WO2015095633A1 - Procédés et compositions concernant des circuits d'acide nucléique et des transducteurs de signal - Google Patents

Procédés et compositions concernant des circuits d'acide nucléique et des transducteurs de signal Download PDF

Info

Publication number
WO2015095633A1
WO2015095633A1 PCT/US2014/071352 US2014071352W WO2015095633A1 WO 2015095633 A1 WO2015095633 A1 WO 2015095633A1 US 2014071352 W US2014071352 W US 2014071352W WO 2015095633 A1 WO2015095633 A1 WO 2015095633A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
acid sequence
rna
sequence
circuit
Prior art date
Application number
PCT/US2014/071352
Other languages
English (en)
Inventor
Andrew Ellington
Yu Sherry JIANG
Sanchita BHADRA
Original Assignee
Board Of Regents, The University Of Texas System
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Board Of Regents, The University Of Texas System filed Critical Board Of Regents, The University Of Texas System
Publication of WO2015095633A1 publication Critical patent/WO2015095633A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays

Definitions

  • a system comprising at least three different nucleic acid sequences, wherein the first and second nucleic acid sequences are complementary to each other over at least a portion of their sequence, but are unable to substantially hybridize to each other unless they are in the presence of a third nucleic acid, and wherein once the first and second nucleic acids hybridize with each other, the third nucleic acid is no longer able to substantially hybridize with either the first or the second nucleic acid, and further wherein the first and second nucleic acid sequences are enzymatically-produced RNA. Either the first or second nucleic acid sequences, or both, can be kinetically trapped. This means that at least one of the sequences are not available for interaction, such as hybridization, with another nucleic acid sequence.
  • Also disclosed herein is a method of detecting a nucleic acid interaction, the method comprising: a) providing a first and second nucleic acid sequence which are complementary to each other over at least a portion of their sequence, wherein the first and second nucleic acid sequence are kinetically trapped and therefore unable to substantially hybridize with each other; b) providing a third nucleic acid sequence which is substantially complementary to either the first nucleic acid sequence, the second nucleic acid sequence, or both, over at least a portion of its sequence; c) allowing the third nucleic acid sequence to interact with either the first nucleic acid sequence, the second nucleic acid sequence, or both, wherein said interaction leads to strand displacement of either the first nucleic acid sequence, the second nucleic acid sequence, or both, therefore kinetically freeing the first, second, or both nucleic acids; d) allowing the first and second nucleic acid sequences to substantially interact with each other, wherein once they interact with each other, they are no longer able to substantially interact with the
  • a method of detecting nucleic acid interaction comprising: a) designing a first and second nucleic acid sequence which are complementary to each other over at least a portion of their sequence, wherein either the first nucleic acid sequence, the second nucleic acid sequence, or both, comprise one or more mismatches in the portion in which the first and second nucleic acid sequences are complementary to each other, and further wherein the first and second nucleic acid sequence are kinetically trapped and therefore unable to substantially hybridize with each other; b) providing a third nucleic acid sequence which is substantially complementary to either the first nucleic acid sequence, the second nucleic acid sequence, or both, over at least a portion of its sequence; c) allowing the third nucleic acid sequence to interact with either the first nucleic acid sequence, the second nucleic acid sequence, or both, wherein said interaction leads to strand displacement of either the first nucleic acid sequence, the second nucleic acid sequence, or both, therefore kinetically freeing the first, second,
  • Figure 1 Design of non-enzymatic catalyzed RNA hairpin assembly circuit
  • CI catalyzes the assembly of HI and H2 into an H1 :H2 duplex and is itself recycled.
  • Circuit output (H1 :H2 duplex) is quantitated as increasing fluorescence intensity of a labeled oligonucleotide probe (RepF) upon displacement of its complementary quencher oligonucleotide (RepQ) by the H1 :H2 duplex,
  • RepF labeled oligonucleotide probe
  • RepQ complementary quencher oligonucleotide
  • hammerhead ribozymes HRz
  • the size (in nucleotides) of each component and its ribozyme flanks is indicated under each schematic. Secondary structures of the resulting chimeric RNA at 42 °C prior to ribozyme processing are depicted. The RNA structures were generated using NUPACK.
  • RNA CHA circuit (a) LHRz and RHRz-mediated co-transcriptional RNA cleavage releases the internal circuit components HI, H2 and CI . 50 ng of PCR-generated transcription templates for HI, H2 and CI were transcribed in 50 ⁇ reactions by T7 RNA polymerase for 2 h at 42 °C. Two microliters of the resulting transcripts were analyzed by electrophoresis on a 10% denaturing polyacrylamide gel. Single-stranded DNA oligonucleotides were used as size markers, (b) RNA hairpins undergo catalyzed assembly into RNA duplexes.
  • RNA catalyst CI and the hairpins HI and H2 were combined as indicated and incubated in IX TNaK buffer containing 20 units of RNaseOUT for 150 min at 42 °C (lanes 1-4), 52 °C (lanes 5-8) or 62 °C (lanes 9-12). The reactions were then analyzed on a 10% native polyacrylamide gel. 15 ng of CI RNA was included in lane 13 as a control. Single- stranded DNA oligonucleotides were used as size markers.
  • FIG. 3 Kinetics and sensitivity of purified RNA CHA circuit
  • the RNA CHA circuit can detect pure CI to picomolar concentration with approximately 87-fold amplification of 0.1 nM CI within 315 min at 52 °C. Circuit output measured as concentration of RepF released from RepF:RepQ duplex was extrapolated from a standard curve of free RepF.
  • Circuits were executed in IX TNaK buffer containing 20 units of RNaseOUT, 0.5 ⁇ ROX reference dye and 400 nM RepF annealed with 5X excess (2 ⁇ ) RepQ at 52 °C for 315 min.
  • Initial rates were calculated from circuit output measurements made during the initial 3-20 min of circuit operation. Average data from three separate experiments is represented. HI concentration has a greater impact on the initial rate suggesting that the first step of the circuit (CI -triggered unfolding of HI) is a rate limiting step, (c) Effect of HI and H2 concentrations on the kinetics of RNA CHA circuit. Average raw fluorescence data from triplicate experiments is plotted. Circuit output is maximal when operated with near equal concentrations of HI and H2. Increasing H2 concentration above that of HI generally decreased the initial reaction rate and resulted in reduced circuit output.
  • FIG. 4 Co-transcriptional RNA CHA and circuit design optimization for co- transcription, (a) Co-transcribed RNA circuit components undergo catalyzed hairpin assembly without requiring gel purification of individual reactants. Fifty nanograms each of HI and H2 transcription templates along with titrating amounts of CI transcription template were co- transcribed for 1 h at 42 °C using T7 RNA polymerase followed by passage through Illustra MicroSpin Sephadex G25 columns. Transcription templates were amplified from cloned inserts using primers pCR2.1.F and pCR2.1.R specific to plasmid sequences flanking the inserts.
  • the single-stranded template DNA (black arrow) consists of a sequence (C*) complementary to the RNA CHA catalyst followed by the nicking enzyme recognition sequence (NE) that is present on the non-cleaved DNA strand and a primer binding site (PBS).
  • primer binding step 1
  • the DNA polymerase synthesizes the complementary strand that now completes the duplex NE site and contains the RNA CHA catalyst sequence (C).
  • Nicking enzyme then binds the duplex NE site (step 2) and cleaves the newly synthesized strand at the NE site.
  • the new 3 '-OH group generated at the nick site is then extended by the DNA polymerase (step 3) while displacing the previously synthesized strand.
  • RNA CHA The displaced ssDNA amplicon can then catalyze RNA CHA.
  • c Schematic of DNA target sequence design for catalysis of RNA CHA.
  • Single toehold (domain 1*) DNA target CI (generated by SDA from the template TLTRSDA) with the same domain architecture as the RNA CI is an inefficient catalyst of RNA CHA.
  • Extended DNA target CI 234 (generated by SDA from the template
  • RNA CHA Co-transcriptionally generated RNA CHA as signal transducer for nucleic acid diagnostics, (a) End-point sequence-specific detection of SDA-generated ssDNA targets by RNA CHA.
  • Samples with or without 10 nM template 1234LTRSDA were amplified by SDA for 90 min at 37 °C in 25 ⁇ reaction volumes. Reactions were then incubated at 95 °C for 5 min and stored at room temperature prior to assay by RNA CHA. Five microliters of these SDA products were then probed with 2 ⁇ of Sephadex G25 column-purified co-transcribed mHl :H2 RNA CHA circuit.
  • RNA CHA co-transcriptions were performed with T7 RNA polymerase using 50 ng each of the mHl and H2 transcription templates for 1 h at 42 °C.
  • End-point RNA CHA detection reactions were assembled in IX TNaK buffer containing 20 units of RNaseOUT, 0.5 ⁇ ROX reference dye and 100 nM RepF (annealed with 5X excess RepQ) fluorescent DNA reporter duplex for quantitating RNA CHA in real-time at 52 °C.
  • Negative control reactions lacking RNA CHA components or containing 2 ⁇ of either only mHl or H2 were also tested,
  • the chromophore DFHBI bound to Spinach.STl is indicated as a red stellate.
  • Spinach.ST is embedded within a tRNA scaffold and is therefore not subjected to RNA end processing by hammerhead ribozymes.
  • H1B, H2 and CI transcription templates were amplified using primers complementary to the exact ends of the cloned inserts (HlB.amp.F:HlB.amp.R, H2.amp.F:H2.amp.R and Cl.amp.F:Cl.amp.R, respectively) rather than the flanking plasmid.
  • Spinach.ST transcription templates were amplified using primers specific to the flanking plasmid sequence at the 5 '-end (pCR2.1.F) and the primer sphT.U.R specific to the 3 '-end sequence of Spinach.ST.
  • RNA CHA circuit as an OR logic processor
  • the RNA hairpin H1B serves as the OR gate and circuit output is measured fluorimetrically using Spinach.STl RNA aptamer beacon
  • HI or mutant HI was co-transcribed with H2 and specific catalyst CI or the non-specific catalyst GQ-C1 for 1 h at 42 °C using T7 RNA polymerase. Following passage through Sephadex G25 columns aliquots of the co-transcribed RNA mixtures were incubated with fluorescent DNA reporter duplex RepF:RepQ in IX TNaK buffer to quantitate formation of H1 :H2 RNA duplexes at 52 °C (A and B). Similar amounts of RNA were transcribed in all reactions as determined by analyzing 2 ⁇ of each transcription on a 10% denaturing
  • C1-T7RNAP Co-transcription reactions lacking T7 RNA polymerase
  • Figure 11 Schematic depicting engineered mismatches between RNA CHA hairpins 1 and 2 designed to reduce uncatalyzed duplex assembly nucleated by breathing hairpin stems.
  • H1 :H2 base mismatches between domains 4 and 4* improve signal to noise ratio of RNA CHA.
  • the single mismatch hairpins mAHl and mGHl demonstrate statistically significant reduction in non-catalyzed assembly with H2.
  • the double mismatch hairpin mHl demonstrates the lowest background with statistically significant difference in its reaction rate compared to those of HI, mAHl and mGHl. Data was analyzed using single-factor ANOVA followed by Tukey's post-hoc analysis for determining statistical significance.
  • H1 :H2 base mismatches between domains 2 and 2* improve signal to noise ratio of RNA CHA.
  • FIG. 14 Introduction of H1 :H2 base mismatches for optimal co-transcriptional RNA CHA. Co-transcribed RNA circuit components undergo catalyzed hairpin assembly without requiring gel purification of individual reactants.
  • FIG. 15 Use of H1 :H2 base mismatch for optimal co-transcriptional RNA CHA.
  • Co- transcribed RNA circuit components undergo catalyzed hairpin assembly without requiring gel purification of individual reactants.
  • FIG. 16 Target sequence-specific end-point signal transduction of SDA by co- transcribed RNA CHA. Reactions containing no template or 10 nM of the templates TLTRSDA (produces the inactive DNA catalyst CI) or 1234LTRSDA (produces the active DNA catalyst C1234) were amplified by SDA at 37 °C for 90 min followed by 5 min incubation at 95 °C prior to storage at room temperature. Five microliter aliquots of these SDA reactions were then probed in 15 ⁇ reaction volumes with 2 ⁇ of co-transcribed mHl :H2 RNA CHA circuits. Co- transcriptions were performed for 1 h at 42 °C with T7 RNA polymerase using 50 ng of each hairpin transcription template.
  • RNA CHA- mediated SDA signal transduction reactions were assembled in 1 X TNaK buffer containing 0.5 ⁇ ROX reference dye, 20 units of RNaseOUT and 100 nM RepF (annealed with 5X excess RepQ) fluorescent DNA reporter duplex. The RNA CHA output was measured in real-time at 52 °C.
  • RNA CHA-mediated real-time signal transduction of ssDNA-generating high temperature SDA High temperature (55 °C) SDA reactions were set up with or without titrating concentrations of 1234HTRSDA template in 20 ⁇ volume containing 0.5 ⁇ ROX reference dye and 75 nM RepF (annealed with 5X excess RepQ) fluorescent DNA reporter duplex for quantitating RNA CHA in real-time.
  • Real-time sequence-specific signal transduction was achieved by adding 2 ⁇ of mHl :H2 RNA CHA circuits co-transcribed from 50 ng of each transcription template to the SDA reactions. Co-transcribed RNA CHA circuits were not purified prior to use as real-time SDA signal transducers.
