WO2015054676A2

WO2015054676A2 - Compositions for modulating c9orf72 expression

Info

Publication number: WO2015054676A2
Application number: PCT/US2014/060194
Authority: WO
Inventors: Susan M. Freier; Frank Rigo; Priyam SINGH
Original assignee: Isis Pharmaceuticals, Inc.
Priority date: 2013-10-11
Filing date: 2014-10-11
Publication date: 2015-04-16
Also published as: IL244759A0; CL2020003121A1; CN105637090B; US10221414B2; US20160251655A1; US20230112920A1; EP4166667A2; AU2020220099A1; CN105637090A; EP3055414A2; SG11201602597YA; CA2926408A1; JP2016533717A; US11339393B2; PH12016500603A1; WO2015054676A3; EP4166667A3; RU2748426C2; KR20160062069A; AU2014331652B2

Abstract

Disclosed herein are compositions and methods for reducing expression of C90RF72 mRNA and protein in an animal with C90RF72 specific inhibitors. Also disclosed herein are compositions and methods of selectively inhibiting a C90RF72 pathogenic associated mRNA variant by administering an antisense compound targeting the region beginning at the start site of exon 1A to the start site of exon 1B of a C90RF72 pre-mRNA. Such methods are useful to treat, prevent, or ameliorate neurodegenerative diseases in an individual in need thereof. Such C90RF72 specific inhibitors include antisense compounds.

Description

COMPOSITIONS FOR MODULATING C90RF72 EXPRESSION Sequence Listing

The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled BIOL0235WOSEQ ST25.txt created October 11, 2014, which is 444 Kb in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.

Field

Provided are compositions and methods for reducing expression of C90RF72 mRNA and protein in an animal. Such methods are useful to treat, prevent, or ameliorate neurodegenerative diseases, including amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), corticalbasal degeneration syndrome (CBD), atypical Parkinsonian syndrome, and

olivopontocerellar degeneration (OPCD).

Background

Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disease characterized clinically by progressive paralysis leading to death from respiratory failure, typically within two to three years of symptom onset (Rowland and Shneider, N. Engl. J. Med., 2001, 344, 1688-1700). ALS is the third most common neurodegenerative disease in the Western world (Hirtz et al., Neurology, 2007, 68, 326-337), and there are currently no effective therapies. Approximately 10% of cases are familial in nature, whereas the bulk of patients diagnosed with the disease are classified as sporadic as they appear to occur randomly throughout the population (Chio et al, Neurology, 2008, 70, 533-537). There is growing recognition, based on clinical, genetic, and epidemiological data, that ALS and frontotemporal dementia (FTD) represent an overlapping continuum of disease, characterized pathologically by the presence of TDP-43 positive inclusions throughout the central nervous system (Lillo and Hodges, J. Clin. Neurosci., 2009, 16, 1131-1135; Neumann et al., Science, 2006, 314, 130-133).

To date, a number of genes have been discovered as causative for classical familial ALS, for example, SOD1, TARDBP, FUS, OPTN, and VCP (Johnson et al., Neuron, 2010, 68, 857-864; Kwiatkowski et al, Science, 2009, 323, 1205-1208; Maruyama et al, Nature, 2010, 465, 223-226; Rosen et al., Nature, 1993, 362, 59-62; Sreedharan et al., Science, 2008, 319, 1668-1672; Vance et al., Brain, 2009, 129, 868-876). Recently, linkage analysis of kindreds involving multiple cases of ALS, FTD, and ALS-FTD had suggested that there was an important locus for the disease on the short arm of chromosome 9 (Boxer et al., J. Neurol. Neurosurg. Psychiatry, 2011, 82, 196-203; Morita et al., Neurology, 2006, 66, 839-844; Pearson et al. J. Nerol., 2011, 258, 647-655; Vance et al., Brain, 2006, 129, 868-876). The mutation in the C90RF72 gene is the most common genetic cause of ALS and FTD. The ALS-FTD causing mutation is a large hexanucleotide (GGGGCC) repeat expansion in the first intron of the C90RF72 gene (Renton et al., Neuron, 2011, 72, 257-268; DeJesus-Hernandez et al., Neuron, 2011, 72, 245-256). A founder haplotype, covering the

C90RF72 gene, is present in the majority of cases linked to this region (Renton et al., Neuron, 2011, 72, 257-268). This locus on chromosome 9p21 accounts for nearly half of familial ALS and nearly one-quarter of all ALS cases in a cohort of 405 Finnish patients (Laaksovirta et al, Lancet Neurol, 2010, 9, 978-985).

A founder haplotype, covering the C90RF72 gene, is present in the majority of cases linked to this region.

There are currently no effective therapies to treat such neurodegenerative diseases.

Therefore, it is an object to provide compositions and methods for the treatment of such

neurodegenerative diseases.

Summary

Provided herein are compositions and methods for modulating levels of C90RF72 mRNA and protein in cells, tissues, and animals. In certain embodiments, C90RF72 specific inhibitors modulate expression of C90RF72 mRNA and protein. In certain embodiments, C90RF72 specific inhibitors are nucleic acids, proteins, or small molecules.

In certain embodiments, modulation can occur in a cell or tissue. In certain embodiments, the cell or tissue is in an animal. In certain embodiments, the animal is a human. In certain embodiments, C90RF72 mRNA levels are reduced. In certain embodiments, C90RF72 protein levels are reduced. In certain embodiments, C90RF72 associated Repeat Associated Non-ATG Translation (RAN translation) products are reduced. In certain embodiments, the C90RF72 associated RAN translation products are poly-(glycine-proline), poly-(glycine-alanine), and poly- (glycine-arginine). In certain embodiments, certain C90RF72 mRNA variants are preferentially reduced. In certain embodiments, the C90RF72 mRNA variants preferentially reduced are variants processed from a pre-mRNA containing intron 1. In certain embodiments, intron 1 contains a hexanucleotide repeat expansion. In certain embodiments, the C90RF72 mRNA variant preferentially reduced is a C90RF72 pathogenic associated mRNA variant. In certain

embodiments, the C90RF72 pathogenic associated mRNA variant is NM 001256054.1 (SEQ ID NO: 1). In certain embodiments, the hexanucleotide repeat expansion is associated with a

C90RF72 associated disease. In certain embodiments, the hexanucleotide repeat expansion is associated with a C90RF72 hexanucleotide repeat expansion associated disease. In certain embodiments, the hexanucleotide repeat expansion comprises at least 24 GGGGCC repeats. In certain embodiments, the hexanucleotide repeat expansion is associated with nuclear foci. In certain embodiments, C90RF72 associated RAN translation products are associated with nuclear foci. In certain embodiments, the C90RF72 associated RAN translation products are are poly-(glycine- proline), poly-(glycine-alanine), and poly-(glycine-arginine). In certain embodiments, the compositions and methods described herein are useful for reducing C90RF72 mRNA levels, C90RF72 protein levels, C90RF72 RAN translation products, and nuclear foci. In certain embodiments, the compositions and methods described herein are useful for selectively reducing C90RF72 pathogenic associated mRNA variants. Such reduction can occur in a time-dependent manner or in a dose-dependent manner.

Also provided are methods useful for preventing, treating, and ameliorating diseases, disorders, and conditions associated with C90RF72. In certain embodiments, such diseases, disorders, and conditions associated with C90RF72 are neurodegenerative diseases. In certam embodiments, the neurodegenerative disease is amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), corticalbasal degeneration syndrome (CBD), atypical Parkinsonian syndrome, and olivopontocerellar degeneration (OPCD).

Such diseases, disorders, and conditions can have one or more risk factors, causes, or outcomes in common. Certain risk factors and causes for development of a neurodegenerative disease, and, in particular, ALS and FTD, include genetic predisposition and older age.

In certain embodiments, methods of treatment include administering a C90RF72 specific inhibitor to an individual in need thereof. In certain embodiments, the C90RF72 specific inhibitor is a nucleic acid. In certain embodiments, the nucleic acid is an antisense compound. In certain embodiments, the antisense compound is a single-stranded antisense oligonucleotide. In certain embodiments, the single-stranded antisense oligonucleotide is complementary to a C90RF72 nucleic acid.

Detailed Description

It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of "or" means "and/or" unless stated otherwise. Additionally, as used herein, the use of "and" means "and/or" unless stated otherwise. Furthermore, the use of the term "including" as well as other forms, such as "includes" and "included", is not limiting. Also, terms such as

"element" or "component" encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise.

The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this disclosure, including, but not limited to, patents, patent applications, published patent applications, articles, books, treatises, and GENBANK Accession Numbers and associated sequence information obtainable through databases such as National Center for Biotechnology Information (NCBI) and other data referred to throughout in the disclosure herein are hereby expressly incorporated by reference for the portions of the document discussed herein, as well as in their entirety.

Definitions

Unless specific definitions are provided, the nomenclature utilized in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques may be used for chemical synthesis, and chemical analysis.

Unless otherwise indicated, the following terms have the following meanings:

"2'-0-methoxyethyl" (also 2'-MOE and 2'-OCH₂CH₂-OCH₃ and MOE) refers to an O- methoxy-ethyl modification of the 2' position of a furanose ring. A 2'-0-methoxyethyl modified sugar is a modified sugar.

"2'-MOE nucleoside" (also 2'-0-methoxyethyl nucleoside) means a nucleoside comprising a MOE modified sugar moiety. "2 '-substituted nucleoside" means a nucleoside comprising a substituent at the 2'-position of the furanose ring other than H or OH. In certain embodiments, 2 '-substituted nucleosides include nucleosides with bicyclic sugar modifications.

"5-methylcytosine" means a cytosine modified with a methyl group attached to the 5' position. A 5-methylcytosine is a modified nucleobase.

"About" means within ±7% of a value. For example, if it is stated, "the compounds affected at least about 70% inhibition of C90RF72", it is implied that the C90RF72 levels are inhibited within a range of 63% and 77%.

"Administered concomitantly" refers to the co-administration of two pharmaceutical agents in any manner in which the pharmacological effects of both are manifest in the patient at the same time. Concomitant administration does not require that both pharmaceutical agents be administered in a single pharmaceutical composition, in the same dosage form, or by the same route of administration. The effects of both pharmaceutical agents need not manifest themselves at the same time. The effects need only be overlapping for a period of time and need not be coextensive.

"Administering" means providing a pharmaceutical agent to an animal, and includes, but is not limited to administering by a medical professional and self-administering.

"Amelioration" refers to a lessening, slowing, stopping, or reversing of at least one indicator of the severity of a condition or disease. The severity of indicators may be determined by subjective or objective measures, which are known to those skilled in the art.

"Animal" refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.

"Antibody" refers to a molecule characterized by reacting specifically with an antigen in some way, where the antibody and the antigen are each defined in terms of the other. Antibody may refer to a complete antibody molecule or any fragment or region thereof, such as the heavy chain, the light chain, Fab region, and Fc region.

"Antisense activity" means any detectable or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid.

"Antisense compound" means an oligomeric compound that is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding. Examples of antisense compounds include single- stranded and double-stranded compounds, such as, antisense oligonucleotides, siRNAs, shRNAs, ssRNAs, and occupancy-based compounds.

"Antisense inhibition" means reduction of target nucleic acid levels in the presence of an antisense compound complementary to a target nucleic acid compared to target nucleic acid levels or in the absence of the antisense compound.

"Antisense mechanisms" are all those mechanisms involving hybridization of a compound with a target nucleic acid, wherein the outcome or effect of the hybridization is either target degradation or target occupancy with concomitant stalling of the cellular machinery involving, for example, transcription or splicing.

"Antisense oligonucleotide" means a single-stranded oligonucleotide having a nucleobase sequence that permits hybridization to a corresponding segment of a target nucleic acid.

"Base complementarity" refers to the capacity for the precise base pairing of nucleobases of an antisense oligonucleotide with corresponding nucleobases in a target nucleic acid (i.e., hybridization), and is mediated by Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen binding between corresponding nucleobases.

"Bicyclic sugar" means a furanose ring modified by the bridging of two atoms. A bicyclic sugar is a modified sugar.

"Bicyclic nucleoside" (also BNA) means a nucleoside having a sugar moiety comprising a bridge connecting two carbon atoms of the sugar ring, thereby forming a bicyclic ring system. In certain embodiments, the bridge connects the 4'-carbon and the 2'-carbon of the sugar ring.

"C90RF72 associated disease" means any disease associated with any C90RF72 nucleic acid or expression product thereof. Such diseases may include a neurodegenerative disease. Such neurodegenerative diseases may include ALS and FTD.

"C90RF72 associated RAN translation products" means aberrant peptide or di-peptide polymers translated through RAN translation (i.e., repeat-associated, and non-ATG-dependent translation). In certain embodiments, the C90RF72 associated RAN translation products are any of poly-(glycine-proline), poly-(glycine-alanine), and poly-(glycine-arginine).

"C90RF72 hexanucleotide repeat expansion associated disease" means any disease associated with a C90RF72 nucleic acid containing a hexanucleotide repeat expansion. In certain embodiments, the hexanucleotide repeat expansion may comprise GGGGCC, GGGGGG,

GGGGGC, or GGGGCG repeated at least 24 times. Such diseases may include a neurodegenerative disease. Such neurodegenerative diseases may include ALS and FTD. "C90RF72 nucleic acid" means any nucleic acid encoding C90RF72. For example, in certain embodiments, a C90RF72 nucleic acid includes a DNA sequence encoding C90RF72, an RNA sequence transcribed from DNA encoding C90RF72 including genomic DNA comprising introns and exons (i.e., pre-mRNA), and an mRNA sequence encoding C90RF72. "C90RF72 mRNA" means an mRNA encoding a C90RF72 protein.

"C90RF72 pathogenic associated mRNA variant" means the C90RF72 mRNA variant processed from a C90RF72 pre-mRNA variant containing the hexanucleotide repeat. A C90RF72 pre-mRNA contains the hexanucleotide repeat when transcription of the pre-mRNA begins in the region from the start site of exon 1 A to the start site of exon IB, e.g., nucleotides 1107 to 1520 of the genomic sequence (SEQ ID NO: 2, the complement of GENBANK Accession No.

NT_008413.18 truncated from nucleosides 27535000 to 27565000). In certain embodiments, the level of a C90RF72 pathogenic associated mRNA variant is measured to determine the level of a C90RF72 pre-mRNA containting the hexanucleotide repeat in a sample.

"C90RF72 specific inhibitor" refers to any agent capable of specifically inhibiting the expression of C90RF72 mRNA and/or C90RF72 protein at the molecular level. For example, C90RF72 specific inhibitors include nucleic acids (including antisense compounds), siRNAs, aptamers, antibodies, peptides, small molecules, and other agents capable of inhibiting the expression of C90RF72 mRNA and/or C90RF72 protein. Similarly, in certain embodiments, C90RF72 specific inhibitors may affect other molecular processes in an animal.

"Cap structure" or "terminal cap moiety" means chemical modifications, which have been incorporated at either terminus of an antisense compound.

"cEt" or "constrained ethyl" means a bicyclic nucleoside having a sugar moiety comprising a bridge connecting the 4'-carbon and the 2'-carbon, wherein the bridge has the formula: 4'- CH(CH₃)-0-2'.

"Constrained ethyl nucleoside" (also cEt nucleoside) means a nucleoside comprising a bicyclic sugar moiety comprising a 4'-CH(CH₃)-0-2' bridge.

"Chemically distinct region" refers to a region of an antisense compound that is in some way chemically different than another region of the same antisense compound. For example, a region having 2'-0-methoxyethyl nucleosides is chemically distinct from a region having nucleosides without 2'-0-methoxyethyl modifications.

"Chimeric antisense compound" means an antisense compound that has at least two chemically distinct regions, each position having a plurality of subunits. "Co-administration" means administration of two or more pharmaceutical agents to an individual. The two or more pharmaceutical agents may be in a single pharmaceutical composition, or may be in separate pharmaceutical compositions. Each of the two or more pharmaceutical agents may be administered through the same or different routes of administration. Co-administration encompasses parallel or sequential administration.

"Complementarity" means the capacity for pairing between nucleobases of a first nucleic acid and a second nucleic acid.

"Comprise," "comprises," and "comprising" will be understood to imply the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements.

"Contiguous nucleobases" means nucleobases immediately adjacent to each other.

"Designing" or"designed to" refer to the process of designing an oligomeric compound that specifically hybridizes with a selected nucleic acid molecule.

"Diluent" means an ingredient in a composition that lacks pharmacological activity, but is pharmaceutically necessary or desirable. For example, in drugs that are injected, the diluent may be a liquid, e.g. saline solution.

"Dose" means a specified quantity of a pharmaceutical agent provided in a single administration, or in a specified time period. In certain embodiments, a dose may be administered in one, two, or more boluses, tablets, or injections. For example, in certain embodiments where subcutaneous administration is desired, the desired dose requires a volume not easily accommodated by a single injection, therefore, two or more injections may be used to achieve the desired dose. In certain embodiments, the pharmaceutical agent is administered by infusion over an extended period of time or continuously. Doses may be stated as the amount of pharmaceutical agent per hour, day, week, or month.

"Effective amount" in the context of modulating an activity or of treating or preventing a condition means the administration of that amount of pharmaceutical agent to a subject in need of such modulation, treatment, or prophylaxis, either in a single dose or as part of a series, that is effective for modulation of that effect, or for treatment or prophylaxis or improvement of that condition. The effective amount may vary among individuals depending on the health and physical condition of the individual to be treated, the taxonomic group of the individuals to be treated, the formulation of the composition, assessment of the individual's medical condition, and other relevant factors. "Efficacy" means the ability to produce a desired effect.

"Expression" includes all the functions by which a gene's coded information is converted into structures present and operating in a cell. Such structures include, but are not limited to the products of transcription and translation.

"Foci" means a nuclear foci comprising a C90RF72 transcript. In certain embodiments, a foci comprises at least one C90RF72 transcript. In certain embodiments, C90RF72 foci comprise transcripts comprising any of the following hexanucleotide repeats: GGGGCC, GGGGGG,

GGGGGC, and/or GGGGCG.

"Fully complementary" or "100% complementary" means each nucleobase of a first nucleic acid has a complementary nucleobase in a second nucleic acid. In certain embodiments, a first nucleic acid is an antisense compound and a target nucleic acid is a second nucleic acid.

"Gapmer" means a chimeric antisense compound in which an internal region having a plurality of nucleosides that support RNase H cleavage is positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region may be referred to as a "gap" and the external regions may be referred to as the "wings."

"Gap-narrowed" means a chimeric antisense compound having a gap segment of 9 or fewer contiguous 2'-deoxyribonucleosides positioned between and immediately adjacent to 5' and 3' wing segments having from 1 to 6 nucleosides.

"Gap-widened" means a chimeric antisense compound having a gap segment of 12 or more contiguous 2'-deoxyribonucleosides positioned between and immediately adjacent to 5' and 3' wing segments having from 1 to 6 nucleosides.

