RU2237090C1 - Method for genetic typing mycobacterium strains of tuberculosis complex - Google Patents

Abstract

FIELD: molecular biology, medicine, biochemistry.

SUBSTANCE: method involves isolation of genome DNA followed by amplification of DNA polymorphous loci with primers flanking their in separate reaction mixtures and the following detection of polymerase chain reaction (PCR) products and determination of allele number in according with the formula taking into account the size of PCR-product, number and size of tandem repeats. As analyzing polymorphous DNA loci the following loci are used: locus V1 (position 2531891-253207 in genome of the strain Mycobacterium tuberculosis H37Rv), locus V2 (position 4052968-4053546 in genome of the strain M. tuberculosis H37Rv), locus V3 (position 1882885-1983323 in genome of the strain M. tuberculosis H37Rv), locus V4 (position 2163729-2164083 in genome of the strain M. tuberculosis H37Rv). Direct (u) and reverse (r) primers flanking their have the following nucleotide sequences: V1u G-A-A-T-T-C-T-T-C-G-G-T-G-G-T-C-T-C-G-A-G-T-G; V1r C-T-A-C-G-G-T-G-T-A-G-C-G-T-C-G-T-G-A-C; V2u T-A-C-A-C-G-C-A-G-C-T-G-G-A-A-A-G-T-C-C-A-G; V2r G-G-T-C-G-T-T-G-G-T-C-T-A-G-C-C-A-G-T-G-G; V3u A-C-G-G-A-A-G-G-A-A-T-A-C-T-C-A-G-C-G-G-A-G; V3r C-T-T-C-A-G-T-C-T-G-C-C-G-G-C-A-A-T-A-A-C-G; V4u C-G-G-T-A-T-C-C-T-G-A-T-G-T-T-A-A-T-C-G-T-T-A-A-G-G; V4r C-C-A-T-C-C-C-A-C-T-G-A-G-C-G-T-C-G-A-A-G. Method provides determining identity of mycobacterium genome of tuberculosis complex and exhibits enhanced differentiating capacity, simplicity in performing and treatment of analysis data.

EFFECT: improved method for genetic typing.

4 cl, 1 dwg, 1 ex

Description

The invention relates to molecular biology and medicine and can be used to establish the identity of the genomes of mycobacterium tuberculosis complex in epidemiological studies and clinical medicine.

Genetic typing of mycobacteria of the tuberculosis complex allows monitoring the dynamics of the activity of the epidemic process, establishing the source of infection during the investigation of individual local outbreaks of tuberculosis infection, identifying cases of laboratory cross-contamination, and differential diagnosis of superinfection and reactivation of tuberculosis.

Mycobacterium tuberculosis is highly conserved genome. DNA polymorphism significant for molecular epidemiological studies has been identified for repeating elements of the genome, such as perfect and imperfect repeats, transposable elements.

Known methods for the genetic typing of mycobacteria within the genus and species for molecular epidemiology by analyzing polymorphism of restriction fragment lengths (RFLPs) [1], spoligotyping [2], by typing dispersed mycobacterial elements MIRU (mycobacterial interspread repeat units) [3].

For the longest time, for molecular epidemiology purposes, a method is used to determine the length polymorphism of restriction fragments using a hybridization probe for the insertion sequence IS 6110 (IS 6110 RFLP) [1]. This method is currently the standard of discriminatory ability. The disadvantage of the IS 6110 RFLP method is multi-stage, the need to obtain a significant amount of pure culture for DNA isolation and complex laboratory equipment. The method is retrospective, the results are complicated for accounting and interpretation, which cannot be done without special software (Gelcompar, Taxotron, etc.), for a comparative analysis of the distribution of electrophoretic patterns of DNA hydrolysis in a gel and the search for matching genotypes in the database. The feature of the used target, the insertion sequence IS 6110, is that this insertion element has preferred integration sites in the genome, which leads to the appearance of the same genotypes in the absence of clonal connections between them and false conclusions in epidemiological analysis. In addition, strains circulating in some territories have single copies of the sequence in the genome, which critically reduces the discriminatory ability of the method.

Methods based on polymerase chain reaction (PCR) -solidigotyping and VNTR-typing (analysis of tandem repeats varying in number) [4] and dispersed mycobacterial elements (MIRU) [3] are much simpler to use, biologically safe, because do not require cultivation of mycobacteria, can be used as express methods. The results are easy to interpret; storing in a convenient format makes it easy to create databases.