  • FIG. 18 Initial catalytic rates of the RNA CHA OR processor. Initial catalytic reaction rates between the first 26 to 65 min of circuit operation were measured using the data depicted in Figure 9b. The statistical significance was calculated using single-factor ANOVA followed by Tukey's post-hoc analysis. The initial catalytic rates in the presence of CI or C2 or both CI and C2 were significantly higher than uncatalyzed reaction rate. The initial catalytic rate of CI was significantly lower than those observed with C2 alone or in C2 in combination with CI. Figure 19. Catalytic hairpin assembly reaction with fluorescence read-out. Briefly, one short linear oligonucleotide, 'catalyst', will react with HI via toehold binding and then initiate a branch migration reaction.
  • the partially-opened HI can interact with a toehold on H2 and similarly initiate a branch migration reaction.
  • the catalyst will be completely displaced from HI and will be available for additional reaction cycles.
  • Numbers in the figure stand for different sequence domains; each domain includes 8 bases.
  • Figure 20 Possible pathways for leakage and positions of potential active breathing sites relative to the introduced mismatches: A) When the left-end of the stem of HI 'breathes', the 3'- end of domain 2 will be transiently exposed, revealing a partial toehold that is complementary to domain 2 of H2. This transient toehold exposure permits HI and H2 to react in the absence of catalyst; B) The four mismatch positions correspond to the revealed interactions that initiate strand displacement reactions between HI and H2.
  • mismatches at the 3 ' end of domain 2 of H2 disrupt binding and / or strand exchange with domain 2* of HI ; similarly, mismatches at the 5 ' end of domain 1 of H 1 disrupt binding and / or strand exchange with domain 1 * of H2.
  • Figure 21 Signal generation with four different mismatches.
  • the wild-type data are the same for each comparison; they are simply broken out for ease of viewing.
  • FIG 22 Signal-to-background ratios for four different mismatches.
  • C denotes 'with 2.5 nM catalyst';
  • B denotes 'background' or 'without catalyst'.
  • Signaknoise ratios were calculated from the linear portion of each fluorescence curve (such as those seen in Figure 21); each set of CHA reactions has been repeated at least three times.
  • the numbers at the tops of columns represent the ratio of the catalyzed rate to background leakage.
  • FIG 23 Signal generation in Circuit A with nine different domain 2 mismatches. Calculated signal-to-background ratios for A) single mismatches in CircA-H2; and B) double mismatches and triple mismatches. Each CHA reaction was carried out with 50 nM of H2 (either wild-type or mismatched), 50 nM CircA-Hl, and 50 nM CircA-reporter.
  • Figure 26 Native polyacrylamide gel electrophoresis of CHA reactions, a) CircA-Hl; b) CircA-H2; c) CircA-H2D2M2; d) CircA-Hl+CircA-H2+5nM Catalyst; e) CircA-Hl+CircA- H2D2M2+5nM catalyst; f) CircA-Hl+CircA-H2; g) CircA-Hl+CircA-H2D2M2.
  • the gel was photographed by Storm Scanner 840.
  • the inset Table shows the relative fluorescence intensity (R-FI; derived from ImageQuant 5.2 software ) of the bands corresponding to the assembled hairpins for lanes d to g.
  • Figure 27 Signal generation with four different mismatches.
  • the wild-type data are the same for each comparison; they are simply broken out for ease of viewing. All wild-type and mismatch sequences are based on Circuit B.
  • FIG. 29 Signal generation in Circuit B with domain 2 mismatches.
  • Each CHA reaction was carried out with 50 nM of H2 (either wild-type or mismatch), 50 nM CircB-Hl, and 50 nM CircB-Reporter.
  • data is provided in a number of different formats, and that this data, represents endpoints and starting points, and ranges for any combination of the data points. For example, if a particular data point "10" and a particular data point 15 are disclosed, it is understood that greater than, greater than or equal to, less than, less than or equal to, and equal to 10 and 15 are considered disclosed as well as between 10 and 15. It is also understood that each unit between two particular units are also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed.
  • a "self-assembly pathway” is a series of reactions autonomously executed by nucleic acid sequences in the execution of hybridized, detectable nucleic acid sequences.
  • the self- assembly pathway comprises assembly, or hybridization, of nucleic acid sequences.
  • the self-assembly pathway can also comprise one or more disassembly reactions.
  • nucleic acid refers to natural nucleic acids, artificial nucleic acids, analogs thereof, or combinations thereof. Nucleic acids may also include analogs of DNA or RNA having modifications to either the bases or the backbone. For example, nucleic acid, as used herein, includes the use of peptide nucleic acids (PNA). The term “nucleic acids” also includes chimeric molecules.
  • hairpin as used herein refers to a structure formed by intramolecular base pairing in a single-stranded polynucleotide ending in an unpaired loop (the "hairpin loop"). In various embodiments, hairpins comprise a hairpin loop protected by stems.
  • a hairpin can comprise a first stem region, a hairpin loop region, and a second stem region.
  • the first and second stem regions can hybridize to each other and together form a duplex region.
  • a stem region of a hairpin nucleic acid is a region that hybridizes to a complementary portion of the same nucleic acid to form the duplex stem of a hairpin.
  • hairpin loop refers to a single stranded region that loops back on itself and is closed by a single base pair.
  • Interior loop and “internal loop,” are used interchangeably and refer to a loop closed by two base pairs.
  • the closing base pairs are separate by single stranded regions of zero or more bases.
  • a “bulge loop” is an interior loop where one of the separated single-stranded regions is zero bases in length and the other is greater than zero bases in length.
  • an “initiator” is a molecule that is able to initiate the hybridization of two other nucleic acid sequences.
  • the initiator is also referred to herein as the third nucleic acid sequence, while it facilitates the hybridization of what is referred to herein as the first and second nucleic acid sequences.
  • “Monomers” as used herein refers to individual nucleic acid sequences. For example, monomers are referred to herein as a first nucleic acid sequence, a second nucleic acid sequence, or a third nucleic acid sequence, etc.
  • nucleic acid sequence is meant a nucleic acid which comprises an individual sequence.
  • first, second, or third nucleic acid sequence is referred to, this is meant that the individual nucleotides of each of the first, second, third, etc., nucleic acid sequence are unique and differ from each other.
  • the first nucleic acid sequence will differ in nucleotide sequences from the second and third, etc.
  • each nucleic acid sequence comprises at least one domain that is complementary to at least a portion of one other sequence being used for the self-assembly pathway.
  • domain refers to a portion of a nucleic acid sequence.
  • An "input domain” of a nuclei acid sequence refers to a domain that is configured to receive a signal which initiates a physical and/or chemical change, such as, a for example, a conformational change, of the nucleic acid sequence.
  • an input domain can be an initiator binding domain, an assembly complement domain, or a disassembly complement domain.
  • An "output domain" of a nucleic acid sequence refers to a domain that is configured to confer a signal.
  • the signal can bind a complementary sequence to an input domain.
  • an output domain is configured to confer a signal to an input domain of another nucleic acid sequence.
  • an output domain can be, for example, an assembly domain, or a disassembly domain.
  • an output domain can be present in an initiator.
  • nucleate means to begin a process of, for example, a physical and/or chemical change at a discrete point in a system.
  • nucleation refers to the beginning of physical and/or chemical changes at discrete points in a system.
  • toehold refers to nucleation site of a domain comprising a nucleic acid sequence designed to initiate hybridization of the domain with a complementary nucleic acid sequence.
  • the secondary structure of a nucleic acid sequence may be such that the toehold is exposed or sequestered.
  • the secondary structure of the toehold is such that the toehold is available to hybridize to a complementary nucleic acid (the toehold is "exposed,” or “accessible"), and in other embodiments, the secondary structure of the toehold is such that the toehold is not available to hybridize to a complementary nucleic acid (the toehold is "sequestered,” or "inaccessible”).
  • the toehold can be made available by some event such as, for example, the opening of the hairpin of which it is a part of.
  • a toehold is configured such that a complementary nucleic acid sequence can nucleate at the toehold.
  • a “propagation region” as used herein refers to a portion of a domain of a first nucleic acid sequence that is configured to hybridize to a complementary second nucleic acid sequence once the toehold of the domain nucleates at an exposed toehold of the second nucleic acid sequence.
  • the propagation region is configured such that an available secondary nucleic acid sequence does not nucleate at the propagation region; rather, the propagation region hybridizes to the second nucleic acid sequence only after nucleation at the toehold of the same domain.
  • nucleic acid sequences can be "metastable.” That is, in the absence of an initiator they are kinetically disfavored from associating with other nucleic acid sequences comprising complementary regions.
  • polymerization and “assembly” are used interchangeably and refer to the association of two or more nucleic acid sequence, or one or more nucleic acid sequences and an initiator, to form a polymer.
  • the "polymer” may comprise covalent bonds, non-covalent bonds or both.
  • a first, second, and third nucleic acid sequence can hybridize sequentially to form a polymer comprising a three-arm branched junction.
  • disassociation refers to the disassociation of an initiator or at least one nucleic acid sequence.
  • reaction graph refers to a representation of assembly (and, optionally, disassembly) pathways that can be translated into molecular executables.
  • flip and “switch” are used interchangeably and refer to a change from one state (e.g., accessible) to another state (e.g., inaccessible).
  • “Kinetically trapped” means that the nucleic acid sequences are inaccessible. In other words, a nucleic acid sequence which is "kinetically trapped” is not available for hybridization. For example, a nucleic acid sequence which has formed a hairpin is considered to be kinetically trapped.
  • an "aptamer” is an oligonucleotide that is able to specifically bind an analyte of interest other than by base pair hybridization.
  • Aptamers typically comprise DNA or RNA or a mixture of DNA and RNA.
  • Aptamers may be naturally occurring or made by synthetic or recombinant means.
  • the aptamers are typically single stranded, but may also be double stranded or triple stranded. They may comprise naturally occurring nucleotides, nucleotides that have been modified in some way, such as by chemical modification, and unnatural bases, for example 2-aminopurine. See, for example, U.S. Pat. No. 5,840,867.
  • the aptamers may be chemically modified, for example, by the addition of a label, such as a fluorophore, or a by the addition of a molecule that allows the aptamer to be crosslinked to a molecule to which it is bound.
  • a label such as a fluorophore
  • Aptamers are of the same "type” if they have the same sequence or are capable of specific binding to the same molecule.
  • the length of the aptamer will vary, but is typically less than about 100 nucleotides.
  • oligonucleotides refers to oligomers of natural (RNA or DNA) or modified nucleic acid sequences or linkages, including deoxyribonucleotides, ribonucleotides, anomeric forms thereof, peptide nucleic acid monomers (PNAs), locked nucleotide acids monomers (LNA), and the like and/or combinations thereof, capable of specifically binding to a single-stranded polynucleotide by way of a regular pattern of sequence- to-sequence interactions, such as Watson-Crick type of base pairing, base stacking, Hoogsteen or reverse Hoogsteen types of base pairing, or the like.
  • PNAs peptide nucleic acid monomers
  • LNA locked nucleotide acids monomers
  • nucleic acid sequences are linked by phosphodiester bonds or analogs thereof to form oligonucleotides ranging in size from a few base units, e.g., 8-12, to several tens of base units, e.g., 100-200.
  • Suitable oligonucleotides may be prepared by the phosphoramidite method described by Beaucage and Carruthers (Tetrahedron Lett., 22, 1859-1862, 1981), or by the triester method according to Matteucci, et al. (J. Am. Chem. Soc, 103, 3185, 1981), both incorporated herein by reference, or by other chemical methods such as using a commercial automated oligonucleotide synthesizer.
  • oligonucleotides are single-stranded, but double-stranded or partially double-stranded oligos may also be used in certain embodiments of the invention.
  • An "oligo pair" is a pair of oligos that specifically bind to one another (i.e., are complementary (e.g., perfectly complementary) to one another).
  • complementarity refers to oligonucleotides related by base-pairing rules.
  • Complementary nucleotides are, generally, A and T (or A and U), or C and G.
  • a and T or A and U
  • C and G For example, for the sequence "5'-AGT-3',” the perfectly complementary sequence is “3'- TCA-5'.”