"Hexanucleotide repeat expansion" means a series of six bases (for example, GGGGCC,

GGGGGG, GGGGCG, or GGGGGC) repeated at least twice. In certain embodiments, the hexanucleotide repeat expansion may be located in intron 1 of a C90RF72 nucleic acid. In certain embodiments, a pathogenic hexanucleotide repeat expansion includes at least 24 repeats of

GGGGCC, GGGGGG, GGGGCG, or GGGGGC in a C90RF72 nucleic acid and is associated with disease. In certain embodiments, the repeats are consecutive. In certain embodiments, the repeats are interrupted by 1 or more nucleobases. In certain embodiments, a wild-type hexanucleotide repeat expansion includes 23 or fewer repeats of GGGGCC, GGGGGG, GGGGCG, or GGGGGC in a C90RF72 nucleic acid. In certain embodiments, the repeats are consecutive. In certain embodiments, the repeats are interrupted by 1 or more nucleobases. "Hybridization" means the annealing of complementary nucleic acid molecules. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense compound and a target nucleic acid. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense oligonucleotide and a nucleic acid target.

"Identifying an animal having a C90RF72 associated disease" means identifying an animal having been diagnosed with a C90RF72 associated disease or predisposed to develop a C90RF72 associated disease. Individuals predisposed to develop a C90RF72 associated disease include those having one or more risk factors for developing a C90RF72 associated disease, including, having a personal or family history or genetic predisposition of one or more C90RF72 associated diseases. Such identification may be accomplished by any method including evaluating an individual's medical history and standard clinical tests or assessments, such as genetic testing.

"Immediately adjacent" means there are no intervening elements between the immediately adjacent elements.

"Individual" means a human or non-human animal selected for treatment or therapy.

"Inhibiting C90RF72" means reducing the level or expression of a C90RF72 mR A and/or protein. In certain embodiments, C90RF72 mRNA and/or protein levels are inhibited in the presence of an antisense compound targeting C90RF72, including an antisense oligonucleotide targeting C90RF72, as compared to expression of C90RF72 mRNA and/or protein levels in the absence of a C90RF72 antisense compound, such as an antisense oligonucleotide.

"Inhibiting the expression or activity" refers to a reduction or blockade of the expression or activity and does not necessarily indicate a total elimination of expression or activity.

"Internucleoside linkage" refers to the chemical bond between nucleosides.

"Linked nucleosides" means adjacent nucleosides linked together by an internucleoside linkage.

"Locked nucleic acid" or " LNA" or "LNA nucleosides" means nucleic acid monomers having a bridge connecting two carbon atoms between the 4' and 2'position of the nucleoside sugar unit, thereby forming a bicyclic sugar. Examples of such bicyclic sugar include, but are not limited to A) a-L-Methyleneoxy (4'-CH₂-0-2') LNA , (B) β-D-Methyleneoxy (4'-CH₂-0-2') LNA , (C) Ethyleneoxy (4'-(CH₂)₂-0-2') LNA , (D) Aminooxy (4'-CH₂-0-N(R)-2') LNA and (E) Oxyamino (4'-CH₂-N(R)-0-2') LNA, as depicted below.

As used herein, LNA compounds include, but are not limited to, compounds having at least one bridge between the 4' and the 2' position of the sugar wherein each of the bridges independently comprises 1 or from 2 to 4 linked groups independently selected from -[C(Ri)(R2)]_n-, -C(R₁)=C(R₂)- , -C(Ri)=N-, -C(=NR])-, -C(=0)-, -C(=S)-, -0-, -Si(Ri)₂-, -S(=0)_x- and -N(Ri)-; wherein: x is 0, 1, or 2; n is 1, 2, 3, or 4; each i and R₂ is, independently, H, a protecting group, hydroxyl, Ci- Ci2 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C2₀ aryl, substituted C5-C2₀ aryl, a heterocycle radical, a substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJi, NJ1J2, SJi, N₃, COOJj, acyl (C(=0)-H), substituted acyl, CN, sulfonyl (S(=0)2-Ji), or sulfoxyl (S(=0)-Ji); and each Ji and h is, independently, H, C1-C12 alkyl, substituted C₁-C₁₂ alkyl, C₂-C₁₂ alkenyl, substituted C₂-C₁₂ alkenyl, C₂-C₁₂ alkynyl, substituted C₂- C12 alkynyl, C5-C2₀ aryl, substituted C5-C2₀ aryl, acyl (C(=0)-H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C1-C12 aminoalkyl, substituted C1-C12 aminoalkyl or a protecting group.

Examples of 4'- 2' bridging groups encompassed within the definition of LNA include, but are not limited to one of formulae: -[C(Ri)(R₂)]_n-, -[C(Ri)(R₂)]_n-0-, -C(RiR₂)-N(Ri)-0- or - C(RiR2)-0-N(Ri)-. Furthermore, other bridging groups encompassed with the definition of LNA are 4'-CH₂-2', 4'-(CH₂)2-2', 4'-(CH₂)₃-2', 4'-CH₂-0-2', 4'-(CH₂)₂-0-2', 4'-CH₂-0-N(Ri)-2' and 4'-CH₂- N(Ri)-0-2'- bridges, wherein each Ri and R2 is, independently, H, a protecting group or C1-C12 alkyl.

Also included within the definition of LNA according to the invention are LNAs in which the 2'-hydroxyl group of the ribosyl sugar ring is connected to the 4' carbon atom of the sugar ring, thereby forming a methyleneoxy (4'-CH2-0-2') bridge to form the bicyclic sugar moiety. The bridge can also be a methylene (-CH2-) group connecting the 2' oxygen atom and the 4' carbon atom, for which the term methyleneoxy (4'-CH2-0-2') LNA is used. Furthermore; in the case of the bicylic sugar moiety having an ethylene bridging group in this position, the term ethyleneoxy (4'- CH2CH2-O-2') LNA is used, a -L- methyleneoxy (4'-Ο¾-0-2'), an isomer of methyleneoxy (4'- CH2-0-2') LNA is also encompassed within the definition of LNA, as used herein. "Mismatch" or "non-complementary nucleobase" refers to the case when a nucleobase of a first nucleic acid is not capable of pairing with the corresponding nucleobase of a second or target nucleic acid.

"Modified internucleoside linkage" refers to a substitution or any change from a naturally occurring internucleoside bond (i.e. , a phosphodiester internucleoside bond).

"Modified nucleobase" means any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil. An "unmodified nucleobase" means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).

"Modified nucleoside" means a nucleoside having, independently, a modified sugar moiety and/or modified nucleobase.

"Modified nucleotide" means a nucleotide having, independently, a modified sugar moiety, modified internucleoside linkage, and/or modified nucleobase.

"Modified oligonucleotide" means an oligonucleotide comprising at least one modified internucleoside linkage, modified sugar, and/or modified nucleobase.

"Modified sugar" means substitution and/or any change from a natural sugar moiety.

"Monomer" means a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides, whether naturally occurring or modified.

"Motif means the pattern of unmodified and modified nucleoside in an antisense compound. "Natural sugar moiety" means a sugar moiety found in DNA (2'-H) or R A (2'-OH).

"Naturally occurring internucleoside linkage" means a 3' to 5' phosphodiester linkage.

"Non-complementary nucleobase" refers to a pair of nucleobases that do not form hydrogen bonds withone another or otherwise support hybridization.

"Nucleic acid" refers to molecules composed of monomeric nucleotides. A nucleic acid includes, but is not limited to, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single- stranded nucleic acids, double-stranded nucleic acids, small interfering ribonucleic acids (siRNA), and microRNAs (miRNA).

"Nucleobase" means a heterocyclic moiety capable of pairing with a base of another nucleic acid.

"Nucleobase complementarity" refers to a nucleobase that is capable of base pairing with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In certain embodiments,

complementary nucleobase refers to a nucleobase of an antisense compound that is capable of base pairing with a nucleobase of its target nucleic acid. For example, if a nucleobase at a certain position of an antisense compound is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, then the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be complementary at that nucleobase pair.

"Nucleobase sequence" means the order of contiguous nucleobases independent of any sugar, linkage, and/or nucleobase modification.

"Nucleoside" means a nucleobase linked to a sugar.

"Nucleoside mimetic" includes those structures used to replace the sugar or the sugar and the base and not necessarily the linkage at one or more positions of an oligomeric compound such as for example nucleoside mimetics having morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicyclo, or tricyclo sugar mimetics, e.g., non furanose sugar units. Nucleotide mimetic includes those structures used to replace the nucleoside and the linkage at one or more positions of an oligomeric compound such as for example peptide nucleic acids or morpho linos (morpholinos linked by -N(H)-C(=0)-0- or other non-phosphodiester linkage). Sugar surrogate overlaps with the slightly broader term nucleoside mimetic but is intended to indicate replacement of the sugar unit

(furanose ring) only. The tetrahydropyranyl rings provided herein are illustrative of an example of a sugar surrogate wherein the furanose sugar group has been replaced with a tetrahydropyranyl ring system. "Mimetic" refers to groups that are substituted for a sugar, a nucleobase, and/or internucleoside linkage. Generally, a mimetic is used in place of the sugar or sugar-internucleoside linkage combination, and the nucleobase is maintained for hybridization to a selected target.

"Nucleotide" means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.

"Off-target effect" refers to an unwanted or deleterious biological effect assocaited with modulation of RNA or protein expression of a gene other than the intended target nucleic acid.

"Oligomeric compound" or "oligomer" means a polymer of linked monomeric subunits which is capable of hybridizing to at least a region of a nucleic acid molecule.

"Oligonucleotide" means a polymer of linked nucleosides each of which can be modified or unmodified, independent one from another.

"Parenteral administration" means administration through injection (e.g., bolus injection) or infusion. Parenteral administration includes subcutaneous administration, intravenous

administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g., intrathecal or intracerebro ventricular

administration.

"Peptide" means a molecule formed by linking at least two amino acids by amide bonds. Without limitation, as used herein, peptide refers to polypeptides and proteins.

"Pharmaceutical agent" means a substance that provides a therapeutic benefit when administered to an individual. For example, in certain embodiments, an antisense oligonucleotide targeted to C90RF72 is a pharmaceutical agent.

"Pharmaceutical composition" means a mixture of substances suitable for administering to as subject. For example, a pharmaceutical composition may comprise an antisense oliognucleotide and a sterile aqueous solution.

"Pharmaceutically acceptable derivative" encompasses pharmaceutically acceptable salts, conjugates, prodrugs or isomers of the compounds described herein.

"Pharmaceutically acceptable salts" means physiologically and pharmaceutically acceptable salts of antisense compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxicological effects thereto.

"Phosphorothioate linkage" means a linkage between nucleosides where the phosphodiester bond is modified by replacing one of the non-bridging oxygen atoms with a sulfur atom. A phosphorothioate linkage is a modified internucleoside linkage.

"Portion" means a defined number of contiguous (i.e., linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an antisense compound.

"Prevent" or "preventing" refers to delaying or forestalling the onset or development of a disease, disorder, or condition for a period of time from minutes to days, weeks to months, or indefinitely.

"Prodrug" means a therapeutic agent that is prepared in an inactive form that is converted to an active form within the body or cells thereof by the action of endogenous enzymes or other chemicals or conditions.

"Prophylactically effective amount" refers to an amount of a pharmaceutical agent that provides a prophylactic or preventative benefit to an animal.

"Region" is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic. "Ribonucleotide" means a nucleotide having a hydroxy at the 2' position of the sugar portion of the nucleotide. Ribonucleotides may be modified with any of a variety of substituents.

"Salts" mean a physiologically and pharmaceutically acceptable salts of antisense compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxicological effects thereto.

"Segments" are defined as smaller or sub-portions of regions within a target nucleic acid.

"Shortened" or "truncated" versions of antisense oligonucleotides taught herein have one, two or more nucleosides deleted.

"Side effects" means physiological responses attributable to a treatment other than desired effects. In certain embodiments, side effects include, without limitation, injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, and myopathies.

"Single-stranded oligonucleotide" means an oligonucleotide which is not hybridized to a complementary strand.

"Sites," as used herein, are defined as unique nucleobase positions within a target nucleic acid.

"Slows progression" means decrease in the development of the disease.

"Specifically hybridizable" refers to an antisense compound having a sufficient degree of complementarity between an antisense oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays and therapeutic treatments.

"Stringent hybridization conditions" or "stringent conditions" refer to conditions under which an oligomeric compound will hybridize to its target sequence, but to a minimal number of other sequences.

"Subject" means a human or non-human animal selected for treatment or therapy.

"Target" refers to a protein, the modulation of which is desired.

"Target gene" refers to a gene encoding a target.

"Targeting" or "targeted" means the process of design and selection of an antisense compound that will specifically hybridize to a target nucleic acid and induce a desired effect.

"Target nucleic acid," "target RNA," and "target RNA transcript" and "nucleic acid target" all mean a nucleic acid capable of being targeted by antisense compounds. "Target region" means a portion of a target nucleic acid to which one or more antisense compounds is targeted.

"Target segment" means the sequence of nucleotides of a target nucleic acid to which an antisense compound is targeted. "5' target site" refers to the 5 '-most nucleotide of a target segment. "3 ' target site" refers to the 3 '-most nucleotide of a target segment.

"Therapeutically effective amount" means an amount of a pharmaceutical agent that provides a therapeutic benefit to an individual.

"Treat" or "treating" or "treatment" means administering a composition to effect an alteration or improvement of a disease or condition.

"Unmodified nucleobases" means the purine bases adenine (A) and guanine (G), and the pyrimidine bases (T), cytosine (C), and uracil (U).

"Unmodified nucleotide" means a nucleotide composed of naturally occuring nucleobases, sugar moieties, and internucleoside linkages. In certain embodiments, an unmodified nucleotide is an RNA nucleotide (i.e. β-D-ribonucleosides) or a DNA nucleotide (i.e. β-D-deoxyribonucleoside).

"Wing segment" means a plurality of nucleosides modified to impart to an oligonucleotide properties such as enhanced inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases.

Certain Embodiments

Certain embodiments provide compositions and methods for decreasing total C90RF72 mRNA and protein expression.

Certain embodiments provide compositions and methods for decreasing C90RF72 pathogenic associated mRNA variants.

Certain embodiments provide methods for the treatment, prevention, or amelioration of diseases, disorders, and conditions associated with C90RF72 in an individual in need thereof. Also contemplated are methods for the preparation of a medicament for the treatment, prevention, or amelioration of a disease, disorder, or condition associated with C90RF72. C90RF72 associated diseases, disorders, and conditions include neurodegenerative diseases. In certain embodiments, the neurodegenerative disease may be ALS or FTD. In certain embodiments, the neurodegenerative disease may be familial or sporadic.

Certain embodiments provide compositions and methods for the treatment, prevention, or amelioration of a C90RF72 hexanucleotide repeat expansion associated disease. In certain embodiments, the hexanucleotide repeat expansion may comprise GGGGCC, GGGGGG,

GGGGGC, or GGGGCG.

Provided herein are compounds, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: SEQ ID NOs: 20-401 and 441-1545.

Provided herein are compounds, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 1107-1520 of SEQ ID NO: 2.

Provided herein are compounds, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 1111-1200 of SEQ ID NO: 2.

Provided herein are compounds, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 1211-1318 of SEQ ID NO: 2.

Provided herein are compounds, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 1326-1540 of SEQ ID NO: 2.

Provided herein are compounds, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 1331-1375 of SEQ ID NO: 2. Provided herein are compounds, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 1368-1391 of SEQ ID NO: 2

Provided herein arecompounds, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 1398-1424 of SEQ ID NO: 2.

Provided herein are compounds, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 1411-1440 of SEQ ID NO: 2.

Provided herein are compounds, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 1429-1481 of SEQ ID NO: 2.

Provided herein are compounds, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 1502-1539 of SEQ ID NO: 2.

Provided herein are compounds, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 1508-1539 of SEQ ID NO: 2.

Provided herein are compounds, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 7860-7906 of SEQ ID NO: 2.

Provided herein are compounds, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 7907-9744 of SEQ ID NO: 2.

Provided herein are compounds, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 7989-8038 of SEQ ID NO: 2.

Provided herein are compounds, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 8020-8135 of SEQ ID NO: 2.

Provided herein are compounds, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 8136-8161 of SEQ ID NO: 2.

Provided herein are compounds, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 8174-8211 of SEQ ID NO: 2.

Provided herein are compounds, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 8213-8325 of SEQ ID NO: 2.

In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to SEQ ID NO: 1.

In certain embodiments, the modified oligonucleotide is a single- stranded modified oligonucleotide.

In certain embodiments at least one internucleoside linkage of the m odified oligonucleotide is a modified internucleoside linkage.

In certain embodiments, at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.

In certain embodiments, each modified internucleoside linkage is a phosphorothioate internucleoside linkage.

In certain embodiments, at least one internucleoside linkage is a phosphodiester internucleoside linkage.

In certain embodiments, at least one internucleoside linkage is a phosphorothioate linkage and at least one internucleoside linkage is a phosphodiester linkage.

In certain embodiments, at least one nucleoside comprises a modified nucleobase.

In certain embodiments, the modified nucleobase is a 5-methylcytosine.

In certain embodiments, at least one nucleoside of the modified oligonucleotide comprises a modified sugar.

In certain embodiments, the at least one modified sugar is a bicyclic sugar.

In certain embodiments, the bicyclic sugar comprises a chemical link between the 2' and 4' position of the sugar 4'-CH2-N(R)-0-2' bridge wherein R is, independently, H, C1-C12 alkyl, or a protecting group.

In certain embodiments, the bicyclic sugar comprises a 4'-CH2-N(R)-0-2' bridge wherein R is, independently, H, C1-C12 alkyl, or a protecting group.

In certain embodiments, at least one modified sugar comprises a 2'-0-methoxyethyl group. In certain embodiments, the modified sugar comprises a 2'-0(CH₂)2-OCH₃ group.

In certain embodiments, the modified oligonucleotide comprises: a gap segment consisting of 10 linked deoxynucleosides;

a 5' wing segment consisting of 5 linked nucleosides; and

a 3' wing segment consisting of 5 linked nucleosides;

wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

In certain embodiments, the modified oligonucleotide comprises:

a gap segment consisting of 8 linked deoxynucleosides;

a 5' wing segment consisting of 5 linked nucleosides; and

a 3' wing segment consisting of 5 linked nucleosides;

In certain embodiments, the modified oligonucleotide comprises sugar modifications in any of the following patterns: eeekkdddddddkkeee, eekkddddddddkkeee, ekddddddddekekeee, kekeddddddddekeke, and ekekddddddddkekee; wherein,

e = a 2'-0-methoxyethyl modified nucleoside

d = a 2'-deoxynucleoside, and

k = a cEt nucleoside.

