resistance or tolerance to a herbicide that inhibits the growing point or meristem, such as an imidazalinone, sulfonanilide or sulfonylurea herbicide.
  • a herbicide that inhibits the growing point or meristem
  • Exemplary genes in this category code for mutant acetolactate synthase (ALS) (Lee et al., 1988 EMBOJ. 7: 1241) also known as acetohydroxyacid synthase (AHAS) enzyme (Miki et al., 1990 Theor. Appl. Genet. 80:449).
  • aryloxyphenoxypropionic acids and cyclohexanediones ACCase inhibitor encoding genes. See, for example, U.S. Patent No. 4,940,835, which discloses the nucleotide sequence of a form of EPSP which can confer glyphosate resistance.
  • a DNA molecule encoding a mutant aroA gene can be obtained under ATCC Accession Number 39256, and the nucleotide sequence of the mutant gene is disclosed in U.S. Patent No. 4,769,061.
  • 4,975,374 disclose nucleotide sequences of glutamine synthetase genes which confer resistance to herbicides such as L-phosphinothricin.
  • the nucleotide sequence of a phosphinothricinacetyl-transferase gene is provided in European Patent Application No. 0 242 246.
  • De Greef et al. (1989) Bio/Technology 7:61 describes the production of transgenic plants that express chimeric bar genes coding for phosphinothricin acetyl transferase activity.
  • cyclohexanediones such as sethoxydim and haloxyfop
  • sethoxydim and haloxyfop are the Accl-Sl, Accl-S2 and Accl-S3 genes described by Marshall et al. (1992) Theor. Appl. Genet. 83:435.
  • C Genes encoding resistance or tolerance to a herbicide that inhibits photosynthesis, such as a triazine (psbA and gs+ genes) and a benzonitrile (nitrilase gene).
  • a herbicide that inhibits photosynthesis such as a triazine (psbA and gs+ genes) and a benzonitrile (nitrilase gene).
  • Przibilla et al. (1991) Plant Cell 3: 169 describe the use of plasmids encoding mutant psbA genes to transform
  • hydroxyphenylpyruvate dioxygenases HPPD
  • HPPD hydroxyphenylpyruvate dioxygenases
  • HPP para-hydroxyphenylpyruvate
  • a gene that produces an overabundance of HPPD in plants can provide tolerance or resistance to such herbicides, including, for example, genes described in U.S. Patent Nos. 6,268,549 and 6,245,968 and U.S. Patent Application Publication No. 2003/0066102.
  • E Genes encoding resistance or tolerance to phenoxy auxin herbicides, such as 2,4- dichlorophenoxyacetic acid (2,4-D) and which may also confer resistance or tolerance to aryloxyphenoxypropionate (AOPP) herbicides. Examples of such genes include the ⁇ - ketoglutarate-dependent dioxygenase enzyme (aad-1) gene, described in U.S. Patent No.
  • (F) Genes encoding resistance or tolerance to phenoxy auxin herbicides, such as 2,4- dichlorophenoxyacetic acid (2,4-D) and which may also confer resistance or tolerance to pyridyloxy auxin herbicides, such as fluroxypyr or triclopyr.
  • phenoxy auxin herbicides such as 2,4- dichlorophenoxyacetic acid (2,4-D)
  • pyridyloxy auxin herbicides such as fluroxypyr or triclopyr.
  • Examples of such genes include the a-ketoglutarate-dependent dioxygenase enzyme gene (aad-12), described in WO2007/053482 A2.
  • A Modified fatty acid metabolism, for example, by transforming maize or Brassica with an antisense gene or stearoyl-ACP desaturase to increase stearic acid content of the plant
  • a gene could be introduced that reduces phytate content. In maize, this, for example, could be accomplished by cloning and then reintroducing DNA associated with the single allele which is responsible for maize mutants characterized by low levels of phytic acid (Raboy et al., 1990 Maydica 35:383).
  • (C) Modified carbohydrate composition effected, for example, by transforming plants with a gene coding for an enzyme that alters the branching pattern of starch.
  • an enzyme that alters the branching pattern of starch.
  • examples of such enzymes include, Streptococcus mucus fructosyltransferase gene (Shiroza et al., 1988) J.
  • Bacteriol. 170:810 Bacillus subtilis levansucrase gene (Steinmetz et al., 1985 Mol. Gen. Genel. 200:220), Bacillus licheniformis a-amylase (Pen et al., 1992 Bio/Technology 10:292), tomato invertase genes (Elliot et al., 1993), barley amylase gene (Sogaard et al., 1993 J. Biol. Chem. 268:22480), and maize endosperm starch branching enzyme II (Fisher et al., 1993 Plant Physiol. 102: 10450).
  • Suitable methods for transformation of plants include any method where DNA may be introduced into a cell, for example and without limitation: electroporation ⁇ see, e.g., U.S. Patent No. 5,384,253); micro-projectile bombardment ⁇ see, e.g., U.S. Patent Nos. 5,015,580; 5,550,318;
  • a DNA construct may be introduced directly into the genomic DNA of the plant cell using techniques such as agitation with silicon carbide fibers ⁇ See, e.g., U.S. Patent Nos.
  • DNA constructs may be introduced directly into plant tissue using biolistic methods, such as DNA particle bombardment (see, e.g., Klein et al., (1987) Nature 327:70-73).
  • DNA constructs may be introduced into the plant cell via nanoparticle transformation (see, e.g., U.S. Patent Publication No. 2009/0104700, incorporated herein by reference in its entirety).
  • gene transfer may be achieved using non-Agrobacterium bacteria or viruses, such as Rhizobium sp. NGR234, Sinorhizoboium meliloti, Mesorhizobium loti, potato virus X, cauliflower mosaic virus, cassava vein mosaic virus, and/or tobacco mosaic virus, see, e.g., Chung et al. (2006) Trends Plant Sci. 11(1): 1-4.
  • non-Agrobacterium bacteria or viruses such as Rhizobium sp. NGR234, Sinorhizoboium meliloti, Mesorhizobium loti, potato virus X, cauliflower mosaic virus, cassava vein mosaic virus, and/or tobacco mosaic virus, see, e.g., Chung et al. (2006) Trends Plant Sci. 11(1): 1-4.
  • a transformed cell After effecting delivery of an exogenous nucleic acid to a recipient cell, a transformed cell is generally identified for further culturing and plant regeneration. In order to improve the ability to identify transformants, one may desire to employ a selectable marker gene with the transformation vector used to generate the transformant. In an illustrative embodiment, a transformed cell population may be assayed by exposing the cells to a selective agent or agents, or the cells may be screened for the desired marker gene trait.
  • Cells that survive exposure to a selective agent, or cells that have been scored positive in a screening assay may be cultured in media that supports regeneration of plants.