  • Methods for calculating the level of complementarity between two nucleic acids are widely known to those of ordinary skill in the art. For example, complementarity may be computed using online resources, such as, e.g., the NCBI BLAST website
  • Two single-stranded RNA or DNA molecules may be considered substantially complementary when the nucleotides of one strand, optimally aligned and with appropriate nucleotide insertions or deletions, pair with at least about 80% of the nucleotides of the other strand, usually at least about 90% to 95%, and more preferably from about 98 to 100%.
  • Two single-stranded oligonucleotides are considered perfectly complementary when the nucleotides of one strand, optimally aligned and with appropriate nucleotide insertions or deletions, pair with 100% of the nucleotides of the other strand.
  • substantial complementarity exists when a first oligonucleotide will hybridize under selective hybridization conditions to a second oligonucleotide
  • Selective hybridization conditions include, but are not limited to, stringent hybridization conditions.
  • Selective hybridization, or substantially complementary hybridization occurs when at least about 65% of the nucleic acid sequences within a first oligonucleotide over a stretch of at least 14 to 25 sequences pair with a perfectly complementary sequences within a second oligonucleotide, preferably at least about 75%, more preferably at least about 90%.
  • the two nucleic acid sequences have at least 95%, 96%, 97%, 98%, 99% or 100% of sequence identity. See, M. Kanehisa, Nucleic Acids Res. 12, 203 (1984), incorporated herein by reference.
  • hybridization occurs when at least about 65% of the nucleic acid sequences within a first oligonucleotide over a stretch of at least 8 to 12 nucleotides pair with a perfectly complementary nucleic acid sequence within a second oligonucleotide, preferably at least about 75%, more preferably at least about 90%.
  • Stringent hybridization conditions will typically include salt concentrations of less than about 1 M, more usually less than about 500 mM and preferably less than about 200 mM.
  • Hybridization temperatures can be as low as 5° C, and are preferably lower than about 30° C. However, longer fragments may require higher hybridization temperatures for specific hybridization.
  • Hybridization temperatures are generally at least about 2° C. to 6° C. lower than melting temperatures (T m ), which are defined below.
  • two perfectly matched nucleotide sequences refers to a nucleic acid duplex wherein the two nucleotide strands match according to the Watson-Crick basepair principle, i.e., A-T and C-G pairs in DNA:DNA duplex and A-U and C-G pairs in DNA:RNA or RNA:RNA duplex, and there is no deletion or addition in each of the two strands.
  • mismatch refers to a nucleic acid duplex wherein at least one of the nucleotide base pairs do not form a match according to the Watson-Crick basepair principle. For example, A-C or U-G "pairs" are lined up, which are not capable of forming a basepair.
  • the mismatch can be in a single set of bases, or in two, three, four, five, or more basepairs of the nucleic acid duplex.
  • nucleic acid sequence As used herein, “complementary to each other over at least a portion of their sequence” means that at least two or more consecutive nucleotide base pairs are complementary to each other. For example, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more consecutive nucleotide base pairs can be complementary to each other over the length of the nucleic acid sequence. .
  • substantially hybridized refers to the conditions under which a stable duplex is formed between two nucleic acid sequences, and can be detected. This is discussed in more detail below.
  • melting temperature refers to the midpoint of the temperature range over which nucleic acid duplex, i.e., DNA:DNA, DNA:RNA and RNA:RNA, is denatured.
  • a "significant reduction in background hybridization” means that nonspecific hybridization, or hybridization between unintended nucleic acid sequences, is reduced by at least 80%, more preferably by at least 90%, even more preferably by at least 95%, still more preferably by at least 99%.
  • a specific binding event between a first and second molecule occurs at least 20 times or more, preferably 50 times or more, more preferably 100 times or more, and even 1000 times or more often than a nonspecific binding event between the first molecule and a molecule that is not the second molecule.
  • a capture moiety can be designed to preferentially bind to a given target agent at least 20 times or more, preferably 50 times or more, more preferably 100 times or more, and even 1000 times or more often than to other molecules in a biological solution.
  • an immobilized binding partner in certain embodiments, will preferentially bind to a target agent, capture moiety, or capture moiety/target agent complex. While not wishing to be limited by applicants present
  • binding affinity of 10 7 1/mole or more may be due to (1) a single monoclonal antibody (e.g., large numbers of one kind of antibody) or (2) a plurality of different monoclonal antibodies (e.g., large numbers of each of several different monoclonal antibodies) or (3) large numbers of polyclonal antibodies. It is also possible to use combinations of (l)-(3).
  • the differential in binding affinity may be accomplished by using several different antibodies as per (l)-(3) above and as such some of the antibodies in a mixture could have less than a four-fold difference.
  • an indication that no binding occurs means that the equilibrium or affinity constant Ka is 10 6 1/mole or less.
  • Antibodies may be designed to maximize binding to the intended antigen by designing peptides to specific epitopes that are more accessible to binding, as can be predicted by one skilled in the art.
  • sample in the present specification and claims is used in its broadest sense and can be, by non-limiting example, any sample that is suspected of containing a target agent(s) to be detected.
  • Bio samples may comprise animal-derived materials, including fluid (e.g., blood, saliva, urine, lymph, etc.), solid (e.g., stool) or tissue (e.g., buccal, organ-specific, skin, etc.), as well as liquid and solid food and feed products and ingredients such as dairy items, vegetables, meat and meat by-products, and waste.
  • fluid e.g., blood, saliva, urine, lymph, etc.
  • solid e.g., stool
  • tissue e.g., buccal, organ-specific, skin, etc.
  • liquid and solid food and feed products and ingredients such as dairy items, vegetables, meat and meat by-products, and waste.
  • Biological samples may be obtained from, e.g., humans, any domestic or wild animals, plants, bacteria or other microorganisms, etc.
  • Environmental samples can include environmental material such as surface matter, soil, water (e.g., contaminated water), air and industrial samples, as well as samples obtained from food and dairy processing instruments, apparatus, equipment, utensils, disposable and non-disposable items. These examples are not to be construed as limiting the sample types applicable to the present invention.
  • a substance is commonly said to be present in "excess" or “molar excess” relative to another component if that component is present at a higher molar concentration than the other component. Often, when present in excess, the component will be present in at least a 10-fold molar excess and commonly at 100-1,000,000 fold molar excess. Those of skill in the art would appreciate and understand the particular degree or amount of excess preferred for any particular reaction or reaction conditions. Such excess is often empirically determined and/or optimized for a particular reaction or reaction conditions.
  • a promoter refers to a segment of DNA or RNA that controls transcription of the DNA or RNA to which it is operatively linked.
  • the promoter region includes specific sequences that are sufficient for RNA polymerase recognition, binding and transcription initiation. This portion of the promoter region is referred to as the promoter.
  • the promoter region includes sequences that modulate this recognition, binding and transcription initiation activity of RNA polymerase. These sequences may be cis acting or may be responsive to trans acting factors. Promoters, depending upon the nature of the regulation, may be constitutive or regulated.
  • operatively linked or operationally associated refers to the functional relationship of nucleic acids with regulatory and effector sequences of nucleotides, such as promoters, enhancers, transcriptional and translational stop sites, and other signal sequences.
  • operative linkage of DNA to a promoter refers to the physical and functional relationship between the DNA and the promoter such that the transcription of such DNA is initiated from the promoter by an RNA polymerase that specifically recognizes, binds to and transcribes the DNA.
  • consensus ribosome binding sites can be inserted immediately 5' of the start codon and may enhance expression.
  • the desirability of (or need for) such modification may be empirically determined.
  • RNA polymerase refers to an enzyme that synthesizes RNA using a DNA or RNA as the template. It is intended to encompass any RNA polymerase with conservative amino acid substitutions that do not substantially alter its activity.
  • reverse transcriptase refers to an enzyme that synthesizes DNA using a RNA as the template. It is intended to encompass any reverse transcriptase with conservative amino acid substitutions that do not substantially alter its activity.
  • Enzymatically produced refers to the production or secondary or tertiary folding of a nucleic acid by an enzyme rather than by chemical synthesis. Enzymatically produced nucleic acids can be made in vitro or in vivo.
  • ribozyme-containing transcription template scaffolds can be engineered to enable enzymatic co-transcriptional synthesis of RNA circuits that can operate without any post-synthetic separation and re-folding of individual circuit components.
  • RNA hairpins RNA hairpins transcribed in vitro also mediated amplification, even without purification.
  • results of the non-enzymatic amplification reactions were readable using a fluorescent RNA aptamer (Spinach) that was engineered to undergo sequence- specific conformational changes (Example 1).
  • Nucleic acids are versatile molecules that store and process information in living systems.
  • the relatively simple rules for base-pairing interactions have led to the extraordinary blossoming of nucleic acids as molecules that are suitable for nanoscale computation and engineering (Chen 2010).
  • an increasingly complex array of nucleic acid circuits and devices has been engineered both in vitro and in vivo based on programmed strand displacement (Chen (2010), Li (2011), Qian (201 1), Zhang (2011), Qian (201 1), Seelig (2006), Choi (2010), Lucks (2011),. Isaacs (2004)).
  • Short complementary single- stranded domains termed 'toeholds' provide a means of initiating more extensive branch migration reactions.
  • the toehold-mediated, non-enzymatic interactions between substrates are driven by the free energy of strand displacement, either via the formation of more net base pairs (enthalpy gain) or via the release of strands from complexes (entropy gain) (Zhang 2011).
  • One example is a programmable DNA circuit known as catalytic hairpin assembly
  • CHA (Yin 2008).
  • two partially complementary DNA hairpins are prevented from reacting with one another by ensconcing the complementary sequences within hairpin structures, effectively leading to kinetic trapping of the reaction (Li (201 1).
  • a short, single-stranded oligonucleotide 'catalyst' that can interact with a toehold on one of the hairpins leads to strand displacement and the revelation of sequences that can interact with the other hairpin, the formation of a double-stranded product, and the recycling of the catalyst.
  • Such CHA circuits have recently been developed into sequence-specific signal transduction tools for detection and quantitation of isothermal nucleic acid amplification reactions (Li (2012), Jiang (2013)).
  • RNA molecules have predictable base-pairing properties similar to DNA, and are also capable of hybridization and strand displacement
  • nucleic acid circuits were developed based on RNA as well as DNA. Nucleic acid circuits were rationally designed that completely relied on programmed interactions between RNA in vitro, rather than on DNA.
  • a RNA CHA circuit was designed based on a well-studied DNA CHA circuit. The production of this RNA circuit further required considerable modification for in vitro transcription, processing, and signal transduction, including engineering the recently described fluorescent RNA aptamer
  • RNA circuits can be directly transcribed from DNA without the need for purification, separation, or refolding of the hairpin reactants. Even so, the RNA circuit could detect picomolar concentrations of a catalyst sequence with a median amplification of 87-fold. Turnover rates (v/[Cl]) of the RNA CHA circuit were between 0.2 to 1/min were, similar to the DNA circuit (Li (201 1)). Such circuits can be especially useful for the in situ generation of substrates for real-time signal transduction of enzymatic isothermal nucleic acid amplification reactions.
  • RNA circuits can be engineered and operated using the same design principles as DNA, but because of the ease of construction of DNA templates rather than DNA substrates may now render large-scale, high-fidelity enzymatic circuit synthesis that is both time and cost effective.
  • co-transcriptional RNA circuit synthesis in vitro may provide a basis for in vivo nucleic acid computation and new regulatory paradigms in synthetic biology.
