WO2015088384A1 - Use of type ii toxin-antitoxin system genes to genotype strains of mycobacterium tuberculosis - Google Patents

Use of type ii toxin-antitoxin system genes to genotype strains of mycobacterium tuberculosis Download PDF

Info

Publication number
WO2015088384A1
WO2015088384A1 PCT/RU2014/000559 RU2014000559W WO2015088384A1 WO 2015088384 A1 WO2015088384 A1 WO 2015088384A1 RU 2014000559 W RU2014000559 W RU 2014000559W WO 2015088384 A1 WO2015088384 A1 WO 2015088384A1
Authority
WO
WIPO (PCT)
Prior art keywords
oligonucleotides
genotype
strains
sequencing
toxin
Prior art date
Application number
PCT/RU2014/000559
Other languages
French (fr)
Russian (ru)
Inventor
Мария Георгиевна АЛЕКСЕЕВА
Валерий Николаевич ДАНИЛЕНКО
Марина Викторовна ЗАЙЧИКОВА
Наталья Владимировна ЗАХАРЕВИЧ
Original Assignee
Автономная Некоммерческая Организация "Научно-Исследовательский Центр Биотехнологии Антибиотиков И Других Биологически Активных Веществ "Биоан"
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Автономная Некоммерческая Организация "Научно-Исследовательский Центр Биотехнологии Антибиотиков И Других Биологически Активных Веществ "Биоан" filed Critical Автономная Некоммерческая Организация "Научно-Исследовательский Центр Биотехнологии Антибиотиков И Других Биологически Активных Веществ "Биоан"
Priority to EA201600315A priority Critical patent/EA028354B1/en
Publication of WO2015088384A1 publication Critical patent/WO2015088384A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/35—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Mycobacteriaceae (F)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Definitions

  • the invention relates to medicine, phthisiology and medical microbiology, and can be used to identify clinically significant strains of Mycobacterium tuberculosis, including those with multiple and wide drug resistance, as well as altered virulence when working with patients.
  • tuberculosis pathogen M. tuberculosis is divided into several genotypes, the main of which are the following (see Figure 1, which shows some of the main genotypes of M. tuberculosis (according to [Homolka S. et.al, IUD Microbiol. 2008], as amended):
  • Genotype of Beijing This genotype includes strains of clusters R220 (a typical representative of M. tuberculosis R1207) and R86 ⁇ M. tuberculosis XI 22) originating from West Africa, strains CCDC5079; CCDC5180 and strains of the W cluster, which are widely distributed throughout the world. They are the most common genotype in the world [Ioerger T. R. et al. The non-clonality of drug resistance in Beijing genotype isolates of Mycobacterium tuberculosis from the Western Cape of South Africa. BMC Genomics. 2010.11: 670].
  • Ural genotype A group widespread in the south and southeast of the Russian Federation [Mokrousov I. The quiet and controversial: Ural family of Mycobacterium tuberculo- sis. Infect Genet Evol. 2012 12 (4): 619-29]. Strains related to this genotype were found in Abkhazia, Georgia, India and Iran. [Ilina E. N. et al. Comparative Chemical Analysis of Mycobacterium tuberculosis Drug Resistant Strains from Russia. Plos one. 2013.8 (2): e56577].
  • LAM genotype It is a diverse group that is ubiquitous throughout the world. It is the predominant genotype in South America [Bazira J. et al. Genetic diversity of Mycobacterium tuberculosis in Mbarara, South Western Kenya. Afr Health Sci. 2010. (4): 306-311]. Cluster 9 of the LAM genotype (LAM9) is widespread in Russia.
  • Genotype F15 / LAM4 / KZN This genotype belongs to the LAM genotype, and when spoligotyping is defined as LAM4. But with the help of RFLP typing, it stands out quite clearly in a separate group.
  • This genotype includes a group of highly virulent multidrug-resistant and extensively drug-resistant strains common in the South and Southeast of Africa [Loerger T.R. et al. Genome analysis of multi- and extensively-drug resistant tuberculosis from KwaZulu-Natal, South Africa. PLOS ONE. 2009. (4) 11].
  • the SMI-049 genotype includes strains BTB 05-559, S96-129 and BTB05-552 endemic for Scandinavian countries, resistant to isoniazid [Sandegren L. et al. Genomic stability over 9 years of an isoniazid resistant Mycobacterium tuberculosis outbreak strain in Sweden. Plos one. 2011.6 (1): e16647]. They are distinguished by high genetic similarity and stability.
  • Genotype T This cluster, along with the genotypes LAM and Haarlem, belongs to the so-called Euro-American line. Extremely heterogeneous in composition. This group includes the reference strain H37Rv [Gagneux S., Deriemer K., Van T. et al. Variable host-pathogen compatibility in Mycobacterium tuberculosis. Proc Natl Acad Sci USA. 2006.103: 2869-2873].
  • genotyping of mycobacteria is of great importance for the development and prescription of the correct treatment regimen.
  • the following methods are used to identify mycobacteria:
  • Spoligotyping is the main standard method of genotyping of mycobacteria. The method is based on the polymorphism of the chromosomal DR locus (from the English direct repeat — direct repeat) [Kamerbeek J., et al. Simultaneous detection and strain differentiation of Mycobacterium tuberculosis for diagnosis and epidemiology. J Clin Microbiol. 1997. 35: 907-14]. This method requires polymerase chain reaction (PCR) and subsequent DNA hybridization with probes immobilized on the membrane in a special device (mini-blotter) and detection of chemiluminescence signals on a photosensitive film.
  • PCR polymerase chain reaction
  • the spoligotyping method allows one to identify several epidemiologically most significant genotypes: Beijing, Haarlem, LAM, ⁇ , etc.
  • the Ural genotype has also been identified [Ilina E.N. et al. Comparative genomic analysis of Mycobacterium tuberculosis drug resistant strains from Russia. Plos one. 2013.8 (2): e56577].
  • the method has several advantages: high specificity, economy (including the ability to use hybridization membranes up to 20 times) and is currently considered the classic method of strain differentiation.
  • An international database of spoligotypes of Mycobacterium tuberculosis complex SpolDB4 has been created
  • the RFLP typing method This method is based on the analysis of restriction fragment length polymorphism resulting from the cleavage of genomic DNA at specific sites by restriction endonucleases [van Embden, J.D.A. et al. Strain identification of Mycobacterium tuberculosis by DNA fingerprinting: recommendations for a stand-ardized methodology. J. Clin. Microbiol. 1993.31: (406-409)].
  • the sizes and relative positions of restriction DNA fragments after their electrophoretic separation are determined by Southern hybridization.
  • the RFLP method has several modifications, but the most common marker is the transposition sequence IS61 10. The method has a high resolution.
  • the disadvantage of this method is the significant mobility and ability of VBIO elements to genomic transpositions, as well as the need for a significant amount of DNA, for the isolation of which a large amount of biomass is required
  • This method allows to increase the sensitivity of the amplification reaction due to the sequential use of two pairs of primers - external and internal [Miyazaki Y. et al. Nested polymerase chain reaction for detection of Mycobacterium tuberculosis in clinical samples. Clin. Microbiol. 1993.31 (8): 2228-2232].
  • Double PCR of repeating elements double - repetitive - element PCR.
  • the method is based on the amplification and analysis of the sequence of sections between two repeating sections of DNA. which most often are WbPO elements, as well as PGRS sequences [Friedman C.R et al. Double repetitive element PCR method for subtyping Mycobacterium tuberculosis clinical isolates. J. Clin. Microbiol. 1995. 33: 1064-1069].
  • This method is used if a small area is lost in the sequence required for the analysis, and is especially useful if it is necessary to determine the sequence after insertion [Plikaytis V.V. et al. Rapid, amplification-based fingerprinting of Mycobacterium tuberculosis. J. Gen. Microbiol. 1993. 139: 1537-1542].
  • the disadvantage of these methods is the significant mobility and ability of IS61 10-elements to genomic transpositions, leading to a change in the genotyping pattern characteristic of the strain after 3-5 years.
  • these typing methods are not always suitable for identifying mycobacterial strains of the tuberculosis complex with a small (not more than 5) number of copies 1S61 10 or with their complete absence.
  • the objective of the present invention is to develop a method for universal and rapid molecular genetic identification of the main genotypes of M. tuberculosis strains using the genetic material of the isolate.
  • the claimed invention provides an identification method based on single nucleotide polymorphisms of genes of toxin-antitoxin type II systems in M. tuberculosis.
  • Type II toxin-antitoxin (TA) systems are widespread in M. tuberculosis and are a module of two genes located one after another (sometimes overlapping) and forming an operon [Yamaguchi Y. et al. Toxin-antitoxin systems in bacteria and atc .. Annu Rev Genet. 2011.45: 61-79] [Prozorov AA, Danilenko BH Toxin-antitoxin systems in bacteria: an apoptosis tool or metabolic modulators? Microbiology. 2010.V. 79. 2. P. 147-159] [Sala A. et al. Toxin-antitoxin loci in Mycobac- terium tuberculosis. In: Gerdes K., editor. Prokaryotic toxin-antitoxins. Berlin: Springer. 2013. P. 295-314]. At present, more than 75 pairs of anthoxin systems have been detected in M. tuberculosis.
  • the main functions of the genes of the toxin-antitoxin system genes in L / tuberculosis include control of cell growth under unfavorable conditions, transition of cells to a resting state, apoptosis, etc. [Ramage H.R. et al. Comprehensive functional analysis of Mycobacterium tuberculosis toxin-antitoxin systems: implications for pathogenesis, stress responses, and evolution. PLoS Genet. 2009.5: el00 () 767].
  • the typing method that we propose has a number of advantages in comparison with our analogues - the use of functional regulatory genes important for the tolerance, persistence, and virulence of M. tuberculosis. as well as versatility (the possibility of using multilocus sequencing, PCR-RV, PCR), ease of execution, reliability, a small number of genes, speed.
  • the technical result of the invention is the ability to accurately and quickly carry out genotyping of mycobacteria in PCR, real-time PCR,
  • the studied strain belongs to the Ural genotype in the case of detection of C394– + T 3 d4 polymorphism when sequencing a fragment generated using oligonucleotides
  • the studied strain belongs to the LAM9 genotype in the case of the detection of G 3 - »A 3 polymorphism during sequencing of a fragment obtained using Rv2274N-Rv2274C oligonucleotides; the studied strain belongs to the F15 / LAM4 / KZN genotype in the case of detection of C - * T 168 polymorphism when sequencing a fragment obtained using Rv2494N-Rv2494C and C] 4o— * A] 4o oligonucleotides using Rvl740N-Rvl740C oligonucleotides; the studied strain belongs to the genotype SMI-049 in the case of detection of polymorphism G 2 i 3 - * C 213 when sequencing a fragment obtained using oligonucleotides Rv2526N-Rv2526C; the studied strain belongs to the Haarlem genotype in case of revealing Gm ⁇ Cm polymorphism during
  • snp polymorphisms were found, which are missense and seismic substitutions, as well as division and insertion of individual nucleotides, leading to a shift in the reading frame.
  • 29 belonged to mis-sense mutations, 19 to seismic mutations, 3 to mutations in the reading frame shift.
  • snp polymorphisms repeated in several strains were taken into account.
  • 8 genes were initially selected, the degree of polymorphism of which was sufficiently high and met the objectives of the present invention (Table 1).
  • Table 1 The minimum set of genes required for genotyping of M. tuberculosis strains, developed on the basis of single-nucleotide polymorphism of the toxin-antitoxin systems of the VapBC, HigAB and MazEF A superfamilies and their functional role
  • VapC38 toxin is characterized by the replacement of T 143 -> -C 143 .
  • the main requirement for this set of primers is their versatility and high specificity.
  • the requirements for the length of the DNA fragment in the case of applying various sequencing techniques were taken into account.
  • the analyzed fragment should not exceed 500 bp, the average length is 400 bp
  • the length of the amplified fragment should not exceed 200 bp
  • the selection of primers was carried out in the range of 100-150 nucleotides from the point of substitution. For ease of use in multilocus sequencing, all primers should have a similar annealing temperature (64 °).
  • sequences 1-10 see the list of sequences
  • a comparative analysis of the nucleotide sequences of the selected genes with the localization of all oligonucleotides for genotyping is presented. All identified polymorphisms are highlighted in red.
  • the genotyping method of Mycobacterium hiberculosis of the present invention is based on a single nucleotide polymorphism of the functional regulatory genes of the VapBC, MazEF and HigAB superfamily systems of the toxin-antitoxin superfamilies.
  • the proposed method involves amplification with genomic DNA using the proposed set of 10 pairs of oligonucleotides, followed by sequencing of the generated fragments.
  • the proposed method allows accurate and fast genotyping mycobacteria in PCR mode. Real-time PCR, multilocus PCR followed by sequencing, including in the MiSeq system (Illumina, USA) and GS Junior (Roche, Switzerland).
  • a mycobacterial culture was grown in LB liquid medium at 37 ° C under aerated conditions in a Multitron temperature-controlled incubator shaker (“Infors”) at 250 rpm for 18 hours, after which genomic DNA was isolated.
  • Infors Multitron temperature-controlled incubator shaker
  • cells from 20 ml of overnight culture are pelleted by centrifugation at 4000 g for 10 min and resuspended in 10 ml of buffer (10 mM Tris-HC1, 10 mM EDTA-Na :, pH 8.0).
  • the resulting suspension was centrifuged under the same conditions and the pellet was resuspended in 500 ⁇ l above the indicated buffer, then the suspension was transferred to a 2 ml centrifuge tube and 50 ⁇ l of chloroform was added.
  • the mixture was vigorously shaken with a vortex (5 times for 10 seconds), 100 ⁇ l of lysozyme solution (60 mg / ml) was added and incubated for 30 min at 37 ° C.
  • the mixture was incubated for 30 minutes at room temperature and centrifuged at 12000g for 20 minutes.
  • the DNA precipitate was washed three times with 0.5 ml portions of 75% ethanol, centrifuged for 5 min at 12000 g and dissolved in 100 ⁇ l of water.
  • PCR High Fidelity PCR Enzyme Mix kit
  • DNA technology a Tertsik device
  • Composition of the PCR mixture (per 100 ⁇ l): 10 ⁇ l JuhPCR buffer (10X High Fidelity PCR Buffer with 15 mM MgC12), 10 ⁇ l of a mixture of 2mM ZdNTPs (or 2 ⁇ l of lOmM ZdNTPs), 5 ⁇ l of DMSO, 0.3 ⁇ g of genomic DNA and 1 ⁇ l (1.25 i) High Fidelity PCR Enzyme Mix. Oligonucleotide primers are added at a concentration of 20 pmol per 100 ⁇ l of the mixture.
  • PCR reaction parameters 95 ° C for 5 min (cell lysis and genomic denaturation DNA); then 35 cycles of amplification - 94 ° ⁇ - 1 min (denaturation), 64 ° ⁇ for 0.5 min (annealing of oligonucleotides), 72 ° ⁇ - 40 sec. (completion (elongation) of the chain); final elongation of fragments at 72 ° ⁇ - 10 min., storage at 4 ° ⁇ .
  • the amplification results are taken into account by analyzing the amplification products of the test samples by electrophoresis in 1% agarose gel. After amplification is completed, 1/5 of the volume of a 6X DNA Loading Dye solution (Fermentas) is carefully added under oil to the tubes with the test samples after amplification, mixed, and 10 ⁇ l of the obtained sample is transferred to agarose gel loops.
  • a 6X DNA Loading Dye solution Fermentas
  • Electrophoresis is carried out in a chamber for horizontal electrophoresis "SE-2" (Helikon Company) with a power source “Elf-4" ("DNA technology”) at a voltage of 120 volts for 60 minutes
  • SE-2 horizontal electrophoresis
  • Elf-4" DNA technology
  • the results of electrophoresis are taken into account in ultraviolet light with a wavelength of 254 nm on a TCP-20 MS transilluminator (Vilber Lourmat, France).
  • a DNA marker Gene Ruler TM 50+ bp ("Fermentas").
  • the obtained target fragments are isolated from the PCR mixture using the kit QIAquick ® PCR Purification Kit ( «Qiagen ») or GeneJET TM PCR Purification Kit
  • the proposed identification method can be used for genotyping in real-time PCR mode, multilocus PCR followed by sequencing.
  • the studied strain belongs to the Beijing genotype in the case of the identification of A46—> G 4 6 polymorphisms during sequencing of a fragment obtained using Rv2103cN-Rv2103cC oligonucleotides; C 36 s— ”T 36 s using oligonucleotides
  • the studied strain belongs to the EAI genotype in case of detection of C 267 -> G 267 and A268- * G268 polymorphisms when sequencing a fragment obtained using Rv0749N-Rv0749C and G 192 - "Ai 92 oligonucleotides using Rv2595N-Rv2595C oligonucleotides.
  • the studied strain belongs to the Ural genotype in case of detection of C 3 9 - * T 3 Q4 polymorphism during sequencing of the fragment obtained using oligonucleotides leotides Rvl397N-Rvl397C.
  • the studied strain belongs to the LAM9 genotype in the case of the detection of G 3 -> A 3 polymorphism during sequencing of a fragment obtained using Rv2274N-Rv2274C oligonucleotides.
  • the studied strain belongs to the LAM genotype in the case of the detection of C 137 -> Ti3 7 npH polymorphism by sequencing a fragment obtained using Rv3408N-Rv3408C oligonucleotides and in the absence of other polymorphisms.
  • the studied strain belongs to the F15 / LAM4 / KZN genotype in the case of detection of polymorphisms of Sk, 8—> T ] 68 npH sequencing of the fragment obtained using Rv2494N-Rv2494C and ⁇ schreib—> ⁇ 14 schreib oligonucleotides using oligonucleotides Rvl 740N-Rvl740C.
  • the studied strain belongs to genotype SMI-049 in the case of detection of polymorphism G 13 - »C 213 when sequencing a fragment generated using Rv2526N-Rv2526C oligonucleotides.
  • the studied strain belongs to the Haarlem genotype in the case of detection of the G197 — C 19 7 polymorphism during sequencing of a fragment obtained using Rv2494N-Rv2494C oligonucleotides.
  • the studied strain belongs to the T genotype in the case of the detection of T 137 - * C 137 polymorphisms when sequencing a fragment obtained using Rv3408N-Rv3408C oligonucleotides
  • amplification with genomic DNA of a typical strain of M. tuberciilosis H37Rv was carried out according to the procedure described above. Analysis of PCR products in a 1% agarose gel showed that 10 amplicons of the expected length were obtained during the reaction. Sequencing of the isolated fragments and in silico analysis showed 100% identity with the corresponding genome regions of the H37Rv strain.
  • Genotyping was performed by amplification using the proposed set of primers. Sequencing of the obtained fragments showed that 9 strains from the studied set belong to the Beijing genotype, 1 strain to the Haarlem genotype and 8 strains to the LAM genotype (Table 3). Thus, the results coincided with the genotyping data obtained by spoligotyping. The results also coincide with epidemiological data on the distribution of various genotypes in the territory of the Russian Federation [Mokrousov I. et al. Mycobacterium tuberculosis population in northwestern Russia: an update from Russian-EU / Lithuanian border region. Plos one. 2012.7 (7): e41318].
  • the strains PanR0605 and PanR0606 had the following snp polymorphisms, based on which they belong to the Beijing genotype:
  • the strain PanR0908 has a C 1 7 - * T t37 substitution in the rv34 () 8 gene, characteristic of the T. genotype.
  • the proposed method provides high sensitivity genotyping of Mycobacterium tuberculosis.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Analytical Chemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biomedical Technology (AREA)