  • any suitable plant tissue culture media may be modified by including further substances, such as growth regulators. Plant tissues may be maintained on a basic media with growth regulators until sufficient tissue is available to begin plant regeneration efforts. Alternatively, following repeated rounds of manual selection, until the morphology of the tissue is suitable for regeneration (e.g., at least 2 weeks), the tissue may then be transferred to media conducive to shoot formation. Cultures are transferred periodically until sufficient shoot formation has occurred. Once shoots are formed, they are transferred to media conducive to root formation. Once sufficient roots are formed, plants may be transferred to soil for further growth and maturity.
  • Such assays may include: molecular biological assays, such as Southern and Northern blotting and PCR; biochemical assays, such as detecting the presence of a protein product by immunological means, such as, ELISA, western blots, and/or LC-MS MS spectrophotometry) or by enzymatic function, such as, by plant part assays, such as leaf, callus, or pollen assays; and/or analysis of the phenotype of the whole regenerated plant.
  • molecular biological assays such as Southern and Northern blotting and PCR
  • biochemical assays such as detecting the presence of a protein product by immunological means, such as, ELISA, western blots, and/or LC-MS MS spectrophotometry
  • enzymatic function such as, by plant part assays, such as leaf, callus, or pollen assays
  • Transgenic events may be screened, for example, by PCR amplification using
  • PCR genotyping is understood to include, but not be limited to, PCR amplification of genomic DNA derived from isolated and/or purified host plant tissue predicted to contain a nucleic acid molecule of interest integrated into the genome, followed by standard cloning, and sequence analysis of PCR
  • PCR genotyping have been well described (see, e.g., Rios et al. (2002) Plant J. 32:243-53) and may be applied to genomic DNA derived from any plant species or tissue type, including cell cultures.
  • oligonucleotide primers that bind to both target sequence and introduced sequence may be used sequentially or multiplexed in PCR amplification reactions. Oligonucleotide primers designed to anneal to the target site, introduced nucleic acid sequences, and/or combinations of the two types of nucleic acid sequences may be produced.
  • PCR genotyping strategies may include, for example and without limitation: amplification of specific sequences in the plant genome; amplification of multiple specific sequences in the plant genome; amplification of nonspecific sequences in the plant genome; and combinations of any of the foregoing.
  • One skilled in the art may devise additional combinations of primers and amplification reactions to interrogate the genome.
  • a set of forward and reverse oligonucleotide primers may be designed to anneal to nucleic acid sequence(s) specific for the target outside the boundaries of the introduced nucleic acid sequence.
  • Forward and reverse oligonucleotide primers may be designed to anneal specifically to an introduced nucleic acid molecule, for example, at a sequence corresponding to a coding region within a nucleotide sequence of interest comprised therein, or other parts of the nucleic acid molecule. Primers may be used in conjunction with primers described herein. Oligonucleotide primers may be synthesized according to a desired sequence and are commercially available (e.g., from Integrated DNA Technologies, Inc., Coralville, IA). Amplification may be followed by cloning and sequencing, or by direct sequence analysis of amplification products. In an
  • oligonucleotide primers specific for the gene target are employed in PCR
  • a method of expressing at least one transgene in a plant comprises growing a plant comprising a Z. mays c.v. LLN37 Ubi-1 promoter (SEQ ID NO: 2) operably linked to at least one transgene.
  • a method of expressing at least one transgene in a plant tissue or plant cell comprises culturing a plant tissue or plant cell comprising a Z. mays c.v. LLN37 Ubi-1 promoter (SEQ ID NO: 2) operably linked to at least one transgene.
  • a method of expressing at least one transgene in a plant comprises growing a plant comprising a gene expression cassette comprising a Z. mays c.v. LLN37 Ubi-1 promoter (SEQ ID NO: 2) operably linked to at least one transgene.
  • a method of expressing at least one transgene in a plant tissue or plant cell comprises culturing a plant tissue or plant cell comprising a gene expression cassette comprising a Z. mays c.v. LLN37 Ubi- 1 promoter (SEQ ID NO: 2) operably linked to at least one transgene.
  • a plant, plant tissue, or plant cell comprises a gene expression cassette comprising a Z. mays c.v.
  • LLN37 Ubi-1 promoter (SEQ ID NO: 2) operably linked to a transgene.
  • the Z. mays c.v. LLN37 Ubi-1 promoter (SEQ ID NO: 2) is comprised of an upstream- promoter (SEQ ID NO: 4), 5'-UTR (SEQ ID NO: 6), and an intron (SEQ ID NO: 8).
  • a plant, plant tissue, or plant cell comprises a gene expression cassette comprising a Z. mays c.v. LLN37 Ubi-1 up stream-promoter (SEQ ID NO: 4), 5'-UTR (SEQ ID NO: 6), and an intron (SEQ ID NO: 8).
  • a plant, plant tissue, or plant cell comprises a gene expression cassette comprising a Z. mays c.v. LLN37 Ubi-1 upstream-promoter (SEQ ID NO: 4), 5'-UTR (SEQ ID NO: 6), and an intron (SEQ ID NO: 8) of a Z. mays c.v. LLN37 Ubi-1 gene.
  • a plant, plant tissue, or plant cell comprises a gene expression cassette comprising a Z. mays c.v. LLN37 Ubi-1 upstream-promoter (SEQ ID NO: 4), 5'-UTR (SEQ ID NO: 6), and an intron (SEQ ID NO: 8) of a Z. mays c.v. LLN37 Ubi-1 gene.
  • a plant, plant tissue, or plant cell comprises a Z. mays c.v. LLN37 Ubi-1 promoter.
  • a Z. mays c.v. LLN37 Ubi-1 promoter may be SEQ ID NO: 2.
  • a plant, plant tissue, or plant cell comprises a gene expression cassette comprising a promoter, wherein the promoter is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 100% identical to SEQ ID NO: 2.
  • a plant, plant tissue, or plant cell comprises a gene expression cassette comprising a Z. mays c.v.
  • a plant, plant tissue, or plant cell comprises a gene expression cassette comprising a Z. mays c.v. LLN37 Ubi-1 promoter that is operably linked to a transgene, wherein the transgene can be an insecticidal resistance transgene, an herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, a DNA binding transgene, a selectable marker transgene, or combinations thereof.
  • a plant, plant tissue, or plant cell comprises a Z. mays c.v. LLN37 Ubi-1 upstream-promoter.
  • a Z. mays c.v. LLN37 Ubi-1 upstream-promoter may be SEQ ID NO: 4.
  • a plant, plant tissue, or plant cell comprises a gene expression cassette comprising an upstream-promoter, wherein the upstream-promoter is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 100% identical to SEQ ID NO: 4.
