WO2015094117A1 - Levure de fermentation de xylose - Google Patents

Levure de fermentation de xylose Download PDF

Info

Publication number
WO2015094117A1
WO2015094117A1 PCT/SG2014/000600 SG2014000600W WO2015094117A1 WO 2015094117 A1 WO2015094117 A1 WO 2015094117A1 SG 2014000600 W SG2014000600 W SG 2014000600W WO 2015094117 A1 WO2015094117 A1 WO 2015094117A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
acid sequence
seq
xylose
cell
Prior art date
Application number
PCT/SG2014/000600
Other languages
English (en)
Inventor
Anli Geng
Bingyin PENG
Original Assignee
Ngee Ann Polytechnic
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ngee Ann Polytechnic filed Critical Ngee Ann Polytechnic
Publication of WO2015094117A1 publication Critical patent/WO2015094117A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/22—Processes using, or culture media containing, cellulose or hydrolysates thereof
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/90—Isomerases (5.)
    • C12N9/92—Glucose isomerase (5.3.1.5; 5.3.1.9; 5.3.1.18)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C12P7/06—Ethanol, i.e. non-beverage
    • C12P7/08—Ethanol, i.e. non-beverage produced as by-product or from waste or cellulosic material substrate
    • C12P7/10—Ethanol, i.e. non-beverage produced as by-product or from waste or cellulosic material substrate substrate containing cellulosic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y503/00—Intramolecular oxidoreductases (5.3)
    • C12Y503/01—Intramolecular oxidoreductases (5.3) interconverting aldoses and ketoses (5.3.1)
    • C12Y503/01005—Xylose isomerase (5.3.1.5)
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00—Technologies for the production of fuel of non-fossil origin
    • Y02E50/10—Biofuels, e.g. bio-diesel