Abstract

The invention relates to medicine, phthisiology and medical microbiology and can be used for identifying clinically significant strains of Mycobacterium tuberculosis, including multidrug resistant and extensively drug resistant strains and also strains with altered virulence, when working with patients. The invention comprises a novel method of genotyping strains of M.tuberculosis which is based on single nucleotide polymorphism of type II toxin-antitoxin system genes of the vapBC, higAB and mazEF superfamilies. The use of proposed pairs of oligonucleotides can be viewed as a method for diagnosing isolates of M.tuberculosis when treating tuberculosis, establishing an epidemiological picture and identifying new resistance and virulence genes. The present genotyping method is not restricted to the use of the above-mentioned genes only: combinations of other toxin-antitoxin system genes for which corresponding oligonucleotides are constructed can be used. The proposed method enables the accurate and rapid gentoyping of microbacteria in PCR mode, real-time PCR mode and multilocus PCR mode with subsequent sequencing, inter alia, in the MiSeq System ("Illumina", USA) and the GS Junior System ("Roche", Switzerland).

Description

Использование генов систем токсин-антитоксин II типа для генотипи- рования штаммов Mycobacterium tuberculosis  The use of genes of the toxin-antitoxin type II systems for the genotyping of strains of Mycobacterium tuberculosis
ОПИСАНИЕ  DESCRIPTION
Изобретение относится к медицине, фтизиатрии и медицинской микробиологии и мо- ет быть использовано для идентификации клинически значимых штаммов Mycobacte- rium tuberculosis, в том числе с множественной и широкой лекарственной устойчиво- стью, а также с измененной вирулентностью при работе с пациентами. The invention relates to medicine, phthisiology and medical microbiology, and can be used to identify clinically significant strains of Mycobacterium tuberculosis, including those with multiple and wide drug resistance, as well as altered virulence when working with patients.
Начиная с 90х годов прошлого века, в мире наблюдается резкий рост заболеваемости туберкулезом. По данным ВОЗ, на 201 1 г. отмечено 8.7 млн. новых случаев заболева- ния. В структуре смертности от инфекционных и паразитарных заболеваний в России доля умерших от туберкулёза составляет 70 %. Since the 90s of the last century, a sharp increase in the incidence of tuberculosis has been observed in the world. According to the WHO, for 201 1, there were 8.7 million new cases of the disease. In the structure of mortality from infectious and parasitic diseases in Russia, the proportion of deaths from tuberculosis is 70%.
Согласно современной классификации, возбудитель туберкулеза М. tuberculosis подраз- деляется на несколько генотипов, основными из которых являются следующие (см. Фиг.1, где показаны некоторые из основных генотипов М. tuberculosis (по [Homolka S. et.al, ВМС Microbiol. 2008], с изменениями):  According to the current classification, the tuberculosis pathogen M. tuberculosis is divided into several genotypes, the main of which are the following (see Figure 1, which shows some of the main genotypes of M. tuberculosis (according to [Homolka S. et.al, IUD Microbiol. 2008], as amended):
Генотип Beijing. К данному генотипу относятся штаммы кластеров R220 (типичный представитель М. tuberculosis R1207) и R86 {M.tuberculosis XI 22), происходящие из За- падной Африки, штаммы CCDC5079; CCDC5180 и штаммы широко распространивше- гося по всему миру кластера W. Являются наиболее часто встречающимся генотипом в мире [Ioerger Т. R. et al. The non-clonality of drug resistance in Beijing genotype isolates of Mycobacterium tuberculosis from the Western Cape of South Africa. BMC Genomics. 2010. 11:670].  Genotype of Beijing. This genotype includes strains of clusters R220 (a typical representative of M. tuberculosis R1207) and R86 {M. tuberculosis XI 22) originating from West Africa, strains CCDC5079; CCDC5180 and strains of the W cluster, which are widely distributed throughout the world. They are the most common genotype in the world [Ioerger T. R. et al. The non-clonality of drug resistance in Beijing genotype isolates of Mycobacterium tuberculosis from the Western Cape of South Africa. BMC Genomics. 2010.11: 670].
Генотип EAI. Данная группа штаммов широко распространена в Юго-Восточной Азии, островах Тихого Океана, в США (Сан-Франциско). [Brudey К. Mycobacterium tuberculo- sis complex genetic diversity: mining the fourth international spoligotyping database  EAI genotype. This group of strains is widespread in Southeast Asia, the islands of the Pacific Ocean, and in the USA (San Francisco). [Brudey K. Mycobacterium tuberculosis complex genetic diversity: mining the fourth international spoligotyping database
(SpolDB4) for classification, population genetics and epidemiology. BMC Microbiol. 2006. 6(6): 23]. (SpolDB4) for classification, population genetics and epidemiology. BMC Microbiol. 2006. 6 (6): 23].
Генотип Ural. Широко распространенная на юге и юго-востоке Российской федерации группа [Mokrousov I. The quiet and controversial: Ural family of Mycobacterium tuberculo- sis. Infect Genet Evol. 2012 12(4):619-29]. Штаммы, относящиеся к данному генотипу, были обнаружены в Абхазии, Грузии, Индии и Иране. [Ilina Е. N. et al. Comparative Ge- nomic Analysis of Mycobacterium tuberculosis Drug Resistant Strains from Russia. PLoS One. 2013. 8(2): e56577]. Ural genotype. A group widespread in the south and southeast of the Russian Federation [Mokrousov I. The quiet and controversial: Ural family of Mycobacterium tuberculo- sis. Infect Genet Evol. 2012 12 (4): 619-29]. Strains related to this genotype were found in Abkhazia, Georgia, India and Iran. [Ilina E. N. et al. Comparative Chemical Analysis of Mycobacterium tuberculosis Drug Resistant Strains from Russia. Plos one. 2013.8 (2): e56577].
Генотип LAM. Представляет собой разнородную группу, распространенную повсемест- но в мире. Является преобладающим генотипом на территории Южной Америки [Bazira J. et al. Genetic diversity of Mycobacterium tuberculosis in Mbarara, South Western Uganda. Afr Health Sci. 2010. (4): 306-311]. В России распространен кластер 9 генотипа LAM (LAM9).  LAM genotype. It is a diverse group that is ubiquitous throughout the world. It is the predominant genotype in South America [Bazira J. et al. Genetic diversity of Mycobacterium tuberculosis in Mbarara, South Western Uganda. Afr Health Sci. 2010. (4): 306-311]. Cluster 9 of the LAM genotype (LAM9) is widespread in Russia.
Генотип F15/LAM4/KZN. Данный генотип принадлежит к генотипу LAM, и при споли- готипировании определяется как LAM4. Но при помощи RFLP - типирования он выде- ляется достаточно четко в отдельную группу. К данному генотипу относится группа вы- соковирулентных штаммов с множественной и широкой лекарственной устойчивостью, распространенных на Юге и Юго-Востоке Африки [Loerger T.R. et al. Genome analysis of multi- and extensively-drug resistant tuberculosis from KwaZulu-Natal, South Africa. PLoS ONE. 2009. (4)11].  Genotype F15 / LAM4 / KZN. This genotype belongs to the LAM genotype, and when spoligotyping is defined as LAM4. But with the help of RFLP typing, it stands out quite clearly in a separate group. This genotype includes a group of highly virulent multidrug-resistant and extensively drug-resistant strains common in the South and Southeast of Africa [Loerger T.R. et al. Genome analysis of multi- and extensively-drug resistant tuberculosis from KwaZulu-Natal, South Africa. PLOS ONE. 2009. (4) 11].
Генотип SMI-049. К генотипу SMI-049 относят эндемичные для скандинавских стран, устойчивые к изониазиду штаммы ВТВ 05-559, S96-129 и ВТВ05-552 [Sandegren L. et al. Genomic stability over 9 years of an isoniazid resistant Mycobacterium tuberculosis outbreak strain in Sweden. PLoS One. 2011. 6(1): е16647]. Отличаются высоким генетическим сходством и стабильностью.  Genotype SMI-049. The SMI-049 genotype includes strains BTB 05-559, S96-129 and BTB05-552 endemic for Scandinavian countries, resistant to isoniazid [Sandegren L. et al. Genomic stability over 9 years of an isoniazid resistant Mycobacterium tuberculosis outbreak strain in Sweden. Plos one. 2011.6 (1): e16647]. They are distinguished by high genetic similarity and stability.
Генотип Haarlem. Штаммы данной группы распространены в Африке, но в последние годы все чаще встречаются в Аргентине, Бразилии, странах Карибского бассейна и США.  The genotype of Haarlem. Strains of this group are common in Africa, but in recent years are increasingly found in Argentina, Brazil, the Caribbean and the USA.
Генотип Т. Данный кластер, наряду с генотипами LAM и Haarlem, принадлежит к т.н. Евро-Американской линии. Чрезвычайно разнороден по своему составу. В данную группу входит референсный штамм H37Rv [Gagneux S., Deriemer К., Van Т. et al.Variable host-pathogen compatibility in Mycobacterium tuberculosis. Proc Natl Acad Sci USA. 2006. 103: 2869-2873].  Genotype T. This cluster, along with the genotypes LAM and Haarlem, belongs to the so-called Euro-American line. Extremely heterogeneous in composition. This group includes the reference strain H37Rv [Gagneux S., Deriemer K., Van T. et al. Variable host-pathogen compatibility in Mycobacterium tuberculosis. Proc Natl Acad Sci USA. 2006.103: 2869-2873].
Ряду штаммов, характерных для центральной и южной Африки, в частности, генотипу F15/LAM4/KZN, присуща большая вирулентность и, по сравнению с европейскими штаммами, склонность к образованию MDR - форм [Chihota V.N. et al. Population struc- ture of multi- and extensively drug-resistant Mycobacterium tuberculosis strains in South Af- rica. J. Clin. Microhio. 2012. 50(3): 995-1002]. Подобное также характерно для представи- телей пекинского (Beiling) генотипа, широко распространенного не только в Юго- Восточной Азии, но, в последние годы, повсеместно в мире [Chakraborty P. et al. Drug resistant clinical isolates of Mycobacterium tuberculosis, from different genotypes exhibit dif- ferential host responses in ΤΉΡ-l cells. PLoS One. 2013. 8(5): e62966] [ Lasunskaia E. et al. Emerging multidrug resistant Mycobacterium tuberculosis strains of the Beijing genotype cir- culating in Russia express a pattern of biological properties associated with enhanced viru- lence. Microbes and Infection. 2010. 12: 467^175] [Parwati I. et al. Possible underlying mech- anisms for successful emergence of the Mycobacterium tuberculosis Beijing genotype strains. Lancet Infect Dis. 2010. 10: 103-111] [Devaux I. et al. Clusters of multidrug-resistant Myco- bacterium tuberculosis casts, Europe. Emerg Infect Dis. 2009. 15(7): 1052-1060] [Von Groll A. et al. Fitness of Mycobacterium tuberculosis strains of the W-Beijing and Non- W-Beijing genotype. PLoS One 2010. 5: el0191]. A number of strains characteristic of central and southern Africa, in particular, the F15 / LAM4 / KZN genotype, are characterized by greater virulence and, compared with European strains, a tendency to form MDR forms [Chihota VN et al. Population struc- ture of multi- and extensively drug-resistant Mycobacterium tuberculosis strains in South Af- rica. J. Clin. Microhio. 2012. 50 (3): 995-1002]. Similar is also characteristic of representatives of the Beijing (Beiling) genotype, which is widespread not only in Southeast Asia, but, in recent years, everywhere in the world [Chakraborty P. et al. Drug resistant clinical isolates of Mycobacterium tuberculosis, from different genotypes exhibit differential host responses in ΤΉΡ-l cells. Plos one. 2013. 8 (5): e62966] [Lasunskaia E. et al. Emerging multidrug resistant Mycobacterium tuberculosis strains of the Beijing genotype circulating in Russia express a pattern of biological properties associated with enhanced virulence. Microbes and Infection. 2010. 12: 467 ^ 175] [Parwati I. et al. Possible underlying mech- anisms for successful emergence of the Mycobacterium tuberculosis Beijing genotype strains. Lancet Infect Dis. 2010.10: 103-111] [Devaux I. et al. Clusters of multidrug-resistant Mycobacterium tuberculosis casts, Europe. Emerg Infect Dis. 2009. 15 (7): 1052-1060] [Von Groll A. et al. Fitness of Mycobacterium tuberculosis strains of the W-Beijing and Non-W-Beijing genotype. PLoS One 2010.5: el0191].