In certain embodiments, the modified oligonucleotide comprises intemucleoside linkages in any of the following patterns: soooossssssssssooss, sooosssssssssooss, soosssssssssooss, and sosssssssssoooss; wherein,

s = a phosphorothioate linkage, and

o = a phosphodiester linkage.

In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 19 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 18 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 17 linked nucleosides. Provided herein are compositions comprising the compound of any preceding claim or salt thereof and at least one of a pharmaceutically acceptable carrier or diluent.

Provided herein are methods comprising administering to an animal the compound or composition of any preceding claim.

In certain embodiments, the animal is a human.

In certain embodiments, administering the compound prevents, treats, ameliorates, or slows progression of a C90RF72 associated disease, disorder or condition.

In certain embodiments, administering the compound prevents, treats, ameliorates, or slows progression of a C90RF72 hexanucleotide repeat expansion associated disease, disorder or condition.

In certain embodiments, the disease, disorder or condition is amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), corticalbasal degeneration syndrome (CBD), atypical Parkinsonian syndrome, and olivopontocerellar degeneration (OPCD).

In certain embodiments, the administering reduces nuclear foci.

In certain embodiments, the administering reduces expression of C90RF72 associated

RAN translation products.

In certain embodiments, the C90RF72 associated RAN translation products are any of poly-(glycine-proline), poly-(glycine-alanine), and poly-(glycine-arginine).

Provided herein are uses of the compound or composition of any preceding claim for the manufacture of a medicament for treating a neurodegenerative disorder.

Provided herein are methods of selectively inhibiting a C90RF72 pathogenic associated mRNA variant by administering an antisense compound targeting the region beginning at the start site of exon 1 A to the start site of exon IB of a C90RF72 pre-mRNA.

Antisense Compounds

Oligomeric compounds include, but are not limited to, oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics, antisense compounds, antisense

oligonucleotides, and siRNAs. An oligomeric compound may be "antisense" to a target nucleic acid, meaning that is is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.

In certain embodiments, an antisense compound has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted. In certain such embodiments, an antisense oligonucleotide has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.

In certain embodiments, an antisense compound targeted to a C90RF72 nucleic acid is 12 to 30 subunits in length. In other words, such antisense compounds are from 12 to 30 linked subunits. In certain embodiments, the antisense compound is 8 to 80, 12 to 50, 15 to 30, 18 to 24, 19 to 22, or 20 linked subunits. In certain embodiments, the antisense compounds are 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked subunits in length, or a range defined by any two of the above values. In some embodiments the antisense compound is an antisense

oligonucleotide, and the linked subunits are nucleosides.

In certain embodiments antisense oligonucleotides targeted to a C90RF72 nucleic acid may be shortened or truncated. For example, a single subunit may be deleted from the 5' end (5' truncation), or alternatively from the 3 ' end (3 ' truncation). A shortened or truncated antisense compound targeted to a C90RF72 nucleic acid may have two subunits deleted from the 5 ' end, or alternatively may have two subunits deleted from the 3' end, of the antisense compound.

Alternatively, the deleted nucleosides may be dispersed throughout the antisense compound, for example, in an antisense compound having one nucleoside deleted from the 5' end and one nucleoside deleted from the 3' end.

When a single additional subunit is present in a lengthened antisense compound, the additional subunit may be located at the 5' or 3' end of the antisense compound. When two or more additional subunits are present, the added subunits may be adjacent to each other, for example, in an antisense compound having two subunits added to the 5' end (5' addition), or alternatively to the 3' end (3' addition), of the antisense compound. Alternatively, the added subunits may be dispersed throughout the antisense compound, for example, in an antisense compound having one subunit added to the 5' end and one subunit added to the 3' end. It is possible to increase or decrease the length of an antisense compound, such as an antisense oligonucleotide, and/or introduce mismatch bases without eliminating activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a series of antisense oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model. Antisense oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the antisense oligonucleotides were able to direct specific cleavage of the target mRNA, albeit to a lesser extent than the antisense oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase antisense oligonucleotides, including those with 1 or 3 mismatches.

Gautschi et al (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti-tumor activity in vivo.

Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358,1988) tested a series of tandem 14 nucleobase antisense oligonucleotides, and a 28 and 42 nucleobase antisense oligonucleotides comprised of the sequence of two or three of the tandem antisense oligonucleotides, respectively, for their ability to arrest translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase antisense oligonucleotides alone was able to inhibit translation, albeit at a more modest level than the 28 or 42 nucleobase antisense oligonucleotides.

Antisense Compound Motifs

In certain embodiments, antisense compounds targeted to a C90RF72 nucleic acid have chemically modified subunits arranged in patterns, or motifs, to confer to the antisense compounds properties such as enhanced inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases.

Chimeric antisense compounds typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and/or increased inhibitory activity. A second region of a chimeric antisense compound may optionally serve as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an RNA:DNA duplex.

Antisense compounds having a gapmer motif are considered chimeric antisense compounds. In a gapmer an internal region having a plurality of nucleotides that supports RNaseH cleavage is positioned between external regions having a plurality of nucleotides that are chemically distinct from the nucleosides of the internal region. In the case of an antisense oligonucleotide having a gapmer motif, the gap segment generally serves as the substrate for endonuclease cleavage, while the wing segments comprise modified nucleosides. In certain embodiments, the regions of a gapmer are differentiated by the types of sugar moieties comprising each distinct region. The types of sugar moieties that are used to differentiate the regions of a gapmer may in some embodiments include β-D-ribonucleosides, β-D-deoxyribonucleosides, 2'-modified nucleosides (such 2 '-modified nucleosides may include 2'-MOE, and 2'-0-CH3, among others), and bicyclic sugar modified nucleosides (such bicyclic sugar modified nucleosides may include those having a 4'-(CH₂)n-0-2' bridge, where n=l or n=2 and 4'-CH₂-0-CH₂-2'). Preferably, each distinct region comprises uniform sugar moieties. The wing-gap-wing motif is frequently described as "X-Y-Z", where "X" represents the length of the 5' wing region, "Y" represents the length of the gap region, and "Z" represents the length of the 3' wing region. As used herein, a gapmer described as "X-Y-Z" has a configuration such that the gap segment is positioned immediately adjacent to each of the 5' wing segment and the 3' wing segment. Thus, no intervening nucleotides exist between the 5' wing segment and gap segment, or the gap segment and the 3' wing segment. Any of the antisense compounds described herein can have a gapmer motif. In some embodiments, X and Z are the same, in other embodiments they are different. In a preferred embodiment, Y is between 8 and 15 nucleotides. X, Y or Z can be any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30 or more nucleotides. Thus, gapmers described herein include, but are not limited to, for example 5-10-5, 5-10-4, 4-10-4, 4-10-3, 3-10-3, 2-10-2, 5-9-5, 5-9-4, 4-9-5, 5-8-5, 5-8-4, 4-8-5, 5-7- 5, 4-7-5, 5-7-4, or 4-7-4.

In certain embodiments, the antisense compound has a "wingmer" motif, having a wing- gap or gap-wing configuration, i.e. an X-Y or Y-Z configuration as described above for the gapmer configuration. Thus, wingmer configurations described herein include, but are not limited to, for example 5-10, 8-4, 4-12, 12-4, 3-14, 16-2, 18-1, 10-3, 2-10, 1-10, 8-2, 2-13, 5-13, 5-8, or 6-8.

In certain embodiments, antisense compounds targeted to a C90RF72 nucleic acid possess a 5-10-5 gapmer motif.

In certain embodiments, antisense compounds targeted to a C90RF72 nucleic acid possess a 5-8-5 gapmer motif. In certain embodiments, antisense compounds targeted to a C90RF72 nucleic acid possess sugar modifications in any of the following patterns: eeekkdddddddkkeee, eekkddddddddkkeee, ekddddddddekekeee, kekeddddddddekeke, and ekekddddddddkekee; wherein,

e = a 2'-0-methoxyethyl modified nucleoside

d = a 2'-deoxynucleoside, and

k = a cEt nucleoside.

In certain embodiments, an antisense compound targeted to a C90RF72 nucleic acid has a gap-narrowed motif. In certain embodiments, a gap-narrowed antisense oligonucleotide targeted to a C90RF72 nucleic acid has a gap segment of 9, 8, 7, or 6 2'-deoxynucleotides positioned immediately adjacent to and between wing segments of 5, 4, 3, 2, or 1 chemically modified nucleosides. In certain embodiments, the chemical modification comprises a bicyclic sugar. In certain embodiments, the bicyclic sugar comprises a 4' to bridge selected from among: 4'-(CH₂)_n- 0-2' bridge, wherein n is 1 or 2; and 4'-CH₂-0-CH₂-2'. In certain embodiments, the bicyclic sugar is comprises a 4'-CH(C]¾)-0-2' bridge. In certain embodiments, the chemical modification comprises a non-bicyclic 2'-modified sugar moiety. In certain embodiments, the non-bicyclic 2'- modified sugar moiety comprises a 2'-0-methylethyl group or a 2'-0-methyl group.

Target Nucleic Acids, Target Regions and Nucleotide Sequences

Nucleotide sequences that encode C90RF72 include, without limitation, the following: the complement of GENBANK Accession No. NM OO 1256054.1 (incorporated herein as SEQ ID NO: 1), GENBANK Accession No. NT 008413.18 truncated from nucleobase 27535000 to 27565000 (incorporated herein as SEQ ID NO: 2), GENBANK Accession No. BQ068108.1 (incorporated herein as SEQ ID NO: 3), GENBANK Accession No. NM_018325.3 (incorporated herein as SEQ ID NO: 4), GENBANK Accession No. DN993522.1 (incorporated herein as SEQ ID NO: 5), GENBANK Accession No. NMJ45005.5 (incorporated herein as SEQ ID NO: 6), GENBANK Accession No. DB079375.1 (incorporated herein as SEQ ID NO: 7), GENBANK Accession No. BU194591.1 (incorporated herein as SEQ ID NO: 8), Sequence Identifier 4141_014_A

(incorporated herein as SEQ ID NO: 9), and Sequence Identifier 4008 73 A (incorporated herein as SEQ ID NO: 10), and GENBANK Accession No. NW_001101662.1 truncated from nucleosides 8522000 to 8552000 (incorporated herein as SEQ ID NO: 19). It is understood that the sequence set forth in each SEQ ID NO in the Examples contained herein is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase. As such, antisense compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase. Antisense compounds described by Isis Number (Isis No) indicate a combination of nucleobase sequence and motif.

In certain embodiments, a target region is a structurally defined region of the target nucleic acid. For example, a target region may encompass a 3' UT , a 5' UTR, an exon, an intron, an exon/intron junction, a coding region, a translation initiation region, translation termination region, or other defined nucleic acid region. The structurally defined regions for C90RF72 can be obtained by accession number from sequence databases such as NCBI and such information is incorporated herein by reference. In certain embodiments, a target region may encompass the sequence from a 5 ' target site of one target segment within the target region to a 3' target site of another target segment within the same target region.

Targeting includes determination of at least one target segment to which an antisense compound hybridizes, such that a desired effect occurs. In certain embodiments, the desired effect is a reduction in mRNA target nucleic acid levels. In certain embodiments, the desired effect is reduction of levels of protein encoded by the target nucleic acid or a phenotypic change associated with the target nucleic acid.

A target region may contain one or more target segments. Multiple target segments within a target region may be overlapping. Alternatively, they may be non-overlapping. In certain embodiments, target segments within a target region are separated by no more than about 300 nucleotides. In certain emodiments, target segments within a target region are separated by a number of nucleotides that is, is about, is no more than, is no more than about, 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nucleotides on the target nucleic acid, or is a range defined by any two of the preceeding values. In certain embodiments, target segments within a target region are separated by no more than, or no more than about, 5 nucleotides on the target nucleic acid. In certain embodiments, target segments are contiguous. Contemplated are target regions defined by a range having a starting nucleic acid that is any of the 5' target sites or 3' target sites listed herein.

Suitable target segments may be found within a 5' UTR, a coding region, a 3' UTR, an intron, an exon, or an exon/intron junction. Target segments containing a start codon or a stop codon are also suitable target segments. A suitable target segment may specifcally exclude a certain structurally defined region such as the start codon or stop codon.

The determination of suitable target segments may include a comparison of the sequence of a target nucleic acid to other sequences throughout the genome. For example, the BLAST algorithm may be used to identify regions of similarity amongst different nucleic acids. This comparison can prevent the selection of antisense compound sequences that may hybridize in a non-specific manner to sequences other than a selected target nucleic acid (i.e., non-target or off-target sequences).

There may be variation in activity (e.g., as defined by percent reduction of target nucleic acid levels) of the antisense compounds within a target region. In certain embodiments, reductions in C90RF72 mRNA levels are indicative of inhibition of C90RF72 expression. Reductions in levels of a C90RF72 protein are also indicative of inhibition of target mRNA expression. Reduction in the presence of expanded C90RF72 RNA foci are indicative of inhibition of C90RF72 epxression. Further, phenotypic changes are indicative of inhibition of C90RF72 expression. For example, improved motor function and respiration may be indicative of inhibition of C90RF72 expression.

Hybridization

In some embodiments, hybridization occurs between an antisense compound disclosed herein and a C90RF72 nucleic acid. The most common mechanism of hybridization involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.

Hybridization can occur under varying conditions. Stringent conditions are sequence- dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.

Methods of determining whether a sequence is specifically hybridizable to a target nucleic acid are well known in the art. In certain embodiments, the antisense compounds provided herein are specifically hybridizable with a C90RF72 nucleic acid.

Complementarity

An antisense compound and a target nucleic acid are complementary to each other when a sufficient number of nucleobases of the antisense compound can hydrogen bond with the corresponding nucleobases of the target nucleic acid, such that a desired effect will occur (e.g., antisense inhibition of a target nucleic acid, such as a C90RF72 nucleic acid). Non-complementary nucleobases between an antisense compound and a C90RF72 nucleic acid may be tolerated provided that the antisense compound remains able to specifically hybridize to a target nucleic acid. Moreover, an antisense compound may hybridize over one or more segments of a C90RF72 nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure).

In certain embodiments, the antisense compounds provided herein, or a specified portion thereof, are, or are at least, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a C90RF72 nucleic acid, a target region, target segment, or specified portion thereof. Percent complementarity of an antisense compound with a target nucleic acid can be determined using routine methods.

For example, an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining noncomplementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. As such, an antisense compound which is 18 nucleobases in length having 4 (four) noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present invention. Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and

PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol, 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). Percent homology, sequence identity or

complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482 489).

In certain embodiments, the antisense compounds provided herein, or specified portions thereof, are fully complementary (i.e., 100% complementary) to a target nucleic acid, or specified portion thereof. For example, an antisense compound may be fully complementary to a C90RF72 nucleic acid, or a target region, or a target segment or target sequence thereof. As used herein,

"fully complementary" means each nucleobase of an antisense compound is capable of precise base pairing with the corresponding nucleobases of a target nucleic acid. For example, a 20 nucleobase antisense compound is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the antisense compound. Fully complementary can also be used in reference to a specified portion of the first and /or the second nucleic acid. For example, a 20 nucleobase portion of a 30 nucleobase antisense compound can be "fully complementary" to a target sequence that is 400 nucleobases long. The 20 nucleobase portion of the 30 nucleobase oligonucleotide is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20 nucleobase portion of the antisense compound. At the same time, the entire 30 nucleobase antisense compound may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the antisense compound are also complementary to the target sequence.

The location of a non-complementary nucleobase may be at the 5' end or 3' end of the antisense compound. Alternatively, the non-complementary nucleobase or nucleobases may be at an internal position of the antisense compound. When two or more non-complementary nucleobases are present, they may be contiguous (i.e., linked) or non-contiguous. In one embodiment, a non- complementary nucleobase is located in the wing segment of a gapmer antisense oligonucleotide.

In certain embodiments, antisense compounds that are, or are up to 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a C90RF72 nucleic acid, or specified portion thereof.

In certain embodiments, antisense compounds that are, or are up to 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non- complementary nucleobase(s) relative to a target nucleic acid, such as a C90RF72 nucleic acid, or specified portion thereof.

The antisense compounds provided herein also include those which are complementary to a portion of a target nucleic acid. As used herein, "portion" refers to a defined number of contiguous (i.e. linked) nucleobases within a region or segment of a target nucleic acid. A "portion" can also refer to a defined number of contiguous nucleobases of an antisense compound. In certain embodiments, the antisense compounds, are complementary to at least an 8 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 9 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 10 nucleobase portion of a target segment. In certain embodiments, the antisense compounds, are complementary to at least an 11 nucleobase portion of a target segment. In certain embodiments, the antisense compounds, are complementary to at least a 12 nucleobase portion of a target segment. In certain embodiments, the antisense compounds, are complementary to at least a 13 nucleobase portion of a target segment. In certain embodiments, the antisense compounds, are complementary to at least a 14 nucleobase portion of a target segment. In certain embodiments, the antisense compounds, are complementary to at least a 15 nucleobase portion of a target segment. Also contemplated are antisense compounds that are complementary to at least a 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleobase portion of a target segment, or a range defined by any two of these values.

Identity

The antisense compounds provided herein may also have a defined percent identity to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific Isis number, or portion thereof. As used herein, an antisense compound is identical to the sequence disclosed herein if it has the same nucleobase pairing ability. For example, a RNA which contains uracil in place of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine. Shortened and lengthened versions of the antisense compounds described herein as well as compounds having non-identical bases relative to the antisense compounds provided herein also are contemplated. The non-identical bases may be adjacent to each other or dispersed throughout the antisense compound. Percent identity of an antisense compound is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared.

In certain embodiments, the antisense compounds, or portions thereof, are at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the antisense compounds or SEQ ID NOs, or a portion thereof, disclosed herein.

In certain embodiments, a portion of the antisense compound is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.

In certain embodiments, a portion of the antisense oligonucleotide is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.

Modifications

A nucleoside is a base-sugar combination. The nucleobase (also known as base) portion of the nucleoside is normally a heterocyclic base moiety. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2', 3' or 5' hydroxyl moiety of the sugar. Oligonucleotides are formed through the covalent linkage of adjacent nucleosides to one another, to form a linear polymeric oligonucleotide. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside linkages of the oligonucleotide.

Modifications to antisense compounds encompass substitutions or changes to

internucleoside linkages, sugar moieties, or nucleobases. Modified antisense compounds are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target, increased stability in the presence of nucleases, or increased inhibitory activity.

Chemically modified nucleosides may also be employed to increase the binding affinity of a shortened or truncated antisense oligonucleotide for its target nucleic acid. Consequently, comparable results can often be obtained with shorter antisense compounds that have such chemically modified nucleosides.

Modified Internucleoside Linkages

The naturally occuring internucleoside linkage of RNA and DNA is a 3' to 5'

phosphodiester linkage. Antisense compounds having one or more modified, i.e. non-naturally occurring, internucleoside linkages are often selected over antisense compounds having naturally occurring internucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.