  • a plant, plant tissue, or plant cell comprises a gene expression cassette comprising a Z. mays c.v. LLN37 Ubi-1 upstream-promoter that is operably linked to a transgene.
  • a plant, plant tissue, or plant cell comprises a gene expression cassette comprising a Z mays c.v.
  • LLN37 Ubi-1 up stream-promoter that is operably linked to a transgene, wherein the transgene can be an insecticidal resistance transgene, an herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, a DNA binding transgene, a selectable marker transgene, or combinations thereof.
  • the transgene can be an insecticidal resistance transgene, an herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, a DNA binding transgene, a selectable marker transgene, or combinations thereof.
  • a plant, plant tissue, or plant cell comprises a Z. mays c.v. LLN37 Ubi-1 5'-UTR or leader sequence.
  • a Z. mays c.v. LLN37 Ubi-1 5'-UTR or leader sequence may be a polynucleotide of SEQ ID NO: 6.
  • a plant, plant tissue, or plant cell comprises a gene expression cassette comprising a 5' -UTR or leader sequence, wherein the 5'-UTR or leader sequence is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 100% identical to SEQ ID NO: 6.
  • a gene expression cassette comprises a Z. mays c.v.
  • LLN37 Ubi-1 5' -UTR or leader that is operably linked to a promoter
  • the promoter is an Ubiquitin promoter, or a promoter that originates from a plant (e.g., Zea mays Ubiquitin- 1 promoter), a virus (e.g., Cassava vein mosaic virus promoter) or a bacteria (e.g., Agwbacterium tumefaciens delta mas).
  • a plant, plant tissue, or plant cell comprises a gene expression cassette comprising a Z. mays c.v. LLN37 Ubi-1 5'-UTR or leader that is operably linked to a transgene.
  • a plant, plant tissue, or plant cell comprising a gene expression cassette comprising a Z. mays c.v. LLN37 Ubi-1 5' -UTR or leader that is operably linked to a transgene, wherein the transgene can be an insecticidal resistance transgene, an herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, a DNA binding transgene, a selectable marker transgene, or combinations thereof.
  • the transgene can be an insecticidal resistance transgene, an herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, a DNA binding transgene, a selectable marker transgene, or combinations thereof.
  • a plant, plant tissue, or plant cell comprises an Ubi-1 intron.
  • a plant, plant tissue, or plant cell comprises a Z. mays c.v. LLN37 Ubi-1 intron.
  • a Z. mays c.v. LLN37 Ubi-1 intron may be a polynucleotide of SEQ ID NO: 8.
  • a plant, plant tissue, or plant cell comprises a gene expression cassette comprising an intron , wherein the intron is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 100% identical to SEQ ID NO: 8.
  • a gene expression cassette comprises a Z. mays c.v. LLN37 Ubi-1 intron that is operably linked to a promoter, wherein the promoter is an Ubiquitin promoter, or a promoter that originates from a plant (e.g., Zea mays Ubiquitin- 1 promoter), a virus (e.g., Cassava vein mosaic virus promoter) or a bacteria (e.g., Agwbacterium tumefaciens delta mas).
  • a plant, plant tissue, or plant cell comprises a gene expression cassette comprising a Z. mays c.v. LLN37 Ubi-1 intron that is operably linked to a transgene.
  • a plant, plant tissue, or plant cell comprising a gene expression cassette comprising a Z. mays c.v. LLN37 Ubi-1 intron that is operably linked to a transgene, wherein the transgene can be an insecticidal resistance transgene, an herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, a DNA binding transgene, a selectable marker transgene, or combinations thereof.
  • the transgene can be an insecticidal resistance transgene, an herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, a DNA binding transgene, a selectable marker transgene, or combinations thereof.
  • a plant, plant tissue, or plant cell comprises a gene expression cassette comprising a Z. mays c.v. LLN37 Ubi-1 up stream-promoter, Ubi-1 intron, and an Ubi-1 5'-UTR that are operably linked to a transgene.
  • the Z. mays c.v. LLN37 Ubi-1 promoter, Ubi-1 intron, and Ubi- 1 5' -UTR can be operably linked to different transgenes within a gene expression cassette when a gene expression cassette includes two or more transgenes.
  • a gene expression cassette comprises a Z. mays c.v.
  • LLN37 Ubi-1 promoter that is operably linked to a transgene, wherein the transgene can be an insecticidal resistance transgene, an herbicide tolerance transgene, a nitrogen use efficiency transgene, a water us efficiency transgene, a nutritional quality transgene, a DNA binding transgene, a selectable marker transgene, or combinations thereof.
  • a gene expression cassette comprises a Z. mays c.v.
  • LLN37 Ubi-1 intron that is operably linked to a transgene, wherein the transgene can be an insecticidal resistance transgene, an herbicide tolerance transgene, a nitrogen use efficiency transgene, a water us efficiency transgene, a nutritional quality transgene, a DNA binding transgene, a selectable marker transgene, or combinations thereof.
  • a gene expression cassette comprises a Z. mays c.v.
  • LLN37 Ubi-1 intron that is operably linked to a promoter, wherein the promoter is an Ubiquitin promoter, or a promoter that originates from a plant (e.g., Zea mays Ubiquitin- 1 promoter), a virus (e.g., Cassava vein mosaic virus promoter) or a bacterium (e.g., Agrobacterium tumefaciens delta mas).
  • a gene expression cassette comprises a Z. mays c.v.
  • transgene can be an insecticidal resistance transgene, an herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, a DNA binding transgene, a selectable marker transgene, or combinations thereof.
  • a plant, plant tissue, or plant cell comprises a vector comprising a constitutive gene promoter regulatory element as disclosed herein.
  • a plant, plant tissue, or plant cell comprises a vector comprising a constitutive gene promoter regulatory element, as disclosed herein, operably linked to a transgene.
  • a plant, plant tissue, or plant cell comprises a vector comprising a gene expression cassette, as disclosed herein.
  • a vector may be a plasmid, a cosmid, a bacterial artificial chromosome (BAC), a bacteriophage, or a virus fragment.
  • a plant, plant tissue, or plant cell may be monocotyledonous.
  • the monocotyledonous plant, plant tissue, or plant cell may be, but is not limited to corn, rice, wheat, sugarcane, barley, rye, sorghum, orchids, bamboo, banana, cattails, lilies, oat, onion, millet, and triticale.
  • a plant, plant tissue, or plant cell, according to the methods disclosed herein may be dicotyledonous.