В связи с этим, для разработки и назначения правильной схемы лечения большое значе- ние имеет генотипирование микобактерий. В настоящее время для идентификации ми- кобактерий применяются следующие методы:  In this regard, genotyping of mycobacteria is of great importance for the development and prescription of the correct treatment regimen. Currently, the following methods are used to identify mycobacteria:
1. Сполиготипирование - основной стандартный метод генотипирования микобактерий. В основе метода лежит полиморфизм хромосомного DR-локуса (от англ. direct repeat— прямой повтор) [Kamerbeek J., et al. Simultaneous detection and strain differentiation of My- cobacterium tuberculosis for diagnosis and epidemiology. J Clin Microbiol. 1997. 35: 907- 14]. Данный метод требует проведения полимеразной цепной реакции (ПЦР) и после- дующей ДНК-гибридизации с иммобилизованными на мембране зондами в специаль- ном приборе (миниблоттере) и выявлением сигналов хемилюминесценции на светочув- ствительной пленке. Метод сполиготипирования позволяет идентифицировать несколь- ко наиболее значимых в эпидемиологическом отношении генотипов: Beijing, Haarlem, LAM , ΕΑΙ и т.д.. В последние годы также выделяют генотип Ural [Ilina E.N. et al. Com- parative genomic analysis of Mycobacterium tuberculosis drug resistant strains from Russia. PLoS One. 2013. 8(2):e56577].  1. Spoligotyping is the main standard method of genotyping of mycobacteria. The method is based on the polymorphism of the chromosomal DR locus (from the English direct repeat — direct repeat) [Kamerbeek J., et al. Simultaneous detection and strain differentiation of Mycobacterium tuberculosis for diagnosis and epidemiology. J Clin Microbiol. 1997. 35: 907-14]. This method requires polymerase chain reaction (PCR) and subsequent DNA hybridization with probes immobilized on the membrane in a special device (mini-blotter) and detection of chemiluminescence signals on a photosensitive film. The spoligotyping method allows one to identify several epidemiologically most significant genotypes: Beijing, Haarlem, LAM, ΕΑΙ, etc. In recent years, the Ural genotype has also been identified [Ilina E.N. et al. Comparative genomic analysis of Mycobacterium tuberculosis drug resistant strains from Russia. Plos one. 2013.8 (2): e56577].
Метод имеет ряд преимуществ: высокая специфичность, экономичность (в т.ч., возмож- ность использовать гибридизационные мембраны до 20 раз) и в настоящее время счита- ется классическим методом штаммовой дифференцировки. Создана международная ба- за данных по сполиготипам микобактерий туберкулезного комплекса SpolDB4  The method has several advantages: high specificity, economy (including the ability to use hybridization membranes up to 20 times) and is currently considered the classic method of strain differentiation. An international database of spoligotypes of Mycobacterium tuberculosis complex SpolDB4 has been created
(www.pasteur.fr/ip/easysite/pasteur/fr). Недостатком данного метода является его трудоемкость, потребность в специальном оборудовании и программном обеспечении, что делает его неприменимым для исполь- зования в практических бактериологических лабораториях. (www.pasteur.fr/ip/easysite/pasteur/fr). The disadvantage of this method is its complexity, the need for special equipment and software, which makes it inapplicable for use in practical bacteriological laboratories.
2. Метод RFLP - типирования. Данный метод основан на анализе полиморфизма длин рестрикционных фрагментов, получающихся при расщеплении геномной ДНК по спе- цифическим сайтам эндонуклеазами рестрикции [van Embden, J.D.A. et al. Strain identifi- cation of Mycobacterium tuberculosis by DNA fingerprinting: recommendations for a stand- ardized methodology . J. Clin. Microbiol. 1993. 31: (406-409)]. Размеры и взаимное распо- ложение рестрикционных фрагментов ДНК после их электрофоретического разделения определяются путем гибридизации по Саузерну. RFLP- метод имеет несколько модифи- каций, но наиболее распространенным маркером является последовательность транспо- зона IS61 10. Метод обладает высокой разрешающей способностью.  2. The RFLP typing method. This method is based on the analysis of restriction fragment length polymorphism resulting from the cleavage of genomic DNA at specific sites by restriction endonucleases [van Embden, J.D.A. et al. Strain identification of Mycobacterium tuberculosis by DNA fingerprinting: recommendations for a stand-ardized methodology. J. Clin. Microbiol. 1993.31: (406-409)]. The sizes and relative positions of restriction DNA fragments after their electrophoretic separation are determined by Southern hybridization. The RFLP method has several modifications, but the most common marker is the transposition sequence IS61 10. The method has a high resolution.
Недостатком данного метода является значительная подвижность и способность ВбИО-элементов к геномным транспозициям, а также потребность в значительном ко- личестве ДНК, для выделения которой необходимо большое количество биомассы  The disadvantage of this method is the significant mobility and ability of VBIO elements to genomic transpositions, as well as the need for a significant amount of DNA, for the isolation of which a large amount of biomass is required
M.tuberculosis. M. tuberculosis.
3. Методы, основанные на IS6110 - амплификации:  3. Methods based on IS6110 - amplification:
• Гнездовая (вложенная) и полугнездовая гБбПО-ПЦР (Hemi-nested PCR).  • Nested (nested) and semi-nested GBBPO-PCR (Hemi-nested PCR).
Данный метод позволяет повысить чувствительность реакции амплификации за счет последовательного применения двух пар праймеров - внешней и внутренней [Miyazaki Y. et al. Nested polymerase chain reaction for detection of Mycobacterium tuberculosis in clinical samples. Clin. Microbiol. 1993. 31(8): 2228-2232]. This method allows to increase the sensitivity of the amplification reaction due to the sequential use of two pairs of primers - external and internal [Miyazaki Y. et al. Nested polymerase chain reaction for detection of Mycobacterium tuberculosis in clinical samples. Clin. Microbiol. 1993.31 (8): 2228-2232].
• Двойная ПЦР повторяющихся элементов (double - repetitive - element PCR).  • Double PCR of repeating elements (double - repetitive - element PCR).
Метод основан на амплификации и анализе последовательности участков между двумя повторяющимися участками ДНК. которыми чаще всего выступают ВбПО-элементы, а также PGRS -последовательности [Friedman C.R et al. Double repetitive element PCR method for subtyping Mycobacterium tuberculosis clinical isolates. J. Clin. Microbiol. 1995. 33:1064-1069].  The method is based on the amplification and analysis of the sequence of sections between two repeating sections of DNA. which most often are WbPO elements, as well as PGRS sequences [Friedman C.R et al. Double repetitive element PCR method for subtyping Mycobacterium tuberculosis clinical isolates. J. Clin. Microbiol. 1995. 33: 1064-1069].
• Инвертированная КбПО-ПЦР.  • Inverted KBPO-PCR.
Данный метод используется в случае, если в необходимой для анализа последователь- ности изестен небольшой участок, и особенно полезен, если требуется определить по- следовательность после инсерции [Plikaytis В.В. et al. Rapid, amplification-based fingerprinting of Mycobacterium tuberculosis. J. Gen. Microbiol. 1993. 139:1537-1542]. Недостатком этих методов является значительная подвижность и способность IS61 10- элементов к геномным транспозициям, приводящая к изменению характерного для штамма рисунка генотипирования спустя 3-5 лет. Кроме того, данные методы типиро- вания не всегда оказываются пригодным для идентификации штаммов микобактерий туберкулезного комплекса с малым (не более 5) числом копий 1S61 10 или с полным их отсутствием. This method is used if a small area is lost in the sequence required for the analysis, and is especially useful if it is necessary to determine the sequence after insertion [Plikaytis V.V. et al. Rapid, amplification-based fingerprinting of Mycobacterium tuberculosis. J. Gen. Microbiol. 1993. 139: 1537-1542]. The disadvantage of these methods is the significant mobility and ability of IS61 10-elements to genomic transpositions, leading to a change in the genotyping pattern characteristic of the strain after 3-5 years. In addition, these typing methods are not always suitable for identifying mycobacterial strains of the tuberculosis complex with a small (not more than 5) number of copies 1S61 10 or with their complete absence.
4. Метод количества тандемных повторов (variable number of tandem repeats, VNTR) [Iwamoto T. et al. Hypervariable loci that enhance the discriminatory ability of newly pro- posed 15-loci and 24-loci variable-number tandem repeat typing method on Mycobacterium tuberculosis strains predominated by the Beijing family. FEMS Microbiol. Lett. 2007. 272: 282-283]. В качестве маркеров используются геномные локусы М. tuberculosis, содер- жащие консервативные тандемные повторы (exact tandem repeats; ETR). Их количество в каждом локусе варьирует у различных штаммов. Методика обладает высокой диффе- ренцирующей способностью. Одним из усовершенствований данного метода является т.н. MIRU-VNTR. В основе метода лежит амплификация локусов, содержащих распре- деленные по геному микобактериальные повторяющиеся элементы (mycobacterial interspersed repetitive units, MIRU).  4. The method of the number of tandem repeats (variable number of tandem repeats, VNTR) [Iwamoto T. et al. Hypervariable loci that enhance the discriminatory ability of newly proposed 15-loci and 24-loci variable-number tandem repeat typing method on Mycobacterium tuberculosis strains predominated by the Beijing family. FEMS Microbiol. Lett. 2007.272: 282-283]. Genomic M. tuberculosis loci containing conservative tandem repeats (exact tandem repeats; ETR) are used as markers. Their number at each locus varies among different strains. The technique has a high differentiating ability. One of the improvements to this method is the so-called. MIRU-VNTR. The method is based on the amplification of loci containing mycobacterial interspersed repetitive units (MIRUs) distributed over the genome.
Недостатками всех указанных методов являются: сложность и/или неоднозначная ин- терпретация полученных результатов.  The disadvantages of all these methods are: complexity and / or ambiguous interpretation of the results.
Задачей данного изобретения является разработка метода универсальной и быстрой мо- лекулярно-генетической идентификации основных генотипов штаммов M.tuberculosis с использованием генетического материала изолята. The objective of the present invention is to develop a method for universal and rapid molecular genetic identification of the main genotypes of M. tuberculosis strains using the genetic material of the isolate.
В заявленном изобретении предложен метод идентификации, основанный на однонук- леотидных полиморфизмах генов систем токсин-антитоксин II типа у М. tu- berculosis. The claimed invention provides an identification method based on single nucleotide polymorphisms of genes of toxin-antitoxin type II systems in M. tuberculosis.
Системы токсин-антитоксин (ТА) II типа широко распространены у M.tuberculosis и представляют собой модуль из двух генов, располагающихся друг за другом (иногда перекрываясь) и образуя оперон [Yamaguchi Y. et al. Toxin-antitoxin systems in bacteria and атс жа.. Annu Rev Genet. 2011.45:61-79] [Прозоров A.A., Даниленко B.H. Системы "токсин-антитоксин" у бактерий: инструмент апоптоза или модуляторы метаболизма? Микробиология. 2010. Т.79. 2. С. 147-159] [Sala A. et al. Toxin-antitoxin loci in Mycobac- terium tuberculosis. In: Gerdes K., editor. Prokaryotic toxin-antitoxins. Berlin: Springer. 2013. P. 295-314]. В настоящее время у M.tuberculosis обнаружено более 75 пар систем- антоксин. Type II toxin-antitoxin (TA) systems are widespread in M. tuberculosis and are a module of two genes located one after another (sometimes overlapping) and forming an operon [Yamaguchi Y. et al. Toxin-antitoxin systems in bacteria and atc .. Annu Rev Genet. 2011.45: 61-79] [Prozorov AA, Danilenko BH Toxin-antitoxin systems in bacteria: an apoptosis tool or metabolic modulators? Microbiology. 2010.V. 79. 2. P. 147-159] [Sala A. et al. Toxin-antitoxin loci in Mycobac- terium tuberculosis. In: Gerdes K., editor. Prokaryotic toxin-antitoxins. Berlin: Springer. 2013. P. 295-314]. At present, more than 75 pairs of anthoxin systems have been detected in M. tuberculosis.