Definitions

  • the invention relates to the use of nucleic acid molecules encoding prokaryotic xylose isomerase in eukaryotic host cells.
  • the invention also relates to a method for processing of lignocellulose material.
  • Fossil-based fuels and polymers are dominant in the current global economy.
  • economic development that is dependent on the consumption of fossil resources is not sustainable.
  • the available reservoir of fossil resources such as petroleum, coal, and natural gas, may be depleted in 35, 107, and 37 years, respectively.
  • bio- refined fuels could satisfy the demand for power and provide a sustainable way to produce these fuels by converting biomass resources.
  • Lignocellulose is the most abundantly available biomass on earth and it is composed of cellulose, hemicelluloses and lignin.
  • the hemicellulose content is about 13-39 percent in different lignocellulosic materials
  • xylose is the main monomer in hemicellulose.
  • agricultural waste such as oil palm empty fruit bunch fiber
  • xylose makes up more than 20 percent of the dry material, which is more than half of the glucose content. Therefore, effective conversion of xylose to desired chemicals and fuels is essential for a commercially viable bio-refinery process.
  • the budding yeast Saccharomyces cerevisiae is a key cellular factory for a bio-refinery. This yeast has several advantages for industrial applications, for example, fast ethanolic fermentation from glucose; tolerance to low pH; resistant to stress and is generally regarded as safe. It can be potentially used to produce a wide range of fuels and chemicals, for example, ethanol, butanol, lactic acid, pyruvic acid, malic acid, glycerol, 1 , 3 -propanediol and succinic acid. Saccharo yces cerevisiae can effectively consume hexoses such as glucose, mannose and galactose, but cannot utilize xylose.
  • an isolated codon optimised nucleic acid sequence that encodes a xylose isomerase protein or enzymatically active fragment thereof, comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs : 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, and 13, or a variant thereof.
  • an expression construct comprising the isolated codon optimised nucleic acid sequence as described herein.
  • a method for processing of lignocellulose material comprising: treating the lignocellulose material to produce lignocellulosic biomass hydrolysate containing glucose, xylose, galactose, mannose, and arabinose; contacting at least one cell as described herein with the lignocellulosic biomass hydrolysate; and culturing said at least one cell under conditions where the substrate is- catabolized to one or more fuels and/or chemicals.
  • codon optimized refers to the codon usage - bias in a particular organism.
  • Codon usage bias reflects the differences in the frequency of occurrence of synonymous codons in coding DNA.
  • a codon is a series of three nucleotides (a triplet) that encodes a specific amino acid residue in a polypeptide chain or for the termination of translation (a stop codon).- There are 64 different codons (61 codons encoding for amino acids plus 3 stop codons) but only 20 different translated amino acids. The overabundance in the number of codons allows many amino acids to be encoded by more than one codon. Because of such redundancy it is said that the genetic code is degenerate.
  • lignocellulose material refers to any of several closely related substances constituting the essential part of woody cell walls of plants and consisting of cellulose intimately associated with lignin
  • cellulose refers to a linear polysaccharide of several hundred to many thousands of ⁇ ( 1—4 ) linked D-glucose units.
  • lignin refers to a complex polymer of aromatic alcohols ⁇ known as monolignols. It is most commonly derived from wood, and is an integral part of the secondary cell walls of plants and some algae.
  • PCR polymerase chain reaction
  • isolated means that a nucleic acid molecule, gene, or oligonucleotide is essentially free from the remainder of the human genome and associated cellular or other impurities. This does not mean that the product has to have been extracted from the human genome; rather, the product could be a synthetic or cloned product for example . .
  • nucleic acid means any single or double -stranded RNA or DNA molecule, such as mRNA, cDNA, and genomic DNA.
  • nucleic acid sequence refers to a succession of letters that indicate the order of nucleotides within a DNA (using GACT) or RNA (GACU) molecule.
  • the nucleotide sequences presented herein are contiguous, 5' to 3' nucleotide sequences, unless otherwise described.
  • dNTPs refers to deoxyribonucleotide triphosphates comprising the four deoxyribonucleotides : dATP, dCTP, dGTP and dTTP, which are polymerized by DNA polymerase to produce DNA.
  • a “deletion” may be defined as a change in a nucleic acid sequence in which one or more nucleotides is absent.
  • An "insertion” or “addition” may be defined as a change in a nucleic acid sequence which has resulted ⁇ in the addition of one or more nucleotides.
  • a "substitution" may result from the replacement of one or more nucleotides by a molecule which is a different molecule from the replaced one or more nucleotides.
  • a nucleic acid may be replaced by a different nucleic acid as exemplified by replacement of a thymine by a cytosine, adenine, guanine, or uridine.
  • Pyrimidine to pyrimidine e.g. C to T or T to C nucleotide substitutions
  • purine to purine e.g. G to A or A to G nucleotide substitutions
  • transitions whereas pyrimidine to purine or purine to pyrimidine (e.g.
  • G to T or G to C or A to T or A to C are termed transversions .