Oligonucleotides having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom as well as internucleoside linkages that do not have a phosphorus atom. Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing linkages are well known.

In certain embodiments, antisense compounds targeted to a C90RF72 nucleic acid comprise one or more modified internucleoside linkages. In certain embodiments, the modified internucleoside linkages are interspersed throughout the antisense compound. In certain

embodiments, the modified internucleoside linkages are phosphorothioate linkages. In certain embodiments, each internucleoside linkage of an antisense compound is a phosphorothioate internucleoside linkage. In certain embodiments, the antisense compounds targeted to a C90RF72 nucleic acid comprise at least one phosphodiester linkage and at least one phosphorothioate linkage.

In certain embodiments, antisense compounds targeted to a C90RF72 nucleic acid possess internucleoside linkages in any of the following patterns: soooossssssssssooss, sooosssssssssooss, soosssssssssooss, and sosssssssssoooss; wherein,

s = a phosphorothioate linkage, and

o = a phosphodiester linkage.

Modified Sugar Moieties

Antisense compounds can optionally contain one or more nucleosides wherein the sugar group has been modified. Such sugar modified nucleosides may impart enhanced nuclease stability, increased binding affinity, or some other beneficial biological property to the antisense compounds. In certain embodiments, nucleosides comprise chemically modified ribofuranose ring moieties. Examples of chemically modified ribofuranose rings include without limitation, addition of substitutent groups (including 5' and 2' substituent groups, bridging of non-geminal ring atoms to form bicyclic nucleic acids (BNA), replacement of the ribosyl ring oxygen atom with S, N(R), or C(Ri)(R₂) (R, Ri and R₂ are each independently H, C₁-C₁₂ alkyl or a protecting group) and combinations thereof. Examples of chemically modified sugars include 2 -F-5 '-methyl substituted nucleoside (see PCT International Application WO 2008/101157 Published on 8/21/08 for other disclosed 5',2'-bis substituted nucleosides) or replacement of the ribosyl ring oxygen atom with S with further substitution at the 2'-position (see published U.S. Patent Application US2005-0130923, published on June 16, 2005) or alternatively 5 '-substitution of a BNA (see PCT International

Application WO 2007/134181 Published on 11/22/07 wherein LNA is substituted with for example a 5 '-methyl or a 5 '-vinyl group). Examples of nucleosides having modified sugar moieties include without limitation nucleosides comprising 5^*-vinyl, 5^*-methyl (R or S), 4'-S, 2'-F, 2'-OCH₃, 2'-OCH₂CH₃, 2'- OCH₂CH₂F and 2'-0(CH₂)₂OCH₃ substituent groups. The substituent at the 2' position can also be selected from allyl, amino, azido, thio, O-allyl, O-Ci-Cio alkyl, OCF₃, OCH₂F, 0(CH₂)₂SCH₃, 0(CH₂)₂-0-N(R_m)(R_n), 0-CH₂-C(=0)-N(R_m)(R_n), and 0-CH₂-C(=0)-N(Ri)-(CH₂)₂-N(R_m)(R_n), where each Ri, R_m and R_n is, independently, H or substituted or unsubstituted Ci-Cio alkyl.

As used herein, "bicyclic nucleosides" refer to modified nucleosides comprising a bicyclic sugar moiety. Examples of bicyclic nucleosides include without limitation nucleosides comprising a bridge between the 4' and the 2' ribosyl ring atoms. In certain embodiments, antisense compounds provided herein include one or more bicyclic nucleosides comprising a 4' to 2' bridge. Examples of such 4' to 2' bridged bicyclic nucleosides, include but are not limited to one of the formulae: 4'- (CH₂)-0-2' (LNA); 4'-(CH₂)-S-2'; 4'-(CH₂)₂-0-2' (ENA); 4'-CH(CH₃)-0-2' and 4'-CH(CH₂OCH₃)- 0-2' (and analogs thereof see U.S. Patent 7,399,845, issued on July 15, 2008); 4'-C(CH₃)(CH₃)-0-2' (and analogs thereof see published International Application WO/2009/006478, published January 8, 2009); 4'-CH₂-N(OCH₃)-2' (and analogs thereof see published International Application

WO/2008/150729, published December 11, 2008); 4'-CH₂-0-N(CH₃)-2' (see published U.S. Patent Application US2004-0171570, published September 2, 2004 ); 4'-CH₂-N(R)-0-2*, wherein R is H, Ci-Ci₂ alkyl, or a protecting group (see U.S. Patent 7,427,672, issued on September 23, 2008); 4'- CH₂-C(H)(CH₃)-2' (see Chattopadhyaya et al, J. Org. Chem., 2009, 74, 118-134); and 4'-CH₂-C- (=CH₂)-2' (and analogs thereof see published International Application WO 2008/154401, published on December 8, 2008).

Further reports related to bicyclic nucleosides can also be found in published literature (see for example: Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al, Proc. Natl. Acad. Sci. U. S. A., 2000, 97, 5633-5638; Kumar et al, Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al, J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al, J. Am. Chem. Soc, 2007, 129(26) 8362-8379; Elayadi et al, Curr. Opinion Invest. Drugs, 2001, 2, 558-561; Braasch et al, Chem. Biol, 2001, 8, 1-7; and Orum et al, Curr. Opinion Mol. Ther., 2001, 3, 239-243; U.S. Patent Nos. 6,268,490; 6,525,191; 6,670,461; 6,770,748;

6,794,499; 7,034,133; 7,053,207; 7,399,845; 7,547,684; and 7,696,345; U.S. Patent Publication No. US2008-0039618; US2009-0012281; U.S. Patent Serial Nos. 60/989,574; 61/026,995; 61/026,998; 61/056,564; 61/086,231; 61/097,787; and 61/099,844; Published PCT International applications WO 1994/014226; WO 2004/106356; WO 2005/021570; WO 2007/134181; WO 2008/150729; WO 2008/154401; and WO 2009/006478. Each of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example a-L-ribofuranose and β-D-ribofuranose (see PCT international application PCT/DK98/00393, published on March 25, 1999 as WO 99/14226).

In certain embodiments, bicyclic sugar moieties of BNA nucleosides include, but are not limited to, compounds having at least one bridge between the 4' and the 2' position of the pentoiuranosyl sugar moiety wherein such bridges independently comprises 1 or from 2 to 4 linked groups independently selected from -[C(Ra)(Rb)]„-,

-C(=S)-, -0-, -Si(Ra)2-, -S(=0)_x-, and -N(Ra)-;

wherein:

x is 0, 1, or 2;

n is 1, 2, 3, or 4;

each Ra and Rb is, independently, H, a protecting group, hydroxyl, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C2₀ aryl, substituted C5-C2₀ aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJi, NJ1J2, SJi, N₃, COOJi, acyl (C(=0)-H), substituted acyl, CN, sulfonyl

or sulfoxyl

each Ji and h is, independently, H, Ci-C₁₂ alkyl, substituted Ci-C₁₂ alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5- C2₀ aryl, acyl (C(=0)-H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C1-C12 aminoalkyl, substituted C1-C12 aminoalkyl or a protecting group.

In certain embodiments, the bridge of a bicyclic sugar moiety is -[C(Ra)(Rb)]n- , -[C(R_a)(Rb)]_n-0-, -C(RaR_b)-N(R)-0- or -C(RaRb)-0-N(R)-. In certain embodiments, the bridge is 4'-CH₂-2', 4'-(CH₂)2-2', 4'-(CH₂)₃-2', 4'-CH₂-0-2', 4'-(CH₂)2-0-2', 4'-CH₂-0-N(R)-2' and 4'-CH₂- N(R)-0-2'- wherein each R is, independently, H, a protecting group or C₁-C₁₂ alkyl.

In certain embodiments, bicyclic nucleosides are further defined by isomeric configuration. For example, a nucleoside comprising a 4'-2' methylene-oxy bridge, may be in the a-L

configuration or in the β-D configuration. Previously, -L-methyleneoxy (4'-CH₂-0-2') BNA's have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). In certain embodiments, bicyclic nucleosides include, but are not limited to, (A) a-L- methyleneoxy (4'-CH₂-0-2') BNA , (B) β-D-methyleneoxy (4'-CH₂-0-2') BNA , (C) ethyleneoxy (4'-(CH₂)₂-0-2') BNA , (D) aminooxy (4'-CH₂-0-N(R)-2') BNA, (E) oxyamino (4'-CH₂-N(R)-0- 2') BNA, and (F) methyl(methyleneoxy) (4'-CH(CH₃)-0-2') BNA, (G) methylene-thio (4'-CH₂-S- 2') BNA, (H) methylene-amino (4'-CH₂-N(R)-2') BNA, (I) methyl carbocyclic (4'-CH₂-CH(CH₃)- 2') BNA, and (J) propylene carbocyclic (4'-(CH₂)₃-2') BNA as depicted below.

wherein Bx is the base moiety and R is independently H, a protecting group or Ci-Ci₂ alkyl.

In certain embodiments, bicyclic nucleosides are provided having Formula I:

wherein:

Bx is a heterocyclic base moiety;

-Qa-Qb-Q_c- is -CH₂-N(Rc)-CH₂-,

-CH₂-0-N(Rc)-, -CH₂-N(IQ-0- or - N(R_c)-0-CH₂; Rc is C1 -C12 alkyl or an amino protecting group; and

T_a and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium.

In certain embodiments, bicyclic nucleosides are provided having Formula II:

wherein:

Bx is a heterocyclic base moiety;

T_a and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;

Z_a is C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, substituted C1-C6 alkyl, substituted C2-C6 alkenyl, substituted C2-C6 alkynyl, acyl, substituted acyl, substituted amide, thiol or substituted thio.

In one embodiment, each of the substituted groups is, independently, mono or poly substituted with substituent groups independently selected from halogen, oxo, hydroxyl, OJ_c, NJ_cJd, SJc, N3, OC(=X)Jc, and

wherein each J_c, Jd and J_e is, independently, H, C1-C6 alkyl, or substituted C1 -C6 alkyl and X is O or NJ_C.

In certain embodiments, bicyclic nucleosides are provided having Formula III:

wherein:

Bx is a heterocyclic base moiety;

Zb is C1 -C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, substituted C1-C6 alkyl, substituted C2-C6 alkenyl, substituted C2-C6 alkynyl or substituted acyl (C(=0)-). In certain embodiments, bicyclic nucleosides are provided having Formula IV:

wherein:

Bx is a heterocyclic base moiety;

Rd is C1-C6 alkyl, substituted Ci-C₆ alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl;

each q_a, qb, q_c and qa is, independently, H, halogen, Q-C6 alkyl, substituted C1-C6 alkyl, C2- Ce alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl, C1-C6 alkoxyl, substituted C1-C6 alkoxyl, acyl, substituted acyl, C1-C6 aminoalkyl or substituted C1-C6 aminoalkyl;

In certain embodiments, bicyclic nucleosides are provided having Formula V:

wherein:

Bx is a heterocyclic base moiety;

T_a and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium; q_a, qb, q_e and qf are each, independently, hydrogen, halogen, Ci-C₁₂ alkyl, substituted Ci-C₁₂ alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, Ci-C₁₂ alkoxy, substituted Ci-C₁₂ alkoxy, OJ_j, SJ_j, SOJ_j, S0₂J_j, NJ_jJ_k, N₃, CN, C(=0)OJ_j, C(=0)NJ_jJ_k, C(=0)Jj, 0-C(=0)NJjJ_k, N(H)C(=NH)NJjJ_k, N(H)C(=0)NJjJ_k or (H)C(=S)NJjJ_k;

or q_e and qf together are =C(q_g)(qh);

q_g and q_h are each, independently, H, halogen, C₁-C₁₂ alkyl or substituted C₁-C₁₂ alkyl. The synthesis and preparation of the methyleneoxy (4'-CH₂-0-2') BNA monomers adenine, cytosine, guanine, 5-methyl-cytosine, thymine and uracil, along with their oligomerization, and nucleic acid recognition properties have been described (Koshkin et al., Tetrahedron, 1998, 54, 3607-3630). BNAs and preparation thereof are also described in WO 98/39352 and WO 99/14226.

Analogs of methyleneoxy (4'-CH₂-0-2') BNA and 2'-thio-BNAs, have also been prepared

(Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222). Preparation of locked nucleoside analogs comprising oligodeoxyribonucleotide duplexes as substrates for nucleic acid polymerases has also been described (Wengel et al., WO 99/14226 ). Furthermore, synthesis of 2'-amino-BNA, a novel comformationally restricted high-affinity oligonucleotide analog has been described in the art (Singh et al., J. Org. Chem., 1998, 63, 10035-10039). In addition, 2'-amino- and 2'-methylamino- BNA's have been prepared and the thermal stability of their duplexes with complementary RNA and DNA strands has been previously reported.

In certain embodiments, bicyclic nucleosides are provided having Formula VI:

wherein:

Bx is a heterocyclic base moiety;

T_a and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium; each q;, c , q_k and qi is, independently, H, halogen, C1-C12 alkyl, substituted C1-C12 alkyl, C2-

C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C1-C12 alkoxyl, substituted Ci-C₁₂ alkoxyl, OJ_j, SJ_J; SOJ_j, S0₂J_j, NJ_jJ_k, N₃, CN, C(=0)OJ_j, C(=0)NJ_jJ_k, C(=0)Jj, O- C(=0)NJ_jJ_k, N(H)C(=NH)NJ_jJ_k, N(H)C(=0)NJ_jJ_korN(H)C(=S)NJ_jJ_k; and

qi and q, or qi and q_k together are =C(q_g)(q_h), wherein q_g and q¾ are each, independently, H, halogen, C1-C12 alkyl or substituted C1-C12 alkyl.

One carbocyclic bicyclic nucleoside having a 4'-(CH2)3-2' bridge and the alkenyl analog bridge 4'-CH=CH-CH₂-2' have been described (Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443 and Albaek et al, J. Org. Chem., 2006, 71, 7731-7740). The synthesis and preparation of carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described (Srivastava et al., J. Am. Chem. Soc, 2007, 129(26), 8362-8379).

As used herein, "4'-2' bicyclic nucleoside" or "4' to 2' bicyclic nucleoside" refers to a bicyclic nucleoside comprising a furanose ring comprising a bridge connecting two carbon atoms of the furanose ring connects the 2' carbon atom and the 4' carbon atom of the sugar ring.

As used herein, "monocylic nucleosides" refer to nucleosides comprising modified sugar moieties that are not bicyclic sugar moieties. In certain embodiments, the sugar moiety, or sugar moiety analogue, of a nucleoside may be modified or substituted at any position.

As used herein, "2 '-modified sugar" means a furanosyl sugar modified at the 2' position. In certain embodiments, such modifications include substituents selected from: a halide, including, but not limited to substituted and unsubstituted alkoxy, substituted and unsubstituted thioalkyl, substituted and unsubstituted amino alkyl, substituted and unsubstituted alkyl, substituted and unsubstituted allyl, and substituted and unsubstituted alkynyl. In certain embodiments, 2' modifications are selected from substituents including, but not limited to: 0[(CH2)_nO]_mCH3, 0(CH₂)_nNH₂, 0(CH₂)_nCH₃, 0(CH₂)_nF, 0(CH₂)_nONH₂, OCH₂C(=0)N(H)CH₃, and

0(CH₂)_nON[(CH₂)_nCH₃]₂, where n and m are from 1 to about 10. Other 2'- substituent groups can also be selected from: Ci-Ci₂ alkyl, substituted alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH₃, OCN, CI, Br, CN, F, CF₃, OCF₃, SOCH₃, S0₂CH₃, ON0₂, N0₂, N₃, NH₂, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving pharmacokinetic properties, or a group for improving the pharmacodynamic properties of an antisense compound, and other substituents having similar properties. In certain embodiments, modifed nucleosides comprise a 2'- MOE side chain (Baker et al, J. Biol. Chem., 1997, 272, 11944-12000). Such 2^*-MOE substitution have been described as having improved binding affinity compared to unmodified nucleosides and to other modified nucleosides, such as 2'- O-methyl, O-propyl, and O-aminopropyl.

Oligonucleotides having the 2'-MOE substituent also have been shown to be antisense inhibitors of gene expression with promising features for in vivo use (Martin, Helv. Chim. Acta, 1995, 78, 486- 504; Altmann et al., Chimia, 1996, 50, 168-176; Altmann et al., Biochem. Soc. Trans., 1996, 24, 630-637; and Altmann et al., Nucleosides Nucleotides, 1997, 16, 917-926).

As used herein, a "modified tetrahydropyran nucleoside" or "modified THP nucleoside" means a nucleoside having a six-membered tetrahydropyran "sugar" substituted in for the pento furanosyl residue in normal nucleosides (a sugar surrogate). Modified THP nucleosides include, but are not limited to, what is referred to in the art as hexitol nucleic acid (HNA), anitol nucleic acid (ANA), manitol nucleic acid (MNA) (see Leumann, Bioorg. Med. Chem., 2002, 10, 841-854), fluoro HNA F-HNA) or those compounds having Formula VII:

VII wherein independently for each of said at least one tetrahydropyran nucleoside analog of Formula VII:

Bx is a heterocyclic base moiety;

T_a and Tb are each, independently, an internucleoside linking group linking the

tetrahydropyran nucleoside analog to the antisense compound or one of T_a and Tb is an

internucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound and the other of T_a and Tb is H, a hydro xyl protecting group, a linked conjugate group or a 5 ' or 3 '-terminal group;

qi , q₂, q3, q4, qs, q6 and q₇ are each independently, H, Q-C6 alkyl, substituted C1-C6 alkyl,

C₂-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl; and each of Ri and 2 is selected from hydrogen, hydroxyl, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJi, N₃, OC(=X)Ji, OC(=X)NJ]J₂, NJ₃C(=X)NJiJ₂ and CN, wherein X is O, S or NJi and each ] J₂ and J3 is, independently, H or C1-C6 alkyl.

In certain embodiments, the modified THP nucleosides of Formula VII are provided wherein qi, q2, q₃, q₄, qs, qe and q₇ are each H. In certain embodiments, at least one of qi , q2, q₃, q₄, qs, qe and q₇ is other than H. In certain embodiments, at least one of qi , q2, q₃, q₄, qs, q6 and q₇ is methyl. In certain embodiments, THP nucleosides of Formula VII are provided wherein one of i and R2 is fluoro. In certain embodiments, Ri is fluoro and R2 is H; Ri is methoxy and R2 is H, and Ri is H and R2 is methoxyethoxy.