  • a system comprising at least three different nucleic acid sequences, wherein the first and second nucleic acid sequences are complementary to each other over at least a portion of their sequence, but are unable to substantially hybridize to each other unless they are in the presence of a third nucleic acid, and wherein once the first and second nucleic acids hybridize with each other, the third nucleic acid is no longer able to substantially hybridize with either the first or the second nucleic acid, and further wherein the first and second nucleic acid sequences are enzymatically-produced RNA. Either the first or second nucleic acid sequences, or both, can be kinetically trapped. This means that at least one of the sequences are not available for interaction, such as hybridization, with another nucleic acid sequence.
  • Also disclosed herein is a method of detecting a nucleic acid interaction, the method comprising: a) providing a first and second nucleic acid sequence which are complementary to each other over at least a portion of their sequence, wherein the first and second nucleic acid sequence are kinetically trapped and therefore unable to substantially hybridize with each other; b) providing a third nucleic acid sequence which is substantially complementary to either the first nucleic acid sequence, the second nucleic acid sequence, or both, over at least a portion of its sequence; c) allowing the third nucleic acid sequence to interact with either the first nucleic acid sequence, the second nucleic acid sequence, or both, wherein said interaction leads to strand displacement of either the first nucleic acid sequence, the second nucleic acid sequence, or both, therefore kinetically freeing the first, second, or both nucleic acids; d) allowing the first and second nucleic acid sequences to substantially interact with each other, wherein once they interact with each other, they are no longer able to substantially interact with the
  • Figure 1 there is a first nucleic acid sequence (HI) and a second nucleic acid sequence (H2) which are kinetically trapped. They are kinetically trapped because they are in a hairpin formation, which means that at least a portion of the nucleic acid sequence is not available for hybridization. It is noted that Figure 1 is illustrative only, as there are many other examples of different circuits which can comprise the systems disclosed herein.
  • At least a portion of either the first or second nucleic acid sequences, or both, are complementary to the third nucleic acid sequence.
  • complementary is meant that the nucleic acid sequences are able to hybridize with one another over at least a portion of their sequence.
  • portion By a "portion” is meant 2, 3, 4 ,5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleotides are capable of hybridization with each other.
  • An example of the third nucleic acid sequence is portrayed as CI in Figure 1, which is capable of hybridizing to a portion of HI and/or H2 at a toehold region. Once CI interacts with HI and/or H2, HI and/or H2 are
  • first and second nucleic acid sequence (such as HI and H2 in Figure 1) become free to interact (hybridize) with one another. Once the first and second nucleic acid sequences hybridize with one another, they are no longer available to hybridize with the third nucleic acid sequence (CI in Figure 1).
  • any of the first, second, and third nucleic acid sequences disclosed herein can be RNA.
  • all three of the nucleic acid sequences are RNA.
  • the nucleic acids can also be enzymatically produced.
  • ribozyme-containing transcription template scaffolds can be engineered to enable enzymatic co-transcriptional synthesis of RNA circuits that can operate without any post-synthetic separation or re-folding of individual circuit components.
  • the RNA is not chemically synthesized, meaning that it is enzymatically produced.
  • the nucleic acid sequences can therefore be co-transcribed, meaning they are transcribed without the need for chemical synthesis.
  • the system disclosed herein can operate in a continuous circuit without intervention, for example.
  • “without intervention” is meant that at least two or more of the steps disclosed herein can be carried out without the need for human interaction with the system.
  • the co-transcription component and the system itself can operate without input from the outside. In other words, it can be self-contained and self-sustaining.
  • the system can function with minor intervention, such as with the simple addition of aliquots, buffer, or reporter, for example.
  • the system can be carried out without strand purification.
  • circuits which are useful with the present systems and methods. Some examples include, but are not limited to, catalytic hairpin assembly (referred to herein as CHA), hybridization chain reaction, various duplex RNA components, such as see-saw gates, hammerhead ribozymes, or tripartite riboswitches.
  • CHA catalytic hairpin assembly
  • hybridization chain reaction various duplex RNA components, such as see-saw gates, hammerhead ribozymes, or tripartite riboswitches.
  • the third nucleic acid sequence is also referred to herein as the initiator.
  • the initiator can be, for example, a nucleic acid that is to be detected in a sample or a portion of a nucleic acid that is to be detected.
  • the sequence of the third nucleic acid is taken into consideration in designing the first and second nucleic acid sequences.
  • the complementary region of either the first or second nucleic acid sequences, or both, are designed to be complementary to a portion of the third nucleic acid sequence, which can be the target.
  • the third nucleic acid sequence comprises at least a portion of a nucleic acid that is part of a "initiation trigger" such that the third nucleic acid sequence, or initiator, is made available when a predetermined physical event occurs.
  • initiation trigger can be the presence of an analyte of interest.
  • the predetermined event may be any physical process that exposes the initiator.
  • the initiator may be exposed as a result of a change in temperature, pH, the magnetic field, or conductivity.
  • the initiator is preferably associated with a molecule that is responsive to the physical process.
  • the initiator and the associated molecule together form the initiation trigger.
  • the initiator may be associated with a molecule that undergoes a conformational change in response to the physical process. The conformational change would expose the initiator and thereby stimulate hybridization of the first and second nucleic acid sequences, which would have previously been kinetically trapped.
  • the initiation trigger comprises a single nucleic acid.
  • the initiator region of the nucleic acid is made available in response to a physical change.
  • the conformation of the initiation trigger may change in response to pH to expose the initiator region.
  • the structure of the trigger is preferably such that when the analyte of interest is not present (or the other physical event has not occurred), the initiator is not available to hybridize with either the first or second nucleic acid sequence, or both. Analyte frees the initiator such that it can interact with the first or second, or both, nucleic acid sequences, as described above. In some embodiments analyte causes a conformational change in the trigger that allows the initiator to interact with the first or second nucleic acid sequences, or both.
  • the initiator may be part of a trigger comprising a nucleic acid that is linked to or associated with a recognition molecule, such as an aptamer, that is capable of interacting with an analyte of interest.
  • the trigger is designed such that when the analyte of interest interacts with the recognition molecule, the initiator is able to stimulate interaction between the first and second nucleic acid sequences.
  • the recognition molecule is one that is capable of binding the analyte of interest.
  • Recognition molecules include, without limitation, polypeptides, such as antibodies and antibody fragments, nucleic acids, such as aptamers, and small molecules. The use of an initiator bound to an aptamer is described in more detail below.
  • the recognition molecule can be a single-stranded DNA amplicon.
  • amplification of diverse recognition events is achieved by coupling the system disclosed herein to nucleic acid aptamer triggers.
  • An aptamer is identified that is able to specifically bind an analyte of interest.
  • the analyte is not limited to a nucleic acid but may be, for example, a polypeptide or small molecule.
  • the aptamer is linked to a nucleic acid comprising a third nucleic acid in such a way that the third nucleic acid sequence (the initiator) is unavailable to interact with the first or second nucleic acid sequence in the absence of analyte binding to the aptamer.
  • conformational changes in the aptamer secondary structure expose the initiator segment of the third nucleic acid sequence.
  • an aptamer trigger is a hairpin nucleic acid that comprises an initiator segment that is complementary to the initiator complement region or sticky end of the first or second nucleic acid sequence.
  • the aptamer trigger also comprises a complementary region that is complementary to a region of the first or second nucleic acid sequence, or both, adjacent to the sticky end, a loop region and an aptamer sequence.
  • the hairpin aptamer trigger may also comprise a region that enhances the stability of the hairpin in the absence of aptamer binding to the analyte, such as a nucleic acid region in one arm of the hairpin that is complementary to a region of the other arm.
  • Hybridization between the first and second nucleic acid sequence is readily detectable by methods known to one of skill in the art for the detection of nucleic acids, including, for example, agarose gel electrophoresis, polyacrylamide gel electrophoresis, capillary
  • polymers comprise nucleic acids
  • they can be visualized by standard techniques, such as staining with ethidium bromide.
  • Other methods also may be suitable including light scattering spectroscopy, such as dynamic light scattering (DLS), viscosity measurement, colorimetric systems and fluroscence spectropscopy.
  • LDS dynamic light scattering
  • the system disclosed herein can be used to transduce signals into a sequence-specific reporter.
  • the signal can trigger hybridization between the first and second nucleic acid sequence, which can be detectable by a sequence-specific reporter.
  • hybridization between the first and second nucleic acid can be monitored by fluorescence resonance energy transfer (FRET).
  • FRET fluorescence resonance energy transfer
  • Certain sequences are labeled with fluorescent dyes so that conformational changes resulting from hybridization between the appropriate strands can be monitored by detecting changes in fluorescence.
  • RNA aptamers are known that bind fluorophores resembling the fluorophore in GFP. These RNA-fluorophore complexes create a palette that spans the visible spectrum.
  • RNA-fluorophore complex termed Spinach
  • Spinach is markedly resistant to photobleaching, and Spinach fusion RNAs can be imaged in living cells. Because the number of hybridized products is inversely related to the amount of the target analyte in a sample, analyte concentration can be determined using the methods disclosed herein.
  • the average molecular weight of the hybridization product of the first and second nucleic acid sequence, when hybridized together, is obtained by standard measurements.
  • the system disclosed herein can take place in solution, on solid platforms such as paperfluidics, or in vivo.
  • the hybridization reaction can be detectable in real time, for example.
  • the ability to co-transcriptionally generate nucleic acid circuits allows for long-term circuit storage in the form of double-stranded transcription templates from which circuits can be synthesized in real-time or as needed during diagnostic application.
  • long period is meant days, weeks, months, or years in storage.
  • One of skill in the art can readily determine how to store such a system for long-term use.
  • the methods and systems disclosed herein allow for long term storage while still retaining functionality.
  • functionality is meant that the system retains its ability to function when used.
  • Nucleic acid computing (or I/O computing) is a form of computing which uses nucleic acids, biochemistry and molecular biology, instead of the traditional silicon-based computer technologies.
  • Nucleic acid computing, or, more generally, biomolecular computing is a fast developing interdisciplinary area. Research and development in this area concerns theory, experiments, and applications of nucleic acid computing. The systems and methods disclosed herein can be used in I/O computation.
  • kits for the detection of an analyte in a sample comprising: at least three different nucleic acid sequences, wherein the first and second nucleic acid sequences are complementary to each other over at least a portion of their sequence, but are unable to substantially hybridize to each other unless they are in the presence of a third nucleic acid, and wherein once the first and second nucleic acids hybridize with each other, the third nucleic acid is no longer able to substantially hybridize with either the first or the second nucleic acid, and further wherein the first and second nucleic acid sequences are enzymatically- produced RNA.
  • either the first nucleic acid sequence, the second nucleic acid sequence, or both comprise one or more mismatches in an area in which the first and second nucleic acid sequences are complementary to each other.