  • a nucleic acid may be replaced by a modified nucleic acid as exemplified by replacement of a thymine by thymine glycol. Mutations may result in a mismatch.
  • mismatch refers to a non-covalent interaction between two nucleic acids, each nucleic acid residing on a different polynucleic acid sequence, which does not follow the base-pairing rules. For example, for the partially complementary sequences 5'-AGT-3* and 5'-AAT-3', a G-A mismatch (a transition) is present.
  • the term "obtained or derived from” as used herein is meant to be used inclusively. That is, it is intended to encompass any nucleotide sequence directly isolated from a biological sample or any nucleotide sequence derived from the sample .
  • the term “substantially” does not exclude “completely” e.g. a composition which is “substantially free” from Y may be completely free from Y. Where necessary, the word “substantially” may be omitted from the definition of the invention.
  • the term "about”, in the context of concentrations of components of the formulations, typically means +/- 5% of the stated value, more typically +/- 4% of the stated value, more typically +/- 3% of the stated value, more typically, +/- 2% of the stated value, even more typically +/- 1% of the stated value, and even more typically +/- 0.5% of the stated value .
  • range format is merely for convenience and brevity and should not be construed as "an inflexible limitation on the scope of the disclosed ranges. Accordingly, the description of a range should be considered to have specifically disclosed all the possible sub-ranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed sub-ranges such as from 1 to 3, from 1 to 4, from 1 to 5 , from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range .
  • Figure 1 Phylogenetic tree using PID from ' MafftWS alignment of amino acid sequences of several xylose isomerase.
  • Figure 2 The map of plasmid pJPPP-XK.
  • FIG. 1 Map of Bacteroides vulgatus xylose isomerase expression plasmid under the promoter of TDH3 or TEF1.
  • Figure 4 Plasmids used for Piromyees sp. E2 xylose isomerase gene expression.
  • Figure ' 5 The activities of xylose isomerase from Bacteroides vulgatus (BvuXI) and Piromyees sp. E2 (PiroXI) expressed in Saccharomyces cerevisiae . Vector containing no XI was used as the control .
  • Figure 7 Continuous transferring cultivation of JUK61a in the synthetic minimal media with 20 g l "1 xylose as the sole carbon source.
  • Figure 8 Batch fermentation of JU xlla on 20 g l "1 xylose.
  • Figure 9 Map of bacterial xylose isomerase expression plasmids under the promoter of PGKl.
  • Figure 10 Aerobic growth of 36a and 39a strains harboring different xylose isomerase genes on 40 g l ""1 xylose.
  • the isolated codon optimised nucleic acid sequence comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs : 1, 2, ,3, 4, 5, 6, 7, 8, 9, 10, 11, 12, and 13, or a variant thereof.
  • the isolated codon optimised nucleic acid sequence of described herein may be SEQ ID NO: 1.
  • the variant may comprise one or more nucleotide base substitutions, additions, deletions or modifications.
  • the variant has at least 80%, 85%, 90% or 95% sequence identity to a nucleic acid sequence selected from the group consisting of SEQ ID NOs : 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, and 13.
  • the nucleotide sequences may have about 80% and above sequence identity with SEQ ID 1, SEQ ID 2, SEQ ID 3, SEQ ID 4, SEQ ID 5, SEQ ID 6, SEQ ID 7, SEQ ID 8, SEQ ID 9, SEQ ID 10, SEQ ID 11, SEQ ID 12, and SEQ ID 13.
  • the nucleotide sequences encode the same peptides or the peptides with 95% sequence identity from those deposited in European Nucleotide Archive under access No.
  • the isolated codon optimised nucleic acid sequence of as described herein may be codon optimized, wherein the nucleic acid sequence is codon optimized for expression in a yeast, a mammal, a bacteria or insect cell.
  • codon optimization of the nucleic acid described herein may be performed according to the host codon usage bias .
  • the codon adaptation index (CAI) of the sequence to a host may be used to evaluate the codon usage bias that may influence the gene expression efficiency.
  • the value of CAI for the nucleic acid sequence to a host should be at least 0.2, and the preferred value is greater than 0.4.
  • the isolated codon optimised nucleic acid as described herein may be derived from a xylose isomerase gene from Alistipes, Paraprevotella xylaniphila, Capnocytophaga, Tannerella, Tannerella forsythia, Bacteroides helcogenes, Bacteroxdes plebeius, Bacteroxdes vulgatus, Bacteroides clarus, Bacteroxdes eggerthii , Bacteroxdes fluxus, Bacteroxdes intestinalis or Bacteroides finegoldii .
  • the present disclosure also provides an isolated polypeptide encoded by the codon optimised nucleic acid sequence described herein.
  • the isolated polypeptide may have at least 80%, 85%, 90% or 95% sequence identity to a polypeptide selected from the group consisting of SEQ ID NO: 14, 15, 16, 17 or 18, wherein the polypeptide has xylose isomerase activity. .. .
  • the codon optimized sequence may be ligated into an expression construct between a promoter and a terminator to generate an expression cassette.
  • the expression construct may be a plasmid or a vector.
  • the plasmid or vector may be introduced into the host cell by transformation using standard techniques well known in the art.
  • -the plasmid or vector may be transformed by a technique selected from the group consisting of lithium acetate (LiAc) /single -stranded DNA (SS -DNA) /polyethylene glycol (PEG) protocol, electroporation, and enzymatic digestion.
  • the expression construct may comprise the isolated codon optimised nucleic acid sequence as described herein.
  • the expression construct may be a plasmid or a vector.