Основные функции генов систем токсин-антитоксин у Л/, tuberculosis включают в себя контроль роста клетки в неблагоприятных условиях, переход клеток в покоящееся со- стояние, апоптоз и др. [Ramage H.R. et al. Comprehensive functional analysis of Mycobac- terium tuberculosis toxin-antitoxin systems: implications for pathogenesis, stress responses, and evolution. PLoS Genet. 2009. 5: el00()767].  The main functions of the genes of the toxin-antitoxin system genes in L / tuberculosis include control of cell growth under unfavorable conditions, transition of cells to a resting state, apoptosis, etc. [Ramage H.R. et al. Comprehensive functional analysis of Mycobacterium tuberculosis toxin-antitoxin systems: implications for pathogenesis, stress responses, and evolution. PLoS Genet. 2009.5: el00 () 767].
Предлагаемый нами метод типирования имеет ряд преимуществ по сравнению с имею- щимися аналогами - использование функциональных регуляторных генов, важных для толерантности, персистенции и вирулентности M.tuberculosis. а также универсальность (возможность использования при мультилокусном секвенировании, ПЦР-РВ, ПЦР), простота в исполнении, надежность, небольшое число генов, быстрота.  The typing method that we propose has a number of advantages in comparison with our analogues - the use of functional regulatory genes important for the tolerance, persistence, and virulence of M. tuberculosis. as well as versatility (the possibility of using multilocus sequencing, PCR-RV, PCR), ease of execution, reliability, a small number of genes, speed.
Техническим результатом изобретения является возможность точно и быстро проводить генотипирование микобактерий в режиме ПЦР, ПЦР в реальном времени, The technical result of the invention is the ability to accurately and quickly carry out genotyping of mycobacteria in PCR, real-time PCR,
мультилокусной ПЦР с последующим секвенированием. в том числе в системе MiSeq («Illumina», США) и GS Junior («Roche», Швецария). Также техническим результатом является простота в исполнении, надежность, потребность в небольшом числе генов. multilocus PCR followed by sequencing. including the system MiSeq ("Illumina", USA) and GS Junior ("Roche", Switzerland). Also the technical result is simplicity in execution, reliability, the need for a small number of genes.
Указанный технический результат достигается за счет того, что предложен метод гено- типирования штаммов Mycobacterium tuberculosis, отличающийся от известных тем, что основан на однонуклеотидном полиморфизме функциональных регуляторных генов систем токсин-антитоксин II типа суперсемейств VapBC, HigAB и MazEF и характери- зующийся тем, что для идентификации проводят амплификацию с геномной ДНК с ис- пользованием набора олигонуклеотидов для 10 генов систем токсин-антитоксин, пред- ставленных в таблице 2, причем ПЦР продукты анализируют в агарозном геле, размер полученного фрагмента определяют с помощью ДНК-маркера, затем выделяют целевые фрагменты из ПЦР-смеси или агарозного геля и секвенируют их с целью обнаружения соответствующих полиморфизмов; исследуемый штамм относится к генотипу Beijing в случае выявления полиморфизмов: А46— »G46 при секвенировании фрагмента, нарабо- танного при использовании олигонуклеотидов Rv2103cN-Rv2103cC, С363— * ^М при ис- пользовании олигонуклеотидов Rvl956N-Rvl956C, Т143— >Ci43 при использовании оли- гонуклеотидов Rv2494N-Rv2494C; исследуемый штамм относится к генотипу EAI в случае выявления полиморфизмов: С267— >G267 и А268— »G268 при секвенировании фраг- мента, наработанного при использовании олигонуклеотидов Rv()749N-Rv()749C и This technical result is achieved due to the fact that a method of genotyping of Mycobacterium tuberculosis strains is proposed, which differs from the known ones in that it is based on the single-nucleotide polymorphism of functional regulatory genes of the toxin-antitoxin II systems of the VapBC, HigAB and MazEF superfamilies and characterized in that for identification, amplification with genomic DNA is performed using a set of oligonucleotides for 10 genes of the toxin-antitoxin systems shown in table 2, the PCR products being analyzed on an agarose gel, size the resulting fragment is determined using a DNA marker, then the target fragments are isolated from the PCR mixture or agarose gel and sequenced to detect the corresponding polymorphisms; the studied strain belongs to the Beijing genotype in the case of detection of polymorphisms: A 46 - »G 46 when sequencing a fragment obtained using Rv2103cN-Rv2103cC oligonucleotides, C 363 - * ^ M using Rvl956N-Rvl956C oligonucleotides, T 143 Ci 43 when using oli Rv2494N-Rv2494C Gonucleotides; the studied strain belongs to the EAI genotype in the case of the identification of polymorphisms: C 267 -> G 2 6 7 and A 2 68— »G268 when sequencing a fragment generated using Rv () 749N-Rv () 749C oligonucleotides and
Gi92—Αΐ92 πρπ использовании олигонуклеотидов Rv2595N-Rv2595C: исследуемый штамм относится к генотипу Ural в случае выявления полиморфизма С394— +Т3д4 при сек- венировании фрагмента, наработанного при использовании олигонуклеотидов Gi9 2 –Αΐ9 2 πρπ using Rv2595N-Rv2595C oligonucleotides: the studied strain belongs to the Ural genotype in the case of detection of C394– + T 3 d4 polymorphism when sequencing a fragment generated using oligonucleotides
Rvl397N-Rvl397C; исследуемый штамм относится к генотипу LAM9 в случае выявле- ния полиморфизма G3— »А3 при секвенировании фрагмента, наработанного при исполь- зовании олигонуклеотидов Rv2274N-Rv2274C; исследуемый штамм относится к гено- типу F15/LAM4/KZN в случае выявления полиморфизма С — *T168 при секвенировании фрагмента, наработанного при использовании олигонуклеотидов Rv2494N-Rv2494C и С]4о— *А]4о при использовании олигонуклеотидов Rvl740N-Rvl740C; исследуемый штамм относится к генотипу SMI-049 в случае выявления полиморфизма G2i3— *С213 при секвенировании фрагмента, наработанного при использовании олигонуклеотидов Rv2526N-Rv2526C; исследуемый штамм относится к генотипу Haarlem в случае выяв- ления полиморфизма Gm^Cm при секвенировании фрагмента, наработанного при ис- пользовании олигонуклеотидов Rv2494N-Rv2494C; исследуемый штамм относится к генотипу Т в случае выявления полиморфизма Т137— +С 7 при секвенировании фрагмен- та, наработанного при использовании олигонуклеотидов Rv3408-Rv3408C; исследуемый штамм относится к генотипу LAM в случае выявления наличия Т137 в сочетании с от- сутствием полиморфизмов по остальным генам при секвенировании фрагмента, нарабо- танного при использовании олигонуклеотидов Rv3408-Rv3408C. Rvl397N-Rvl397C; the studied strain belongs to the LAM9 genotype in the case of the detection of G 3 - »A 3 polymorphism during sequencing of a fragment obtained using Rv2274N-Rv2274C oligonucleotides; the studied strain belongs to the F15 / LAM4 / KZN genotype in the case of detection of C - * T 168 polymorphism when sequencing a fragment obtained using Rv2494N-Rv2494C and C] 4o— * A] 4o oligonucleotides using Rvl740N-Rvl740C oligonucleotides; the studied strain belongs to the genotype SMI-049 in the case of detection of polymorphism G 2 i 3 - * C 213 when sequencing a fragment obtained using oligonucleotides Rv2526N-Rv2526C; the studied strain belongs to the Haarlem genotype in case of revealing Gm ^ Cm polymorphism during sequencing of a fragment obtained using Rv2494N-Rv2494C oligonucleotides; the studied strain belongs to the T genotype in the case of the detection of T 137 - + C 7 polymorphism during sequencing of a fragment obtained using Rv3408-Rv3408C oligonucleotides; the studied strain belongs to the LAM genotype in the case of the presence of T 137 in combination with the absence of polymorphisms in the remaining genes during sequencing of the fragment obtained using Rv3408-Rv3408C oligonucleotides.
1. Биоинформатический анализ наличия генов систем токсин-антитоксин II типа у штаммов M.luberciilosis 1. Bioinformatic analysis of the presence of genes of toxin-antitoxin type II systems in M.luberciilosis strains
Авторами настоящего изобретения был проведен анализ in silico 75 пар генов систем токсин-антитоксин в 22 «complete»- и 138 «draft»- геномах секвенированных (по дан- ным на ноябрь 2013 г.) штаммов М. tuberculosis с использованием баз данных: National Center for Biotechnology Information (NCBI) (http://www.ncbi.nlm.nih.gov/), UniProt (http://www.uniprot.org/), Tuberculist (http://tuberculist.cpfl.ch/index.html), Pathosystems Resours Integration Center (http://patricbrc.org/portal/portal/patric/Taxon?cType=  The authors of the present invention carried out an in silico analysis of 75 pairs of toxin-antitoxin system genes in 22 “complete” and 138 “draft” genomes of sequenced (as of November 2013) M. tuberculosis strains using the following databases: National Center for Biotechnology Information (NCBI) (http://www.ncbi.nlm.nih.gov/), UniProt (http://www.uniprot.org/), Tuberculist (http://tuberculist.cpfl.ch/ index.html), Pathosystems Resources Integration Center (http://patricbrc.org/portal/portal/patric/Taxon?cType=
taxon&cId=1763), TADB (http://bioinfo-mml.sjtu.edu.cn/TADB/). Сравнительный анализ последовательностей обнаруженных генов проводили с использованием программ BioEdit (http://www.mbio.ncsu.edu/BioEdit/bioedit), LALIGN taxon & cId = 1763), TADB (http://bioinfo-mml.sjtu.edu.cn/TADB/). A comparative analysis of the sequences of the detected genes was performed using programs BioEdit (http://www.mbio.ncsu.edu/BioEdit/bioedit), LALIGN
(http://www.ch.embnet.org/software/ LALIGN_form.html), Blast (http://www.ch.embnet.org/software/ LALIGN_form.html), Blast
(http://blast.ncbi.nlm.nih.gov/) и CLUSTALW (www.ch.embnet.org/software/ClustalW.html). Было установлено, что геномы всех штаммов М. tuberculosis содержат 75 пар ТА- модулей, принадлежащих к 5 суперсемействам - VapBC, RelBE, MazEF, ParDE, HigAB, а также новые системы, обозначенные как novel, которые к настоящему моменту не мо- гут быть однозначно классифицированы. К суперсемейству VapBC из них принадлежат 48, к RelBE - 4 , к MazEF - 9, к ParDE - 2, к HigAB - 1, к novel - 11. При анализе были найдено значительное число snp-полиморфизмов, представлющих собой миссенс- и сеймсенс-замены, а также делении и вставки отдельных нуклеотидов, приводящие к сдвигу рамки считывания. Из обнаруженных snp- полиморфизмов 29 относились к мис- сенс-мутациям, 19 - к сеймсенс-мутациям, 3 - к мутациям сдвига рамки считывания. Во избежания возможных неточностей, связанных с ошибками секвенирования. учитыва- лись snp-полиморфизмы, повторяющиеся у нескольких штаммов. Для дальнейшего ана- лиза были первоначально отобраны 8 генов, степень полиморфизма которых была дос- таточно высока и удовлетворяла целям настоящего изобретения (Таблица 1).  (http://blast.ncbi.nlm.nih.gov/) and CLUSTALW (www.ch.embnet.org/software/ClustalW.html). It was found that the genomes of all M. tuberculosis strains contain 75 pairs of TA-modules belonging to 5 superfamilies - VapBC, RelBE, MazEF, ParDE, HigAB, as well as new systems designated as novel, which currently cannot be uniquely classified. Of these, 48 belong to the VapBC superfamily, to RelBE - 4, to MazEF - 9, to ParDE - 2, to HigAB - 1, to novel - 11. In the analysis, a significant number of snp polymorphisms were found, which are missense and seismic substitutions, as well as division and insertion of individual nucleotides, leading to a shift in the reading frame. Of the detected snp polymorphisms, 29 belonged to mis-sense mutations, 19 to seismic mutations, 3 to mutations in the reading frame shift. To avoid possible inaccuracies associated with sequencing errors. snp polymorphisms repeated in several strains were taken into account. For further analysis, 8 genes were initially selected, the degree of polymorphism of which was sufficiently high and met the objectives of the present invention (Table 1).
Таблица 1. Минимальный набор генов, необходимый для генотипирования штаммов M.tuberculosis, разработанный на основе однонуклеотидного полиморфизма систем ток- син-антитоксин суперсемейств VapBC, HigAB и MazEF А и их функциональная роль Table 1. The minimum set of genes required for genotyping of M. tuberculosis strains, developed on the basis of single-nucleotide polymorphism of the toxin-antitoxin systems of the VapBC, HigAB and MazEF A superfamilies and their functional role
Figure imgf000010_0001
Figure imgf000010_0001
Figure imgf000011_0001
Figure imgf000011_0001
2. Биоинформатический анализ snp-полиморфизмов выбранных генов у штаммов2. Bioinformatics analysis of snp polymorphisms of selected genes in strains