  • dicotyledonous plant, plant tissue, or plant cell may be, but is not limited to rapeseed, canola, Indian mustard, Ethiopian mustard, soybean, sunflower, and cotton.
  • a transformed plant cell, root, leaf, callus, pollen, tissue, or plant may be identified and isolated by selecting or screening the engineered plant material for traits encoded by the marker genes present on the transforming DNA. For example, selection may be performed by growing the engineered plant material on media containing an inhibitory amount of an antibiotic or herbicide to which the transforming gene construct confers resistance. Further, transformed cells may also be identified by screening for the activities of any visible marker genes (e.g., the YFP, GFP, ⁇ -glucuronidase, Luciferase, B or CI genes) that may be present on the recombinant nucleic acid constructs. Such selection and screening methodologies are well known to those of ordinary skill in the art.
  • any visible marker genes e.g., the YFP, GFP, ⁇ -glucuronidase, Luciferase, B or CI genes
  • Physical and biochemical methods also may be used to identify plant or plant cell transformants containing inserted gene constructs. These methods include, but are not limited to: 1) Southern analysis or PCR amplification for detecting and determining the structure of the recombinant DNA insert; 2) Northern blot, S 1 RNase protection, primer-extension, or reverse transcriptase-PCR amplification for detecting and examining RNA transcripts of the gene constructs; 3) enzymatic assays for detecting enzyme or ribozyme activity, where such gene products are encoded by the gene construct; 4) next generation sequencing (NGS) analysis; or 5) protein gel electrophoresis, western blot techniques, immunoprecipitation, or enzyme-linked immunosorbent assay (ELISA), where the gene construct products are proteins.
  • RNA e.g., mRNA
  • mRNA messenger RNA
  • Other methods of measuring gene and/or encoded polypeptide activity may be used. Different types of enzymatic assays may be used, depending on the substrate used and the method of detecting the increase or decrease of a reaction product or by-product.
  • the levels of polypeptide expressed may be measured
  • the transgene may also be selectively expressed in some cell types or tissues of the plant or at some developmental stages.
  • the transgene may also be substantially expressed in all plant tissues and along its entire life cycle. However, any combinatorial expression mode is also applicable.
  • the present disclosure also encompasses seeds of the transgenic plants described above, wherein the seed comprises the reporter gene, transgene, or gene expression cassette.
  • the present disclosure further encompasses the progeny, clones, cell lines, or cells of the transgenic plants described above, wherein said progeny, clone, cell line, or cell comprises the reporter gene, transgene, or gene construct.
  • a novel promoter sequence from the Ubi-1 gene of Zea mays c.v. LLN37 was amplified using Polymerase Chain Reaction (PCR). Oligonucleotides (Table 1) designed to amplify the novel promoter, Z. mays c.v. LLN37, were derived from conserved regions of the Z. mays c.v. B73 Ubi- 1 promoter sequence, which served as the control. A PCR product was obtained from Z. mays c.v. LLN37 and was characterized.
  • the PCR product comprising the novel promoter was cloned into TopoTM vectors using Invitrogen Zero Blunt® TOPO® PCR Cloning Kit according to manufacturer' s instructions.
  • a vector map showing the cloned plasmid comprising the novel promoter PCR product is provided. Plasmid pDAB 105712 corresponds to Z. mays c.v. LLN37 (FIG. 2).
  • the promoter insert containing the PCR product was sequenced using methods known to those skilled in the art.
  • the promoter polynucleotide sequences of Z. mays c.v. LLN37 (FIG. 4) was computationally aligned and subsequently analyzed for sequence homology to the Z. mays c.v. B73 Ubi- 1 control sequence (FIG. 3).
  • Example 2 Novel Promoter Characterization
  • Sequence homology analysis (FIGS. 3-7), including sequence alignment and comparison to the Z. mays c.v. B73 Ubi-1 control sequence (SEQ ID NO: 1; FIG. 3) revealed a novel Ubi-1 promoter for further characterization. It was also observed that the new Ubi-1 promoter sequence, obtained from Z. mays c.v. LLN37 (SEQ ID NO: 2; FIG. 4), comprised polynucleotide sequences of three distinct regions; 1) an upstream-promoter region (SEQ ID NO: 4), 2) a 5'- UTR (SEQ ID NO: 6), and 3) an intron (SEQ ID NO: 8).
  • the promoter regions and specific promoter elements from Z. mays c.v.
  • LLN37 were analyzed for sequence homology to the Z. mays c.v. B73 Ubi-1 control sequence (FIGS. 5-7). More specifically, sequence alignment was performed to independently compare the upstream-promoter, 5' -UTR, and intronic regions, as well as the TATA Box and Heat Shock Element (HSE) regulatory elements of the Z. mays c.v. LLN37 promoter to the corresponding regions of the Z. mays c.v. B73 Ubi-1 control sequence (FIGS. 5-7, Table 2).
  • HSE TATA Box and Heat Shock Element
  • FIG. 5 shows the sequence alignment of the upstream-promoter regions of the Z. mays c.v. LLN37 promoter compared to the upstream-promoter region of the Z. mays c.v. B73 Ubi-1 control promoter sequence.
  • FIG. 6 shows the sequence alignment of the 5'-UTR or leader sequence of the Z. mays c.v. LLN37 promoter compared to the 5' -UTR or leader sequence of the Z. mays c.v. B73 Ubi-1 control promoter sequence.
  • FIG. 7 shows the sequence alignment of the intronic regions of the Z. mays c.v. LLN37 promoter compared to the intronic sequence of the Z. mays c.v. B73 Ubi-1 control promoter sequence.
  • the promoter elements obtained from Z. mays c.v. LLN37 showed 99.5% overall sequence identity (Table 2) to the Z. mays c.v. B73 Ubi-1 sequence. Characterization of the novel promoter sequence from Z. mays c.v. LLN37 confirmed that most of the promoter regulatory elements (i.e., a TATA box or Heat Shock Element) typically found in a functional promoter, were also highly conserved within the core promoter regions of the Z. mays c.v.
  • FIG. 5 shows a highly conserved TATA box (base pairs 869-876 shown in italics and underlined) that was identified and found to be located approximately 50bp 5' upstream of the TSS in the upstream-promoter region of the novel Z. mays c.v. LLN37 Ubi-1 promoter.
  • FIG. 5 shows two overlapping Heat Shock Element (HSE) sequences (base pairs 457-481 shown as underlined and 482-500 shown in double underlined, respectively) were conserved in the novel Z. mays c.v. LLN37 Ubi-1 promoter analyzed in this study and were located approximately 200bp 5' upstream of the TSS.