  • the codon optimised nucleic acid sequence may be operably linked to a promoter and a terminator.
  • the promoter used to control xylose isomerase gene expression is preferably a strong promoter.
  • Such strong promoters may comprise glycolytic promoters, such as promoters for 3 -phosphoglycerate kinase ⁇ PGK1) , glyceraldehyde-3 - phosphate dehydrogenase (TDH3) , fructose 1, 6-bisphosphate aldolase (FBAlp) , triose phosphate isomerase (TPIl) , and pyruvate decarboxylase (PDC1) and the like, or the transcription elongation factor (TEF1) promoter.
  • glycolytic promoters such as promoters for 3 -phosphoglycerate kinase ⁇ PGK1) , glyceraldehyde-3 - phosphate dehydrogenase (TDH3) , fructose 1, 6-bisphosphate aldolase (FBAlp) , triose phosphate isomerase (TPIl)
  • the terminator used for expression of xylose isomerase may be heterogeneous or endogenous .
  • Saccharomyces cerevisiae terminators of genes PGK1, CYC1 (Cytochrome c) , TEF1, TDH3, ADH1 (alcohol dehydrogenase), PDC1 , and TPI1 and the like may be used. It will be appreciated by those of skill in the art that the promoter and terminator are not limited to those described herein.
  • the xylose isomerase expression cassette may be introduced into the host, for example Saccharomyces cerevisiae, via a yeast episomal plasmid (YEp) , a yeast integrating plasmid (Yip) , a yeast replicating plasmid (YRp) , a yeast centromere plasmid (YCp) , or by random genome integration. It is preferred that the plasmid can maintain high-copy number in the host cell, for example, YEp, YRp andmulti-integrated Yip.
  • the integration site may be a ribosome DNA region, for example, NTS2 (Non-transcribed region of the rDNA repeat) in Saccharomyces cerevisiae, or a ⁇ -sequence.
  • NTS2 Non-transcribed region of the rDNA repeat
  • the host where the xylose isomerase is introduced may be Saccharomyces cerevisiae, but not limited to Saccharomyces cerevisiae .
  • the yeast host may be selected from the genera Saccharomyces, Candida, Kluyveromyces, Schizosaccharomyces, Scheffersomyces, Hansenula, Kloecher, Schwanniomyces,
  • the optimized sequence of the xylose isomerase gene may be any of the sequences -described herein.
  • the promoter and terminator may be endogenous or heterogeneous to the host .
  • the plasmid used to express xylose isomerase may be integrated into the host genome.
  • host cells may also contain other genetic modifications in their respective genomes.
  • the modifications in the genome can be generated by spontaneous mutagenesis or by the exposure to a mutagen or any other means known in the art.
  • Other genetic - modifications and mutations may improve xylose utilization, host tolerance to toxic components; tolerance to a stressful environment or an improvement in the yield of a desired chemical or fuel.
  • the downstream pathway of xylose metabolism can be supported by overexpressing the relevant enzymes (or genes), for example, xylulokinase (XKS1; EC 2.7.1.17,), transaldolase ⁇ TALI) ⁇ TALI; EC 2.2.1.2), transketolase ( TKL1 ; EC 2.2.1.1), ribose-5- phosphate isomerase ⁇ RKI1,- EC 5.3.1.6), and ribulose 5- phosphate 3-epimerase (RPE1; EC 5.1.3.1) .
  • By-product xylitol may be reduced by knocking-out endogenous xylose reductase (aldose reductase) ( GRE3 ; EC 1.1.1.21) .
  • the cell is a yeast cell.
  • the yeast cell may be a species selected from the group consisting of Pichia, Candida, Schizosaccharomyces, Zygosaccharo yces, Saccharomyces, Kluyveromyces, Scheffersomyces, Hansenula, Kloecher, Schwanniomyces, Yarrowia, and Sret anomyces .
  • the cell may be selected from the group consisting of Saccharomyces cerevisiae, Saccharomyces bayanus, and Saccharomyces carlsbergensis .
  • the cell may be Saccharomyces cerevisiae cell.
  • the method comprises: treating the lignocellulose material to produce lignocellulosic biomass hydrolysate containing glucose, xylose, galactose, mannose, and arabinose; contacting at least one cell as described herein with the lignocellulosic biomass hydrolysate; and culturing said at least one cell under conditions where the substrate is catabolized to one or more fuels and/or chemicals.
  • the lignocellulosic material may comprise cellulose, hemicellulose and lignin.
  • the cellulose may contain glucose and polymerized glucose such as cellobiose, cellotriose, cellooligosaccharides or glucan.
  • the hemicellulose may contain xylose and polymerized xylose such as xylobiose, xylotriose, xylooligosaccharides , xylan or xylosides.
  • the lignocellulosic materials may be selected from the group consisting of rice straw, reed, sugarcane bagasse, corn stalks, corn cobs, oil palm empty fruit bunch, oil palm trunk, oil palm fronds, palm kernel shells, and mesocarp fiber, sweet sorghum, wood, and organic wastes from industries of pulp and paper, wood processing, and/or horticulture, energy crops, and any woody and herbaceous plant biomass .
  • the energy crops may be selected from the group consisting of jatropha, Sida Hermaphrodita, Cardoon (Cynara cardunculus) , fungi, and algae, woody crops and herbaceous crops.
  • the woody crops include but are not limited to willow and poplar.
  • the herbaceous crops include but are not limit to Switchgrass, elephant grass (Miscanthus and Pennisetum purpureum), and tall wheatgrass.
  • the one or more fuels and/or chemicals may be selected from the group consisting of ethanol, butanol, fatty acid, fatty acid esters, lactic acid, acetic acid, adipic acid, 1,3- propylene glycol, 1, 2 -propanediol, ethylene, glycerol, 2,3- butanediol, 1, -butanediol, butadiene, glycolate, oxalate, malonate, oxalaacetate, malate, fumarate, succinate, acetoacetate , Jeta-hydroxybutyric acid, 4-hydroxybenzoate, catechol, muconate, ethylacetate , and any other chemicals can be derived from sugar through fermentation.