  • Nucleic acid circuits have been shown to execute non-specifically, even in the absence of particular inputs. Specifically, unintended duplexes occur because DNA naturally "breathes" and when the double-stranded end of one hairpin "breathes," it results in a temporarily single- stranded hairpin end that can react with the single-stranded loop of another hairpin. The introduction of a mismatch into the hairpin sequence does not deter breathing but does forestall hairpin duplex assembly. This background leakage is characterized by an initial burst of signal followed by a steady-state, non-catalyzed rate of circuit execution.
  • CHA circuits can be designed for a variety of sequence targets and applications, the signal-to-noise ratio for these circuits (that is, the catalyzed reaction relative to the uncatalyzed reaction) seldom exceeds 100-fold.
  • the background leakage can be attributed to a number of factors, including the purity of DNA samples and the mis-folding of nucleic acids into alternative conformers. Underlying many of these mechanisms, though, is the uncatalyzed binding of an otherwise occluded toehold to its hybridization partner, the subsequent initiation of strand exchange, and the continued propagation of the hairpin assembly reaction. For example, when the kinetically trapped hairpin substrates in CHA 'breathe' they inadvertently reveal binding sites that can then initiate CHA even in the absence of a catalyst strand.
  • a method of detecting nucleic acid interaction comprising: a) designing a first and second nucleic acid sequence which are complementary to each other over at least a portion of their sequence, wherein either the first nucleic acid sequence, the second nucleic acid sequence, or both, comprise one or more mismatches in the portion in which the first and second nucleic acid sequences are complementary to each other, and further wherein the first and second nucleic acid sequence are kinetically trapped and therefore unable to substantially hybridize with each other; b) providing a third nucleic acid sequence which is substantially complementary to either the first nucleic acid sequence, the second nucleic acid sequence, or both, over at least a portion of its sequence; c) allowing the third nucleic acid sequence to interact with either the first nucleic acid sequence, the second nucleic acid sequence, or both, wherein said interaction leads to strand displacement of either the first nucleic acid sequence, the second nucleic acid sequence, or both, therefore kinetically freeing the first, second,
  • the first and second nucleic acid sequences can be any nucleic acid. In one example, they are enzymatically-produced RNA.
  • the method can be carried out in a nucleic acid circuit, such as CHA, or one of the other nucleic acid circuits disclosed herein, such as hybridization chain reaction (HCR).
  • the third nucleic acid sequence is able to hybridize with the first nucleic acid sequence, second nucleic acid sequence, or both, when an analyte is present in the sample. Examples of analytes, aptamers, and initiators and initiator triggers are discussed herein.
  • first nucleic acid sequence, the second nucleic acid sequence, or both can comprise two or more mismatches.
  • the first, second, or both nucleic acid sequence can comprise 2, 3, 4, 5 ,6 ,7, 8, 9, or 10 or more mismatches.
  • the mismatch(es) can reduce hybridization between the first and second nucleic acid when they are not in the presence of the third nucleic acid.
  • the mismatch(es) can reduce hybridization between the first and second nucleic acid by at least 10 fold.
  • the two or more of the mismatches can be consecutive. Alternatively, they can be spaced so that they are 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or more nucleobases away from each other.
  • the mismatch can comprise an addition or deletion to one or more of the first or second nucleic acid sequences.
  • the mismatches are intentionally engineered into the nucleic acid sequence.
  • One of skill in the art can appreciate how such a mismatch can be engineered. For example, in the design of the first and second nucleic acid sequences, one can design such sequences so that they are perfectly matched, or complementary over 100% of their sequence. One can then intentionally design a mismatch in said sequences, in which one or more of the nucleotide bases are no longer perfectly matched, but a mismatch is created.
  • hybridization typically means a sequence driven interaction between at least two nucleic acid molecules, such as a primer or a probe and a gene.
  • Sequence driven interaction means an interaction that occurs between two nucleotides or nucleotide analogs or nucleotide derivatives in a nucleotide specific manner. For example, G interacting with C or A interacting with T are sequence driven interactions. Typically sequence driven interactions occur on the Watson-Crick face or Hoogsteen face of the nucleotide.
  • the hybridization of two nucleic acids is affected by a number of conditions and parameters known to those of skill in the art. For example, the salt concentrations, pH, and temperature of the reaction all affect whether two nucleic acid molecules will hybridize.
  • selective hybridization conditions can be defined as stringent hybridization conditions.
  • stringency of hybridization is controlled by both temperature and salt concentration of either or both of the hybridization and washing steps.
  • the conditions of hybridization to achieve selective hybridization may involve hybridization in high ionic strength solution (6X SSC or 6X SSPE) at a temperature that is about 12-25°C below the Tm (the melting temperature at which half of the molecules dissociate from their hybridization partners) followed by washing at a combination of temperature and salt concentration chosen so that the washing temperature is about 5°C to 20°C below the Tm.
  • the temperature and salt conditions are readily determined empirically in preliminary experiments in which samples of reference DNA immobilized on filters are hybridized to a labeled nucleic acid of interest and then washed under conditions of different stringencies. Hybridization temperatures are typically higher for DNA-RNA and RNA-RNA hybridizations. The conditions can be used as described above to achieve stringency, or as is known in the art. (Sambrook et al, Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989;
  • a preferable stringent hybridization condition for a DNA:DNA hybridization can be at about 68°C (in aqueous solution) in 6X SSC or 6X SSPE followed by washing at 68°C.
  • Stringency of hybridization and washing if desired, can be reduced accordingly as the degree of complementarity desired is decreased, and further, depending upon the G-C or A-T richness of any area wherein variability is searched for.
  • stringency of hybridization and washing if desired, can be increased accordingly as homology desired is increased, and further, depending upon the G-C or A-T richness of any area wherein high homology is desired, all as known in the art.
  • selective hybridization is by looking at the amount (percentage) of one of the nucleic acids bound to the other nucleic acid. For example, in some embodiments selective hybridization conditions would be when at least about, 60, 65, 70, 71, 72, 73, 74, 75,
  • the non-limiting primer is in for example, 10 or 100 or 1000 fold excess. This type of assay can be performed at under conditions where both the limiting and non-limiting primer are for example, 10 fold or 100 fold or 1000 fold below their kd, or where only one of the nucleic acid molecules is 10 fold or 100 fold or 1000 fold or where one or both nucleic acid molecules are above their kd.
  • selective hybridization conditions would be when at least about, 60, 65, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 percent of the primer is enzymatically manipulated under conditions which promote the enzymatic manipulation, for example if the enzymatic manipulation is DNA extension, then selective hybridization conditions would be when at least about 60, 65, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90,
  • composition or method meets any one of these criteria for determining hybridization either collectively or singly it is a composition or method that is disclosed herein.
  • Example 1 Design and Application of Co-Transcriptional, Non-Enzymatic RNA Circuits and Signal Transducers
  • oligonucleotides were obtained from Integrated DNA Technologies (IDT, Coralville, IA, USA). Oligonucleotides were re-suspended at 100 GM concentration in TE (10:0.1) buffer (10 mM Tris-HCl, pH 7.5, 0.1 mM EDTA, pH 8.0) and stored at -20 °C. The concentrations of the DNA and RNA suspensions were measured by UV spectrophotometry using the NanoDrop 1000 spectrophotometer (Thermo Scientific, Wilmington, DE, USA). All transcription templates were built using DNA oligonucleotides obtained from IDT.
  • Short transcription templates ( ⁇ 60 bp) were initially prepared by annealing two completely complementary oligonucleotides that were mixed in equimolar concentration in TE (10:0.1) buffer containing 50 mM NaCl. The oligonucleotides further underwent denaturation for 5 min at 95 °C before being annealed via slow cooling (0.1 °C/s) to 25 °C; this last step was performed in order to ensure higher yield and greater structural uniformity. Annealed oligonucleotides were quantitated and used directly for in vitro transcription reactions and excess was stored at -20 °C. Longer transcription templates were sequentially assembled from sets of shorter overlapping oligonucleotides by
  • oligonucleotide annealing was performed by overlap PCR using mutagenic primers. All DNA enzymatic amplification reactions were performed using highfidelity Phusion DNA polymerase (New England Biolabs (NEB), Ipswich, MA, USA) or Taq DNA polymerase (NEB), according to the manufacturer's protocols. In some cases, fully assembled transcription templates were subjected to A-tailing by Taq DNA polymerase (NEB).
  • transcription templates cloned in a pCR2.1- TOPO vector were amplified from sequenced plasmids by PCR using Phusion DNA polymerase.
  • Primers pCR2.1.F and pCR2.1.R specific to the plasmid sequences flanking the insert were used for the amplification of ribozyme-containing transcription templates to ensure uniformity of transcription.
  • RNA CHA circuit components H1B, H2, and CI were amplified using primers complementary to the exact ends of the cloned inserts
  • transcripts of the circuit components were either (i) used directly for assembly or (ii) subjected to purification prior to assembly.
  • Transcripts intended for purification were either filtered through Sephadex G25 using the Illustra MicroSpin G-25 columns, according to the manufacturer's instructions (GE).
  • RNA gel purification Specifically, these latter transcripts were treated with 2 units of DNase I (Epicentre Biotechnologies, Madison, WI, USA) at 37 °C for 30 min to degrade the template DNA prior to RNA gel purification. Any RNA not used directly for circuit assembly was stored for short durations at -20 °C while long term storage was done at -80 °C.
  • DNase I Epicentre Biotechnologies, Madison, WI, USA
  • Denaturing poly aery lamide gel electrophoresis and RNA gel purification 10% polyacrylamide gels containing 7 M urea were prepared using 40% acrylamide and bis -aery lamide solution, 19: 1 (Bio-Rad) in IX TBE buffer (89 mM Tris Base, 89 mM Boric acid, 2 mM EDTA, pH 8.0) containing 0.04% ammonium persulphate and 0.1% TEMED. An equal volume of 2X denaturing dye (7 M urea, IX TBE, 0.1% bromophenol blue) was added to the RNA samples. These were incubated at 65 °C for 3 min followed by cooling to room temperature before electrophoresis.
  • a ssDNA ladder prepared by mixing 20 nt-, 42 nt-, 66 nt-, and 99 nt-long oligonucleotides was included as a size marker.
  • the gels were stained for 10 min with SYBR-Gold (Life Technologies) prior to visualization on the Storm Imager (GE).
  • RNA purification desired bands were excised from the gel and the RNA was eluted twice into TE (10: 1) buffer (10 mM Tris-HCl, pH 7.5, 1 mM EDTA, pH 8.0) and incubated at 70 °C and 1000 rpm for 20 min. Acrylamide traces were removed by filtering eluates through Ultrafree-MC centrifugal filter units (EMD Millipore, Billerica, MA, USA) followed by precipitation with 2X volume of 100% ethanol in the presence of both 15 Gg GlycoBlue (Life Technologies) and 0.3 M sodium acetate, pH 5.2. RNA pellets were washed once in 70% ethanol. Dried pellets of purified RNA samples were resuspended in 0.1 mM EDTA and stored at -80 °C.
  • TE 10: 1 buffer (10 mM Tris-HCl, pH 7.5, 1 mM EDTA, pH 8.0) and incubated at 70 °C and 1000 rpm for 20
  • RNA CHA reactions 200 nM each of gel-purified HI and H2 and 5 nM of gel purified CI were used to set up 15 Gl RNA CHA reactions in 0.2 ml PCR tubes. All RNA components were thawed from -80 °C storage and diluted to the desired stock concentrations in 0.1 mM EDTA without refolding. Reactions were assembled at 4 °C by mixing circuit components in the indicated combinations in IX TNaK buffer (20 mM Tris-HCl, pH 7.5, 140 mM NaCl, 5 mM KCl) containing 20 units of RNaseOUT.
  • IX TNaK buffer 20 mM Tris-HCl, pH 7.5, 140 mM NaCl, 5 mM KCl
  • HI was added last to the assembled reactions which were then incubated for 2.5 h in thermocyclers maintained at 42 °C, 52 °C or 62 °C. Following incubation, 10 Gl of 50% glycerol was added to each reaction and mixed by pipetting. 15 ng of CI alone was similarly prepared as a loading control. All samples were then electrophoresed at room temperature on a native 10% polyacrylamide gel in IX TBE. A mixture of ssDNA and bromophenol-containing loading dye was used as a size marker. The gels were stained with SYBR-Gold for 10 min prior to visualization on the Storm Imager.
  • RNA CHA real-time fluorimetric detection of RNA CHA was performed using a RepF:RepQ duplex DNA FRET reporter.