M.tuberculosis, относящихся к разным генотипам M. tuberculosis belonging to different genotypes
2.1. Анализ полиморфизмов в геномах штаммов M.tuberculosis  2.1. Analysis of polymorphisms in the genomes of M. tuberculosis strains
из зарубежных коллекций  from foreign collections
Был осуществлен анализ in silico нуклеотидных последовательностей выбранных генов с использованием программы Blast. Для анализа были использованы доступные в базе данных геномы M.tuberculosis с известной генотипической принадлежностью.  An in silico analysis of the nucleotide sequences of the selected genes was performed using the Blast program. For analysis, the M. tuberculosis genomes with known genotypic affiliation, available in the database, were used.
При анализе snp-полиморфизмов выбранных генов у всех штаммов, относящихся к ге- нотипу Beijing, были выявлены следующие нуклеотидные замены:  When analyzing snp polymorphisms of the selected genes in all strains belonging to the Beijing genotype, the following nucleotide substitutions were revealed:
- для гена г\>2103с (токсин VapC37) характерна замена Адб— *G46; - for the gene r \> 2103c (VapC37 toxin), the replacement of Ad b - * G 46 is characteristic;
- для гена rv!956 (токсин HigA) характерна замена С363—Тз63; - for the rv! 956 gene (HigA toxin), the replacement C 363 —Tz 63 is characteristic;
- для гена rv2494 (токсин VapC38) характерна замена Т143— >-С143. - the rv2494 gene (VapC38 toxin) is characterized by the replacement of T 143 -> -C 143 .
Анализ полиморфизма выбранных генов у штаммов генотипа EAI показал наличие ха- рактерных для данного генотипа замен: An analysis of the polymorphism of selected genes in strains of the EAI genotype showed the presence of replacements for this genotype:
- в гене г\0749 (токсин Vap31) обнаружены две замены С267— *G267 и A26s— *Ог^ - in the gene r \ 0749 (Vap31 toxin) two substitutions C 2 67— * G 267 and A 26 s— * Og ^ were found
- в гене rv2595 (антитоксин VapB40) обнаружена замена G192— +Α192· - in the rv2595 gene (VapB40 antitoxin), the replacement G 192 - + Α 19 2 · was found
Анализ полиморфизма выбранных генов у штаммов генотипа F15/LAM4/KZN показал наличие двух характерных для данного генотипа замен:  An analysis of the polymorphism of the selected genes in the strains of the F15 / LAM4 / KZN genotype showed the presence of two substitutions characteristic of this genotype:
- в гене rv2494 (токсин VapC38) обнаружена замена С —►Т^;  - in the rv2494 gene (VapC38 toxin), a C —►T ^ substitution was found;
- в гене rvl740 (антитоксин УарВ34)обнаружена замена С1 0— *АНО-- in the rvl740 gene (UBB34 antitoxin), a replacement of C 1 0 - * ANO- was detected
Анализ полиморфизма выбранных генов у штаммов генотипа SMI-049 показал наличие характерной замены G213— »C213 в гене rv2526 (антитоксин VapB17). An analysis of the polymorphism of the selected genes in strains of genotype SMI-049 showed the presence of a characteristic replacement for G 213 - »C 213 in the rv2526 gene (antitoxin VapB17).
Анализ полиморфизма выбранных генов у штаммов генотипа Haarlem показал наличие замены Gi97— >Ci97 в гене п>2494 (токсин VapC38). An analysis of the polymorphism of the selected genes in strains of the Haarlem genotype showed the presence of a Gi 97 -> Ci 97 substitution in the n> 2494 gene (VapC38 toxin).
Анализ полиморфизма выбранных генов у штаммов генотипа Т выявил наличие поли- морфизма Т137— >C137 B гене rv3408 (токсин VapC47). An analysis of the polymorphism of the selected genes in strains of the T genotype revealed the presence of the T 137 -> C 137 B polymorphism of the rv3408 gene (VapC47 toxin).
Анализ штаммов генотипа LAM показал очень низкую степень полиморфизма не только по выбранным генам, но также по всем 150 генам систем ТА. Выделить данный генотип на основании полиморфизма выбранных десяти генов можно путем детекции полимор- физма по гену токсина VapC47 (rv3408) наличие в гене в 137-м положении тимина и отсутствии других полиморфизмов, маркирующих остальные генотипы.  Analysis of strains of the LAM genotype showed a very low degree of polymorphism not only for the selected genes, but also for all 150 genes of TA systems. This genotype can be distinguished based on the polymorphism of the selected ten genes by detecting the polymorphism by the VapC47 toxin gene (rv3408), the presence of thymine in the gene at the 137th position and the absence of other polymorphisms marking the remaining genotypes.
Полученные результаты представлены в таблице 1. The results are presented in table 1.
2.2. Анализ полиморфизмов в геномах штаммов M.tuberculosis 2.2. Analysis of polymorphisms in the genomes of M. tuberculosis strains
из российских коллекций from Russian collections
Проведен анализ ш silica выбранных генов систем токсин -антитоксин в геномах 38 эпи- демиологически значимых штаммов, выделенных у пациентов на территории Россий- ской Федерации [http://www.ncbi.nlm.nih.gov/sra/?term=SRA061654]. Принадлежность штаммов к различным генотипам (Уральский, пекинский и LAM9) была установлена перед депонированием методом сполиготипирования. К уральскому генотипу принад- лежат семь штаммов: MOS9; SP24; SP25; SP28; SP31; SP32; SP33.  The analysis of the silica of the selected genes of the toxin-antitoxin systems in the genomes of 38 epidemiologically significant strains isolated from patients in the Russian Federation was performed [http://www.ncbi.nlm.nih.gov/sra/?term=SRA061654] . The belonging of the strains to different genotypes (Ural, Beijing and LAM9) was established before deposition by spoligotyping. Seven strains belong to the Ural genotype: MOS9; SP24; SP25; SP28; SP31; SP32; SP33.
В ходе работы было установлено, что штаммы уральского генотипа не имеют полимор- физмов по анализируемым генам. Был проведен анализ ряда других генов систем ТА суперсемейства VapBC Результатом работы стало обнаружение snp-полиморфизма в гене токсина VapCIO (rv 1397с) - замены С394— >T394. Данная замена присутствует у всех представителей уральского генотипа и отсутствует у штаммов, принадлежащих к дру- гим филогенетическим группам. In the course of the work, it was found that strains of the Ural genotype do not have polymorphisms for the analyzed genes. An analysis was made of a number of other genes of the TA systems of the VapBC superfamily. The result of the work was the detection of snp polymorphism in the VapCIO toxin gene (rv 1397c) - substitution C 394 -> T 394 . This replacement is present in all representatives of the Ural genotype and is absent in strains belonging to other phylogenetic groups.
К генотипу LAM9 относятся 9 штаммов: MOS2, MOS7, SP34, SP35, SP36, SP37, SP38. Полиморфизмов в системах токсин-антитоксин суперсемейства VapBC не было выявле- но. При анализе генов других систем токсин-антитоксин, обнаружена замена G3— »А3 в гене токсина MazF8 (rv2274c). Замена присутствует у всех штаммов данного генотипа. 9 strains belong to the LAM9 genotype: MOS2, MOS7, SP34, SP35, SP36, SP37, SP38. No polymorphisms were detected in the toxin-antitoxin systems of the VapBC superfamily. When analyzing the genes of other toxin-antitoxin systems, a G 3 - »A 3 substitution was found in the MazF8 toxin gene (rv2274c). Substitution is present in all strains of this genotype.
3. Разработка олигонуклеотидов для идентификации основных 3. The development of oligonucleotides to identify the main
генотипов M.tuberculosis genotypes of M. tuberculosis
Основным требованием к данному набору праймеров является их универсальность и высокая специфичность. Для выбора праймеров учтены требования к длине фрагмента ДНК в случае применения различных методик секвенирования .  The main requirement for this set of primers is their versatility and high specificity. For the selection of primers, the requirements for the length of the DNA fragment in the case of applying various sequencing techniques were taken into account.
Для мультилокусного секвенирования, в соответствии с характеристиками системы (http://roche-applied-science.ru/assets/files/GS_Junior.pdf), максимальная длина For multilocus sequencing, in accordance with the characteristics of the system (http://roche-applied-science.ru/assets/files/GS_Junior.pdf), the maximum length
анализируемого фрагмента не должна превышать 500 п.н., средняя длина - 400 п.н. При использовании метода PCR-real time длина амплифицируемого фрагмента не должна превышать 200 п.н. Исходя из этих требований, подбор праймеров осуществлялся в интервале 100-150 нуклеотидов от точки замены. Для удобства применения при мультилокусном секвенировании все праймеры должны иметь сходную температуру отжига (64°). the analyzed fragment should not exceed 500 bp, the average length is 400 bp When using the PCR-real time method, the length of the amplified fragment should not exceed 200 bp Based on these requirements, the selection of primers was carried out in the range of 100-150 nucleotides from the point of substitution. For ease of use in multilocus sequencing, all primers should have a similar annealing temperature (64 °).
На основании сравнительного анализа последовательностей выбранных генов разработан набор из 10 пар олигонуклеотидов для идентификации основных генотипов М luberciilosis: Rv0749N-Rv0749C, Rv2103cN-Rv2103cC, Rvl740N-Rvl740C, Rvl956N- Rvl956C, Rv2526N-Rv2526C, Rv2529N-Rv2529C, Rv2494N-Rv2494C, Rvl397cN- Rvl397cC, Rv2274cN-Rv2274cC, Rv3408N-Rv3408C представленный в таблице 2.  Based on a comparative analysis of the sequences of the selected genes, a set of 10 pairs of oligonucleotides was developed for identification of the main genotypes of M luberciilosis: Rv0749N-Rv0749C, Rv2103cN-Rv2103cC, Rvl740N-Rvl740C, Rvl956, Rv2529N, Rv2526N, Rv2526N, Rv2926N Rvl397cC, Rv2274cN-Rv2274cC, Rv3408N-Rv3408C are presented in table 2.
На последовательностях 1-10 (см. перечень последовательностей) представлен сравни- тельный анализ нуклеотидных последовательностей выбранных генов с локализацией всех олигонуклеотидов для генотипирования. Все выявленные полиморфизмы выделе- ны красным цветом.  On sequences 1-10 (see the list of sequences), a comparative analysis of the nucleotide sequences of the selected genes with the localization of all oligonucleotides for genotyping is presented. All identified polymorphisms are highlighted in red.
Таблица 2. Table 2.
Набор олигонуклеотидов для генотипирования штаммов M.tuberculosis Название Структура олигонуклеотида 5' - Ъ' Название Размер олигонук- гена фрагмент леотида а, п.н.A set of oligonucleotides for genotyping strains of M. tuberculosis Name Structure of the oligonucleotide 5 '- b' Name Size of the oligonucleotene fragment of leotide a, bp
Rv0749N CCCGGTCCCAGACACCTCATGC vapC31 202Rv0749N CCCGGTCCCAGACACCTCATGC vapC31 202
Rv()749C GACTGTACTTGAGGACCGCTCGCTA токсин Rv ( ) 749C GACTGTACTTGAGGACCGCTCGCTA toxin
Rv2103cN GGACGAAGAGCTTGTGCGCCGTCA vapC32 181 Rv2103cN GGACGAAGAGCTTGTGCGCCGTCA vapC32 181
Rv2103cC GCCAACAACGGCACCCAGGCGAAC токсин Rv2103cC GCCAACAACGGCACCCAGGCGAAC toxin
Rvl740N CGGGCGCACCAGATCCATTTCGCTA vupB34 186 Rvl740N CGGGCGCACCAGATCCATTTCGCTA vupB34 186
Rvl740C CG CCTCG G GTTC ATCGTTG AG С АТС антитоксин Rvl740C CG CCTCG G GTTC ATCGTTG AG With ATS antitoxin
Rvl956N CTGCG G CTG GTG CTCG AAGTTCCCA higA 213 Rvl956N CTGCG G CTG GTG CTCG AAGTTCCCA higA 213
Rvl956C CGCGTTGCAGGTCAAGGTCGTC токсин Rvl956C CGCGTTGCAGGTCAAGGTCGTC toxin
Rv2526N TCGTCGACCATCTCGCGCACG ναρΒΠ 194 Rv2526N TCGTCGACCATCTCGCGCACG ναρΒΠ 194
Rv2526C AATACAGCCATTCAAGTTCGCCGAT антитоксин Rv2526C AATACAGCCATTCAAGTTCGCCGAT antitoxin
Rv2595N AACTCGTTCGGGAAGGCTCGG ναρΒ4() 202 Rv2595N AACTCGTTCGGGAAGGCTCGG ναρΒ4 () 202
Rv2595C ACGAGCGATACGTCGTCAGCCAG антитоксин Rv2595C ACGAGCGATACGTCGTCAGCCAG antitoxin
Rv2494N G ACTTG CCCG CTC ACCG A AG CC vapC38 195 Rv2494N G ACTTG CCCG CTC ACCG A AG CC vapC38 195
Rv2494C GGTCACCTGGCGATAACCGACGA токсин Rv2494C GGTCACCTGGCGATAACCGACGA toxin
Rvl397cN CGTGTGGCATTTCCCCATGTTCG vapCIO 192 Rvl397cN CGTGTGGCATTTCCCCATGTTCG vapCIO 192
Rvl397cC AGG AGTG CGGTCTT ATTG CAAC токсин Rvl397cC AGG AGTG CGGTCTT ATTG CAAC Toxin
Rv2274cN CGGTGTTGAGGTCAGTGATCAGGGT mazFS 138 Rv2274cN CGGTGTTGAGGTCAGTGATCAGGGT mazFS 138
Rv2274cC GTGAGTGT ACCCG CCGCC AC AG токсин Rv2274cC GTGAGTGT ACCCG CCGCC AC AG Toxin
Rv34()8N GACACCTCGGCCCTGACTAAGCTG vapC47  Rv34 () 8N GACACCTCGGCCCTGACTAAGCTG vapC47
225 225
Rv3408C GATCACCGGTTCGGTGAGCGGGA токсин Rv3408C GATCACCGGTTCGGTGAGCGGGA toxin
Таким образом: In this way:
1) Метод генотипирования Mycobacterium hiberculosis по настоящему изобретению основан на однонуклеотидном полиморфизме функциональных регуляторных генов систем токсин-антитоксин суперсемейств VapBC, MazEF и HigAB.  1) The genotyping method of Mycobacterium hiberculosis of the present invention is based on a single nucleotide polymorphism of the functional regulatory genes of the VapBC, MazEF and HigAB superfamily systems of the toxin-antitoxin superfamilies.
2) Предлагаемый метод предусматривает проведение амплификации с геномной ДНК с использованием предлагаемого набора 10 пар олигонуклеотидов с последующим секвенированием наработанных фрагментов.  2) The proposed method involves amplification with genomic DNA using the proposed set of 10 pairs of oligonucleotides, followed by sequencing of the generated fragments.
3) Предлагаемый метод позволяет точно и быстро проводить генотипирование микобактерий в режиме ПЦР. ПЦР в реальном времени, мультилокусной ПЦР с последующим секвенированием, в том числе в системе MiSeq («Illumina», США) и GS Junior («Roche», Швецария). 3) The proposed method allows accurate and fast genotyping mycobacteria in PCR mode. Real-time PCR, multilocus PCR followed by sequencing, including in the MiSeq system (Illumina, USA) and GS Junior (Roche, Switzerland).
Осуществление изобретения The implementation of the invention
Культуру микобактерий выращивают в жидкой питательной среде LB при 37°С в аэрируемых условиях в термостатируемом шейкере-инкубаторе Multitron («Infors») при 250 об/мин в течение 18 часов, после чего выделяют геномную ДНК.  A mycobacterial culture was grown in LB liquid medium at 37 ° C under aerated conditions in a Multitron temperature-controlled incubator shaker (“Infors”) at 250 rpm for 18 hours, after which genomic DNA was isolated.
Для этого клетки из 20 мл ночной культуры осаждают центрифугированием при 4000g в течение 10 мин и ресуспендируют в 10 мл буфера (10 мМ Трис-НС1, 10 мМ ЭДТА-Na:, рН 8.0). Полученную суспензию центрифугируют в тех же условиях и осадок ресуспен- дируют в 500 мкл выше указанного буфера, затем суспензию переносят в 2-мл центри- фужную пробирку и добавляют 50 мкл хлороформа. Смесь энергично встряхивают с помощью вортекса (5 раз по 10 сек), вносят 100 мкл раствора лизоцима (60 мг/мл) и ин- кубируют 30 мин при 37°С. Добавляют 6 мкл РНКазы А (10 мг/мл) и инкубируют еще 30 мин при 37°С. Для лизиса клеток к суспензии добавляют 200 мкл 10% SDS и 200 мкл 5М NaCl, осторожно перемешивают и инкубируют 16 ч при 65°С. Полученный лизат клеток остужают до комнатной температуры, добавляют 1 мл смеси фенол/хлороформ (1 : 1) и перемешивают путем переворачивания пробирки в течение 5 мин до состояния гомогенной эмульсии. Затем смесь центрифугируют при 12000g в течение 15 мин. Вод- ную фазу, содержащую ДНК, отбирают в новую 1.5-мл пробирку и смешивают с 600 мкл изопропанола. Смесь инкубируют 30 мин при комнатной температуре и центрифу- гируют при 12000g в течение 20 мин. Осадок ДНК трижды промывают порциями по 0.5 мл 75% этанола с центрифугированием по 5 мин при 12000g и растворяют в 100 мкл во- ды. For this, cells from 20 ml of overnight culture are pelleted by centrifugation at 4000 g for 10 min and resuspended in 10 ml of buffer (10 mM Tris-HC1, 10 mM EDTA-Na :, pH 8.0). The resulting suspension was centrifuged under the same conditions and the pellet was resuspended in 500 μl above the indicated buffer, then the suspension was transferred to a 2 ml centrifuge tube and 50 μl of chloroform was added. The mixture was vigorously shaken with a vortex (5 times for 10 seconds), 100 μl of lysozyme solution (60 mg / ml) was added and incubated for 30 min at 37 ° C. Add 6 μl of RNase A (10 mg / ml) and incubate for another 30 min at 37 ° C. For cell lysis, 200 μl of 10% SDS and 200 μl of 5M NaCl are added to the suspension, mix gently and incubate for 16 hours at 65 ° C. The resulting cell lysate was cooled to room temperature, 1 ml of a phenol / chloroform mixture (1: 1) was added and stirred by inverting the tube for 5 min to a homogeneous emulsion. The mixture is then centrifuged at 12000g for 15 minutes. The aqueous phase containing the DNA is taken into a new 1.5 ml tube and mixed with 600 μl of isopropanol. The mixture was incubated for 30 minutes at room temperature and centrifuged at 12000g for 20 minutes. The DNA precipitate was washed three times with 0.5 ml portions of 75% ethanol, centrifuged for 5 min at 12000 g and dissolved in 100 μl of water.
При выборе для генотипирования режима ПЦР амплификацию ДНК проводят с использованием набора High Fidelity PCR Enzyme Mix («Fermentas») на приборе «Терцик» («ДНК-технология»). Состав смеси для ПЦР (на 100 мкл): 10 мкл ЮхПЦР буфера (10Х High Fidelity PCR Buffer with 15 mM MgC12), 10 мкл смеси 2mM ZdNTPs (либо 2 мкл lOmM ZdNTPs), 5 мкл DMSO, 0.3 мкг геномной ДНК и 1 мкл (1.25 и) фермента High Fidelity PCR Enzyme Mix. Олигонуклеотидные праймеры добавляют в концентрации 20 пмоль на 100 мкл смеси.  When choosing the PCR mode for genotyping, DNA amplification is performed using the High Fidelity PCR Enzyme Mix kit (“Fermentas”) on a Tertsik device (“DNA technology”). Composition of the PCR mixture (per 100 μl): 10 μl JuhPCR buffer (10X High Fidelity PCR Buffer with 15 mM MgC12), 10 μl of a mixture of 2mM ZdNTPs (or 2 μl of lOmM ZdNTPs), 5 μl of DMSO, 0.3 μg of genomic DNA and 1 μl (1.25 i) High Fidelity PCR Enzyme Mix. Oligonucleotide primers are added at a concentration of 20 pmol per 100 μl of the mixture.
Параметры ПЦР реакции: 95°С в течение 5 мин (лизис клеток и денатурация геномной ДНК); затем 35 циклов амплификации - 94°С - 1 мин (денатурация), 64°С в течение 0.5 мин (отжиг олигонуклеотидов), 72°С - 40 сек. (достройка (элонгация) цепи); финальная элонгация фрагментов при 72°С - 10 мин., хранение при 4°С. PCR reaction parameters: 95 ° C for 5 min (cell lysis and genomic denaturation DNA); then 35 cycles of amplification - 94 ° С - 1 min (denaturation), 64 ° С for 0.5 min (annealing of oligonucleotides), 72 ° С - 40 sec. (completion (elongation) of the chain); final elongation of fragments at 72 ° С - 10 min., storage at 4 ° С.
Результаты амплификации учитывают путем анализа продуктов амплификации исследуемых образцов методом электрофореза в 1% агарозном геле. В пробирки с исследуемыми образцами после завершения амплификации вносят аккуратно под масло 1/5 объема раствора 6Х DNA Loading Dye («Fermentas»), перемешивают и 10 мкл полученного образца вносят в лупки агарозного геля. Электрофорез проводят в камере для горизонтального электрофореза "SE-2" (Компания «Хеликон») с источником питания '" Эльф-4 " («ДНК-технология») при напряжении 120 вольт в течение 60 мин. Результаты электрофореза учитывают в ультрафиолетовом свете с длинной волны 254 нм на трансиллюминаторе ТСР-20 МС («Vilber Lourmat», Франция). В качестве контроля размера полученного фрагмента используют ДНК маркер Gene Ruler™ 50+ п.н. («Fermentas»). The amplification results are taken into account by analyzing the amplification products of the test samples by electrophoresis in 1% agarose gel. After amplification is completed, 1/5 of the volume of a 6X DNA Loading Dye solution (Fermentas) is carefully added under oil to the tubes with the test samples after amplification, mixed, and 10 μl of the obtained sample is transferred to agarose gel loops. Electrophoresis is carried out in a chamber for horizontal electrophoresis "SE-2" (Helikon Company) with a power source "Elf-4" ("DNA technology") at a voltage of 120 volts for 60 minutes The results of electrophoresis are taken into account in ultraviolet light with a wavelength of 254 nm on a TCP-20 MS transilluminator (Vilber Lourmat, France). As a control of the size of the obtained fragment using a DNA marker Gene Ruler ™ 50+ bp ("Fermentas").
Полученные целевые фрагменты выделяют из ПЦР-смеси с использованием набора QIAquick® PCR Purification Kit («Qiagen») или GeneJET™ PCR Purification Kit The obtained target fragments are isolated from the PCR mixture using the kit QIAquick ® PCR Purification Kit ( «Qiagen ») or GeneJET ™ PCR Purification Kit
(«Fermentas») и секвенируют для выявления полиморфизмов, соответствующих геноти- пам штаммов M.taberculosis. (“Fermentas”) and sequenced to identify polymorphisms corresponding to the genotypes of M. taberculosis strains.
Предлагаемый метод идентификации можно использовать для генотипирования в ре- жиме ПЦР в реальном времени, мультилокусной ПЦР с последующим секвенировани- ем.  The proposed identification method can be used for genotyping in real-time PCR mode, multilocus PCR followed by sequencing.
Оценка результатов  Evaluation of the results
Исследуемый штамм относится к генотипу Beijing в случае выявления полиморфизмов А46— >G46 при секвенировании фрагмента, наработанного при использовании олигонук- леотидов Rv2103cN-Rv2103cC; С36з— »Т36з при использовании олигонуклеотидов The studied strain belongs to the Beijing genotype in the case of the identification of A46—> G 4 6 polymorphisms during sequencing of a fragment obtained using Rv2103cN-Rv2103cC oligonucleotides; C 36 s— ”T 36 s using oligonucleotides
Rvl956N-Rvl956C и Т — ^Снз при использовании олигонуклеотидов Rv2494N- Rv2494C.  Rvl956N-Rvl956C and T - ^ CnS using Rv2494N-Rv2494C oligonucleotides.
Исследуемый штамм относится к генотипу EAI в случае выявления полиморфизмов С267— >G267 и A268-*G268 при секвенировании фрагмента, наработанного при использова- нии олигонуклеотидов Rv0749N-Rv0749C и G192— »Ai92 при использовании олигонуклео- тидов Rv2595N-Rv2595C. The studied strain belongs to the EAI genotype in case of detection of C 267 -> G 267 and A268- * G268 polymorphisms when sequencing a fragment obtained using Rv0749N-Rv0749C and G 192 - "Ai 92 oligonucleotides using Rv2595N-Rv2595C oligonucleotides.
Исследуемый штамм относится к генотипу Ural в случае выявления полиморфизма С39 — *T3Q4 при секвенировании фрагмента, наработанного при использовании олигонук- леотидов Rvl397N-Rvl397C. The studied strain belongs to the Ural genotype in case of detection of C 3 9 - * T 3 Q4 polymorphism during sequencing of the fragment obtained using oligonucleotides leotides Rvl397N-Rvl397C.
Исследуемый штамм относится к генотипу LAM9 в случае выявления полиморфизма G3— >A3 при секвенировании фрагмента, наработанного при использовании олигонукле- отидов Rv2274N-Rv2274C. The studied strain belongs to the LAM9 genotype in the case of the detection of G 3 -> A 3 polymorphism during sequencing of a fragment obtained using Rv2274N-Rv2274C oligonucleotides.
Исследуемый штамм относится к генотипу LAM в случае выявления полиморфизма С137— >Ti37 npH секвенировании фрагмента, наработанного при использовании олигонук- леотидов Rv3408N-Rv3408C и при отсутствии других полиморфизмов. The studied strain belongs to the LAM genotype in the case of the detection of C 137 -> Ti3 7 npH polymorphism by sequencing a fragment obtained using Rv3408N-Rv3408C oligonucleotides and in the absence of other polymorphisms.
Исследуемый штамм относится к генотипу F15/LAM4/KZN в случае выявления поли- морфизмов Ск,8— >T]68 npH секвенировании фрагмента, наработанного при использова- нии олигоиуклеотидов Rv2494N-Rv2494C и С о— >А14о при использовании олигонуклео- тидов Rvl 740N-Rvl740C. The studied strain belongs to the F15 / LAM4 / KZN genotype in the case of detection of polymorphisms of Sk, 8—> T ] 68 npH sequencing of the fragment obtained using Rv2494N-Rv2494C and С о—> А 14 о oligonucleotides using oligonucleotides Rvl 740N-Rvl740C.
Исследуемый штамм относится к генотипу SMI-049 в случае выявления полиморфизма G 13— »С213 при секвенировании фрагмента, наработанного при использовании олиго- нуклеотидов Rv2526N-Rv2526C. The studied strain belongs to genotype SMI-049 in the case of detection of polymorphism G 13 - »C 213 when sequencing a fragment generated using Rv2526N-Rv2526C oligonucleotides.
Исследуемый штамм относится к генотипу Haarlem в случае выявления полиморфизма G197— С197 при секвенировании фрагмента, наработанного при использовании олиго- нуклеотидов Rv2494N-Rv2494C. The studied strain belongs to the Haarlem genotype in the case of detection of the G197 — C 19 7 polymorphism during sequencing of a fragment obtained using Rv2494N-Rv2494C oligonucleotides.
Исследуемый штамм относится к генотипу Т в случае выявления полиморфизмов Т137— *С137 при секвенировании фрагмента, наработанного при использовании олигонук- леотидов Rv3408N-Rv3408C The studied strain belongs to the T genotype in the case of the detection of T 137 - * C 137 polymorphisms when sequencing a fragment obtained using Rv3408N-Rv3408C oligonucleotides