  • the one or more fuels and/or chemicals is ethanol.
  • the invention illustratively described herein may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein.
  • the terms and expressions employed herein have been used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and " described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed.
  • amino acid sequences of xylose isomerase used in analysis can be found under the EMBL-EBI access Nos .
  • AEL74969.1 uncultured microorganism
  • ACA65427.1 [Orpinomyces sp. ukkl)
  • CAB76571.1 (Piro yces sp. E2)
  • EGG54729.1 Paraprevotella xylaniphila, SEQ ID 15
  • EGJ53764.1 Capnocytophaga sp. oral taxon 329 str. F0087, SEQ ID 16
  • EHL81684.1 ⁇ Tannerella sp.
  • Phylogenetic tree analysis showed that these xylose isomerases exhibited a close relationship (Fig. 1) .
  • 6_1_58FAA_CT1 (SEQ ID 17), Bacteroides plebeius (EDY95162.1) , Tannerella forsythia (SEQ ID 18) , Bacteroides helcogenes (ADV44323.1) , Bacteroides clarus (EGF54042.1) , Bacteroides eggerthii (EFV28579.1) , Bacteroides fluxus (EGF56331.1) , Bacteroides stercoris (AEK21499.1) , Bacteroides vulgatus (ABR41556.1) , Bacteroides intestinalis (EDV03057.1) ,
  • Bacteroides finegoldii (EEX47182.1) and Bacteroides thetaiotaomicron (AAO75900.1) had lower than 80% identity to AEL74969.1 and about 80% identity to Piromyces sp. E2 xylose isomerase. Furthermore, the identity of Alistipes sp. HGB5 xylose isomerase (SEQ ID 14) to Piromyces sp. E2 xylose isomerase (CAB76571.1) was 76% and that to the rest xylose isomerase was lower than 81%.
  • Table 1 Sequence identity matrix of the amino acid sequences of xylose isomerases aligned by ClustalW.
  • CAI was calculated - through an online tool
  • CAI EMBL-ENA Organism accession original gene value of d gene for the for from for the optimize sequence optimize origina d and d original 1 original sequence sequence sequenc sequence
  • T Llrec2a arm2 TTAGGATCCTTTGAGCTCTTTGGTACCA
  • ADHlpa promoter ACACCGGCAGCCATTGTATATGAGATAG
  • KanMX4a TATCCTGCAGGCATAGGCCACTAGTGGA
  • FBAlp-TKLl (1, 318) (recombinant arm targeting to TKL1 open reading frame, ORF)
  • TKL1 -501 , -286) (recombinant arm targeting to TKL1 promoter)
  • PDClp-TALl- TALlt ADHlp-RKIl-RKIlt
  • TPIlp-RPEl -RPElt and PGKlp-XKSl-XKSlp
  • G418 resistant marker loxP-KanMX4 -loxP was amplified from plasmid pUG6. These DNA fragments were sequentially cloned into pUC19 (Yanisch-Perron et al . , 1985) to generate the plasmid pJPPP-XK (Fig. 2) . Details of plasmid pJPPP-XK construction are as follows:
  • the FBA1 promoter and recombinant arm 1 targeting to TKL1 ORF (1,318) were fused using primers FBAlps and TKLlrecla.
  • a SphI-ffindlll digested FBAlp-TKLl (1, 318) fragment was cloned into the SphI-HindiII sites of pUC19 to generate pGALOl.
  • Recombinant arm 2 targeted to TKL1 promoter region (- 501,-286).
  • An EcoRI-BamHIII digested TKL1 (-501, -286) fragment was cloned into EcoRI-BarriHIII sites of pGALOl to generate pGAL02.
  • ADH1 promoter and RKI1 were fused using primers ADHlps and RKIla.
  • a Sacl-Kpnl digested ADHlp-RKIl fragment was cloned into the Sacl-Kpnl site of pGAL03-l to generate pGAL04.
  • TPI1 promoter and RPE1 were fused using primers TPIlps and RPEla.
  • a BamHI-SacI digested TPIlp-RPEl fragment was cloned into the BamHI-SacI site of pGAL04 to generate pGAL05.
  • PGK1 promoter and XKS1 were fused using primers PGKlps and XKSla.
  • a BamHI-Sbfl digested TPIlp-RPEl fragment was cloned into the Ba-riHI-Sfofl site of pGAL05 to generate pGAL06.
  • Saccharomyces cerevisiae haploid strain was isolated by the diploid strain S. cerevisiae ATCC 24860.
  • the diploid strain was cultivated in 20 g L "1 potassium acetate (pH 6.0) for four days.
  • the cell wall was digested with Zymolyase 20T. Any spores sticking to the plastic tube were resuspended in 0.01% (V/V) triton X-100 by a bath sonicator and spread on YPD (10 g L "1 yeast extract, 20 g IT 1 peptone, 20 g I 1 glucose) plates to isolate single clones.
  • the mating type was analyzed by 'PCR.
  • the LiAc/ssDNA/PEG solution was used for yeast transformation (Gietz and Woods 2002) .
  • the disruption of ura3 , gre3 and cyc3 was performed according to protocols by Giildener et al. (1996) using primers listed in Table 4.
  • Overexpression of the downstream genes of xylose metabolism was performed by digesting the plasmid pJPPP-XK using restriction enzyme swal and then transforming the digested plasmid into Saccharomyces cerevisiae, and then removing- the KanMX4 selectable marker through Cre-loxP recombination (Giildener et al . (1996) .
  • JUK36a MATa ura3 : : loxP TKLl(-268, -1) : :RKIlt-RKIl- ADHlp-RPE11 -RPE1 -TPI1 -LoxP- XKS11-XKS1 -PGKlp-PDClp-TALI -TALIt- FBAlp gre3::loxP.
  • JUK39a MATa ura3 : : loxP TKLl(-268, -1) : :RKIlt-RKIl- ADH1p-RPE11-RPE1 -TPI1 -LoxP- XKS11-XKS1 -PGKlp-PDClp-TALI -TALIt - FBAlp gre3::loxP cyc3 : : loxP.
  • Table 4 Primers used for gene disruption and verification, The sequences underlined represent the homogenous region involved gene disruption.
  • TDH3ps ACCCTCGAGATAAAAAACACGCTTTTTC
  • the coding sequence of Bacteroides vulgatus xylose isomerase was artificially synthesized according to the sequence EMBL-ENA accession No. ABR41556.1, and then amplified by polymerase chain reaction (PCR) using primers BvuXylAs and BvuXylAa.
  • PCR polymerase chain reaction
  • a TDH3 promoter from Saccharomyces cerevisiae was amplified using PCR using primers (TDH3ps and TDH3pa) and Saccharomyces cerevisiae genomic DNA as template.
  • PGK1 promoter from Saccharomyces cerevisiae was amplified by PCR using primers (PGKlts and PGKla) and Saccharomyces, cerevisiae genomic DNA as template.