  • This reporter was prepared by annealing the FAM- labeled fluorescent RepF and quencher RepQ oligonucleotides in a 1 :5 molar ratio in IX TNaK buffer. The oligonucleotides were first denatured for 1 min at 95 °C followed by slow cooling at a rate of 0.1 °C/s to 25 °C in order to generate annealed duplexes that were then stored in the dark at -20 °C. Prior to circuit assembly, all gelpurified RNA was thawed from -80 °C and stored on ice.
  • RNA hairpins The refolding of RNA hairpins was deemed unnecessary.
  • the HI and H2 RNA were diluted to working concentrations in 0.1 mM EDTA.
  • the specific (CI) and non-specific (GQ-C1) catalyst RNA were diluted to working concentrations in 0.1 mM EDTA containing 1 GM oligo dT17. Circuits were assembled on ice in 15 Gl reactions by mixing the indicated concentrations of H2 and CI in IX TNaK buffer containing 0.5 GM ROX reference dye (Life Technologies), 20 units of RNaseOUT, and 100 to 400 GM RepF (annealed with 5X excess RepQ).
  • HI RNA concentration ranged between 5 pM to 5 nM. Circuit operation was quantitated in 96-well optically-clear plates in an ABI 7300 real-time PCR machine (Life Technologies) that was programmed to cycle the circuits through 3 min incubations at 52 °C followed by 30 s at 51 °C. Fluorescence data was acquired in the FAM and ROX channels.
  • Co-transcriptions were performed using 50 ng each of PCR-amplified HI and H2 transcription templates; the transcriptions were performed both with different concentrations of CI and non-specific catalyst GQC1 template as well as in the absence of any catalyst template. Transcriptions were mediated by T7 RNA polymerase in 50 Gl reactions that were incubated for 1 h at 42 °C. For some experiments, the transcribed RNA was filtered through Sephadex G25 prior to circuit assembly. For other experiments, the cotranscribed RNA was used directly for RNA CHA quantitation.
  • End-point RNA CHA-mediated signal transduction of low-temperature SDA Various concentrations of the ssDNA templates TLTRSDA and 1234LTRSDA were amplified in 25 Gl reactions containing IX NEB Buffer 2 (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgC12, 1 mM DTT, pH 7.9), 100 nM primer PSDA, 200 nM dNTP, 10 units of Nb.BbvCI (NEB), and 6.25 units of Klenow Fragment (3' ⁇ 5' exo-) (NEB). The reactions were assembled on ice and then incubated at 37 °C for 90 min followed by denaturation for 5 min at 95°C.
  • IX NEB Buffer 2 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgC12, 1 mM DTT, pH 7.9
  • 100 nM primer PSDA 200 nM dNTP
  • RNA CHA end-point signal analysis by RNA CHA.
  • the mHl :H2 RNA CHA circuit was co-transcribed using T7 RNA polymerase with 50 ng each of the PCR amplified hairpin transcription templates. Following 1 h of co-transcription at 42 °C, the mHl :H2 RNA CHA circuits were used for end-point SDA signal transduction either directly (i.e. without purification) or after an initial filtration through Sephadex G25.
  • the fully assembled SDA end-point RNA CHA signal transduction reactions were then transferred to 96-well optically-clear plates.
  • the FAM and ROX signals were monitored in real-time using an ABI 7300 real-time PCR machine that was programmed to cycle the reactions through 3 min incubations at 52 °C followed by 30 s at 51 °C.
  • RNA CHA-mediated signal transduction of high-temperature SDA Various concentrations of the ssDNA template 1234HTRSDA were amplified in 20 Gl reactions containing IX NEB Buffer 2 (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgC12, 1 mM DTT, pH 7.9), 100 nM primer PSDA, 200 nM dNTP, 10 units of Nb.BsrDI (NEB), and 8 units of Bst 2.0 (NEB). For fluorescent quantitation, 0.625 GM ROX reference dye and 75 nM RepF (annealed with 5X excess of RepQ) were included in the reactions.
  • IX NEB Buffer 2 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgC12, 1 mM DTT, pH 7.9
  • 100 nM primer PSDA 200 nM dNTP, 10 units of Nb.BsrDI (NEB), and 8
  • the :H2 RNA CHA circuit was co-transcribed using T7 RNA polymerase from 50 ng each of the PCR-amplified hairpin transcription templates. Following 1 h of co-transcription at 42 °C, the mHl :H2 RNA CHA circuits were used for SDA signal transduction either directly (i.e. without purification) or after an initial filtration through Sephadex G25. Two-Gl aliquots of the mHl :H2 circuits were added to the SDA reactions on ice. Control SDA reactions included (i) reactions without the 1234HTRSDA template, (ii) reactions with 2 Gl of only the mHl or H2 RNA, and (iii) reactions without any of the RNA CHA components.
  • the fully assembled SDA reactions with real-time RNA CHA were then transferred to 96-well optically-clear plates.
  • the FAM and ROX signals were monitored in real- time using an ABI 7300 real-time PCR machine programmed to cycle the reactions through 3 min incubations at 55 °C followed by 30 s at 54 °C.
  • RNA aptamer beacon as a sequence-specific signal transducer of RNA CHA. H1B, H2, CI, C2, and Spinach.
  • ST 1 RNA were transcribed separately by T7 RNA polymerase using 500 ng of double-stranded transcription templates. Transcription templates for H1B, H2, and CI were amplified using primers complementary to the exact ends of the cloned inserts (HlB.amp.F:HlB.amp.R, H2.amp.F:H2.amp.R, and Cl.amp.F:Cl .amp.R, respectively) rather than the flanking plasmid.
  • Spinach. ST 1 transcription templates were amplified using a primer (pCR2. l.F) specific to the flanking plasmid sequence at the 5'-end and a primer
  • RNA CHA reactions with Spinach.STl signal transduction were then performed in 15 Gl reactions containing IX TNaK buffer, 20 units of RNaseOUT, and 70 GM DFHBI. Three-Gl transcription aliquots of each RNA circuit component - including the hairpins H1B and H2, catalysts CI and C2, and reporter Spinach.STl - were added to the CHA reactions as indicated. The reactions were transferred to 384-well flat-bottomed black plates and Spinach.STl fluorescence was measured in a TECAN Safire plate reader (TECAN, Switzerland) maintained at 37 °C.
  • RNA CHA quantitation Comparison of Spinach.STl and DNA FRET reporter duplex for gel-purified RNA CHA quantitation.
  • Gel purified RNA components were used for direct comparison of the efficiency of the two types of fluorescent nucleic acid reporters.
  • the FAM-labeled fluorescent DNA reporter H1B.F was annealed with the quencher oligonucleotide H1B.Q at a 1 :2 molar ratio in IX TNaK buffer.
  • the oligonucleotides were denatured for 1 min at 95 °C and then annealed by slow cooling at a rate of 0.1 °C/s to 25 °C.
  • RNA components H1B, H2, CI, and Spinach.STl were transcribed by T7 RNA polymerase from 1 Gg each of PCR-generated transcription templates and purified from denaturing polyacrylamide gels. Stored RNA components were thawed from -80 °C and diluted to the desired working concentrations in 0.1 mM EDTA.
  • RNA CHA circuits were assembled from 1 GM each of H1B and H2 RNA in 15 Gl reactions containing IX TNaK buffer and 20 units of RNaseOUT. One set of reactions was quantitated by adding 1 GM HIB.F (annealed with 2X excess of HIB.Q) while a second set was quantitated by adding 1 GM Spinach.
  • RNA circuits are decidedly different than those of a corresponding DNA circuit, since RNA:RNA interactions are much more stable than DNA:DNA interactions (Lesnick (1995)).
  • catalytic hairpin assembly reaction was used (Li (2008), Yin (2011)), in which two short hairpin species form a double-stranded product only in the presence of a single-stranded catalyst that can bind to a toehold and initiate strand-exchange (Figure la).
  • RNA circuits The chemical synthesis of RNA is more complex, more expensive, and more fraught with error than is the chemical synthesis of DNA. It has been found that the imperfections present in chemically synthesized substrates in nucleic acid circuits are a persistent source of noise during their execution (Lesnick (2005)). Therefore, it was chosen to enzymatically transcribe the substrates for RNA circuits, a procedure that may also provide new options for the design and execution of nucleic acid circuitry in general.
  • RNA CHA reaction was initially chosen based on DNA CHA reactions that had previously yielded efficient amplification of a single-stranded sequence signal (Yin (2008)). It was hypothesized that the RNA CHA circuit would operate optimally under conditions in which the RNA hairpin free energies were predicted to be similar to that of their DNA counterparts in the parent DNA CHA circuit. A similar hypothesis led to the design of thermostable DNA circuits that can be used for the real-time detection of isothermal amplification reactions (Jiang (2013)). Thus, instead of redesigning the sequences of the circuit the DNA sequence was converted to a RNA sequence (with minor sequence changes to allow hammerhead ribozyme cleavage at the 3 '-end of circuit components) and predicted a new thermal optimum.
  • RNA transcripts are frequently heterogeneous, with so-called N+l, non-templated additions of adenosine occurring (Milligan (1987), Krupp (1988)), meaning it was desirable to make the ends flush via some processing mechanism.
  • each RNA substrate was flanked with hammerhead ribozymes (Figure lb), similar to constructs that are frequently used for the preparation of RNA molecules for crystallography (Price (1995); Ke (2004)). Additionally with this design, short transcripts that would result from the abortive cycling of T7 RNA polymerase (Milligan (1987); Martin (1988)) should only contain ribozyme-derived sequences and not domains from the CHA components that could potentially poison the CHA reaction or increase noise. Nascent transcripts undergo co-transcriptional ribozyme self-cleavage to release circuit components with exact 5'- and 3'-ends. The correct-sized substrates can be separated from the processed ribozyme flanks via denaturing polyacrylamide gel electrophoresis ( Figure 2a).
  • RNA CHA reaction was then carried out at 52 °C in IX TNaK buffer ( Figure 4a). It was observed that co-transcribed HI and H2 showed some reaction in the absence of a catalyst, but could undergo much more robust amplification in the presence of co-transcribed catalyst. As controls, transcription reactions lacking T7 RNA polymerase failed to synthesize the circuit and did not activate the reporter, while co-transcription of non-specific catalyst sequences also failed to catalyze RNA CHA.
  • Uncatalyzed HI :H2 duplex assembly was unacceptably high in co-transcribed circuits, and resulted in end-point signal-to-noise ratios of only between 1 and 1.6. It was believed that separating nucleation of toehold interactions from propagation of these interactions might be a way to disrupt uncatalyzed noise resulting from the random breathing or opening of hairpins.
  • the distal ends of the hairpin stems were predicted to be least stable such that the first few bases in H2 domain 4 and HI domain 2 might be transiently single-stranded due to RNA structural breathing.
  • mutant HI was generated that had a single-stranded loop domain 4* that contained either a 2 base (mHl) or 1 base (mAHl and mGHl) mismatch with stem domain 4 of H2 ( Figure 4b).
  • the mutant hairpins were designed so as to achieve the strongest mismatches while keeping the domain GC content unaltered.
  • a mutant H2 hairpin (m2H2) was designed whose single-stranded loop domain 2* contained a 2 base mismatch with the stem domain 2 of HI ( Figure 4c).
  • RNA signal transducers for nucleic acid diagnostics
  • Non-enzymatic nucleic acid amplification circuits have recently been adapted into novel diagnostic tools for sequence-specific detection of amplicons generated by enzymatic amplification (Jiang (2013), Li (201 1)). These nucleic acid devices function not only in solution but also operate on solid surfaces such as paper (Allen (2012)).
  • RNA circuits as similar transducers might further simplify the production of nucleic acid circuits for point-of-care applications; instead of producing, purifying, and storing multiple kinetically trapped nucleic acid substrates, double- stranded transcription templates could generate these substrates on the fly.
  • RNA:RNA base pairs are typically more stable than DNA:RNA base pairs
  • the RNA circuitry must be carefully designed to ensure that DNA amplicons can strand invade and trigger the CHA reaction.
  • SDA strand displacement amplification
  • Hairpin mHl alone (which contained fluorescent reporter binding domains) yielded some signal when incubated with the SDA-generated CI 234 ssDNA catalyst, but the signal was greatly increased due to catalytic amplification in the presence of co-transcribed H2.
  • catalyst-specific signal was generated just due to mHl -mediated interactions with the reporter, the majority of signal was generated due to C1234-catalyzed initiation of RNA CHA.
  • RNA CHA circuitry could also be used for the real-time detection of SDA. Since the optimal operating temperature of the mHl :H2 RNA CHA circuit was 52 °C the model
  • 1234LTRSDA template described above was further modified to include a nicking site for a thermo endonuclease (Nb.BsrDI).
  • the 1234HTRSDA template was used in SDA reactions along with a previously cotranscribed mHl :H2 RNA CHA circuit added directly to the SDA reactions without purification.
  • RNA CHA is a viable sequence-specific signal transducer that can be adapted for detection the end-point or real-time detection of single-stranded DNA targets and amplicons.
  • the simplicity of generating large quantities of RNA circuits via one pot enzymatic co-transcription without purification or re-folding make RNA circuits an attractive alternative for not only diagnostic applications but also for the construction of more complex computational circuitry. Transcriptional generation of an RNA amplifier circuit and a fluorescent RNA reporter
  • RNA CHA was adapted to function as a reporter for isothermal amplification reactions. These adaptations of RNA CHA have required that oligonucleotides bearing a fluor and quencher pair be added to the reaction. In order to further simplify the transduction scheme, a 'label free' fluorescent RNA signal transducer was used that could be generated by transcription alone for quantitation of RNA CHA reactions.