As used herein, "2'-modified" or "2 '-substituted" refers to a nucleoside comprising a sugar comprising a substituent at the 2' position other than H or OH. 2 '-modified nucleosides, include, but are not limited to, bicyclic nucleosides wherein the bridge connecting two carbon atoms of the sugar ring connects the 2' carbon and another carbon of the sugar ring; and nucleosides with non- bridging 2'substituents, such as allyl, amino, azido, thio, O-allyl, O-Ci-Cio alkyl, -OCF₃, 0-(CH₂)₂- O-CH3, 2'-0(CH₂)₂SCH3, 0-(CH₂)₂-0-N(R_m)(Rn), or 0-CH₂-C(=0)-N(R_m)(R„), where each R_m and R_n is, independently, H or substituted or unsubstituted Ci-Cio alkyl. 2'-modifed nucleosides may further comprise other modifications, for example at other positions of the sugar and/or at the nucleobase.

As used herein, "2'-F" refers to a nucleoside comprising a sugar comprising a fluoro group at the 2' position.

As used herein, "2'-OMe" or "2'-OCH₃" or "2'-0-methyl" each refers to a nucleoside comprising a sugar comprising an -OCH₃ group at the 2' position of the sugar ring.

As used herein, "MOE" or "2'-MOE" or "2'-OCH₂CH₂OCH₃" or "2'-0-methoxyethyl" each refers to a nucleoside comprising a sugar comprising a -OCH₂CH₂OCH₃ group at the 2' position of the sugar ring.

As used herein, "oligonucleotide" refers to a compound comprising a plurality of linked nucleosides. In certain embodiments, one or more of the plurality of nucleosides is modified. In certain embodiments, an oligonucleotide comprises one or more ribonucleosides (R A) and/or deoxyribonucleosides (DNA).

Many other bicyclo and tricyclo sugar surrogate ring systems are also known in the art that can be used to modify nucleosides for incorporation into antisense compounds (see for example review article: Leumann, Bioorg. Med. Chem., 2002, 10, 841-854).

Such ring systems can undergo various additional substitutions to enhance activity.

Methods for the preparations of modified sugars are well known to those skilled in the art. In nucleotides having modified sugar moieties, the nucleobase moieties (natural, modified or a combination thereof) are maintained for hybridization with an appropriate nucleic acid target.

In certain embodiments, antisense compounds comprise one or more nucleosides having modified sugar moieties. In certain embodiments, the modified sugar moiety is 2'-MOE. In certain embodiments, the 2'-MOE modified nucleosides are arranged in a gapmer motif. In certain embodiments, the modified sugar moiety is a bicyclic nucleoside having a (4'-CH(CH₃)-0-2') bridging group. In certain embodiments, the (4'-CH(CH₃)-0-2') modified nucleosides are arranged throughout the wings of a gapmer motif. Compositions and Methods for Formulating Pharmaceutical Compositions

Antisense oligonucleotides may be admixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

An antisense compound targeted to a C90RF72 nucleic acid can be utilized in

pharmaceutical compositions by combining the antisense compound with a suitable

pharmaceutically acceptable diluent or carrier. A pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS). PBS is a diluent suitable for use in compositions to be delivered parenterally. Accordingly, in one embodiment, employed in the methods described herein is a pharmaceutical composition comprising an antisense compound targeted to a C90RF72 nucleic acid and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is PBS. In certain embodiments, the antisense compound is an antisense oligonucleotide.

Pharmaceutical compositions comprising antisense compounds encompass any

pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

A prodrug can include the incorporation of additional nucleosides at one or both ends of an antisense compound which are cleaved by endogenous nucleases within the body, to form the active antisense compound.

Conjugated Antisense Compounds

Antisense compounds may be covalently linked to one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the resulting antisense oligonucleotides. Typical conjugate groups include cholesterol moieties and lipid moieties.

Additional conjugate groups include carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. Antisense compounds can also be modified to have one or more stabilizing groups that are generally attached to one or both termini of antisense compounds to enhance properties such as, for example, nuclease stability. Included in stabilizing groups are cap structures. These terminal modifications protect the antisense compound having terminal nucleic acid from exonuclease degradation, and can help in delivery and/or localization within a cell. The cap can be present at the 5'-terminus (5'-cap), or at the 3'-terminus (3'-cap), or can be present on both termini. Cap structures are well known in the art and include, for example, inverted deoxy abasic caps. Further 3' and 5'- stabilizing groups that can be used to cap one or both ends of an antisense compound to impart nuclease stability include those disclosed in WO 03/004602 published on January 16, 2003.

Cell culture and antisense compounds treatment

The effects of antisense compounds on the level, activity or expression of C90RF72 nucleic acids can be tested in vitro in a variety of cell types. Cell types used for such analyses are available from commerical vendors {e.g. American Type Culture Collection, Manassus, VA; Zen- Bio, Inc., Research Triangle Park, NC; Clonetics Corporation, Walkersville, MD) and are cultured according to the vendor's instructions using commercially available reagents (e.g. Invitrogen Life Technologies, Carlsbad, CA). Illustrative cell types include, but are not limited to, HepG2 cells, Hep3B cells, and primary hepatocytes. In vitro testing of antisense oligonucleotides

Described herein are methods for treatment of cells with antisense oligonucleotides, which can be modified appropriately for treatment with other antisense compounds.

In general, cells are treated with antisense oligonucleotides when the cells reach approximately 60-80% confluency in culture.

One reagent commonly used to introduce antisense oligonucleotides into cultured cells includes the cationic lipid transfection reagent LIPOFECTIN (Invitrogen, Carlsbad, CA). Antisense oligonucleotides are mixed with LIPOFECTIN in OPTI-MEM 1 (Invitrogen, Carlsbad, CA) to achieve the desired final concentration of antisense oligonucleotide and a LIPOFECTIN

concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.

Another reagent used to introduce antisense oligonucleotides into cultured cells includes

LIPOFECTAMINE (Invitrogen, Carlsbad, CA). Antisense oligonucleotide is mixed with

LIPOFECT AMINE in OPTI-MEM 1 reduced serum medium (Invitrogen, Carlsbad, CA) to achieve the desired concentration of antisense oligonucleotide and a LIPOFECTAMINE concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.

Another technique used to introduce antisense oligonucleotides into cultured cells includes electroporation.

Cells are treated with antisense oligonucleotides by routine methods. Cells are typically harvested 16-24 hours after antisense oligonucleotide treatment, at which time RNA or protein levels of target nucleic acids are measured by methods known in the art and described herein. In general, when treatments are performed in multiple replicates, the data are presented as the average of the replicate treatments.

The concentration of antisense oligonucleotide used varies from cell line to cell line.

Methods to determine the optimal antisense oligonucleotide concentration for a particular cell line are well known in the art. Antisense oligonucleotides are typically used at concentrations ranging from 1 nM to 300 nM when transfected with LIPOFECTAMINE. Antisense oligonucleotides are used at higher concentrations ranging from 625 to 20,000 nM when transfected using

electroporation.

RNA Isolation

RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. RNA is prepared using methods well known in the art, for example, using the TRIZOL Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's recommended protocols.

Analysis of inhibition of target levels or expression

Inhibition of levels or expression of a C90RF72 nucleic acid can be assayed in a variety of ways known in the art. For example, target nucleic acid levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or quantitaive real-time PCR. RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. Northern blot analysis is also routine in the art. Quantitative real-time PCR can be conveniently accomplished using the commercially available ABI PRISM 7600, 7700, or 7900 Sequence Detection System, available from PE-Applied Biosystems, Foster City, CA and used according to manufacturer's instructions. Quantitative Real-Time PCR Analysis of Target RNA Levels

Quantitation of target RNA levels may be accomplished by quantitative real-time PCR using the ABI PRISM 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, CA) according to manufacturer's instructions. Methods of quantitative real-time PCR are well known in the art.

Prior to real-time PCR, the isolated RNA is subjected to a reverse transcriptase (RT) reaction, which produces complementary DNA (cD A) that is then used as the substrate for the real-time PCR amplification. The RT and real-time PCR reactions are performed sequentially in the same sample well. RT and real-time PCR reagents are obtained from Invitrogen (Carlsbad, CA). RT real-time-PCR reactions are carried out by methods well known to those skilled in the art.

Gene (or RNA) target quantities obtained by real time PCR are normalized using either the expression level of a gene whose expression is constant, such as cyclophilin A, or by quantifying total RNA using RIBOGREEN (Invitrogen, Inc. Carlsbad, CA). Cyclophilin A expression is quantified by real time PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA is quantified using RIBOGREEN RNA quantification reagent (Invetrogen, Inc. Eugene, OR). Methods of RNA quantification by RIBOGREEN are taught in Jones, L.J., et al, (Analytical Biochemistry, 1998, 265, 368-374). A CYTOFLUOR 4000 instrument (PE Applied Biosystems) is used to measure RIBOGREEN fluorescence.

Probes and primers are designed to hybridize to a C90RF72 nucleic acid. Methods for designing real-time PCR probes and primers are well known in the art, and may include the use of software such as PRIMER EXPRESS Software (Applied Biosystems, Foster City, CA).

Analysis of Protein Levels

Antisense inhibition of C90RF72 nucleic acids can be assessed by measuring C90RF72 protein levels. Protein levels of C90RF72 can be evaluated or quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme- linked immunosorbent assay (ELISA), quantitative protein assays, protein activity assays (for example, caspase activity assays), immunohistochemistry, immuno cytochemistry or fluorescence- activated cell sorting (FACS). Antibodies directed to a target can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, MI), or can be prepared via conventional monoclonal or polyclonal antibody generation methods well known in the art. Antibodies useful for the detection of mouse, rat, monkey, and human C90RF72 are commercially available.

In vivo testing of antisense compounds

Antisense compounds, for example, antisense oligonucleotides, are tested in animals to assess their ability to inhibit expression of C90RF72 and produce phenotypic changes, such as, improved motor function and respiration. In certain embodiments, motor function is measured by rotarod, grip strength, pole climb, open field performance, balance beam, hindpaw footprint testing in the animal. In certain embodiments, respiration is measured by whole body plethysmo graph, invasive resistance, and compliance measurements in the animal. Testing may be performed in normal animals, or in experimental disease models. For administration to animals, antisense oligonucleotides are formulated in a pharmaceutically acceptable diluent, such as phosphate- buffered saline (PBS) or artificial cerebrospinal fluid (aCSF). Administration includes parenteral routes of administration, such as intraperitoneal, intravenous, and subcutaneous, as well as central routes of administration such as intracerebro ventricular or intrathecal. Calculation of antisense oligonucleotide dosage and dosing frequency is within the abilities of those skilled in the art, and depends upon factors such as route of administration and animal body weight. Following a period of treatment with antisense oligonucleotides, RNA is isolated from CNS tissue or CSF and changes in C90RF72 nucleic acid expression are measured.

Targeting C90RF72

Antisense oligonucleotides described herein may hybridize to a C90RF72 nucleic acid in any stage of RNA processing. For example, described herein are antisense oligonucleotides that are complementary to a pre-mRNA or a mature mRNA. Additionally, antisense oligonucleotides described herein may hybridize to any element of a C90RF72 nucleic acid. For example, described herein are antisense oligonucleotides that are complementary to an exon, an intron, the 5' UTR, the 3' UTR, a repeat region, a hexanucleotide repeat expansion, a splice junction, an exon:exon splice junction, an exonic splicing silencer (ESS), an exonic splicing enhancer (ESE), exon la, exon lb, exon lc, exon Id, exon le, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exonl 1, intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, or intron 10 of a C90RF72 nucleic acid. In certain embodiments, antisense oligonucleotides described herein hybridize to all variants of C90RF72. In certain embodiments, the antisense oligonucleotides described herein selectively hybridize to certain variants of C90RF72. In certain embodiments, the antisense oligonucleotides described herein selectively hybridize to variants of C90RF72 containing a hexanucleotide repeat expansion. In certain embodiments, the antisense oliognucleotides described herein selectively hybridize to pre-mRNA variants containing the hexanucleotide repeat. In certain embodiments, pre-mRNA variants of C90RF72 containing a hexanucleotide repeat expansion include SEQ ID NO: 1-3 and 6-10. In certain embodiments, such hexanucleotide repeat expansion comprises at least 24 repeats of any of GGGGCC, GGGGGG, GGGGGC, or GGGGCG.

In certain embodiments, the antisense oligonucleotides described herein inhibit expression of all variants of C90RF72. In certain embodiments, the antisense oligonucleotides described herein inhibit expression of all variants of C90RF72 equally. In certain embodiments, the antisense oligonucleotides described herein preferentially inhibit expression of one or more variants of C90RF72. In certain embodiments, the antisense oligonucleotides described herein preferentially inhibit expression of variants of C90RF72 containing a hexanucleotide repeat expansion. In certain embodiments, the antisense oliognucleotides described herein selectively inhibit expression of pre- mRNA variants containing the hexanucleotide repeat. In certain embodiments, the antisense oliognucleotides described herein selectively inhibit expression of C90RF72 pathogenic associated mRNA variants. In certain embodiments, pre-mRNA variants of C90RF72 containing a hexanucleotide repeat expansion include SEQ ID NO: 1-3 and 6-10. In certain embodiments, such hexanucleotide repeat expansion comprises at least 24 repeats of any of GGGGCC, GGGGGG, GGGGGC, or GGGGCG. In certain embodiments, the hexanucleotide repeat expansion forms nuclear foci. In certain embodiments, antisense oligonucleotides described herein are useful for reducing nuclear foci. Nuclear foci may be reduced in terms of percent of cells with foci as well as number of foci per cell.

Selective Inhibition of Certain Pathogenic Associated Variants

In certain examples herein, primer probe set RTS3905 detects an mRNA variant (e.g. NM_001256054.1) processed from a pre-mRNA variant containing the hexanucleotide repeat. The mRNA variant processed from a pre-mRNA variant containing the hexanucleotide repeat (i.e., the "C90RF72 pathogenic associated mRNA variant"). A pre-mRNA contains the hexanucleotide repeat when transcription of the pre-mRNA begins in the region from the start site of exon 1A to the start site of exon IB, e.g., nucleotides 1107 to 1520 of the genomic sequence (SEQ ID NO: 2, the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000). Oligonucleotides were designed in this region to selectively target the pre-mRNA variant containing the hexanucleotide repeat. RTS3905 measures an mRNA product (i.e. the C90RF72 pathogenic associated mRNA variant) of the pre-mRNA variant containing the hexanucleotide repeat and, therefore, measures the reduction of the pre-mRNA variant containing the hexanucleotide repeat.

C90RF72 Features

Antisense oligonucleotides described herein may hybridize to any C90RF72 variant at any state of processing within any element of the C90RF72 gene. For example, antisense

oligonucleotides described herein may hybridize to an exon, an intron, the 5' UTR, the 3' UTR, a repeat region, a hexanucleotide repeat expansion, a splice junction, an exon:exon splice junction, an exonic splicing silencer (ESS), an exonic splicing enhancer (ESE), exon la, exon lb, exon lc, exon Id, exon le, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, or intron 10. For example, antisense oligonucleotides may target any of the exons characterized below in Tables 1-5 for the various C90RF72 variants described below. Antisense oligonucleotides described herein may also target variants not characterized below and such variants are characterized in GENBANK. Moreover, antisense oligonucleotides described herein may also target elements other than exons and such elements are characterized in GENBANK.

Table 1

Functional Segments for NM_001256054.1 (SEQ ID NO: 1)

exon 8 1058 1293 18207 18442 exon 9 1294 1351 24296 24353 exon 10 1352 1461 26337 26446 exon 11 1462 3339 26581 28458

Table 2

Functional Segments for NM_018325.3 (SEQ ID NO: 4)

Table 3

Functional Segments for NM_ 145005.5 (SEQ ID NO: 6)

Table 4

Functional Segments for DB079375.1 (SEQ ID NO: 7)

Table 5

Functional Segments for BU194591.1 (SEQ ID NO: 8)

Certain Indications

In certain embodiments, provided herein are methods of treating an individual comprising administering one or more pharmaceutical compositions described herein. In certain embodiments, the individual has a neurodegenerative disease. In certain embodiments, the individual is at risk for developing a neurodegenerative disease, including, but not limited to, ALS or FTD. In certain embodiments, the individual has been identified as having a C90RF72 associated disease. In certain embodiments, the individual has been identified as having a C90RF72 hexanucleotide repeat expansion associated disease. In certain embodiments, provided herein are methods for

prophylactically reducing C90RF72 expression in an individual. Certain embodiments include treating an individual in need thereof by administering to an individual a therapeutically effective amount of an antisense compound targeted to a C90RF72 nucleic acid.

In one embodiment, administration of a therapeutically effective amount of an antisense compound targeted to a C90RF72 nucleic acid is accompanied by monitoring of C90RF72 levels in an individual, to determine an individual's response to administration of the antisense compound. An individual's response to administration of the antisense compound may be used by a physician to determine the amount and duration of therapeutic intervention. In certain embodiments, administration of an antisense compound targeted to a C90RF72 nucleic acid results in reduction of C90RF72 expression by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by any two of these values. In certain embodiments, administration of an antisense compound targeted to a C90RF72 nucleic acid results in improved motor function and respiration in an animal. In certain embodiments, administration of a C90RF72 antisense compound improves motor function and respiration by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by any two of these values.

In certain embodiments, pharmaceutical compositions comprising an antisense compound targeted to C90RF72 are used for the preparation of a medicament for treating a patient suffering or susceptible to a neurodegenerative disease including ALS and FTD.

Certain Combination Therapies

In certain embodiments, one or more pharmaceutical compositions described herein are co- administered with one or more other pharmaceutical agents. In certain embodiments, such one or more other pharmaceutical agents are designed to treat the same disease, disorder, or condition as the one or more pharmaceutical compositions described herein. In certain embodiments, such one or more other pharmaceutical agents are designed to treat a different disease, disorder, or condition as the one or more pharmaceutical compositions described herein. In certain embodiments, such one or more other pharmaceutical agents are designed to treat an undesired side effect of one or more pharmaceutical compositions described herein. In certain embodiments, one or more pharmaceutical compositions described herein are co-administered with another pharmaceutical agent to treat an undesired effect of that other pharmaceutical agent. In certain embodiments, one or more pharmaceutical compositions described herein are co-administered with another

pharmaceutical agent to produce a combinational effect. In certain embodiments, one or more pharmaceutical compositions described herein are co-administered with another pharmaceutical agent to produce a synergistic effect.

In certain embodiments, one or more pharmaceutical compositions described herein and one or more other pharmaceutical agents are administered at the same time. In certain embodiments, one or more pharmaceutical compositions described herein and one or more other pharmaceutical agents are administered at different times. In certain embodiments, one or more pharmaceutical compositions described herein and one or more other pharmaceutical agents are prepared together in a single formulation. In certain embodiments, one or more pharmaceutical compositions described herein and one or more other pharmaceutical agents are prepared separately.

In certain embodiments, pharmaceutical agents that may be co-administered with a pharmaceutical composition described herein include Riluzole (Rilutek), Lioresal (Lioresal), and Dexpramipexole.