  • Bacteroides vulgatus xylose isomerase ' expression cassette TDH3p-BvuXylA-PGKlt was amplified through over-lap extension PCR using primers (TDH3ps and PGKlta) and the DNA fragments of TDH3 promoter, Bacteroides vulgatus gene and PGK1 terminator as template.
  • TDH3p- BvuXylA-PGKl was digested using restriction enzymes Xhol and Sbfl and cloned into the Sail/Pstl site of pRS327 (ATCC) , and then URA3 marker gene was cut out from pUG72 (Euro SCARF) by Xbal and Ndel and cloned into the Spel/Ndel sites. In the end, pJFXll was generated (Fig. 3) .
  • the yeast expression vector pJFEll was constructed by replacing GAL1 promoter of plasmid pYES2 by TEF1 promoter.
  • TEF1 promoter was amplified by PCR using primers TEFlps and TEFlpa, and PCR fragment was digested by restriction enzymes Xhol and Spel and cloned into Xhol/Spel sites in pYES2 to generate pJFEll.
  • E2 xylose ' isomerase gene was synthesized artificially and amplified by PCR " using the primers PiroXylAs and PiroXylAa, and PCR fragment was digested by restriction enzymes BanMI and Xhol, and cloned into BamHI/Xhol sites of pJFEll to generate pJFXl ' 2 (Fig. 4) .
  • the Saccharomyces cerevisiae strain JUK36a (MATa ura3 : : loxP TKL1 (-268, -1) : : RKI11 -RKI1 -ADH1p-RPEl t-RPE1 - PI1 - LoxP-XKSlt-XKSl-PGKlp-PDClp-TALl-TALlt-FBAlp gre3 : : loxP) was used as host to express xylose isomerase from Bacteroides vulgatus and Piromyces sp. E2. Generation of JUK36a can be found in examples 3 and 4.
  • Plasmids pJFEll (Empty vector) , pJFXll (BvuXI) and pJFX12 (PiroXI) were transformed into JUK36a through LiAc/PEG/ssDNA method to generate JUK50a (No xylose isomerase) , JUK51a (BvuXI) and JU 52a (PiroXI) , separately.
  • Xylose isomerase activities were determined by following method. Cells were cultivated in glucose minimal media (YNB 6.7 g l "1 , 20 g l "1 glucose, pH 6.0) and were harvested at OD 600 3.0. Cell-free extracts were prepared in 100 mM tris-HCl buffer (pH 7.5), using a glass bead beater, and protease inhibitor cocktail set IV (Merck) was added. The xylose isomerase activity of the cell extracts was determined at ambient temperature (25°C) , using the UV-VIS Spectrophotometer 1240 (Shimazu) .
  • the 1 ml reaction mixture contained 100 mmol 1 _1 Tris-HCl buffer (pH 7.5), 10 mmol l -1 MgCl 2 , 500 mmol l -1 xylose, 1 U of sorbitol dehydrogenase (Roche), 0.15 mmol l "1 NADH, and 0.05 ml of the cell extract. Protein concentrates were measured using the Coomassie protein assay kit (Thermo Scientific) . One unit of enzyme activity was defined as the amount of enzyme required to oxidize 1 ⁇ of coenzyme/min, and the specific activity was expressed in units per milligram of protein.
  • xylose isomerase from Bacteroides vulgatus was expressed in Saccharomyces cerevisiae with an increased activity, which was 4.6-fold to xylose isomerase from Piromyces sp. E2 (Fig. 5) .
  • Synthetic minimal media (Yeast nitrogen base, YNB, 6.7 g l "1 , pH 6.0) supplied with 20 g l "1 Xylose was used in batch cultivation of strains JUK51a (BvuXI) and JUK52a (BvuXI) . Aerobic cultivation was performed in 125 ml cotton-plugged Erlenmeyer flask with 30 ml media in 200 rpm shaker at 30°C. Biomass was monitored by measuring the absorbance at the wavelength of 600 nm.
  • Saccharomyces cerevisiae strain JUK39a (MATa ura3::loxP TKLK-268, -1) : : RKIlt-RKIl-ADHlp-RPElt-RPEl-TPIl- LoxP-XKSlt-XKSl-PGKlp-PDClp-TALl-TALlt-FBAlp gre3 : : loxP cyc3::loxP), a respiration-deficient strain generated from JUK36a by disrupting cyc3 (encoding cytochrome c heme lyase) , was used as host (Example 4). Bacteroides vulgatus xylose isomerase plasmid pJFXll was transformed into JUK39a to generate JUK61a.
  • Saccharomyces cerevisiae strain JUK36a ATa ura3::loxP TKLl(-268, -1) : : RKIlt-RKIl-ADHlp-RPElt-RPEl-TPIl- LoxP-XKSlt-XKSl-PGKlp-PDClp-TALl-TALlt-FBAlp gre3::loxP
  • JUK39a MATa ura3 : : loxP TKLl(-268, -1) : : RKIlt-RKIl-ADHlp- RPE1t-RPE1-TPI1-LoxP-XKSIt-XKS1-PGKlp-PDClp-TALI-TALIt-FBAlp gre3 : : loxP
  • xylose isomerase from Bacteroides vulgatus (ABR41556.1) , Tannerella sp.
  • 6_1_58FAA_CT1 (EHL8168 .1) , Alistipes sp . HGB5 (EFR57390.1) and Paraprevotella xylaniphila (EGG54729.1) in Saccharomyces cerevisiae .
  • Generation of JUK36a and JUK39a can be found in examples 3 and .
  • Plasmids pPYl-Bvu (BvuXI) , pPYl-TAA (TAAXI) , pPYl-HGB5 (HGB5XI) and pPYl-YIT (YITXI) were transformed into JUK36a and JUK39a through LiAc/PEG/ssDNA method to generate 36a(Bvu), 36a (TAA) , 36a(HGB5), 36a(YIT), 39a(Bvu), 39a (TAA) , 39a(HGB5), and 39a (YIT) , separately .
  • Synthetic minimal media (Yeast nitrogen base, YNB, 6.7 g l "1 , pH 6.0) supplied with 40 g l "1 xylose was used in batch cultivation of strains 36a and 39a strains. Aerobic cultivation was performed in 125 ml cotton-plugged Erlenmeyer flask with 30 ml media in 200 rpm shaker at 30°C. Biomass was monitored by measuring the absorbance at the wavelength of 600 nm.
  • strains harboring HGB5 xylose isomerase gene was able to utilize xylose more rapidly than other strains and produced more ethanol.
  • respiration deficient 39a strains were able to utilize more xylose and produced ethanol in higher concentration and higher production rate.
  • JUK61a JUK39a derivative ⁇ pJFXll ⁇ JUKxlla Obtained from the adaptive cultivation of JUK61a on xylose
  • E2 xylose isomerase gene under the control of TEFl promoter and CYCl terminator pPYl pYES2, PpGKi'TcYci pPYl-Bvu pPYl, Bacteroides vulgatus xylose isomerase gene under the control of PGKl promoter and CYCl terminator pPYl-TAA pPYl, Tannerella sp. 6_1_58FAA_CT1 xylose isomerase gene under the control of PGKl promoter and CYCl terminator pPYl-HGB5 pPYl, Alistipes sp . HGB5 xylose
  • isomerase gene under the control of PGKl promoter and CYCl terminator pPYl-YIT pPYl, Paraprevotella xylaniphila xylose isomerase gene under the control of PGKl promoter and CYCl terminator