  • HSE Heat Shock Element
  • a lObp promoter regulatory element located in the upstream-promoter region of the Z. mays c.v. LLN37 Ubi-1 promoter (base pairs 90-100 shown underlined) was 100% identical to the same element found in the Z. mays c.v. B73 Ubi-1 upstream-promoter region (FIG. 5).
  • regulatory motifs exist in the Z. mays Ubi-1 upstream-promoter region that extends 100-200bp 5' upstream of the TSS. These motifs bind transcription factors that interact with the transcriptional initiation complex and facilitate its assembly, improve its stability, or increase the efficiency of promoter escape once the transcriptional machinery sets off (PE EMA TI et al. 2010). Thus, deletions, substitutions, and mismatches within this regulatory region could potentially affect both promoter strength and specificity.
  • the Z. mays promoters comprising the upstream-promoter, 5'-UTR, and intronic regions, as previously described, were extracted from the Ubi-1 gene of the Z. mays species and the PCR amplicons were gel purified using QIAquick Gel Extraction Kit® (Qiagen Carlsbad, CA).
  • the promoter polynucleotide sequence was then cloned into a Gateway Entry Vector® (Invitrogen) using standard cloning techniques known in the art.
  • the resulting Gateway Entry Vector® comprising the Ubi-1 promoter sequence for Z. mays c.v. LLN37 was confirmed via restriction digest and sequencing.
  • a control entry vector comprising the Z. mays c.v. B73 Ubi-1 promoter sequence was also cloned into a gateway entry vector using standard cloning techniques in the art.
  • the entry vector also comprised the yellow fluorescent protein reporter gene from the Phialidium species (P/u ' YFP; Shagin, D. A., (2004) Mol Biol Evol. 21;841-50) with an ST-LS1 intron incorporated into the sequence (Vancanneyt, G., (1990) Mol Gen Genet. 220;245-50) and the 3'-UTR region of the Zea mays Peroxidase 5 gene (ZmPer5; U.S. Patent No. 6,699,984).
  • Vector maps showing the cloned entry vectors comprising each of the promoter sequences are provided.
  • Construct pDAB 105742 corresponds to the control entry vector comprising the Z.
  • Construct pDAB 105741 corresponds to the entry vector comprising Z. mays Ubi-1 LLN37 promoter sequence.
  • entry vectors comprising gene expression cassettes comprising a Z. mays Ubi-1 promoter, the PhiYFP gene, and the ZmPer5 3' -UTR were established.
  • a binary expression vector construct comprising the PhiYFP reporter gene driven by the new promoter sequence and terminated by the ZmPer5 3' -UTR, was constructed. Transformation or expression vectors for Agrobacterium-mediated maize embryo transformation were constructed through the use of standard cloning methods and Gateway® recombination reactions employing a standard destination binary vector, pDAB101917, and the entry vectors comprising the gene expression cassettes, as described above.
  • the binary destination vector, pDAB101917 comprised an herbicide tolerance gene, phosphinothricin acetyltransferase (PAT; Wehrmann et al., 1996, Nature Biotechnology 14: 1274-1278).
  • PAT phosphinothricin acetyltransferase
  • the pDAB101917 vector also comprised a 3'-UTR region from the Z. mays lipase gene (ZmLip; U.S. Patent No. 7,179,902). The ZmLip 3'-UTR was used to terminate transcription of the PAT mRNA.
  • the Gateway® recombination reaction enabled the insertion of each entry vector comprising the gene expression cassette (i.e., a Z. mays c.v. LLN37 or Z. mays c.v. B73 Ubi-1 promoter, the PhiYFP gene, and the ZmPer5 3' -UTR) into the pDAB101917 destination binary vector.
  • the entry vectors were inserted into the gene expression cassette (i.e., a Z. mays c.v. LLN37 or Z. mays c.v. B73 Ubi-1 promoter, the PhiYFP gene, and the ZmPer5 3' -UTR) into the pDAB101917 destination binary vector.
  • the entry vectors were inserted into the
  • pDAB 105747 Ubi-1 PhiYFP ZmPer5 Z. mays Ubi- 1 PAT ZmLip 9
  • Vector maps showing the binary expression construct, pDAB101917, with the gene expression cassettes comprised of a Z. mays Ubi-1 promoter, the PhiYFP gene, and the ZmPer5 3'-UTR incorporated, are provided.
  • Control construct, pDAB 105748 corresponds to the gene expression cassette comprising the Z mays c.v. B73 Ubi-1 promoter (FIG. 8).
  • construct pDAB 105747 corresponds to the gene expression cassette comprising Z mays c.v. LLN37 Ubi-1 promoter sequence (FIG. 9).
  • Binary vector constructs pDAB 105748 (Z mays c.v. B73) and pDAB 105747 (Z mays c.v. LLN37), were each transformed into the Agwbacterium tumefaciens strain, EHAlOl, using standard transformation techniques known in the art. Bacterial colonies were isolated and binary plasmid DNA was extracted, purified, and confirmed via restriction enzyme digestion.
  • Transformation of corn plants was performed according to the protocol described in Vega et al., 2008, Plant Cell Rep 27:297-305 which employed Agrobacterium-mediated transformation and the phosphinothricin acetyltransf erase gene (PAT; Wehrmann et al., 1996, Nature Biotechnology 14: 1274-1278) as a selectable plant marker.
  • Agwbacterium tumefaciens cultures comprising the binary vector constructs (described above) were used to transform Z mays c.v. Hi-II plants and produce first round, T 0 , transgenic corn events (Table 4). The immature zygotic embryos were produced, prepared, and harvested 2.5 months after transformation.
  • Stable integration of the PhiYFP transgene within the genome of the transgenic Z. mays plants was confirmed via a hydrolysis probe assay.
  • Stably-transformed transgenic Z. mays plantlets that developed from the callus were obtained and analyzed to identify events that contained a low copy number (i.e., 1-2 copies) of full-length T-strand inserts.
  • the Roche Light Cycler 480TM system was used to determine the transgene copy number according to manufacturer's instructions.
  • the method utilized a biplexed TaqMan ® PCR reaction that employed oligonucleotides specific to the PhiYFP gene and to the endogenous reference gene, Z mays Invertase (Zmlnv; Genbank Accession No: U16123.1), in a single assay. Copy number and zygosity were determined by measuring the intensity of PhiYFP- specific fluorescence, relative to the Zmlnv- specific fluorescence, as compared to known copy number standards.
  • a PhiYFP gene-specific DNA fragment was amplified with one TaqMan ® primer/probe set containing a probe labeled with FAMTM fluorescent dye, and Zmlnv was amplified with a second TaqMan ® primer/probe set containing a probe labeled with HEXTM fluorescence (Table 5).
  • Primers and probes for copy number analysis were commercially synthesized by Integrated DNA Technologies (Coralville, IA).