Closest to the claimed method, the prototype, is a VNTR typing method using for analysis of exact tandem repeats ETR A, B, C, D, E in the genome of mycobacterium tuberculosis complex [4]. This method uses a system of five pairs of primers annealed below and above each tandem repeat:

ETR-A1 AAATCGGTCCCATCACCTTCTTAT;

ETR-A2 CGAAGCCTGGGGTGCCCGCGATTT;

ETR-B1 GCGAACACCAGGACAGCATCATG;

ETR-B2 GGCATGCCGGTGATCGAGTGG;

ETR-C1 GTGAGTCGCTGCAGAACCTGCAG;

ETR-C2 GGCGTCTTGACCTCCACGAGTG;

ETR-D1 CAGGTCACAACGAGAGGAAGAGC;

ETR-D2 GCGGATCGGCCAGCGACTCCTC;

ETR-E1 CTTCGGCGTCGAAGAGAGCCTC;

ETR-E2 CGGAACGCTGGTCACCACCTAAG.

PCR is carried out separately for each pair of primers in a final volume of 25 μl containing 2.5 μl. 10x GeneAmp PCR buffer II (Perkin-Elmer Cetus) 2 mM MgCl ₂ ; 100 nM of each primer, 200 μM dNTP and 0.625 U of AmpliTaq Gold DNA Polymerase (Perkin-Elmer Cetus). Initial denaturation at 95 ° C for 12 min, then for 35 cycles with denaturation at 94 ° C for 30 sec, annealing at 60 ° C for 1 min and synthesis at 72 ° C for 2 min. Final elongation is carried out at 72 ° C for 10 minutes. The size of the PCR product is determined on an agarose gel in TBE buffer followed by staining with ethidium bromide and documented as a five-digit number representing the allelic profile of ETR A, B, C, D, E.

However, the VNTR-typing method using these polymorphic sites has less discriminatory ability in comparison with the classical RFLP method and does not always allow us to differentiate closely related clonal-disseminated variants of mycobacterial strains circulating in certain geographical areas.

An object of the invention is to increase the differentiating ability of the method through the use of new polymorphic DNA loci of Mycobacterium tuberculosis complex.

The proposed method is as follows:

The genomic DNA of mycobacterium tuberculosis complex is isolated from clinical samples and environmental objects by boiling without subsequent purification according to standard methods. Further, to differentiate, or to establish the identity of the isolates of the mycobacterium tuberculosis complex, polymorphic DNA loci are amplified with selected primer pairs in separate reaction mixtures. A preliminary search for polymorphic loci in the genome of M. tuberculosis H37Rv strain, the nucleotide sequence of which was previously fully determined by Cole S.T et al. (5). For analysis using the following loci and flanking their primers:

1. V1 Locus 2531891-2532207 in the genome of M. tuberculosis H37Rv strain (in the promoter of the adhE2 gene encoding alcohol dehydrogenase)

53 bp repeat

Direct Primer: V1u GAATTCTTCGGTGGTCTCGAGTG

Reverse Primer: V1r CTACGGTGTAGCGTCGCTGAC

2. V2 Locus 4052968-4053546 in the genome of M. tuberculosis strain H37Rv (as part of the coding sequence of the gene for the hypothetical protein Rv3611.

A repeat of 111 bp

Direct primer: V2u TACACGCAGCTGGAAAGTCCAG

Reverse Primer: V2r GGTCGTTGGTCTAGCCAGTGG

3. V3 Locus 1882885-1983323 in the genome of the M. tuberculosis H37Rv strain (as part of the coding sequence of the genes of the PEE family (proteins rich in Gly-, Asn-).

A repeat of 78 bp

Direct Primer: V3u ACGGAAGGAATACTCAGCGGAG

Reverse Primer: V3r CTTCAGTCTGCCGGCAATAACG

4. V4 Locus 2163729-2164083 in the genome of the M. tuberculosis strain H37Rv (as part of the coding sequence of the MPTR family genes (PPE) (proteins rich in Gly-, Asn-).

A repeat of 69 bp

Direct Primer: V4u CGGTATCCTGATGTTAATCGTAAGG

Reverse Primer: V4r CCATCCCACTGAGCGTCGAAG

The reaction mixture used in a volume of 20 μl, contains 67 mm Tris-Hcl (pH 8.9), 16 mm ammonium sulfate; 1.5 mM MgCl ₂ ; 0.01% Tween 20; 0.2 mM dNTP; 0.5 μM solutions of direct and reverse oligonucleotide primers and Taq polymerase enzyme (recombinant) 1 ED. The amplification mode used includes the steps of: initial denaturation at 96 ° C for 2 min, then for 39 cycles with denaturation at 95 ° C for 1 min, annealing at 64 ° C for 1 min, and synthesis at 72 ° C for 2 min. Final elongation is carried out at 72 ° C for 10 minutes PCR products are fractionated in a 1.5% agarose gel, followed by staining with ethidium bromide.