Примеры идентификации по настоящему изобретению Identification Examples of the Present Invention
Пример 1.  Example 1
Наработка фрагментов с геномной ДНК контрольного секвенированного штамма  The production of fragments with genomic DNA of the control sequenced strain
M.tuberciilosis H37Rv с использованием сконструированных олигоиуклеотидов. M. tuberciilosis H37Rv using engineered oligoyucleotides.
Для проверки правильности конструирования олигоиуклеотидов была проведена ам- плификация с геномной ДНК типового штамма M.tuberciilosis H37Rv по методике, опи- санной выше. Анализ ПЦР продуктов в 1 % агарозном геле показал, что в процессе ре- акции получены 10 ампликонов ожидаемой длины. Секвенирование выделенных фраг- ментов и анализ in silico показали 100% идентичность с соответствующими участками генома штамма H37Rv.  To verify the correct construction of oligoyucleotides, amplification with genomic DNA of a typical strain of M. tuberciilosis H37Rv was carried out according to the procedure described above. Analysis of PCR products in a 1% agarose gel showed that 10 amplicons of the expected length were obtained during the reaction. Sequencing of the isolated fragments and in silico analysis showed 100% identity with the corresponding genome regions of the H37Rv strain.
Таким образом, предлагаемый набор олигоиуклеотидов позволяет селективно отбирать фрагменты для последующего выявления полиморфизмов, соответствующих разным генотипам M. tuberculosis. Пример 2. Thus, the proposed set of oligoyucleotides allows you to selectively select fragments for subsequent identification of polymorphisms corresponding to different genotypes of M. tuberculosis. Example 2
Генотипирование изолятов M.tuberciilosis из российских коллекций с применением пред- лагаемого метода идентификации.  Genotyping of M. tuberciilosis isolates from Russian collections using the proposed identification method.
Для анализа использованы 18 образцов геномной ДНК M.tuberciilosis полученной из коллекции Центрального научно-исследовательского института эпидемиологии (г. Москва). Образцы выделены из мокроты пациентов, больных туберкулезом.  For analysis, 18 samples of M.tuberciilosis genomic DNA obtained from the collection of the Central Research Institute of Epidemiology (Moscow) were used. Samples isolated from sputum of patients with tuberculosis.
Генотипирование проводили путем амплификации с использованием предложенного набора праймеров. Результаты секвенирования полученных фрагментов показали, что 9 штаммов из исследованного набора принадлежат к пекинскому генотипу, 1 штамм - к генотипу Haarlem и 8 штаммов - к генотипу LAM (Таблица 3). Таким образом, резуль- таты совпали с данными генотипирования, полученными методом сполиготипирования. Результаты также совпадают с эпидемиологическими данными по распространению на территории РФ различных генотипов [Mokrousov I. et al. Mycobacterium tuberculosis population in northwestern Russia: an update from Russian-EU/Latvian border region. PLoS One. 2012. 7(7):e41318]. Genotyping was performed by amplification using the proposed set of primers. Sequencing of the obtained fragments showed that 9 strains from the studied set belong to the Beijing genotype, 1 strain to the Haarlem genotype and 8 strains to the LAM genotype (Table 3). Thus, the results coincided with the genotyping data obtained by spoligotyping. The results also coincide with epidemiological data on the distribution of various genotypes in the territory of the Russian Federation [Mokrousov I. et al. Mycobacterium tuberculosis population in northwestern Russia: an update from Russian-EU / Latvian border region. Plos one. 2012.7 (7): e41318].
Пример 3. Example 3
Генотипирование изолятов M.iuberculosis из российских коллекций с помощью коммер- ческих наборов для штаммовой идентификации.  Genotyping of M.iuberculosis isolates from Russian collections using commercial strain identification kits.
Для анализа использованы 18 образцов геномной ДНК, полученной из коллекции Цен- трального научно-исследовательского института эпидемиологии.  For analysis, 18 samples of genomic DNA obtained from the collection of the Central Research Institute of Epidemiology were used.
В работе был использованы набор АМПЛИТУБ-Beijing («Синтол», Россия), позволяю- щий определить принадлежность штамма к пекинскому генотипу. По результатам ПЦР- РТ, проведенной с набором АМПЛИТУБ-Beijing, из 18 исследованных штаммов 9 при- надлежат к пекинскому генотипу, что совпадает с генотипированием по предлагаемому методу идентификации. Таблица 3. In the work, we used the AMPLITUB-Beijing kit (Synthol, Russia), which allowed us to determine the strain belonging to the Beijing genotype. According to the results of PCR-RT performed with the AMPLITUB-Beijing kit, of the 18 studied strains, 9 belong to the Beijing genotype, which coincides with genotyping by the proposed identification method. Table 3.
Однонуклеотидные замены в исследуемых генах, детектированные с применением предлагаемого набора праймеров
Figure imgf000019_0001
Single nucleotide substitutions in the studied genes detected using the proposed set of primers
Figure imgf000019_0001
Пример 4. Example 4
Биоинформатический анализ секвенированных геномов российских штаммов  Bioinformatics analysis of sequenced genomes of Russian strains
M.tuberculosis, представленных в базе данных SRA. M. tuberculosis presented in the SRA database.
С использованием разработанных праймеров для 10 генов систем ТА с использованием программы BLAST проанализировано 38 секвенированных генома M.tuberculosis рос- сийского происхождения, депонированных в базе данных SRA  Using the developed primers for 10 genes of TA systems using the BLAST program, 38 sequenced genomes of M. tuberculosis of Russian origin were analyzed, deposited in the SRA database
(http://www.ncbi.nlm.nih.gov/sra), относящихся к 3 генотипам: Beijing, Ural и LAM. (http://www.ncbi.nlm.nih.gov/sra) belonging to 3 genotypes: Beijing, Ural and LAM.
Генотипы всех штаммов, установленные с использованием предлагаемых нами генов, полностью идентичны генотипам, заявленным авторами представленных в базе штам- мов. The genotypes of all strains identified using the genes we offer are completely identical to the genotypes declared by the authors of the strains presented in the database.
Пример 5. Example 5
Биоинформатическое генотипирование M.tuberculosis из базы данных секвенированных геномов, изолированных в Панаме.  Bioinformatic genotyping of M. tuberculosis from a database of sequenced genomes isolated in Panama.
С использованием разработанных праймеров для 10 генов систем ТА проведен анализ 67 draft-геномов лекарственно-устойчивых штаммов Mycobacterium tuberculosis, изолиро- ванных в Панаме. [Lanzas F. et al. Multidrug-resistant tuberculosis in Panama is driven by clonal expansion of a multidrug-resistant Mycobacterium tuberculosis strain related to the KZN extensively drag-resistant M. tuberculosis strain from South Africa., J Clin Microbiol, 2013. 51(10):3277-85]. Перед депонированием штаммов в базу данных NCBI  Using the developed primers for 10 genes of TA systems, we analyzed 67 draft genomes of drug-resistant Mycobacterium tuberculosis strains isolated in Panama. [Lanzas F. et al. Multidrug-resistant tuberculosis in Panama is driven by clonal expansion of a multidrug-resistant Mycobacterium tuberculosis strain related to the KZN extensively drag-resistant M. tuberculosis strain from South Africa., J Clin Microbiol, 2013.51 (10): 3277-85 ]. Before depositing the strains into the NCBI database
(http://www.ncbi.nlm.nih.gov/genome/) были определены их сполиготипы. (http://www.ncbi.nlm.nih.gov/genome/) their spoligotypes were determined.
Штаммы PanR0605 и PanR0606 имели следующие snp - полиморфизмы, на основании которых относятся к генотипу Beijing:  The strains PanR0605 and PanR0606 had the following snp polymorphisms, based on which they belong to the Beijing genotype:
- в гене rv2103c (токсин VapC37) обнаружена замена ^— >G46; - in the rv2103c gene (VapC37 toxin), the replacement ^ -> G 46 was detected;
- в гене п>1956 (токсин HigA) характерна замена С36з— > збз; - in the gene n> 1956 (HigA toxin), C 36 s -> s b s is characteristic;
- в гене rv2494 (токсин VapC38) характерна замена Т14з— *Ci43. - in the rv2494 gene (VapC38 toxin), a replacement of T 14 s— * Ci 43 is characteristic.
На основании сполиготипирования данные штаммы также отнесены к линии PGG-1. ко- торой соответствует генотипу Beijing [Rahim Z. et al. Assessment of population structure and major circulating phylogeographical clades of Mycobacterium tuberculosis complex in Bangladesh suggests a high prevalence of a specific subclade of ancient M. tuberculosis geno- types. J Clin Microbiol. 2007. 45(11): 3791-3794].  Based on spoligotyping, these strains are also assigned to the PGG-1 line. which corresponds to the Beijing genotype [Rahim Z. et al. Assessment of population structure and major circulating phylogeographical clades of Mycobacterium tuberculosis complex in Bangladesh suggests a high prevalence of a specific subclade of ancient M. tuberculosis geno types. J Clin Microbiol. 2007. 45 (11): 3791-3794].
В гене токсина VapC38 rv2494) у штаммов PanR0907, PanR()902, PanROSOl , PaiiR0206, PanR0315, PanR0301, PanR()305, PanR0316 была обнаружена замена Giy7— *C197. соответ- ствующая генотипу Haarlem. In the toxin gene VapC38 rv2494) in the strains PanR0907, PanR () 902, PanROSOl, PaiiR0206, PanR0315, PanR0301, PanR () 305, PanR0316, the replacement Gi y7 - * C 197 was detected. according to Haarlem genotype.
У штамма PanR0908 присутствует замена С1 7— *Tt37 в гене rv34()8, характерная для ге- нотипа Т. The strain PanR0908 has a C 1 7 - * T t37 substitution in the rv34 () 8 gene, characteristic of the T. genotype.
У штаммов PanR02()2, PanR0208 и PanR0309 в гене токсина Vap31 (rv0749) обнаружены две замены С267— и A26s— *G268. но замены в гене rv2595 , характерной для EAI (включая линию филлипин), обнаружено не было. На основании сполиготипирования данные штаммы отнесены к кластеру Т. Можно сделать предположение, что PanR0202, PanR0208 и PanR0309 занимают промежуточное положение между Т и подгруппой филлипин генотипа EAI. In strains PanR02 () 2, PanR0208, and PanR0309, two substitutions of C 267 - and A 26 s— * G268 were found in the Vap31 toxin gene (rv0749). but no replacement was found in the rv2595 gene characteristic of EAI (including the phillipin line). Based on spoligotyping, these strains are assigned to cluster T. It can be assumed that PanR0202, PanR0208, and PanR0309 occupy an intermediate position between T and the phillipin subgroup of the EAI genotype.
У штаммов PanR1006, PanRl iOl, PanR0201, PanR()203, PanR0209, PanR0207, PanR0206, PanR0205, PanR0315, PanR0304, PanR0306, PanR0307, PanR0308, PanR()311, PanR0313, PanR0314, PanR0317, PanR0401, PanR0402, PanR0403, PanR0404, PanR0405, PanR()407, PanR0409, PanR0410, PanR0411, PanR0412, PanR06U, PanR061(), PanR0609, PanR0607, PanR0604, PanR0603, PanR0602, PanR0601, PanR0505, PanR0503, PanR0501, PanR1007, PanR0909, PanR0906, PanR()904, PanR0903, PanR0805, PanR0804, PanR0803, PanR0708, PanR0707, PanR0703 и PanR0702 в гене rv3408 был выявлен полиморфизм Ci 7— >T137, a другие полиморфизмы отсутствуют, это позволяет отнести их к генотипу LAM. For strains PanR1006, PanRl iOl, PanR0201, PanR ( ) 203, PanR0209, PanR0207, PanR0206, PanR0205, PanR0315, PanR0304, PanR0306, PanR0307, PanR0308, PanR () 311, PanR0313, PanR03R040, PanR03R040, PanR03R040, PanR03R040, PanR03R040, PanR03R040, PanR03R040, PanR03R040, PanR03R040, PanR03R040, PanR03R040, PanR03R040, PanR03R040, PanR03R040, PanR03R040, , PanR0405, PanR () 407, PanR0409, PanR0410, PanR0411, PanR0412 , PanR06U, PanR061 (), PanR0609, PanR0607, PanR0604, PanR0603, PanR0602, PanR0601, PanR0505, PanR0503, PanR0501, PanR1007, PanR0909, PanR0906, PanR () 904 , PanR0903, PanR0805, PanR0804, PanR0803, PanR0708, PanR0707, PanR0703 and PanR0702 in the rv3408 gene, Ci 7 -> T 137 polymorphism was detected, and other polymorphisms are absent, which allows us to attribute them to the LAM genotype.
Таким образом, предлагаемый способ обеспечивает высокую чувствительность генотипирования Mycobacterium tuberculosis.  Thus, the proposed method provides high sensitivity genotyping of Mycobacterium tuberculosis.