  • the FAMTM fluorescent moiety was excited at an optical density of 465/510 nm
  • the HEXTM fluorescent moiety was excited at an optical density of 533/580 nm.
  • PCR reactions were prepared in a final ⁇ reaction volume using reagents, as described in Table 6. Gene-specific DNA fragments were amplified according to the thermocycling conditions set forth in Table 7. Copy number and zygosity of the samples were determined by measuring the relative intensity of fluorescence specific for the reporter gene, P/u ' YFP, to fluorescence specific for the reference gene, Zmlnv, as compared to known copy number standards.
  • Copy Number standards were created by diluting the vector, pDAB 108706, into Z. mays c.v. LLN37 genomic DNA (gDNA) to obtain standards with a known ratio of
  • pDAB108706:gDNA samples having one, two, and four copies of vector DNA per one copy of the Z mays c.v. LLN37 gDNA were prepared.
  • One and two copy dilutions of the pDAB 108706 mixed with the Z. mays c.v. LLN37 gDNA standard were validated against a control Z. mays event that was known to be hemizygous, and a control Z. mays event that was known to be homozygous (i.e., Z. mays event 278; see PCT International Patent Publication No. WO 2011/022469 A2).
  • Probe Fluorescent Label/Sequence 5'HEX/CGAGCAGACCGCCGTGTACTT 16
  • Plants were sampled at V4-5 stage of development using a leaf ELISA assays. Samples were collected in 96-well collection tube plates and 4 leaf disks (paper hole punch size) were taken for each sample. Two 4.5 mm BBs (Daisy corporation, Roger, AR) and 200 ⁇ ⁇ extraction buffer [lx PBS supplemented with 0.05% Tween®-20 and 0.05% BSA (MiUipore Probumin®, EMD MiUipore Corp., Billerica, MA)] were added to each tube. Additional 200 ⁇ ⁇ of extraction buffer was added to each tube followed by inversion to mix. Plates were spun for 5 minutes at 3000 rpm. Supernatant was transferred to corresponding wells in a deep well 96 stored on ice.
  • the Nunc® 96-well Maxi-Sorp Plates (Thermo Fisher Scientific Inc., Rockford, IL) were used for ELISA. Plates were coated with mouse monoclonal anti-YFP capture antibody (OriGene Technologies Inc., Rockville, MD). The antibody was diluted in PBS (1 ⁇ g/mL) and 150 ⁇ ⁇ of diluted PBS was added per well. The plates were incubated overnight at 4°C. The overnight plates were kept at room temperature for 20-30 minutes before washing 4x with 350 ⁇ ⁇ of wash buffer [lx PBS supplemented with 0.05% Tween®-20 (Sigma- Aldrich, St. Louis, MO)] .
  • Plates were blocked with 200 ⁇ ⁇ per well of blocking buffer [lx PBS supplemented with 0.05% Tween®-20 plus 0.5% BSA (MiUipore Probumin®)] for a minimum of 1 hr at +37°C followed by 4x washing with 350 ⁇ ⁇ of wash buffer (Tomtec QuadraWashTM 2, Tomtec, Inc., Hamden, CT).
  • blocking buffer [lx PBS supplemented with 0.05% Tween®-20 plus 0.5% BSA (MiUipore Probumin®)] for a minimum of 1 hr at +37°C followed by 4x washing with 350 ⁇ ⁇ of wash buffer (Tomtec QuadraWashTM 2, Tomtec, Inc., Hamden, CT).
  • Evrogen recombinant Phi-YFP lmg/mL (Axxora LLC, Farmingdale, NY) was used as a standard.
  • a 5-parameter fit standard curve (between the 1 ng/ml and 0.125 ng/ml Standards) was used to ensure all data fall in the linear portion of the curve.
  • 100 ⁇ ⁇ of standard or sample was added to the well.
  • a minimum 1 :4 dilution of sample in the Assay Buffer was used. Plates were incubated for 1 hr at room temperature on plate shaker (250 rpm; Titer Plate shaker) followed by 4x washing with 350 ⁇ ⁇ of wash buffer (Tomtec QuadraWashTM 2).
  • Evrogen rabbit polyclonal anti-PhiYFP primary antibody (Axxora) was added to each well. Plates were incubated for 1 hr at room temperature on a plate shaker at 250 rpm followed by 4x washing with 350 ⁇ ⁇ of wash buffer (Tomtec QuadraWashTM 2). Next, 100 ⁇ ⁇ of anti-rabbit IgG HRP secondary antibody (Thermo Scientific) diluted 1:5000 in
  • Blocking/Assay buffer which PAT proteins were quantified using kit from Envirologix
  • the ELISAs were performed using multiple dilutions of plant extracts and the reagents and instructions essentially as provided by the suppliers.
  • Protein expression was observed in transgenic plant tissues.
  • PhiYFP expression was observed in calli of To plants that were stably transformed by co-cultivation with Agwbacterium.
  • the transgenic plants were grown from Z. mays embryos transformed using the binary vector constructs comprising the novel promoter, pDAB 105747 (Z. mays c.v. LLN37, FIG. 9) and the control promoter, pDAB105748 (Z. mays c.v. B73, FIG. 8).
  • the plant calli were observed under a stereomicroscope (Leica Microsystems, Buffalo Grove, IL) using an YFP filter and a 500 nm light source.
  • FIG. 10 Representative examples of the stable expression of PhiYFP observed in the callus tissue of the transgenic T 0 maize plants comprising pDAB105747 as compared to the control, pDAB 105748, are shown in FIG. 10.
  • the data confirms that the novel promoter comprising pDAB 105747 (Z. mays c.v. LLN37), as described herein, is able to drive robust expression of the PhiYFP gene in callus tissue of T 0 transgenic plants.
  • a mean PhiYFP protein expression of approximately 153.7 ng/mg (+/- 20.9 ng/mg) of PhiYFP was observed for the T ⁇ plants comprising the novel promoter construct, pDAB 105747 (Z. mays c.v. LLN37, FIG. 9), as compared to approximately 285.3 ng/mg (+/- 22.7 ng/mg) of PhiYFP protein produced by the control plant comprising the control construct, pDAB 105748 (Z. mays c.v. B73, FIG. 8).
  • the mean PAT expression for all T ⁇ plants comprising pDAB105747 was approximately 73.2 ng/mg (+/- 6.8) as compared to approximately 105.8 ng/mg (+/- 7.4 ng/mg) of PAT protein produced by the control plant comprising pDAB 105748 from the Z. mays c.v. B73 promoter.
  • the expression of PAT protein for all maize plants was significantly lower than the expression observed for the PhiYFP gene in maize plants.
  • PhiYFP protein expression was also measured in pollen derived from the tassels of selected Ti transgenic plants representing each of the novel promoter constructs described herein. As shown in FIG. 11, image analysis of the transgenic pollen confirms that the novel promoter comprising pDAB 105747 (Z. mays c.v. LLN37), as described in this application, drives high expression of PhiYFP protein in pollen.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Developmental Biology & Embryology (AREA)
  • Physiology (AREA)
  • Botany (AREA)
  • Environmental Sciences (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Compounds Of Unknown Constitution (AREA)
  • Nutrition Science (AREA)
PCT/US2014/072917 2013-12-31 2014-12-31 Novel maize ubiquitin promoters Ceased WO2015103351A1 (en)