In certain embodiments, pharmaceutical agents that may be co-administered with a C90RF72 specific inhibitor described herein include, but are not limited to, an additional C90RF72 inhibitor. In certain embodiments, the co-adminstered pharmaceutical agent is administered prior to administration of a pharmaceutical composition described herein. In certain embodiments, the co- administered pharmaceutical agent is administered following administration of a pharmaceutical composition described herein. In certain embodiments the co-administered pharmaceutical agent is administered at the same time as a pharmaceutical composition described herein. In certain embodiments the dose of a co-administered pharmaceutical agent is the same as the dose that would be administered if the co-administered pharmaceutical agent was administered alone. In certain embodiments the dose of a co-administered pharmaceutical agent is lower than the dose that would be administered if the co-administered pharmaceutical agent was administered alone. In certain embodiments the dose of a co-administered pharmaceutical agent is greater than the dose that would be administered if the co-administered pharmaceutical agent was administered alone.

In certain embodiments, the co-administration of a second compound enhances the effect of a first compound, such that co-administration of the compounds results in an effect that is greater than the effect of administering the first compound alone. In other embodiments, the coadministration results in effects that are additive of the effects of the compounds when administered alone. In certain embodiments, the co-administration results in effects that are supra-additive of the effects of the compounds when administered alone. In certain embodiments, the first compound is an antisense compound. In certain embodiments, the second compound is an antisense compound.

Certain Amplicon Regions

Certain antisense oligonucleotides described herein may target the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of these compounds.

Certain Human Therapeutics The human C90RF72 antisense oligonucleotides described herein are being evaluated as possible human therapeutics. Various parameters of potency, efficacy, and/or tolerability are being examined. Such parameters include in vitro inhibition of total C90RF72 R A expression, in vitro inhibition of C90RF72 pathogenic associated RNA variant expression, in vitro dose response (IC50), in vivo inhibition of total or pathogenic RNA and/or protein in a transgenic animal containing a human C90RF72 transgene in relevant tissues (e.g., brain and/or spinal cord), tolerability in mouse, tolerability in rat, and/or tolerability in a primate. Tolerability markers that may be measured in elude blood and serum chemistry parameters, CSF chemistry parameters, body and organ weights, general observations and/or behavioral tests, and/or biochemical markers such as GFAP and/or AIF1. Acute or long term tolerability may be measured.

Certain Hotspot Regions

1. Nucleobases 1107-1520 of SEP ID NO; 2

In certain embodiments, antisense oligonucletoides are designed to target nucleobases 1107-1520 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000). In certain embodiments, nucleobases 1107- 1 20 are a hotspot region. In certain embodiments, nucleobases 1107-1520 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotides are 17, 18, or 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers or 5-8-5 MOE gapmers. In certain embodiments, the antisense oligonucleotides are 17-mer Deoxy, MOE and cEt oligonucleotides. In certain embodiments, the nucleosides of the antisense olignonucleotides are linked by

phosphorothioate intemucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester intemucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleotide linkages (e.g., the antisense oligonucleotides have "mixed backbones").

In certain embodiments, nucleobases 1107-1520 are targeted by the following ISIS numbers: 619042-619333, 672581-672714, 672735-672865, 672885-673015, 673035-673165, 673185-673315, and 673335-673465.

In certain embodiments, nucleobases 1107-1520 are targeted by the following SEQ ID

NOs: 21-31, 33-50, 52, 54-134, 138-248, 251-319, 325, 744-877, and 898-1028. In certain embodiments, nucleobases 1 107-1520 are targeted by the following ISIS numbers: 619042-619333.

In certain embodiments, nucleobases 1 107-1520 are targeted by the following SEQ ID NOs: 21-31 , 33-50, 52, 54-134, 138-248, 251-319, and 325.

In certain embodiments, antisense oligonucleotides targeting nucleobases 1107-1520 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%), at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% reduction of total C90RF72 mRNA and/or protein levels in vitro and/or in vivo.

In certain embodiments, antisense oligonucleotides targeting nucleobases 1107-1520 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% reduction of C90RF72 pathogenic associated mR A variant levels in vitro and/or in vivo.

2. Nucleobases 1111-1200 of SEP ID NO: 2

In certain embodiments, antisense oligonucletoides are designed to target nucleobases 1111-1200 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000). In certain embodiments, nucleobases 1111- 1200 are a hotspot region. In certain embodiments, nucleobases 1111-1200 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the nucleosides of the antisense olignonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleotide linkages (e.g., the antisense oligonucleotides have "mixed backbones").

In certain embodiments, nucleobases 1111-1200 are targeted by the following ISIS numbers: 619042-619095.

In certain embodiments, nucleobases 1111-1200 are targeted by the following SEQ ID NOs: 21, 26-31, 33-50, 52, 54-60, 75, 81, and 87-96.

In certain embodiments, antisense oligonucleotides targeting nucleobases 1111-1200 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% reduction of total C90RF72 mRNA and/or protein levels in vitro and/or in vivo.

In certain embodiments, antisense oligonucleotides targeting nucleobases 1111-1200 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%), at least 98%, at least 99%, or at least 100% reduction of C90RF72 pathogenic associated mRNA variant levels in vitro and/or in vivo.

3. Nucleobases 1211-1318 of SEP ID NO: 2

In certain embodiments, antisense oligonucletoides are designed to target nucleobases

1211-1318 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000). In certain embodiments, nucleobases 1211- 1318 are a hotspot region. In certain embodiments, nucleobases 1211-1318 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the nucleosides of the antisense olignonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleotide linkages (e.g., the antisense oligonucleotides have "mixed backbones").

In certain embodiments, nucleobases 1211-1318 are targeted by the following ISIS numbers: 619096-619172.

In certain embodiments, nucleobases 1211-1318 are targeted by the following SEQ ID NOs: 22-25, 70-74, 76-80, 82-86, 99-134, and 138-159.

In certain embodiments, antisense oligonucleotides targeting nucleobases 1211-1318 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% reduction of total C90RF72 mRNA and/or protein levels in vitro and/or in vivo.

In certain embodiments, antisense oligonucleotides targeting nucleobases 1211-1318 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% reduction of C90RF72 pathogenic associated mRNA variant levels in vitro and/or in vivo. 4. Nucleobases 1326-1540 of SEP ID NO; 2

In certain embodiments, antisense oligonucletoides are designed to target nucleobases 1326-1540 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000). In certain embodiments, nucleobases 1326- 1540 are a hotspot region. In certain embodiments, nucleobases 1326-1540 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotides are 17, 18, or 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers or 5-8-5 MOE gapmers. In certain embodiments, the antisense oligonucleotides are 17-mer Deoxy, MOE and cEt oligonucleotides. In certain embodiments, the nucleosides of the antisense olignonucleotides are linked by

In certain embodiments, nucleobases 1326-1540 are targeted by the following ISIS numbers: 619173-619354, and 672581-673484.

In certain embodiments, nucleobases 1326-1540 are targeted by the following SEQ ID NOs: 97, 98, 160-248, 2 1-322, 325-343, and 744-1047.

In certain embodiments, nucleobases 1326-1540 are targeted by the following ISIS numbers: 619173-619354.

In certain embodiments, nucleobases 1326-1540 are targeted by the following SEQ ID

NOs: 97, 98, 160-248, 251-322, and 325-343. In certain embodiments, antisense oligonucleotides targeting nucleobases 1326-1540 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%>, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% reduction of total C90RF72 mR A and/or protein levels in vitro and/or in vivo.

In certain embodiments, antisense oligonucleotides targeting nucleobases 1326-1540 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%), at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% reduction of C90RF72 pathogenic associated mRNA variant levels in vitro and/or in vivo. 5. Nucleobases 1331-1375 of SEP ID NO: 2

In certain embodiments, antisense oligonucletoides are designed to target nucleobases 1331-1375 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000). In certain embodiments, nucleobases 1331- 1375 are a hotspot region. In certain embodiments, nucleobases 1331-1375 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the nucleosides of the antisense olignonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleotide linkages (e.g., the antisense oligonucleotides have "mixed backbones"). In certain embodiments, the antisense oligonucleotides comprise the following sugar modification pattern: soooossssssssssooss.

In certain embodiments, nucleobases 1331-1375 are targeted by the following ISIS numbers: 619178-619203.

In certain embodiments, nucleobases 1331-1375 are targeted by the following SEQ ID NOs: 165-190.

In certain embodiments, antisense oligonucleotides targeting nucleobases 1331-1375 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%), at least 98%, at least 99%, or at least 100% reduction of C90RF72 pathogenic associated mR A variant levels in vitro and/or in vivo. 6. Nucleobases 1368-1391 of SEP ID NO: 2

In certain embodiments, antisense oligonucletoides are designed to target nucleobases 1368-1391 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT 008413.18 truncated from nucleosides 27535000 to 27565000). In certain embodiments, nucleobases 1368- 1391 are a hotspot region. In certain embodiments, nucleobases 1368-1391 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the nucleosides of the antisense olignonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleotide linkages (e.g., the antisense oligonucleotides have "mixed backbones"). In certain embodiments, the antisense oligonucleotides comprise the following sugar modification pattern: soooossssssssssooss.

In certain embodiments, nucleobases 1368-1391 are targeted by the following ISIS numbers: 619215-619219.

In certain embodiments, nucleobases 1368-1391 are targeted by the following SEQ ID NOs: 202-206.

In certain embodiments, antisense oligonucleotides targeting nucleobases 1368-1391 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%), at least 98%, at least 99%, or at least 100% reduction of C90RF72 pathogenic associated mR A variant levels in vitro and/or in vivo.

7. Nucleobases 1398-1424 of SEP ID NO: 2

In certain embodiments, antisense oligonucletoides are designed to target nucleobases 1398-1424 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT 008413.18 truncated from nucleosides 27535000 to 27565000). In certain embodiments, nucleobases 1398- 1424 are a hotspot region. In certain embodiments, nucleobases 1398-1424 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the nucleosides of the antisense olignonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleotide linkages (e.g., the antisense oligonucleotides have "mixed backbones"). In certain embodiments, the antisense oligonucleotides comprise the following sugar modification pattern: soooossssssssssooss.

In certain embodiments, nucleobases 1398-1424 are targeted by the following ISIS numbers: 619245-619252.

In certain embodiments, nucleobases 1398-1424 are targeted by the following SEQ ID NOs: 232-239.

In certain embodiments, antisense oligonucleotides targeting nucleobases 1398-1424 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%), at least 98%, at least 99%, or at least 100% reduction of C90RF72 pathogenic associated mR A variant levels in vitro and/or in vivo.

8. Nucleobases 1411-1440 of SEP ID NO: 2

In certain embodiments, antisense oligonucletoides are designed to target nucleobases 1411-1440 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT 008413.18 truncated from nucleosides 27535000 to 27565000). In certain embodiments, nucleobasesl411- 1440 are a hotspot region. In certain embodiments, nucleobases 1411-1440 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the nucleosides of the antisense olignonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleotide linkages (e.g., the antisense oligonucleotides have "mixed backbones"). In certain embodiments, the antisense oligonucleotides comprise the following sugar modification pattern: soooossssssssssooss.

In certain embodiments, nucleobases 1411-1440 are targeted by the following ISIS numbers: 619258-619268.

In certain embodiments, nucleobases 1411-1440 are targeted by the following SEQ ID NOs: 244-248, 251-255, and 325.

In certain embodiments, antisense oligonucleotides targeting nucleobases 1411-1440 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%), at least 98%, at least 99%, or at least 100% reduction of C90RF72 pathogenic associated mR A variant levels in vitro and/or in vivo.

9. Nucleobases 1429-1481 of SEP ID NO: 2

1429-1481 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000). In certain embodiments, nucleobases 1429- 1481 are a hotspot region. In certain embodiments, nucleobases 1429-1481 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the nucleosides of the antisense olignonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleotide linkages (e.g., the antisense oligonucleotides have "mixed backbones"). In certain embodiments, the antisense oligonucleotides comprise the following sugar modification pattern: soooossssssssssooss.

In certain embodiments, nucleobases 1429-1481 are targeted by the following ISIS numbers: 619276-619303.

In certain embodiments, nucleobases 1429-1481 are targeted by the following SEQ ID

NOs: 98 and 263-289. In certain embodiments, antisense oligonucleotides targeting nucleobases 1429-1481 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%>, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%), at least 98%, at least 99%, or at least 100% reduction of C90RF72 pathogenic associated rnRNA variant levels in vitro and/or in vivo.

10. Nucleobases 1502-1539 of SEP ID NO: 2

In certain embodiments, antisense oligonucletoides are designed to target nucleobases 1502-1539 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000). In certain embodiments, nucleobases 1502- 1539 are a hotspot region. In certain embodiments, nucleobases 1502-1539 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the nucleosides of the antisense olignonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleotide linkages (e.g., the antisense oligonucleotides have "mixed backbones"). In certain embodiments, the antisense oligonucleotides comprise the following sugar modification pattern: soooossssssssssooss. In certain embodiments, nucleobases 1502-1539 are targeted by the following ISIS numbers: 619335-619353.

In certain embodiments, nucleobases 1502-1539 are targeted by the following SEQ ID NOs: 321, 322, and 326-342.

In certain embodiments, antisense oligonucleotides targeting nucleobases 1502-1539 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%o, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%), at least 98%, at least 99%, or at least 100% reduction of C90RF72 pathogenic associated mRNA variant levels in vitro and/or in vivo.

11. Nucleobases 1508-1539 of SEP ID NO: 2

In certain embodiments, antisense oligonucletoides are designed to target nucleobases 1508-1539 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000). In certain embodiments, nucleobases 1508- 1539 are a hotspot region. In certain embodiments, nucleobases 1508-1539 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the nucleosides of the antisense olignonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleotide linkages (e.g., the antisense oligonucleotides have "mixed backbones"). In certain embodiments, the antisense oligonucleotides comprise the following sugar modification pattern: soooossssssssssooss.

In certain embodiments, nucleobases 1508-1539 are targeted by the following ISIS numbers: 619341-619353.

In certain embodiments, nucleobases 1508-1539 are targeted by the following SEQ ID NOs: 330-342.

In certain embodiments, antisense oligonucleotides targeting nucleobases 1508-1539 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% reduction of C90RF72 pathogenic associated mRNA variant levels in vitro and/or in vivo 12. Nucleobases 7860-7906 of SEP ID NO: 2

In certain embodiments, antisense oligonucleotides are designed to target nucleobases 7860-7906 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000). In certain embodiments, nucleobases 7860- 7906 are a hotspot region. In certain embodiments, nucleobases 7860-7906 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleoside linkages (e.g., the antisense oligonucleotides have "mixed backbones").

In certain embodiments, nucleobases 7860-7906 are targeted by the following ISIS numbers: 655135-655144.

In certain embodiments, nucleobases 7860-7906 are targeted by the following SEQ ID NOs: 445-454.

In certain embodiments, antisense oligonucleotides targeting nucleobases 7860-7906 achieve at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%o, at least 67%, at least 68%>, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%), or at least 89% reduction of total C90RF72 mR A and/or protein levels in vitro and/or in vivo.

13. Nucleobases 7907-7944 of SEP ID NO: 2

In certain embodiments, antisense oligonucleotides are designed to target nucleobases 7907-7944 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000). In certain embodiments, nucleobases 7907- 7944 are a hotspot region. In certain embodiments, nucleobases 7907-7944 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleoside linkages (e.g., the antisense oligonucleotides have "mixed backbones").

In certain embodiments, nucleobases 7907-7944 are targeted by the following ISIS numbers: 655150-655156. In certain embodiments, nucleobases 7907-7944 are targeted by the following SEQ ID NOs: 460-467.

In certain embodiments, antisense oligonucleotides targeting nucleobases 7907-7944 achieve at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, or at least 91% reduction of total C90RF72 mRNA and/or protein levels in vitro and/or in vivo.

14. Nucleobases 7989-8038 of SEP ID NO: 2

In certain embodiments, antisense oligonucleotides are designed to target nucleobases 7989-8038 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000). In certain embodiments, nucleobases 7989- 8038 are a hotspot region. In certain embodiments, nucleobases 7989-8038 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester Internucleoside linkages (e.g., the antisense oligonucleotides have "mixed backbones").

In certain embodiments, nucleobases 7989-8038 are targeted by the following ISIS numbers: 619411, 619412, 619420, 625183, 627833, and 655173-655180.

In certain embodiments, nucleobases 7989-8038 are targeted by the following SEQ ID NOs: 20, 51, 53, and 484-493.

In certain embodiments, antisense oligonucleotides targeting nucleobases 7989-8038 achieve at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, or at least 76% reduction of total C90RF72 mRNA and/or protein levels in vitro and/or in vivo.

In certain embodiments, antisense oligonucleotides targeting nucleobases 7989-8038 achieve at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% reduction of C90RF72 pathogenic associated mRNA variant levels in vitro and/or in vivo.

15. Nucleobases 8020-8135 of SEP ID NO: 2

In certain embodiments, antisense oligonucleotides are designed to target nucleobases 8020-8135 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000). In certain embodiments, nucleobases 8020- 8135 are a hotspot region. In certain embodiments, nucleobases 8020-8135 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleoside linkages (e.g., the antisense oligonucleotides have "mixed backbones").

In certain embodiments, nucleobases 8020-8135 are targeted by the following ISIS numbers: 619413, 619414, 625255, 627834, 655181-655208.

In certain embodiments, nucleobases 8020-8135 are targeted by the following SEQ ID NOs: 135, 136, 494-511, and 517-528.

In certain embodiments, antisense oligonucleotides targeting nucleobases 8020-8135 achieve at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, at least 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, or at least 54% reduction of total C90RF72 mRNA and/or protein levels in vitro and/or in vivo.

In certain embodiments, antisense oligonucleotides targeting nucleobases 8020-8135 achieve at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% reduction of C90RF72 pathogenic associated mRNA variant levels in vitro and/or in vivo. 16. Nucleobases 8136-8161 of SEP ID NO: 2

In certain embodiments, antisense oligonucleotides are designed to target nucleobases 8136-8161 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000). In certain embodiments, nucleobases 8136- 8161 are a hotspot region. In certain embodiments, nucleobases 8136-8161 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleoside linkages (e.g., the antisense oligonucleotides have "mixed backbones").

In certain embodiments, nucleobases 8136-8161 are targeted by the following ISIS numbers: 655215-655217.

In certain embodiments, nucleobases 8136-8161 are targeted by the following SEQ ID

NOs: 535-537. In certain embodiments, antisense oligonucleotides targeting nucleobases 8136-8161 achieve at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, or at least 41% reduction of total C90RF72 mRNA and/or protein levels in vitro and/or in vivo.

In certain embodiments, antisense oligonucleotides targeting nucleobases 8136-8161 achieve at least 91%, at least 92%, at least 93%, at least 94%, or at least 95% reduction of C90RF72 pathogenic associated mRNA variant levels in vitro and/or in vivo.