Claims

Формула изобретения Claim
Метод генотипирования штаммов Mycobacterium tuberculosis, основанный на однонуклео- тидном полиморфизме функциональных регуляторных генов систем токсин-антитоксин II типа суперсемейств VapBC, HigAB и MazEF и характеризующийся тем, что для идентифи- кации проводят амплификацию с геномной ДНК с использованием набора олигонуклеоти- дов для 10 генов систем токсин-антитоксин, представленных в таблице 2, причем ПЦР про- дукты анализируют в агарозном геле, размер полученного фрагмента определяют с помо- щью ДНК-маркера, затем вьщеляют целевые фрагменты из ПЦР-смеси или агарозного геля и секвенируют их с целью обнаружения соответствующих полиморфизмов; исследуемый штамм относится к генотипу Beijing в случае выявления полиморфизмов: ^— »G 6 при сек- венировании фрагмента, наработанного при использовании олигонуклеотидов Rv2103cN- Rv2103cC, Сзбз— *· 63 при использовании олигонуклеотидов Rvl 956N-Rvl956C, Т143— >С14з при использовании олигонуклеотидов Rv2494N-Rv2494C; исследуемый штамм относится к генотипу EAI в случае выявления полиморфизмов: С267— *G267 и A26s— +G26s при секвениро- вании фрагмента, наработанного при использовании олигонуклеотидов Rv0749N-Rv0749C и Gi92-*Ai92 при использовании олигонуклеотидов Rv2595N-Rv2595C; исследуемый штамм относится к генотипу Ural в случае выявления полиморфизма С394— >Т394 при секвенирова- нии фрагмента, наработанного при использовании олигонуклеотидов Rvl397N-Rvl397C; исследуемый штамм относится к генотипу LAM9 в случае выявления полиморфизма G3— >Аз при секвенировании фрагмента, наработанного при использовании олигонуклеоти- дов Rv2274N-Rv2274C: исследуемый штамм относится к генотипу F15/LAM4/KZN в случае выявления полиморфизма Ci68— >Тт при секвенировании фрагмента, наработанного при использовании олигонуклеотидов Rv2494N-Rv2494C и Сно-^А при использовании оли- гонуклеотидов Rvl740N-Rvl740C; исследуемый штамм относится к генотипу SMI-049 в случае выявления полиморфизма G213— >C2i3 при секвенировании фрагмента, наработанного при использовании олигонуклеотидов Rv2526N-Rv2526C: исследуемый штамм относится к генотипу Haarlem в случае выявления полиморфизма Gi 7— »С при секвенировании фраг- мента, наработанного при использовании олигонуклеотидов Rv2494N-Rv2494C; исследуе- мый штамм относится к генотипу Т в случае выявления полиморфизма Ti37— >Ci37 при сек- венировании фрагмента, наработанного при использовании олигонуклеотидов Rv3408- Rv3408C; исследуемый штамм относится к генотипу LAM в случае выявления наличия Т137 в сочетании с отсутствием полиморфизмов по остальным генам при секвенировании фраг- мента, наработанного при использовании олигонуклеотидов Rv3408-Rv34()8C. The method of genotyping of strains of Mycobacterium tuberculosis, based on the single-nucleotide polymorphism of the functional regulatory genes of the toxin-antitoxin II systems of the VapBC, HigAB and MazEF superfamilies and characterized in that amplification with genomic DNA is carried out using a set of oligonucleotides for 10 genes the toxin-antitoxin systems shown in Table 2, whereby the PCR products are analyzed on an agarose gel, the size of the obtained fragment is determined using a DNA marker, then the target fragments are inserted from the PCR mixture if the agarose gel and sequenced in order to detect their respective polymorphisms; the studied strain belongs to the Beijing genotype in case of detection of polymorphisms: ^ - »G 6 when sequencing a fragment obtained using Rv2103cN-Rv2103cC oligonucleotides, Szbz— * · 6 3 when using Rvl 956N-Rvl956C oligonucleotides, T143—> 14 when using oligonucleotides Rv2494N-Rv2494C; the studied strain belongs to the EAI genotype in the case of the detection of polymorphisms: C 2 6 7 - * G 26 7 and A 26 s— + G 2 6s during sequencing of the fragment obtained using oligonucleotides Rv0749N-Rv0749C and Gi9 2 - * Ai9 2 when the use of oligonucleotides Rv2595N-Rv2595C; the studied strain belongs to the Ural genotype in case of detection of C394 -> T 3 94 polymorphism during sequencing of a fragment generated using Rvl397N-Rvl397C oligonucleotides; the studied strain belongs to the LAM9 genotype in case of detection of the G 3 -> Az polymorphism when sequencing a fragment obtained using Rv2274N-Rv2274C oligonucleotides: the studied strain refers to the F15 / LAM4 / KZN genotype in the case of Ci 6 8 -> T t polymorphism when sequencing a fragment generated using Rv2494N-Rv2494C and Со ^ A oligonucleotides using Rvl740N-Rvl740C oligonucleotides; the studied strain belongs to genotype SMI-049 in case of detection of G 21 3—> C 2 i3 polymorphism when sequencing a fragment obtained using Rv2526N-Rv2526C oligonucleotides: the studied strain refers to the Haarlem genotype in case of revealing Gi 7 - »C polymorphism during fragment sequencing - ment obtained using Rv2494N-Rv2494C oligonucleotides; the studied strain belongs to the T genotype in the case of the detection of Ti 37 -> Ci 37 polymorphism during sequencing of a fragment obtained using Rv3408-Rv3408C oligonucleotides; the studied strain belongs to the LAM genotype in the case of the presence of T 137 in combination with the absence of polymorphisms of the remaining genes during sequencing of the fragment generated using Rv3408-Rv34 () 8C oligonucleotides.
PCT/RU2014/000559 2013-12-12 2014-07-24 Use of type ii toxin-antitoxin system genes to genotype strains of mycobacterium tuberculosis WO2015088384A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EA201600315A EA028354B1 (en) 2013-12-12 2014-07-24 Use of type ii toxin-antitoxin system genes to genotype strains of mycobacterium tuberculosis

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
RU2013155216/10A RU2547598C1 (en) 2013-12-12 2013-12-12 METHOD OF GENOTYPING STRAINS Mycobacterium tuberculosis
RU2013155216 2013-12-12

Publications (1)

Publication Number Publication Date
WO2015088384A1 true WO2015088384A1 (en) 2015-06-18

Family

ID=53296402

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/RU2014/000559 WO2015088384A1 (en) 2013-12-12 2014-07-24 Use of type ii toxin-antitoxin system genes to genotype strains of mycobacterium tuberculosis

Country Status (3)

Country Link
EA (1) EA028354B1 (en)
RU (1) RU2547598C1 (en)
WO (1) WO2015088384A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106048019A (en) * 2016-06-13 2016-10-26 遵义医学院附属医院 Antituberculous drug drug-resistance gene and screening method thereof

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2612894C1 (en) * 2015-12-11 2017-03-13 Федеральное Государственное Бюджетное Учреждение науки Институт химической биологии и фундаментальной медицины Сибирского отделения РАН (ИХБФМ СО РАН) Method for brca1 and brca2 genes exons nucleotide sequence determination
RU2689800C1 (en) * 2017-12-07 2019-05-29 федеральное государственное бюджетное учреждение "Санкт-Петербургский научно-исследовательский институт фтизиопульмонологии" Министерства здравоохранения Российской Федерации Method for detection of isolates mycobacterium tuberculosis beijing 94-32-cluster in real time format
RU2760751C1 (en) * 2021-06-09 2021-11-30 Федеральное государственное бюджетное учреждение "Национальный медицинский исследовательский центр фтизиопульмонологии и инфекционных заболеваний" Министерства здравоохранения Российской Федерации (ФГБУ "НМИЦ ФПИ" Минздрава России) Strain of mycobacterium tuberculosis bn for modelling latent tuberculosis infection

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2237090C1 (en) * 2003-04-24 2004-09-27 Институт химической биологии и фундаментальной медицины СО РАН Method for genetic typing mycobacterium strains of tuberculosis complex
RU2405836C2 (en) * 2008-05-12 2010-12-10 Федеральное государственное учреждение "Санкт-Петербургский научно-исследовательский институт фтизиопульмонологии Федерального агентства по высокотехнологичной медицинской помощи" Method for mycobacterium tuberculosis beijing genotype detection
US20110105531A1 (en) * 2007-06-22 2011-05-05 Ibis Biosciences, Inc. Compositions and methods for identification of subspecies characteristics of mycobacterium tuberculosis

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2237090C1 (en) * 2003-04-24 2004-09-27 Институт химической биологии и фундаментальной медицины СО РАН Method for genetic typing mycobacterium strains of tuberculosis complex
US20110105531A1 (en) * 2007-06-22 2011-05-05 Ibis Biosciences, Inc. Compositions and methods for identification of subspecies characteristics of mycobacterium tuberculosis
RU2405836C2 (en) * 2008-05-12 2010-12-10 Федеральное государственное учреждение "Санкт-Петербургский научно-исследовательский институт фтизиопульмонологии Федерального агентства по высокотехнологичной медицинской помощи" Method for mycobacterium tuberculosis beijing genotype detection

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
JIA- RU CHANG ET AL.: "Clonal Expansion of Both Modem and Ancient Genotypes of Mycobacterium tuberculosis in Southern Taiwan", PLOS ONE, vol. 7, no. ISSUE, August 2012 (2012-08-01), pages E43018 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106048019A (en) * 2016-06-13 2016-10-26 遵义医学院附属医院 Antituberculous drug drug-resistance gene and screening method thereof

Also Published As

Publication number Publication date
EA028354B1 (en) 2017-11-30
RU2547598C1 (en) 2015-04-10
EA201600315A1 (en) 2016-08-31

Similar Documents

Publication Publication Date Title
Abadia et al. Resolving lineage assignation on Mycobacterium tuberculosis clinical isolates classified by spoligotyping with a new high-throughput 3R SNPs based method
Schönian et al. Molecular approaches for a better understanding of the epidemiology and population genetics of Leishmania
Scicluna et al. DNA barcoding of Blastocystis
JP5116481B2 (en) A method for simplifying microbial nucleic acids by chemical modification of cytosine
US20170183725A1 (en) Next Generation Genomic Sequencing Methods
TWI647236B (en) Primers, snp markers and method for genotyping mycobacterium tuberculosis
WO2015088384A1 (en) Use of type ii toxin-antitoxin system genes to genotype strains of mycobacterium tuberculosis
Hoshide et al. Geographical differences associated with single-nucleotide polymorphisms (SNPs) in nine gene targets among resistant clinical isolates of Mycobacterium tuberculosis
JP2020010714A (en) Compositions and methods for detection and analysis of Mycobacterium tuberculosis
US9365904B2 (en) Ion torrent genomic sequencing
Xiao et al. Cas12a/guide RNA-based platform for rapid and accurate identification of major Mycobacterium species
US20220136071A1 (en) Methods and systems for detecting pathogenic microbes in a patient
CN112384608A (en) Bacterial capture sequencing platform and design, construction and use methods thereof
Yang et al. A genome-phenome association study in native microbiomes identifies a mechanism for cytosine modification in DNA and RNA
Asgharzadeh et al. Current trends in molecular epidemiology studies of Mycobacterium tuberculosis
Guerbouj et al. Molecular tools for understanding eco-epidemiology, diversity and pathogenesis of Leishmania parasites
Muñoz et al. An American lineage of Helicobacter pylori prophages found in Colombia
Dijkshoorn Acinetobacter baumannii
RU2689800C1 (en) Method for detection of isolates mycobacterium tuberculosis beijing 94-32-cluster in real time format
Benikhlef et al. ITS1 and cpb genetic polymorphisms in Algerian and Tunisian Leishmania infantum isolates from humans and dogs
RU2735415C1 (en) Method for detecting mycobacteria tuberculosis central asian epidemic cluster beijing genotype
US9637800B2 (en) Diagnostic test for bacterial pathogens using internal control bacterial strain
US10190176B2 (en) Primers, probes, and methods for mycobacterium tuberculosis specific diagnosis
Soto Serrano et al. Matching Excellence: ONT's Rise to Parity with PacBio in Genome Reconstruction of Non-Model Bacterium with High GC Content
e Oliveira Development of novel genotyping method of Mycobacterium tuberculosis strains based on discriminatory analysis of whole genomes alignment

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14868731

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 201600315

Country of ref document: EA

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 14868731

Country of ref document: EP

Kind code of ref document: A1