Priority Applications (10)

Application Number Priority Date Filing Date Title
EP14876153.9A EP3090046A4 (en) 2013-12-31 2014-12-31 Novel maize ubiquitin promoters
CN201480076356.1A CN106029882A (zh) 2013-12-31 2014-12-31 新型玉米泛素启动子
MX2016008756A MX362667B (es) 2013-12-31 2014-12-31 Promotores de ubiquitina de maíz novedosos.
CA2935381A CA2935381A1 (en) 2013-12-31 2014-12-31 Novel maize ubiquitin promoters
AU2014373769A AU2014373769B2 (en) 2013-12-31 2014-12-31 Novel maize Ubiquitin promoters
RU2016131302A RU2016131302A (ru) 2013-12-31 2014-12-31 Новые промоторы убиквитина кукурузы
KR1020167020540A KR20160099103A (ko) 2013-12-31 2014-12-31 신규 메이즈 유비퀴틴 프로모터
JP2016543695A JP2017500875A (ja) 2013-12-31 2014-12-31 新規トウモロコシユビキチンプロモーター
IL246514A IL246514A0 (en) 2013-12-31 2016-06-28 Novel maize ubiquitin promoters
PH12016501293A PH12016501293A1 (en) 2013-12-31 2016-06-30 Novel maize ubiquitin promoters.