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

L'invention concerne une séquence d'acide nucléique optimisée par codon, isolée, qui code pour une protéine xylase-isomérase ou son fragment enzymatiquement actif, comprenant une séquence d'acide nucléique sélectionnée dans le groupe constitué des SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, et 13, ou un variant de celles-ci. L'invention concerne également un polypeptide isolé codé par la séquence d'acide nucléique optimisée par codon et un procédé de traitement de matière lignocellulosique.
PCT/SG2014/000600 2013-12-16 2014-12-16 Levure de fermentation de xylose WO2015094117A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
SG2013092820A SG2013092820A (en) 2013-12-16 2013-12-16 Xylose isomerase genes for xylose-fermenting yeast construction
SG201309282-0 2013-12-16

Publications (1)

Publication Number Publication Date
WO2015094117A1 true WO2015094117A1 (fr) 2015-06-25

Family

ID=53403266

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/SG2014/000600 WO2015094117A1 (fr) 2013-12-16 2014-12-16 Levure de fermentation de xylose

Country Status (2)

Country Link
SG (1) SG2013092820A (fr)
WO (1) WO2015094117A1 (fr)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105200098A (zh) * 2015-06-30 2015-12-30 苏州汉酶生物技术有限公司 一种利用酿酒酵母酶法制备瑞鲍迪甙m的方法
WO2020255106A1 (fr) * 2019-06-21 2020-12-24 Universidade Do Minho Nouveau gène de xylose isomérase et polypeptide et utilisations correspondantes
US11312985B2 (en) 2016-10-21 2022-04-26 Pepsico, Inc. Enzymatic method for preparing Rebaudioside C
US11352653B2 (en) 2016-10-21 2022-06-07 Pepsico, Inc. Enzymatic method for preparing rebaudioside N
US11359222B2 (en) 2016-10-21 2022-06-14 Pepsico, Inc. Enzymatic method for preparing Rebaudioside j

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009109633A1 (fr) * 2008-03-07 2009-09-11 Dsm Ip Assets B.V. Cellule de fermentation de sucre pentose
WO2011003893A1 (fr) * 2009-07-10 2011-01-13 Dsm Ip Assets B.V. Production par fermentation d'éthanol à partir de glucose, de galactose et d'arabinose employant une souche de levure recombinée
WO2012142094A2 (fr) * 2011-04-11 2012-10-18 Cargill, Incorporated Compositions et procédés pour une production accrue d'éthanol à partir de biomasse