  • RNA aptamer (Spinach) has been reported that binds to the fluorophore DFHBI ((Z)-4-(3,5-difluoro-4- hydroxybenzylidene)-l,2-dimethyl-lH-imidazol-5(4H)-one), leading to a large increase in its fluorescence emission (Paige (2011)).
  • Spinach was therefore engineered into a sequence- dependent fluorescent aptamer beacon (Spinach. ST) that remains conformationally trapped into an inactive state unable to bind DFHBI until it interacts with a specific sequence target (Figure 10).
  • a new CHA fuel HIB was created by replacing the domain 6* of HI with a sequence complementary to domain 6 (the basal stem) of Spinach. ST 1.
  • the exposed toehold 2* of HIB will bind to the toehold domain 2 of Spinach.
  • ST 1 initiating branch migration through domains 5 and the duplicate domain 6, regenerating the Spinach basal stem and conformation allowing it to complex with the fluorophore DFHBI ( Figure 10).
  • RNA CHA circuit was assembled from gel-purified (rather than size exclusion-purified) RNA components. Some 1 GM of purified H1B and H2 fueled CHA reactions in which the amount of CI was titrated from 0 to 100 nM. Spinach.STl (+ 70 GM DFHBI) or H1BF (annealed with 2X concentration of H1BQ) were included at 1 GM concentrations to monitor CHA execution.
  • H1BF:H1BQ DNA FRET reporter clearly outperformed the Spinach.STl aptamer beacon and yielded better signal-to-noise ratios at all tested concentrations of the catalyst ( Figures 1 lb, 1 1c, and l id).
  • Better relative performance of H1BF:H1BQ might be partly due to the 4-fold greater brightness of FAM compared to DFHBI in Spinach
  • Circuit components H1B and H2 RNA hairpins
  • reporter RNA Spinach. ST 1
  • the inputs CI and C2 were separately transcribed in vitro and purified by filtration through
  • RNA as an alternate information processing and signaling molecule for engineering nucleic acid devices and automata.
  • Structural free energy (WG) proved to be a reliable metric for predicting circuit kinetics, and the RNA circuit reported in this paper demonstrated very similar kinetics of operation when compared to the original DNA circuit from which it is derived.
  • This demonstration paves the way to circuits that can be entirely generated by transcription.
  • the conceptual demonstration was underpinned by a number of important technical demonstrations. It was shown that using ribozyme-mediated end-processing of transcripts can easily generate substrates for RNA circuits without requiring further downstream purification and/or re-folding of each individual circuit component.
  • Enzymatic synthesis potentially provides much greater fidelity compared to chemical synthesis, but at a lower cost (Hecker (1998), Tian (2004)).
  • Chemically synthesized oligonucleotides usually demonstrate deletions at a rate of 1 in 100 bases and mismatches and insertions at about 1 in 400 bases, whereas the T7 RNA polymerase is reported to have a nucleotide substitution error rate of ⁇ 6 x 10-5 and a deletion error rate of 6 x 10-5 (Hecker (1998), Brakmann (2001)).
  • Such differences have proven to be surprisingly important for DNA circuits, where enzymatically synthesized material routinely outperforms chemically synthesized material, in part because it allows more uniform folding of the kinetically trapped substrates (Chen (2013), Price (1995)).
  • RNA is an especially attractive medium for executing nucleic acid circuits in vivo because it can fold during transcription into engineered conformations amenable to computation and regulation.
  • the formulation of design principles for RNA circuits translates into a toolbox for synthesis and operation of complex non-enzymatic nucleic acid circuits in vivo (Lucks (2011); Isaacs (2004)).
  • Table 1 Initial rates of catalyzed and uncatalyzed RNA CHA.
  • RNA CHA circuits were assembled using gel purified RNA
  • H2 transcription >GATACACATGG ⁇ 3*>CGACATCT ⁇ 2*>AACCTAGC ⁇ 4*>CCATGTGTATC ⁇ RH template Rz>GACGGAGTCTAGACTCCGTCCTGAAGAGTCCGTGAGGACGAAATACAC
  • H1 transcription >GCTAGGTT ⁇ 3>AGATGTCG ⁇ 4*>CCATGTGTATC ⁇ 3*>CGACATCT ⁇ 2*>AACC template TAGC ⁇ 5*>CCTTGTCA ⁇ 6*>TAGAGCTC ⁇ RHRz>GACGGAGTCTAGACTCCGT
  • pT7 T7 RNA polymerase promoter
  • LHRz left hammerhead ribozyme
  • RHRz right hammerhead ribozyme
  • * complementary domain
  • L.tRNA left tRNA scaffold
  • R.tRNA right tRNA scaffold. Mismatched bases are highlighted in red.
  • Nucleic acid circuits that are based on toehold-mediated strand exchange reactions have yielded interesting approaches to computation, nanotechnology, and diagnostics (Zhang DY, 2009; Ma C, 2012; Yin P, 2008; Zhang DY 2007; Zhang H, 2013; Liu J, 2009).
  • An example of a common amplification reaction, which is known as the catalytic hairpin assembly (CHA), is shown in Figure 19. This circuit has been adapted to a variety of applications, including acting as a monitor of isothermal amplification reactions, both end-point (Li B 2012) and real-time (Jiang Y 2013).
  • CHA circuits have also been shown to execute non-specifically, even in the absence of particular inputs (Li B, 2012; Huang J, 2012; Ren J, 201 1).
  • This background leakage is characterized by an initial burst of signal, which is followed by a steady-state, non- catalyzed rate of circuit execution.
  • the rate constant of the steady-state leakage of a typical CHA circuit was approximately 200 M ' V 1 , while the corresponding catalytic rate at a catalyst concentration of 5 nM was 4000 M ' V 1 (Li B, 2012).
  • CHA circuits can be designed for a variety of sequence targets and applications, the signal-to-noise ratio for these circuits (that is, the catalyzed reaction relative to the uncatalyzed reaction) seldom exceeds a ratio of greater than 100: 1.
  • the background leakage can be attributed to a number of factors, including the purity of the DNA samples (Chen X, 2013) and the misfolding of nucleic acids into alternative conformers. Underlying many of these mechanisms, however, is the uncatalyzed binding of an otherwise occluded toehold to its hybridization partner, the subsequent initiation of strand exchange, and the continued propagation of the hairpin assembly reaction. For example, when the kinetically trapped hairpin substrates in CHA "breathe", they inadvertently reveal binding sites that can then initiate CHA even in the absence of a catalyst strand.
  • a CHA circuit (Circuit A) (Li B, 2012) was designed, wherein domains 1 and 1 * were shortened from ten to eight nucleotides, a length that was found to act as an efficient toehold. Furthermore, mismatches were introduced at the 3 '-end of domain 2 in H2 (CircA- H2D2M2, where CircA refers to the overall circuit, H2 refers to the hairpin substrate, D2 refers to the domain, and M2 refers to the type of mutation, that is, single, double, etc.; see also Table 4) to reduce its ability to hybridize to the complementary domain 2* in HI. To probe the potential contribution of different mismatches to background suppression, two consecutive mismatches were introduced at each of four sites ( Figure 20 and Table 4).
  • the resultant "MismatCHA" circuits were assayed by monitoring the release of a fluorescent oligonucleotide from a quencher ("Reporter” in Figure 19; for the sequence, see Table 10).
  • CircA-H2D2M2 was paired with HI, and the development of a fluorescent signal was monitored as a function of time ( Figure 3).
  • Figure 3 When compared with the perfectly paired wild-type Circuit A (CircA-Hl paired with CircA-H2), the introduction of a double mismatch into domain 2 (CircA-H2D2M2; Table 4 and Figure 21 A) led to a significant diminution of background signal development in the absence of catalyst.
  • CircA-H2D2M2 and CircA-HlD4M2 there was more opportunity for the suppression of the background signal for constructs CircA-H2D2M2 and CircA-HlD4M2 than for CircA-H2D3M2 and CircA-HlDlM2, as for CircA-H2D2M2 and CircA-HlD4M2, the intensity of the background signal should decrease because of breathing at the terminus of the HI helix, whereas CircA-H2D3M2 and CircA-HlDlM2 should reduce background interactions owing to breathing adjacent to the loop in HI .
  • the double mismatch may effectively prevent not only the uncatalyzed reaction because of breathing, but also the initiation of the second strand exchange reaction that occurs following the opening of HI ( Figure 19).
  • the double mismatch in domain 2 would not interfere with the initiation, but only with the propagation of the second strand exchange reaction.
  • the performance of the C:C mismatch may be due to the fact that it is one of the strongest mismatches (Kwok S, 1994; Kowk S, 1990), or may be due to the increase in the length of the H2 stem, which arises from a fortuitous pairing with an opposing guanosine in the loop.
  • Figure 23B and Figure 25B various multiple mismatches were compared between HI and H2.
  • Four different double mismatches were assayed, either adjacent to one another (AC:CA, AC:AA) or separated by potentially paired residues (ATC:CAA,
  • TTTC:CAAT paired residues underlined
  • the double mismatches generally displayed higher signal-to-background ratios than the single mismatches, and three of the four ratios were greater than 100: 1.
  • Three mismatches (AAC:CAA) also yielded a high signal-to-background ratio. Both the double and triple mismatches decreased the catalytic rate of the CHA circuit, while generally improving the signal-to-background ratio.
  • Electrophoresis was carried out at 250v for 1.5h.
  • the fluorescent bands were photographed using a Storm Scanner 840 (Amersham Bioscience, UK) with Excitation 450nM, Emission 520LP, normal sensitivity and PMT Voltage of 800. Fluorescence values were obtained using ImageQuant 5.2 software and the relative fluorescence intensity ( -FI) was determined by subtracting the background (BG) fluorescence and then normalizing to the 'g' band as 1.
  • MismatCHA designs substantially decreased the amounts of uncatalyzed background reactions in CHA amplification reactions.
  • introducing mismatches at the 3 '-end of domain 2 generally gave higher signal-to-background ratios, with multiple mismatches almost always yielding much larger signal-to-background ratios while only modestly decreasing rates.
  • MismatCHA circuits can increase the signal-to-background ratio from single digits to over 100: 1, they should prove useful for the sequence-specific signal transduction with amplicons that arise from isothermal amplification reactions (Compton J, Walker GT, 1992; Notomi T, 2000).
  • CHA can now be used with isothermal amplification reactions in the same way a TaqMan probe is used for the polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • CircA AGAGGCAT CAATGGGA ATGGGATC ATGCCTCT AACCTAGC
  • CircA AGAGGCAT CAATGGGA ATGGGATC ATGCCTCT AACCTAcg GATCCCAT
  • CircA AGAGGCAT CAATGGGA ATGGGATC taGCCTCT AACCTAGC GATCCCAT
  • CircB- CTCCTAAG CTCAAACC CAATATCC CTTAGGAG GACGTTTC H2 GGATATTG GGTTTGAG AGAGTTTC GAGTTCTG (SEQ ID NO: 46)
  • CircB- CTCCTAAG CTCAAACC CAATATCC CTTAGGAG GACGTca H2D2M2 GGATATTG GGTTTGAG AGAGTTTC GAGTTCTG (SEQ ID NO: 47)
  • CircB- CTCCTAAG CTCAAACC CAATATCC aaTAGGAG GACGTTTC H2D3M2 GGATATTG GGTTTGAG AGAGTTTC GAGTTCTG (SEQ ID NO: 48)
  • H1D1M2 CTTAGGAG GACGTTTC (SEQ ID NO: 50)
  • CircB CTCCTAAG CTCAAACC CAATATCC CTTAGGAG GACGTTTa H2D2M1 GGATATTG GGTTTGAG AGAGTTTC GAGTTCTG (SEQ ID NO: 52)
  • H2D2M2 GGATATTG GGTTTGAG AGAGTTTC GAGTTCTG (SEQ ID NO: 53)
  • CircB- /56-FAM/-CAC AGAACTC GAAACTCT CTCAAACC
  • CircA-Reporter was a mixture of CircA-ReporterF and CircA-ReporterQ with a ratio of 1:2.
  • 50 nM CircA-Reporter contains 50 nM CircA-ReporterF and 100 nM CircA- ReporterQ.
  • CircB-Reporter was a mixture of CircB-ReporterF and CircB-ReporterQ with a ratio of 1 :2 where 50 nM CircB-Reporter contains 50 nM CircB-ReporterF and 100 nM CircB-ReporterQ.
  • CHA reaction sample contained 50 nM HI (either wild-type or mismatch), 50 nM H2 (either wild-type or mismatch), 50 nM Reporter (which consisted of ReporterF: ReporterQ in a 1 :2 ratio), and either 2.5 nM catalyst or no catalyst at all. All the kinetic readings were carried out with a 384-well plate from Thermo Fisher Scientific (Rochester, NY) in a TEC AN Safire plate reader; each kinetic reading proceeded for 3 h.
  • RNA synthesis strategies for the use of bacteriophage RNA polymerases. Gene, 72, 75-89.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne des compositions et des procédés pour des circuits d'acide nucléique. L'invention concerne particulièrement des procédés et des systèmes utilisant des circuits d'acide nucléique à ensemble en épingle à cheveux catalytique (CHA). L'invention concerne un système comprenant au moins trois séquences d'acide nucléique différentes, la première et la deuxième séquence d'acide nucléique étant complémentaires entre elles sur au moins une partie de leur séquence mais ne pouvant sensiblement pas s'hybrider mutuellement sans la présence d'un troisième acide nucléique. Lorsque le premier et le deuxième acide nucléique se sont mutuellement hybridés, le troisième acide nucléique ne peut plus sensiblement s'hybrider avec l'un ou l'autre des deux autres acides nucléiques. En outre, la première et la deuxième séquence d'acide nucléique sont des ARN obtenus par production enzymatique. La première ou la deuxième séquence d'acide nucléique, ou bien les deux, peuvent être capturées par piège cinétique. Ce qui signifie qu'au moins une des séquences n'est pas disponible pour une interaction telle que l'hybridation avec une autre séquence d'acide nucléique.
PCT/US2014/071352 2013-12-20 2014-12-19 Procédés et compositions concernant des circuits d'acide nucléique et des transducteurs de signal WO2015095633A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201361919352P 2013-12-20 2013-12-20
US61/919,352 2013-12-20