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201361922525P 2013-12-31 2013-12-31
US61/922,525 2013-12-31

Publications (1)

Publication Number Publication Date
WO2015103351A1 true WO2015103351A1 (en) 2015-07-09

Family

ID=53481050

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2014/072917 Ceased WO2015103351A1 (en) 2013-12-31 2014-12-31 Novel maize ubiquitin promoters

Country Status (18)

Country Link
US (1) US20150184180A1 (https=)
EP (1) EP3090046A4 (https=)
JP (1) JP2017500875A (https=)
KR (1) KR20160099103A (https=)
CN (1) CN106029882A (https=)
AP (1) AP2016009335A0 (https=)
AR (1) AR099009A1 (https=)
AU (1) AU2014373769B2 (https=)
BR (1) BR102014033091A2 (https=)
CA (1) CA2935381A1 (https=)
CL (1) CL2016001660A1 (https=)
IL (1) IL246514A0 (https=)
MX (1) MX362667B (https=)
PH (1) PH12016501293A1 (https=)
RU (1) RU2016131302A (https=)
TW (1) TW201527315A (https=)
UY (1) UY35929A (https=)
WO (1) WO2015103351A1 (https=)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10400246B2 (en) * 2016-10-03 2019-09-03 Dow Agrosciences Llc Plant promoter for transgene expression

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070074303A1 (en) * 2005-08-24 2007-03-29 Pioneer Hi-Bred International, Inc. Methods and compositions for controlling weeds

Family Cites Families (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US201314A (en) * 1878-03-12 Improvement in music-racks
ATE112314T1 (de) * 1988-05-17 1994-10-15 Lubrizol Genetics Inc Pflanzliches ubiquitinpromotorsystem.
CN101410524A (zh) * 2005-08-24 2009-04-15 先锋高级育种国际公司 表达目标多核苷酸的方法和组合物
WO2010144775A1 (en) * 2009-06-11 2010-12-16 Syngenta Participations Ag A method for the transient expression of nucleic acids in plants
US9204599B2 (en) * 2009-08-19 2015-12-08 Dow Agrosciences Llc Detection of AAD1 event DAS-40278-9
CN103409460A (zh) * 2013-08-21 2013-11-27 北京大北农科技集团股份有限公司 转化玉米的方法
TW201527314A (zh) * 2013-12-31 2015-07-16 Dow Agrosciences Llc 新穎玉米泛素啓動子(三)
TW201527316A (zh) * 2013-12-31 2015-07-16 Dow Agrosciences Llc 新穎玉米泛素啓動子(五)
TW201527313A (zh) * 2013-12-31 2015-07-16 Dow Agrosciences Llc 新穎玉米泛素啓動子(二)
TW201527312A (zh) * 2013-12-31 2015-07-16 Dow Agrosciences Llc 新穎玉米泛素啓動子(一)

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070074303A1 (en) * 2005-08-24 2007-03-29 Pioneer Hi-Bred International, Inc. Methods and compositions for controlling weeds

Also Published As

Publication number Publication date
AU2014373769B2 (en) 2017-12-07
JP2017500875A (ja) 2017-01-12
AR099009A1 (es) 2016-06-22
PH12016501293A1 (en) 2016-08-15
CA2935381A1 (en) 2015-07-09
IL246514A0 (en) 2016-08-31
AP2016009335A0 (en) 2016-07-31
CL2016001660A1 (es) 2017-05-05
RU2016131302A3 (https=) 2018-07-27
TW201527315A (zh) 2015-07-16
MX2016008756A (es) 2016-10-26
AU2014373769A1 (en) 2016-07-14
EP3090046A4 (en) 2017-06-21
MX362667B (es) 2019-01-31
UY35929A (es) 2015-07-31
EP3090046A1 (en) 2016-11-09
CN106029882A (zh) 2016-10-12
BR102014033091A2 (pt) 2015-11-24
RU2016131302A (ru) 2018-02-06
US20150184180A1 (en) 2015-07-02
KR20160099103A (ko) 2016-08-19

Similar Documents

Publication Publication Date Title
AU2014373771B2 (en) Novel maize ubiquitin promoters
US9885054B2 (en) Maize ubiquitin promoters
AU2014373772B2 (en) Novel maize Ubiquitin promoters
CA2939112C (en) Root specific expression conferred by chimeric gene regulatory elements
US10030246B2 (en) Maize ubiquitin promoters
AU2014373769B2 (en) Novel maize Ubiquitin promoters

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14876153

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2935381

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 246514

Country of ref document: IL

ENP Entry into the national phase

Ref document number: 2016543695

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 16171772

Country of ref document: CO

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 12016501293

Country of ref document: PH

Ref document number: MX/A/2016/008756

Country of ref document: MX

ENP Entry into the national phase

Ref document number: 2014373769

Country of ref document: AU

Date of ref document: 20141231

Kind code of ref document: A

REEP Request for entry into the european phase

Ref document number: 2014876153

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2014876153

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 20167020540

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: A201608362

Country of ref document: UA

ENP Entry into the national phase

Ref document number: 2016131302

Country of ref document: RU

Kind code of ref document: A