17. Nucleobases 8174-8211 of SEP ID NO: 2

In certain embodiments, antisense oligonucleotides are designed to target nucleobases

8174-8211 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000). In certain embodiments, nucleobases 8174- 8211 are a hotspot region. In certain embodiments, nucleobases 8174-8211 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleoside linkages (e.g., the antisense oligonucleotides have "mixed backbones").

In certain embodiments, nucleobases 8174-8211 are targeted by the following ISIS numbers: 655228-655234.

In certain embodiments, nucleobases 8174-8211 are targeted by the following SEQ ID NOs: 548-554.

In certain embodiments, antisense oligonucleotides targeting nucleobases 8174-8211 achieve at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, or at least 63% reduction of total C90RF72 mRNA and/or protein levels in vitro and/or in vivo.

In certain embodiments, antisense oligonucleotides targeting nucleobases 8174-8211 achieve at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% reduction of C90RF72 pathogenic associated mRNA variant levels in vitro and/or in vivo.

18. Nucleobases 8213-8325 of SEP ID NO: 2

In certain embodiments, antisense oligonucleotides are designed to target nucleobases 8213-8325 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT 008413.18 truncated from nucleosides 27535000 to 27565000). In certain embodiments, nucleobases 8213- 8325 are a hotspot region. In certain embodiments, nucleobases 8213-8325 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleoside linkages (e.g., the antisense oligonucleotides have "mixed backbones").

In certain embodiments, nucleobases 8213-8325 are targeted by the following ISIS numbers: 655235-655270.

In certain embodiments, nucleobases 8213-8325 are targeted by the following SEQ ID NOs: 555-590.

In certain embodiments, antisense oligonucleotides targeting nucleobases 8213-8325 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, at least 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, or at least 51% reduction of total C90RF72 mRNA and/or protein levels in vitro and/or in vivo.

In certain embodiments, antisense oligonucleotides targeting nucleobases 8213-8325 achieve at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, or at least 98% reduction of C90RF72 pathogenic associated mRNA variant levels in vitro and/or in vivo.

EXAMPLES Non-limiting disclosure and incorporation by reference

While certain compounds, compositions, and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references recited in the present application is incorporated herein by reference in its entirety.

Example 1: Antisense inhibition of a human C90RF72 mRNA variant in HepG2 cells by MOE gapmers

Antisense oligonucleotides targeting a C90RF72 nucleic acid were designed and tested for their effects on C90RF72 mRNA in vitro. ISIS 576816, previously tested in US Application No. 61/714,132, filed October 15, 2012, was used as a benchmark oligonucleotide. ISIS 576816 is a 5- 10-5 MOE gapmer with phosphorothioate linkages throughout. Cultured HepG2 cells at a density of 20,000 cells per well were transfected using electroporation with 4,000 nM antisense

oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and C90RF72 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3905 (forward primer sequence GGGTCTAGCAAGAGCAGGTG, designated herein as SEQ ID NO: 13; reverse primer sequence GTCTTGGCAACAGCTGGAGAT, designated herein as SEQ ID NO: 14; probe sequence TGATGTCGACTCTTTGCCCACCGC, designated herein as SEQ ID NO: 15 - a TAQ-man primer probe set) was used. RTS3905 detects an mRNA variant (e.g. NM_001256054.1) processed from a pre-mRNA variant containing the hexanucleotide repeat. The mRNA variant processed from a pre-mRNA variant containing the hexanucleotide repeat is herein the "C90RF72 pathogenic associated mRNA variant." A pre-mRNA contains the hexanucleotide repeat when transcription of the pre-mRNA begins in the region from the start site of exon 1A to the start site of exon IB (generally nucleotides 1107 to 1520 of the genomic sequence: SEQ ID NO: 2, the complement of GENBAN Accession No. NT 008413.18 truncated from nucleosides

27535000 to 27565000. Therefore, oligonucleotides were designed in this region selectively target the pre-mRNA variant containing the hexanucleotide repeat. RTS3905 measures an mRNA product (i.e. the C90RF72 pathogenic associated mRNA variant) of the pre-mRNA variant containing the hexanucleotide repeat and, therefore, measures the reduction of the pre-mRNA variant containing the hexanucleotide repeat. The levels of the C90RF72 pathogenic associated mRNA variant were normalized to the total RNA content of the cell, as measured by RIBOGREEN®. Results are presented as percent inhibition of C90RF72, relative to untreated control cells. The

oligonucleotide marked with an asterisk (*) targets the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of these oligonucleotides.

The chimeric antisense oligonucleotides in the Tables below were designed as 5-10-5 MOE gapmers. The gapmers are 20 nucleosides in length, wherein the central gap segment comprises ten 2'-deoxynucleosides and is flanked by wing segments on both the 5' end and on the 3' end comprising five nucleosides each. Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment comprises a 2' -MOE group. All cytosine residues throughout each

oligonucleotide are 5-methylcytosines. The internucleoside linkages for the gapmers are mixed phosphorothioate and phosphodiester linkages. The internucleoside linkages for each gapmer are presented in the Linkage column, where Ό' indicates a phosphodiester linkage and's' indicates a phosphorothioate linkage.

"Start site" indicates the 5 '-most nucleoside to which the gapmer is targeted in the human gene sequence. "Stop site" indicates the 3 '-most nucleoside to which the gapmer is targeted human gene sequence. Each antisense oligonucleotide listed in the Table below is targeted to either human C90RF72 mRNA sequence, designated herein as SEQ ID NO: 1 (GENBANK Accession No.

NM_001256054.1) or the human C90RF72 genomic sequence, designated herein as SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000), or both, 'n/a' indicates that the antisense oligonucleotide does not target that particular gene sequence

Table 6

Percent inhibition of the C90RF72 pathogenic associated mRNA variant compared to PBS control by antisense oligonucleotides targeting SEQ ID NOs: 1 and 2

SEQ SEQ ID ID

SEQ NO: NO: %

ISIS NO Sequence Linkage ID

1 2 inhibition

NO

Start Start

Site Site

576816 310 7990 GCCTTACTCTAGGACCAAGA sssssssssssssssssss 40 20

619060 10 1146 CTTTCCTAGCGGGACACCGT soooossssssssssooss 34 21

619111 100 1236 AAAAGAGAAGCAACCGGGCA soooossssssssssooss 34 22

619112 101 1237 CAAAAGAGAAGCAACCGGGC soooossssssssssooss 38 23

619113 102 1238 CCAAAAGAGAAGCAACCGGG soooossssssssssooss 44 24

619114 103 1239 CCCAAAAGAGAAGCAACCGG soooossssssssssooss 100 25

619061 11 1147 TCTTTCCTAGCGGGACACCG soooossssssssssooss 100 26

619062 12 1148 CTCTTTCCTAGCGGGACACC soooossssssssssooss 20 27

619063 13 1149 TCTCTTTCCTAGCGGGACAC soooossssssssssooss 14 28

619064 14 1150 CTCTCTTTCCTAGCGGGACA soooossssssssssooss 9 29

619065 15 1151 CCTCTCTTTCCTAGCGGGAC soooossssssssssooss 12 30

619066 16 1152 ACCTCTCTTTCCTAGCGGGA soooossssssssssooss 0 31

619410* 160 7840 ATCCAAATGCTCCGGAGATA soooossssssssssooss 96 32

619067 17 1153 CACCTCTCTTTCCTAGCGGG soooossssssssssooss 0 33

619068 18 1154 GCACCTCTCTTTCCTAGCGG soooossssssssssooss 24 34

619069 19 1155 CGCACCTCTCTTTCCTAGCG soooossssssssssooss 39 35

619052 2 1138 GCGGGACACCGTAGGTTACG soooossssssssssooss 30 36

619070 20 1156 ACGCACCTCTCTTTCCTAGC soooossssssssssooss 14 37

619071 21 1157 GACGCACCTCTCTTTCCTAG soooossssssssssooss 7 38

619072 22 1158 TGACGCACCTCTCTTTCCTA soooossssssssssooss 50 39

619073 23 1159 TTGACGCACCTCTCTTTCCT soooossssssssssooss 0 40

619074 24 1160 TTTGACGCACCTCTCTTTCC soooossssssssssooss 55 41

619075 25 1161 GTTTGACGCACCTCTCTTTC soooossssssssssooss 12 42

619076 26 1162 TGTTTGACGCACCTCTCTTT soooossssssssssooss 65 43

619077 27 1163 CTGTTTGACGCACCTCTCTT soooossssssssssooss 28 44

619078 28 1164 GCTGTTTGACGCACCTCTCT soooossssssssssooss 18 45

619079 29 1165 CGCTGTTTGACGCACCTCTC soooossssssssssooss 14 46

619053 3 1139 AGCGGGACACCGTAGGTTAC soooossssssssssooss 23 47

619080 30 1166 TCGCTGTTTGACGCACCTCT soooossssssssssooss 100 48

619081 31 1167 GTCGCTGTTTGACGCACCTC soooossssssssssooss 23 49

619082 32 1168 TGTCGCTGTTTGACGCACCT soooossssssssssooss 0 50

619411 324 8004 TGGAGCCCAAATGTGCCTTA soooossssssssssooss 99 51 619083 33 1169 TTGTCGCTGTTTGACGCACC soooossssssssssooss 36 52

619412 332 8012 TCTGTCTTTGGAGCCCAAAT soooossssssssssooss 100 53

619084 34 1170 CTTGTCGCTGTTTGACGCAC soooossssssssssooss 28 54

619085 35 1171 ACTTGTCGCTGTTTGACGCA soooossssssssssooss 55 55

619086 36 1172 AACTTGTCGCTGTTTGACGC soooossssssssssooss 29 56

619087 37 1173 GAACTTGTCGCTGTTTGACG soooossssssssssooss 21 57

619088 38 1174 GGAACTTGTCGCTGTTTGAC soooossssssssssooss 100 58

619089 39 1175 CGGAACTTGTCGCTGTTTGA soooossssssssssooss 67 59

619054 4 1140 TAGCGGGACACCGTAGGTTA soooossssssssssooss 59 60

619090 40 1176 GCGGAACTTGTCGCTGTTTG soooossssssssssooss 8 61

619091 41 1177 GGCGGAACTTGTCGCTGTTT soooossssssssssooss 38 62

619092 42 1178 GGGCGGAACTTGTCGCTGTT soooossssssssssooss 16 63

619093 43 1179 TGGGCGGAACTTGTCGCTGT soooossssssssssooss 22 64

619094 44 1180 GTGGGCGGAACTTGTCGCTG soooossssssssssooss 24 65

619095 45 1181 CGTGGGCGGAACTTGTCGCT soooossssssssssooss 100 66

619055 5 1141 CTAGCGGGACACCGTAGGTT soooossssssssssooss 100 67

619056 6 1142 CCTAGCGGGACACCGTAGGT soooossssssssssooss 11 68

619057 7 1143 TCCTAGCGGGACACCGTAGG soooossssssssssooss 22 69

619096 75 1211 GACGGCTGACACACCAAGCG soooossssssssssooss 100 70

619097 76 1212 GGACGGCTGACACACCAAGC soooossssssssssooss 88 71

619098 77 1213 GGGACGGCTGACACACCAAG soooossssssssssooss 29 72

619099 78 1214 AGGGACGGCTGACACACCAA soooossssssssssooss 83 73

619100 79 1215 CAGGGACGGCTGACACACCA soooossssssssssooss 23 74

619058 8 1144 TTCCTAGCGGGACACCGTAG soooossssssssssooss 32 75

619101 80 1216 GCAGGGACGGCTGACACACC soooossssssssssooss 18 76

619102 81 1217 AGCAGGGACGGCTGACACAC soooossssssssssooss 39 77

619103 82 1218 CAGCAGGGACGGCTGACACA soooossssssssssooss 39 78

619104 83 1219 GCAGCAGGGACGGCTGACAC soooossssssssssooss 22 79

619105 84 1220 GGCAGCAGGGACGGCTGACA soooossssssssssooss 43 80

619059 9 1145 TTTCCTAGCGGGACACCGTA soooossssssssssooss 4 81

619106 95 1231 AGAAGCAACCGGGCAGCAGG soooossssssssssooss 54 82

619107 96 1232 GAGAAGCAACCGGGCAGCAG soooossssssssssooss 100 83

619108 97 1233 AGAGAAGCAACCGGGCAGCA soooossssssssssooss 32 84

619109 98 1234 AAGAGAAGCAACCGGGCAGC soooossssssssssooss 30 85

619110 99 1235 AAAGAGAAGCAACCGGGCAG soooossssssssssooss 44 86

619042 n/a 1111 GTTTTCTATGTGCGATGACG soooossssssssssooss 6 87

619043 n/a 1112 TGTTTTCTATGTGCGATGAC soooossssssssssooss 45 88

619044 n/a 1113 CTGTTTTCTATGTGCGATGA soooossssssssssooss 23 89

619045 n/a 1114 TCTGTTTTCTATGTGCGATG soooossssssssssooss 10 90

619046 n/a 1115 GTCTGTTTTCTATGTGCGAT soooossssssssssooss 11 91

619047 n/a 1116 TGTCTGTTTTCTATGTGCGA soooossssssssssooss 28 92

619048 n/a 1117 CTGTCTGTTTTCTATGTGCG soooossssssssssooss 34 93

619049 n/a 1118 TCTGTCTGTTTTCTATGTGC soooossssssssssooss 72 94 619050 n/a 1119 GTCTGTCTGTTTTCTATGTG soooossssssssssooss 37 95

619051 n/a 1120 CGTCTGTCTGTTTTCTATGT soooossssssssssooss 1 96

619253 n/a 1406 TACAGGCTGCGGTTGTTTCC soooossssssssssooss 100 97

619293 n/a 1446 CCCGGCCCCTAGCGCGCGAC soooossssssssssooss 98 98

Example 2: Antisense inhibition of a human C90RF72 mRNA variant in HepG2 cells by MOE gapmers

Additional antisense oligonucleotides targeting a C90RF72 nucleic acid were designed and tested for their effects on C90RF72 mRNA in vitro. ISIS 576816, previously tested in US

Application No. 61/714,132, filed October 15, 2012, was used as a benchmark oligonucleotide. The antisense oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Cultured HepG2 cells at a density of 20,000 cells per well were transfected using electroporation with 1,000 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and C90RF72 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3905 was used to measure the C90RF72 pathogenic associated mRNA variant, which is the product of a pre-mRNA containing a hexanucleotide repeat. The levels of the C90RF72 pathogenic associated mRNA variant were normalized to the total RNA content of the cell, as measured by RIBOGREEN®. Results are presented as percent inhibition of C90RF72, relative to untreated control cells. The oligonucleotides marked with as asterisk (*) targets the region of the primer probe set. Additional assays may be used to measure the potency and efficacy of these oligonucleotides, 'n.d.' indicates that there was no signal reading in the assay for that particular oligonucleotide.

The chimeric antisense oligonucleotides in the Tables below were designed as 5-10-5 MOE gapmers. The gapmers are 20 nucleosides in length, wherein the central gap segment comprises ten 2'-deoxynucleosides and is flanked by wing segments on both the 5' end and on the 3' end comprising five nucleosides each. Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment comprises a 2' -MOE group. All cytosine residues throughout each oligonucleotide are 5-methylcytosines. The internucleoside linkages for the gapmers are mixed phosphorothioate and phosphodiester linkages. The internucleoside linkages for each gapmer are presented in the Linkage column, where 'o' indicates a phosphodiester linkage and's' indicates a phosphorothioate linkage. "Start site" indicates the 5 '-most nucleoside to which the gapmer is targeted in the human gene sequence. "Stop site" indicates the 3 '-most nucleoside to which the gapmer is targeted human gene sequence. The gapmers of the Tables below also target either human C90RF72 mRNA sequence, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM_001256054.1) or the human C90RF72 genomic sequence, designated herein as SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000), or both. Some of the gapmers of Table 10 are targeted to GENBANK Accession No. NM 145005.5 (incorporated herein as SEQ ID NO: 3), GENBANK Accession No. DB079375.1 (incorporated herein as SEQ ID NO: 4), or GENBANK Accession No. BUI 94591.1 (incorporated herein as SEQ ID NO: 5). 'n/a' indicates that the antisense oligonucleotide does not target that particular gene sequence.