Publications (1)

Publication Number Publication Date
WO2015095633A1 true WO2015095633A1 (fr) 2015-06-25

Family

ID=53403723

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2014/071352 WO2015095633A1 (fr) 2013-12-20 2014-12-19 Procédés et compositions concernant des circuits d'acide nucléique et des transducteurs de signal

Country Status (1)

Country Link
WO (1) WO2015095633A1 (fr)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2017079634A (ja) * 2015-10-27 2017-05-18 国立大学法人 熊本大学 生体試料中の目的とする細胞を検出する方法
WO2017143006A1 (fr) * 2016-02-17 2017-08-24 President And Fellows Of Harvard College Outils de programmation moléculaire
CN108048533A (zh) * 2017-11-22 2018-05-18 中国科学院长春应用化学研究所 基于三通连接-核酸分子线路换能器的分子检测方法
CN110079866A (zh) * 2016-12-22 2019-08-02 胡家铭 一种免疫脂质-聚合物杂化纳米粒生物芯片和其应用
CN110286216A (zh) * 2019-05-16 2019-09-27 中国科学院武汉物理与数学研究所 一种快速可视化的溶血性大肠杆菌o157：h7检测方法
CN111521808A (zh) * 2020-05-26 2020-08-11 济南大学 一种检测多氯联苯的生物传感器及其制备方法
CN111690722A (zh) * 2020-06-29 2020-09-22 闽江学院 基于熵驱动和杂交链反应的atp检测核酸传感器及其制备方法
US11359229B2 (en) 2016-09-20 2022-06-14 President And Fellows Of Harvard College Molecular verification systems
US11492661B2 (en) 2017-01-10 2022-11-08 President And Fellows Of Harvard College Multiplexed signal amplification
US11639522B2 (en) 2015-01-30 2023-05-02 President And Fellows Of Harvard College Microscope-free imaging
US11981956B2 (en) 2018-01-26 2024-05-14 President And Fellows Of Harvard College Proximity detection methods and compositions

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120035065A1 (en) * 2004-10-05 2012-02-09 California Institute Of Technology Aptamer Regulated Nucleic Acids and Uses Thereof
US20130274135A1 (en) * 2010-10-27 2013-10-17 President And Fellows Of Harvard College Compositions of toehold primer duplexes and methods of use
US20130338015A1 (en) * 2012-06-15 2013-12-19 Emerald Therapeutics, Inc. Polynucleotide probe design

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120035065A1 (en) * 2004-10-05 2012-02-09 California Institute Of Technology Aptamer Regulated Nucleic Acids and Uses Thereof
US20130274135A1 (en) * 2010-10-27 2013-10-17 President And Fellows Of Harvard College Compositions of toehold primer duplexes and methods of use
US20130338015A1 (en) * 2012-06-15 2013-12-19 Emerald Therapeutics, Inc. Polynucleotide probe design

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
JIANG ET AL.: "Real-time detection of isothermal amplification reactions with thermostable catalytic hairpin assembly", J AM CHEM SOC., vol. 135, 22 May 2013 (2013-05-22), pages 1 - 12 *
PAIGE ET AL.: "Fluorescence imaging of cellular metabolites with RNA", SCIENCE, vol. 335, 9 March 2012 (2012-03-09), pages 1 - 3 *

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11639522B2 (en) 2015-01-30 2023-05-02 President And Fellows Of Harvard College Microscope-free imaging
JP2017079634A (ja) * 2015-10-27 2017-05-18 国立大学法人 熊本大学 生体試料中の目的とする細胞を検出する方法
US11286517B2 (en) 2016-02-17 2022-03-29 President And Fellows Of Harvard College Molecular programming tools
WO2017143006A1 (fr) * 2016-02-17 2017-08-24 President And Fellows Of Harvard College Outils de programmation moléculaire
US11359229B2 (en) 2016-09-20 2022-06-14 President And Fellows Of Harvard College Molecular verification systems
CN110079866A (zh) * 2016-12-22 2019-08-02 胡家铭 一种免疫脂质-聚合物杂化纳米粒生物芯片和其应用
US11492661B2 (en) 2017-01-10 2022-11-08 President And Fellows Of Harvard College Multiplexed signal amplification
CN108048533B (zh) * 2017-11-22 2021-03-23 中国科学院长春应用化学研究所 基于三通连接-核酸分子线路换能器的分子检测方法
CN108048533A (zh) * 2017-11-22 2018-05-18 中国科学院长春应用化学研究所 基于三通连接-核酸分子线路换能器的分子检测方法
US11981956B2 (en) 2018-01-26 2024-05-14 President And Fellows Of Harvard College Proximity detection methods and compositions
CN110286216A (zh) * 2019-05-16 2019-09-27 中国科学院武汉物理与数学研究所 一种快速可视化的溶血性大肠杆菌o157：h7检测方法
CN111521808A (zh) * 2020-05-26 2020-08-11 济南大学 一种检测多氯联苯的生物传感器及其制备方法
CN111521808B (zh) * 2020-05-26 2022-11-25 济南大学 一种检测多氯联苯的生物传感器及其制备方法
CN111690722A (zh) * 2020-06-29 2020-09-22 闽江学院 基于熵驱动和杂交链反应的atp检测核酸传感器及其制备方法

Similar Documents

Publication Publication Date Title
WO2015095633A1 (fr) Procédés et compositions concernant des circuits d'acide nucléique et des transducteurs de signal
Bhadra et al. Design and application of cotranscriptional non-enzymatic RNA circuits and signal transducers
Zhang et al. CRISPR/Cas12a-assisted ligation-initiated loop-mediated isothermal amplification (CAL-LAMP) for highly specific detection of microRNAs
Li et al. Adapting enzyme-free DNA circuits to the detection of loop-mediated isothermal amplification reactions
Bhadra et al. A Spinach molecular beacon triggered by strand displacement
JP4918210B2 (ja) ポリヌクレオチドの合成方法
Yue et al. Cross-catalytic hairpin assembly-based exponential signal amplification for CRET assay with low background noise
JP6638122B2 (ja) 標的核酸の検出方法及びキット
EP1869217A2 (fr) Méthodes, compositions et trousses de détection de micro-arn
US9562258B2 (en) Sequence-specific detection of nucleotide sequences
EP3207160B1 (fr) Adn de conversion de séquence et amplificateur de signal comportant des acides nucléiques verrouillés et procédés de détection l'utilisant
EP2137321B1 (fr) Procédés permettant la détection d'une séquence nucléotidique cible dans un échantillon et utilisant un complexe nucléase/aptamère
CN108064312B (zh) 基于具有靶扩增的信号放大dna级联反应的检测方法
US20110294125A1 (en) Colorimetric biosensor with allosteric dnazyme activation and rolling circle signal amplification
AU2011323478A1 (en) Integrated capture and amplification of target nucleic acid for sequencing
Song et al. Self-priming hairpin-utilized isothermal amplification enabling ultrasensitive nucleic acid detection
Carbonell et al. Design, synthesis, and functional analysis of highly specific artificial small RNAs with antiviral activity in plants
KR102323375B1 (ko) 다중 프로브
Huang et al. High-specific microRNA detection based on dual-recycling cascade reaction and nicking endonuclease signal amplification
CN115335536A (zh) 用于即时核酸检测的组合物和方法
WO2021147910A1 (fr) Procédés et kits pour l'amplification et la détection d'acides nucléiques
Marciniak et al. Coupled rolling circle amplification loop-mediated amplification for rapid detection of short DNA sequences
US20230323439A1 (en) Crispr-based methods for the detection of nucleic acids in a sample
JP7026416B2 (ja) 非線形増幅率を示すスイッチ様等温ｄｎａ増幅
Bhadra et al. Design, synthesis, and application of spinach molecular beacons triggered by strand displacement

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14871247

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 14871247

Country of ref document: EP

Kind code of ref document: A1