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009109633A1 (fr) * 2008-03-07 2009-09-11 Dsm Ip Assets B.V. Cellule de fermentation de sucre pentose
WO2011003893A1 (fr) * 2009-07-10 2011-01-13 Dsm Ip Assets B.V. Production par fermentation d'éthanol à partir de glucose, de galactose et d'arabinose employant une souche de levure recombinée
WO2012142094A2 (fr) * 2011-04-11 2012-10-18 Cargill, Incorporated Compositions et procédés pour une production accrue d'éthanol à partir de biomasse

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK 15 December 2011 (2011-12-15), DEWHIRST, F. ET AL: "xylose isomerase [Tannerella forsythia 92A2]", accession no. EW20165.1 *
DATABASE GENBANK 17 July 2013 (2013-07-17), LUCAS, S. ET AL: "D-xylose isomerase [Alistipes finegoldii DSM 17242]", accession no. FL78914.1 *

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105200098A (zh) * 2015-06-30 2015-12-30 苏州汉酶生物技术有限公司 一种利用酿酒酵母酶法制备瑞鲍迪甙m的方法
US11312985B2 (en) 2016-10-21 2022-04-26 Pepsico, Inc. Enzymatic method for preparing Rebaudioside C
US11352653B2 (en) 2016-10-21 2022-06-07 Pepsico, Inc. Enzymatic method for preparing rebaudioside N
US11359222B2 (en) 2016-10-21 2022-06-14 Pepsico, Inc. Enzymatic method for preparing Rebaudioside j
US11952604B2 (en) 2016-10-21 2024-04-09 Pepsico, Inc. Enzymatic method for preparing Rebaudioside J
US11976312B2 (en) 2016-10-21 2024-05-07 Pepsico, Inc. Enzymatic method for preparing Rebaudioside C
US11976313B2 (en) 2016-10-21 2024-05-07 Pepsico, Inc. Enzymatic method for preparing rebaudioside N
WO2020255106A1 (fr) * 2019-06-21 2020-12-24 Universidade Do Minho Nouveau gène de xylose isomérase et polypeptide et utilisations correspondantes

Also Published As

Publication number Publication date
SG2013092820A (en) 2015-07-30

Similar Documents

Publication Publication Date Title
Jansen et al. Saccharomyces cerevisiae strains for second-generation ethanol production: from academic exploration to industrial implementation
Lee et al. Bioethanol production from cellulosic hydrolysates by engineered industrial Saccharomyces cerevisiae
Cadete et al. The yeasts of the genus Spathaspora: Potential candidates for second‐generation biofuel production
EP3165609B1 (fr) Cassette d'expression pour la transformation d'une cellule eucaryote, procédé pour la transformation d'une cellule eucaryote, micro-organisme génétiquement modifié, procédé de production de biocombustibles et/ou d'agents biochimiques et biocombustible et/ou agent biochimique ainsi produits
JP5321320B2 (ja) 発酵能力が向上された酵母及びその利用
JP6422478B2 (ja) 酵母細胞中において活性な雌ウシの第一胃のキシロースイソメラーゼ
WO2011140386A2 (fr) Détoxification d'acétate dérivé de biomasse par conversion métabolique en éthanol, acétone, isopropanol ou acétate d'éthyle
WO2015094117A1 (fr) Levure de fermentation de xylose
WO2012049170A2 (fr) Cellule de levure fermentant le pentose et le glucose
JP2016510990A (ja) 酵母細胞中において活性な細菌性キシロースイソメラーゼ
Adebami et al. Genetics and metabolic engineering of yeast strains for efficient ethanol production
WO2016188813A1 (fr) Cellule de levure consommant de l'acétate
WO2015163814A1 (fr) Souches de saccharomyces cerevisiae
Liu et al. Metabolic engineering and adaptive evolution of Clostridium beijerinckii to increase solvent production from corn stover hydrolysate
US20200377846A1 (en) Yeast cell capable of simultaneously fermenting hexose and pentose sugars
CN111712576B (zh) 微生物菌株及其用途
Saxena et al. Current status of metabolic engineering of microorganisms for bioethanol production by effective utilization of pentose sugars of lignocellulosic biomass
Sun et al. Metabolic and evolutionary engineering of diploid yeast for the production of first-and second-generation ethanol
Zhou et al. Strategies on simultaneous fermentation of pentose and hexose to bioethanol
US12049660B2 (en) Gene duplications for crabtree-warburg-like aerobic xylose fermentation
US8603776B2 (en) Method for preparing xylose-utilizing strain
JP6156770B2 (ja) キシロースの発酵能が強化された酵母とその利用
JP5689062B2 (ja) 五炭糖輸送体
JP2019068788A (ja) 組換え酵母及びこれを用いたエタノールの製造方法
조정현 Development of xylose reductase isozyme system for enhancing xylose metabolism in Saccharomyces cerevisiae

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14872775

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 14872775

Country of ref document: EP

Kind code of ref document: A1