Alleles are determined by determining the size of the PNR fragment with subsequent calculation of the number of copies of each tandem repeat in accordance with the calculation formula and documented as a four-digit number representing the allelic profile in accordance with the number of tandem repeats at loci V1, V2, V3, V4. The following formulas for calculating allele numbers are used:

V1: (fragment size (bp) - 51): 53

V2: (fragment size (bp) - 93): 111

V3: (fragment size (bp) - 63): 78

V4: (fragment size (bp) - 100): 69

The inventive method was analyzed 100 strains of mycobacterium tuberculosis complex, isolated in the Novosibirsk region and other regions of the world. The proposed method allows us to distinguish not only strains with a high degree of evolutionary divergence, but also closely related isolates. For example, 16 isolates belonging to the family of Beijing strains having the same genotype when analyzed using the prototype were divided into 10 genetic variants.

The determining significant difference of the proposed method, in comparison with the prototype, is that for analysis we used four new polymorphic loci V1, V2, V3, V4 in the genome of mycobacterium tuberculosis complex, the amplification of which using PCR is carried out with selected four pairs of direct and reverse flanking them primers, which allows to increase the differentiating ability of the method, to provide the possibility of differentiation of closely related isolates within the clonal-disseminated variants of the pathogen, rkuliruyuschih in the area. In addition, the two types of polymorphic loci described in the prototype do not show polymorphism in the genome of strains of mycobacteria circulating in the West Siberian region and are useless for their typing. Thus, the use of the proposed method will allow, in comparison with the prototype, to significantly increase the discriminatory ability of the latter, significantly exceeding the manufacturability of laboratory research, the method of storage and processing of results.

The proposed method will allow to identify taxonomic differences within the genus and species of mycobacteria of the tuberculosis complex, having a slight evolutionary divergence, because uses rapidly evolving polymorphic loci in the genome of the causative agent of tuberculosis. In the practice of epidemiological surveillance, this method will allow to differentiate closely related strains having endemic distribution in certain territories.

The method allows to reduce the number of analyzed polymorphic loci from 5 to 4, which saves material resources. Changed upward and differentiating ability, tk. the two types of polymorphic loci described in the prototype do not exhibit polymorphism in the genome of strains of mycobacterium tuberculosis complex circulating in the West Siberian region.

The invention is illustrated by the following specific embodiment.

Example.

In clinical trials, to differentiate closely related isolates of the family of Beijing strains, genomic DNA from clinical samples was isolated by boiling without subsequent purification by the standard method. Then, to differentiate or establish the identity of the isolates, four polymorphic DNA loci were amplified: V1, V2, V3, V4 with selected primer pairs in separate reaction mixtures.

Used the reaction mixture in a volume of 20 μl, contained 67 mm Tris-Hcl (pH 8.9), 16 mm ammonium sulfate; 1.5 mM MgCl ₂ ; 0.01% Tween 20; 0.2 mM dNTP; 0.5 μM solutions of oligonucleotide primers and Taq polymerase enzyme (recombinant) 1 ED. For each analyzed strain, 4 reaction mixtures were made, differing in the content of the corresponding pair of primers flanking one of the four analyzed loci. The nucleotide sequences for 22-link direct (u) and 21-link reverse (r) primers for loci V1, V2, V3, V4 are as follows:

V1u GAATTCTTCGGTGGTCTCGAGTG,

V1r CTACGGTGTAGCGTCGCTGAC;

V2u TACACGCAGCTGGAAAGTCCAG

V2r GGTCGTTGGTCTAGCCAGTGG

V3u ACGGAAGGAATACTCAGCGGAG

V3r CTTCAGTCTGCCGGCAATAACG

V4u CGGTATCCTGATGTTAATCGTAAGG

V4r CCATCCCACTGAGCGTCGAAG

The amplification mode used was the same for all primer pairs. It included the following stages: initial denaturation at 96 ° С for 2 min, then for 39 cycles with denaturation at 95 ° С for 1 min, annealing at 64 ° С for 1 min, and synthesis at 72 ° С for 2 min. Final elongation was carried out at 72 ° C for 10 min. PCR products were fractionated in a 1.5% agarose gel for 30 min at a voltage of 300 V. The gel was stained with ethidium bromide, visualized in ultraviolet light with a wavelength of 260 nm.

Alleles for isolates of the Beijing strain family were determined by comparing the size of the amplified DNA fragment with a molecular weight marker. Next, the calculation of the number of copies of each tandem repeat was carried out in accordance with the formula for each pair of primers:

V1: (fragment size (bp) - 51): 53

V2: (fragment size (bp) - 93): 111

V3: (fragment size (bp) - 63): 78

V4: (fragment size (bp) - 100): 69

The drawing shows an example of amplification of the V1 locus, where M is the molecular weight marker - DNA of the plasmid pBlueScript hydrolyzed with Nae III. 1-15 amplification products using primers at locus V1. On tracks 6, 10, 15, the size of the amplified fragment corresponds to the content of 6 tandem repeats (indicated as the number 6 in the four-digit description of the strain genotype); 1, 2, 3, - the size of the amplified fragment corresponds to the content of 7 tandem repeats; in the genome of isolates 4, 11, 12, 13, the locus contains 3 tandem repeats; eight tandem repeats in the genome of isolates 5 and 9; in the genome of isolates 7 and 8, ten tandem repeats at the studied locus (V1).

The genotype obtained in a similar way when analyzing 4 loci was documented as a four-digit number representing the allelic profile in accordance with the number of tandem repeats at loci V1, V2, V3, V4. For example: 3544, where 3 is the number of tandem repeats at locus V1, 5 is the number of tandem repeats at locus V2, 4 is the number of tandem repeats at locus V3, and 4 is the number of tandem repeats at locus V4.

When testing the proposed method for the genetic typing of mycobacterium tuberculosis complex, 16 clinical isolates of closely related mycobacteria of the family of Beijing strains and 3 reference laboratory strains H37Rv, BCG, Academy were genotyped. As a result, it was found that all of the newly proposed loci V1, V2, V3, V4 showed polymorphism in the genome of the studied strains. The proposed method using the found loci V1, V2, V3, V4 allowed us to divide 16 closely related strains into eight types. Genotyping using exact tandem repeats ETR A, B, C, D, E - the prototype [4] does not allow differentiating these options, since exact tandem repeats are not polymorphic in the genomes of these strains.

Thus, the discriminatory ability of the proposed method of genetic typing based on the proposed loci is comparable to the classical standard in molecular epidemiology - the IS 6110 RFLP method for differentiating strains within the family of Beijing strains, but compares favorably with the simplicity of laboratory technology and the method of processing and storing the results.

SOURCES OF INFORMATION

1. van Embden J.D., Crawford J.T., Dale J.W. et al. // J. Clin. Microbiol. - 1993. - Vol. 31. - P.406-409.

2. Kamerbeek J., Schouls L., Kolk A. et al. // J. Clin. Microbiol. - 1997. - Vol. 35. - P.907-914.

3. Mazars E., Lesjean S., Gilbert M et al. // PNAS.- 2001.-V. 98. - No. 4. - P.1901-1906.

4. Frothingham R. and Meeker-O'Connell W. A. // Microbiology. - 1998. - Vol. 144.- P.1189-1196.

5. Cole S. T., Brosch R., Parkhill J. et al. // Nature. - 1998. - Vol. 393. - P.537-544.

Claims (4)

1. A method for the genetic typing of strains of mycobacterium tuberculosis complex, including isolation of genomic DNA, amplification of polymorphic DNA loci with primers flanking them in separate reaction mixtures, followed by detection of PCR products and determining the allele number in accordance with a formula that takes into account the size of the PCR product, the number and the size of tandem repeats, characterized in that the V1, V2, V3, and V4 loci are used as the analyzed polymorphic DNA loci, and the forward (u) and reverse (r) primers flanking them have the following Suitable nucleotide sequences: V1u GAATTCTTCGGTGGTCTCGAGTG, V1r CTACGGTGTAGCGTCGCTGAC, V2u TACACGCAGCTGGAAAGTCCAG, V2r GGTCGTTGGTCTAGCCAGTGG, V3u ACGGAAGGAATACTCAGCGGAG, V3r CTTCAGTCTGCCGGCAATAACG, V4u CGGTATCCTGATGTTAATCGTAAGG, V4r CCATCCCACTGAGCGTCGAAG. 2. The method according to claim 1, characterized in that for each analyzed strain are four reaction mixtures containing the corresponding pair of primers flanking one of the four analyzed loci. 3. The method according to claim 1, characterized in that the identified alleles are assigned a four-digit number representing the allelic profile in accordance with the number of tandem repeats at loci V1, V2, V3, V4. 4. The method according to claim 1, characterized in that the allele number for each of the four loci is determined by the formulas: V1: (N-51): 53; V2: (N-93): 111; V3: (N-63): 78; V4: (N-100): 69, where N is the size of the DNA fragment, bp