Table 7

SEQ SEQ ID ID

% SEQ ID

ISIS NO NO: 1 NO: 2 Sequence Linkage

inhibition NO Start Start

Site Site

576816 310 7990 GCCTTACTCTAGGACCAAGA sssssssssssssssssss 70 20

619115 104 1240 CCCCAAAAGAGAAGCAACCG soooossssssssssooss 10 99

619116 105 1241 CCCCCAAAAGAGAAGCAACC soooossssssssssooss 19 100

619117 106 1242 GCCCCCAAAAGAGAAGCAAC soooossssssssssooss 0 101

619118* 107 1243 CGCCCCCAAAAGAGAAGCAA soooossssssssssooss 17 102

619119* 108 1244 CCGCCCCCAAAAGAGAAGCA soooossssssssssooss 14 103

619120* 109 1245 CCCGCCCCCAAAAGAGAAGC soooossssssssssooss 4 104

619121* 110 1246 CCCCGCCCCCAAAAGAGAAG soooossssssssssooss 19 105

619122* 111 1247 ACCCCGCCCCCAAAAGAGAA soooossssssssssooss 47 106

619123* 112 1248 GACCCCGCCCCCAAAAGAGA soooossssssssssooss 11 107

619124* 113 1249 AGACCCCGCCCCCAAAAGAG soooossssssssssooss 16 108

619125* 114 1250 TAGACCCCGCCCCCAAAAGA soooossssssssssooss 15 109

619126* 115 1251 CTAGACCCCGCCCCCAAAAG soooossssssssssooss 43 110

619127* 116 1252 GCTAGACCCCGCCCCCAAAA soooossssssssssooss 67 111

619128* 117 1253 TGCTAGACCCCGCCCCCAAA soooossssssssssooss 85 112

619129* 118 1254 TTGCTAGACCCCGCCCCCAA soooossssssssssooss 41 113

619130* 119 1255 CTTGCTAGACCCCGCCCCCA soooossssssssssooss 62 114

619131* 120 1256 TCTTGCTAGACCCCGCCCCC soooossssssssssooss 95 115

619132* 121 1257 CTCTTGCTAGACCCCGCCCC soooossssssssssooss 81 116

619133* 122 1258 GCTCTTGCTAGACCCCGCCC soooossssssssssooss 90 117 619134* 123 1259 TGCTCTTGCTAGACCCCGCC soooossssssssssooss 85 118

619135* 124 1260 CTGCTCTTGCTAGACCCCGC soooossssssssssooss 81 119

619136* 125 1261 CCTGCTCTTGCTAGACCCCG soooossssssssssooss 78 120

619137* 126 1262 ACCTGCTCTTGCTAGACCCC soooossssssssssooss 85 121

619138* 127 1263 CACCTGCTCTTGCTAGACCC soooossssssssssooss 81 122

619139* 128 1264 ACACCTGCTCTTGCTAGACC soooossssssssssooss 77 123

619140* 129 1265 CACACCTGCTCTTGCTAGAC soooossssssssssooss 86 124

619141* 130 1266 CCACACCTGCTCTTGCTAGA soooossssssssssooss 90 125

619142* 131 1267 CCCACACCTGCTCTTGCTAG soooossssssssssooss 98 126

619143* 132 1268 ACCCACACCTGCTCTTGCTA soooossssssssssooss 94 127

619144* 133 1269 AACCCACACCTGCTCTTGCT soooossssssssssooss 93 128

619145* 134 1270 AAACCCACACCTGCTCTTGC soooossssssssssooss 95 129

619146* 135 1271 TAAACCCACACCTGCTCTTG soooossssssssssooss 78 130

619147* 136 1272 CTAAACCCACACCTGCTCTT soooossssssssssooss 64 131

619148* 137 1273 CCTAAACCCACACCTGCTCT soooossssssssssooss 84 132

619149* 138 1274 TCCTAAACCCACACCTGCTC soooossssssssssooss 87 133

619150* 139 1275 CTCCTAAACCCACACCTGCT soooossssssssssooss 89 134

619413 340 8020 GTACCTGTTCTGTCTTTGGA soooossssssssssooss 70 135

619414 353 8033 CCATCACTGAGAAGTACCTG soooossssssssssooss 78 136

619415 940 16395 GGCATAATGTTCTGACTATC soooossssssssssooss 67 137

619151* n/a 1276 CCTCCTAAACCCACACCTGC soooossssssssssooss 64 138

619152* n/a 1277 ACCTCCTAAACCCACACCTG soooossssssssssooss 45 139

619153* n/a 1278 CACCTCCTAAACCCACACCT soooossssssssssooss 36 140

619154* n/a 1279 ACACCTCCTAAACCCACACC soooossssssssssooss 26 141

619155* n/a 1280 CACACCTCCTAAACCCACAC soooossssssssssooss 50 142

619156* n/a 1281 ACACACCTCCTAAACCCACA soooossssssssssooss 53 143

619157* n/a 1282 CACACACCTCCTAAACCCAC soooossssssssssooss 44 144

619158* n/a 1283 ACACACACCTCCTAAACCCA soooossssssssssooss 65 145

619159* n/a 1284 AACACACACCTCCTAAACCC soooossssssssssooss 9 146

619160* n/a 1285 AAACACACACCTCCTAAACC soooossssssssssooss 0 147

619161* n/a 1286 AAAACACACACCTCCTAAAC soooossssssssssooss 15 148

619162* n/a 1287 AAAAACACACACCTCCTAAA soooossssssssssooss 10 149

619163* n/a 1288 CAAAAACACACACCTCCTAA soooossssssssssooss 7 150

619164* n/a 1289 ACAAAAACACACACCTCCTA soooossssssssssooss 55 151

619165* n/a 1290 AACAAAAACACACACCTCCT soooossssssssssooss 24 152

619166* n/a 1291 AAACAAAAACACACACCTCC soooossssssssssooss 19 153

619167* n/a 1292 AAAACAAAAACACACACCTC soooossssssssssooss 8 154

619168* n/a 1294 GAAAAACAAAAACACACACC soooossssssssssooss 17 155

619169* n/a 1295 GGAAAAACAAAAACACACAC soooossssssssssooss 26 156

619170 n/a 1297 TGGGAAAAACAAAAACACAC soooossssssssssooss 30 157

619171 n/a 1298 GTGGGAAAAACAAAAACACA soooossssssssssooss 23 158

619172 n/a 1299 GGTGGGAAAAACAAAAACAC soooossssssssssooss 22 159

619173 n/a 1326 CTGTGAGAGCAAGTAGTGGG soooossssssssssooss 43 160 619174 n/a 1327 ACTGTGAGAGCAAGTAGTGG soooossssssssssooss 36 161

619175 n/a 1328 TACTGTGAGAGCAAGTAGTG soooossssssssssooss 24 162

619176 n/a 1329 GTACTGTGAGAGCAAGTAGT soooossssssssssooss 58 163

619177 n/a 1330 AGTACTGTGAGAGCAAGTAG soooossssssssssooss 22 164

619178 n/a 1331 GAGTACTGTGAGAGCAAGTA soooossssssssssooss 100 165

619179 n/a 1332 CGAGTACTGTGAGAGCAAGT soooossssssssssooss 62 166

619180 n/a 1333 GCGAGTACTGTGAGAGCAAG soooossssssssssooss 63 167

619181 n/a 1334 AGCGAGTACTGTGAGAGCAA soooossssssssssooss 36 168

619182 n/a 1335 CAGCGAGTACTGTGAGAGCA soooossssssssssooss 41 169

619183 n/a 1336 TCAGCGAGTACTGTGAGAGC soooossssssssssooss 66 170

619184 n/a 1337 CTCAGCGAGTACTGTGAGAG soooossssssssssooss 28 171

619185 n/a 1338 CCTCAGCGAGTACTGTGAGA soooossssssssssooss 37 172

619186 n/a 1339 CCCTCAGCGAGTACTGTGAG soooossssssssssooss 43 173

619187 n/a 1340 ACCCTCAGCGAGTACTGTGA soooossssssssssooss 84 174

619253 n/a 1406 TACAGGCTGCGGTTGTTTCC soooossssssssssooss 31 97

619293 n/a 1446 CCCGGCCCCTAGCGCGCGAC soooossssssssssooss 63 98

Table 8

619205 n/a 1358 TCAGGTCTTTTCTTGTTCAC soooossssssssssooss 68 192

619206 n/a 1359 ATCAGGTCTTTTCTTGTTCA soooossssssssssooss 52 193

619207 n/a 1360 TATCAGGTCTTTTCTTGTTC soooossssssssssooss 47 194

619208 n/a 1361 TTATCAGGTCTTTTCTTGTT soooossssssssssooss 37 195

619209 n/a 1362 TTTATCAGGTCTTTTCTTGT soooossssssssssooss 31 196

619210 n/a 1363 CTTTATCAGGTCTTTTCTTG soooossssssssssooss 24 197

619211 n/a 1364 TCTTTATCAGGTCTTTTCTT soooossssssssssooss 37 198

619212 n/a 1365 ATCTTTATCAGGTCTTTTCT soooossssssssssooss 34 199

619213 n/a 1366 AATCTTTATCAGGTCTTTTC soooossssssssssooss 38 200

619214 n/a 1367 TAATCTTTATCAGGTCTTTT soooossssssssssooss 32 201

619215 n/a 1368 TTAATCTTTATCAGGTCTTT soooossssssssssooss 55 202

619216 n/a 1369 GTTAATCTTTATCAGGTCTT soooossssssssssooss 72 203

619217 n/a 1370 GGTTAATCTTTATCAGGTCT soooossssssssssooss 85 204

619218 n/a 1371 TGGTTAATCTTTATCAGGTC soooossssssssssooss 82 205

619219 n/a 1372 CTGGTTAATCTTTATCAGGT soooossssssssssooss 62 206

619220 n/a 1373 TCTGGTTAATCTTTATCAGG soooossssssssssooss 19 207

619221 n/a 1374 TTCTGGTTAATCTTTATCAG soooossssssssssooss 31 208

619222 n/a 1375 CTTCTGGTTAATCTTTATCA soooossssssssssooss 40 209

619223 n/a 1376 TCTTCTGGTTAATCTTTATC soooossssssssssooss 41 210

619224 n/a 1377 TTCTTCTGGTTAATCTTTAT soooossssssssssooss 11 211

619225 n/a 1378 TTTCTTCTGGTTAATCTTTA soooossssssssssooss 46 212

619226 n/a 1379 TTTTCTTCTGGTTAATCTTT soooossssssssssooss 14 213

619227 n/a 1380 GTTTTCTTCTGGTTAATCTT soooossssssssssooss 50 214

619228 n/a 1381 TGTTTTCTTCTGGTTAATCT soooossssssssssooss 49 215

619229 n/a 1382 TTGTTTTCTTCTGGTTAATC soooossssssssssooss 31 216

619230 n/a 1383 CTTGTTTTCTTCTGGTTAAT soooossssssssssooss 16 217

619231 n/a 1384 CCTTGTTTTCTTCTGGTTAA soooossssssssssooss 23 218

619232 n/a 1385 TCCTTGTTTTCTTCTGGTTA soooossssssssssooss 52 219

619233 n/a 1386 CTCCTTGTTTTCTTCTGGTT soooossssssssssooss 32 220

619234 n/a 1387 CCTCCTTGTTTTCTTCTGGT soooossssssssssooss 59 221

619235 n/a 1388 CCCTCCTTGTTTTCTTCTGG soooossssssssssooss 48 222

619236 n/a 1389 TCCCTCCTTGTTTTCTTCTG soooossssssssssooss 31 223

619237 n/a 1390 TTCCCTCCTTGTTTTCTTCT soooossssssssssooss 24 224

619238 n/a 1391 TTTCCCTCCTTGTTTTCTTC soooossssssssssooss 42 225

619239 n/a 1392 GTTTCCCTCCTTGTTTTCTT soooossssssssssooss 46 226

619240 n/a 1393 TGTTTCCCTCCTTGTTTTCT soooossssssssssooss 81 227

619241 n/a 1394 TTGTTTCCCTCCTTGTTTTC soooossssssssssooss 53 228

619242 n/a 1395 GTTGTTTCCCTCCTTGTTTT soooossssssssssooss 28 229

619243 n/a 1396 GGTTGTTTCCCTCCTTGTTT soooossssssssssooss 40 230

619244 n/a 1397 CGGTTGTTTCCCTCCTTGTT soooossssssssssooss 31 231

619245 n/a 1398 GCGGTTGTTTCCCTCCTTGT soooossssssssssooss 69 232

619246 n/a 1399 TGCGGTTGTTTCCCTCCTTG soooossssssssssooss 73 233

619247 n/a 1400 CTGCGGTTGTTTCCCTCCTT soooossssssssssooss 90 234 619248 n/a 1401 GCTGCGGTTGTTTCCCTCCT soooossssssssssooss 40 235

619249 n/a 1402 GGCTGCGGTTGTTTCCCTCC soooossssssssssooss 50 236

619250 n/a 1403 AGGCTGCGGTTGTTTCCCTC soooossssssssssooss 61 237

619251 n/a 1404 CAGGCTGCGGTTGTTTCCCT soooossssssssssooss 72 238

619252 n/a 1405 ACAGGCTGCGGTTGTTTCCC soooossssssssssooss 69 239

619253 n a 1406 TACAGGCTGCGGTTGTTTCC soooossssssssssooss 67 97

619254 n a 1407 CTACAGGCTGCGGTTGTTTC soooossssssssssooss 43 240

619255 n/a 1408 GCTACAGGCTGCGGTTGTTT soooossssssssssooss 54 241

619256 n/a 1409 TGCTACAGGCTGCGGTTGTT soooossssssssssooss 36 242

619257 n/a 1410 TTGCTACAGGCTGCGGTTGT soooossssssssssooss 29 243

619258 n/a 1411 CTTGCTACAGGCTGCGGTTG soooossssssssssooss 50 244

619259 n/a 1412 GCTTGCTACAGGCTGCGGTT soooossssssssssooss 76 245

619260 n/a 1413 AGCTTGCTACAGGCTGCGGT soooossssssssssooss 80 246

619261 n/a 1414 GAGCTTGCTACAGGCTGCGG soooossssssssssooss 54 247

619262 n/a 1415 AGAGCTTGCTACAGGCTGCG soooossssssssssooss 62 248

619293 n/a 1446 CCCGGCCCCTAGCGCGCGAC soooossssssssssooss 64 98

24657

619416 1937 AAAAAACAGTAGTTGTGGTC soooossssssssssooss 78 249

27056

619417 1988 27107 GCCAACTCAGATTTCACCTT soooossssssssssooss 86 250

Table 9

619278 n/a 1431 GCGACTCCTGAGTTCCAGAG soooossssssssssooss 98 265

619279 n/a 1432 CGCGACTCCTGAGTTCCAGA soooossssssssssooss 69 266

619280 n/a 1433 GCGCGACTCCTGAGTTCCAG soooossssssssssooss 75 267

619281 n/a 1434 CGCGCGACTCCTGAGTTCCA soooossssssssssooss 67 268

619282 n/a 1435 GCGCGCGACTCCTGAGTTCC soooossssssssssooss 55 269

619283 n/a 1436 AGCGCGCGACTCCTGAGTTC soooossssssssssooss 62 270

619284 n/a 1437 TAGCGCGCGACTCCTGAGTT soooossssssssssooss 100 271

619285 n/a 1438 CTAGCGCGCGACTCCTGAGT soooossssssssssooss 68 272

619286 n/a 1439 CCTAGCGCGCGACTCCTGAG soooossssssssssooss 41 273

619287 n/a 1440 CCCTAGCGCGCGACTCCTGA soooossssssssssooss 70 274

619288 n/a 1441 CCCCTAGCGCGCGACTCCTG soooossssssssssooss 68 275

619289 n/a 1442 GCCCCTAGCGCGCGACTCCT soooossssssssssooss 52 276

619290 n/a 1443 GGCCCCTAGCGCGCGACTCC soooossssssssssooss 49 277

619291 n/a 1444 CGGCCCCTAGCGCGCGACTC soooossssssssssooss 69 278

619292 n/a 1445 CCGGCCCCTAGCGCGCGACT soooossssssssssooss 76 279

619293 n/a 1446 CCCGGCCCCTAGCGCGCGAC soooossssssssssooss 52 98

619294 n/a 1447 CCCCGGCCCCTAGCGCGCGA soooossssssssssooss 62 280

619295 n/a 1448 GCCCCGGCCCCTAGCGCGCG soooossssssssssooss 68 281

619296 n/a 1449 GGCCCCGGCCCCTAGCGCGC soooossssssssssooss 56 282

619297 n/a 1450 CGGCCCCGGCCCCTAGCGCG soooossssssssssooss 71 283

619298 n/a 1451 CCGGCCCCGGCCCCTAGCGC soooossssssssssooss 73 284

619299 n/a 1452 CCCGGCCCCGGCCCCTAGCG soooossssssssssooss 51 285

619300 n/a 1453 CCCCGGCCCCGGCCCCTAGC soooossssssssssooss 49 286

619301 n/a 1454 GCCCCGGCCCCGGCCCCTAG soooossssssssssooss 60 287

619302 n/a 1455 GGCCCCGGCCCCGGCCCCTA soooossssssssssooss 48 288

619303 n/a 1462 ACGCCCCGGCCCCGGCCCCG soooossssssssssooss 49 289

619304 n/a 1463 CACGCCCCGGCCCCGGCCCC soooossssssssssooss 25 290

619305 n/a 1464 CCACGCCCCGGCCCCGGCCC soooossssssssssooss 66 291

619306 n/a 1465 ACCACGCCCCGGCCCCGGCC soooossssssssssooss 70 292

619307 n/a 1466 GACCACGCCCCGGCCCCGGC soooossssssssssooss 73 293

619308 n/a 1467 CGACCACGCCCCGGCCCCGG soooossssssssssooss 55 294

619309 n/a 1468 CCGACCACGCCCCGGCCCCG soooossssssssssooss 70 295

619310 n/a 1469 CCCGACCACGCCCCGGCCCC soooossssssssssooss 50 296

619311 n/a 1470 CCCCGACCACGCCCCGGCCC soooossssssssssooss 45 297

619312 n/a 1471 GCCCCGACCACGCCCCGGCC soooossssssssssooss 36 298

619313 n/a 1472 CGCCCCGACCACGCCCCGGC soooossssssssssooss 58 299

619314 n/a 1473 CCGCCCCGACCACGCCCCGG soooossssssssssooss 100 300

619315 n/a 1474 CCCGCCCCGACCACGCCCCG soooossssssssssooss 44 301

619316 n/a 1475 GCCCGCCCCGACCACGCCCC soooossssssssssooss 97 302

619317 n/a 1476 GGCCCGCCCCGACCACGCCC soooossssssssssooss 76 303

619318 n/a 1477 GGGCCCGCCCCGACCACGCC soooossssssssssooss 44 304

619319 n/a 1478 CGGGCCCGCCCCGACCACGC soooossssssssssooss 40 305

619320 n/a 1479 CCGGGCCCGCCCCGACCACG soooossssssssssooss 50 306 619321 n/a 1480 CCCGGGCCCGCCCCGACCAC soooossssssssssooss 22 307

619322 n/a 1481 CCCCGGGCCCGCCCCGACCA soooossssssssssooss 56 308

619323 n/a 1482 CCCCCGGGCCCGCCCCGACC soooossssssssssooss 40 309

619324 n/a 1483 GCCCCCGGGCCCGCCCCGAC soooossssssssssooss 65 310

619325 n a 1484 CGCCCCCGGGCCCGCCCCGA soooossssssssssooss 25 311

619326 n/a 1486 CCCGCCCCCGGGCCCGCCCC soooossssssssssooss 41 312

619327 n/a 1487 GCCCGCCCCCGGGCCCGCCC soooossssssssssooss 36 313

619328 n/a 1488 GGCCCGCCCCCGGGCCCGCC soooossssssssssooss 14 314

619329 n/a 1495 CGCCCCGGGCCCGCCCCCGG soooossssssssssooss 33 315

619330 n/a 1497 CCCGCCCCGGGCCCGCCCCC soooossssssssssooss 35 316

619331 n/a 1498 CCCCGCCCCGGGCCCGCCCC soooossssssssssooss 42 317

619332 n/a 1499 GCCCCGCCCCGGGCCCGCCC soooossssssssssooss 47 318

619333 n/a 1500 AGCCCCGCCCCGGGCCCGCC soooossssssssssooss 53 319

619334 n/a 1501 CAGCCCCGCCCCGGGCCCGC soooossssssssssooss 32 320

619335 n/a 1502 GCAGCCCCGCCCCGGGCCCG soooossssssssssooss 58 321

619336 n/a 1503 CGCAGCCCCGCCCCGGGCCC soooossssssssssooss 75 322

619418 n/a 27155 CTACACACCAAAGAATGCCA soooossssssssssooss 71 323

619419 n/a 15587 GGAATAAGGTCACTAGTTCG soooossssssssssooss 72 324

619420 n/a 7990 GCCTTACTCTAGGACCAAGA soooossssssssssooss 100 20

619263 n/a 1416 CAGAGCTTGCTACAGGCTGC soooossssssssssooss 63 325

619253 n/a 1406 TACAGGCTGCGGTTGTTTCC soooossssssssssooss 50 97

Table 10

Percent inhibition of the C90RF72 pathogenic associated mRNA variant compared to PBS control by antisense oligonucleotides targeting SEQ ID NOs: 1-5

619347 n/a 1514 n/a n/a n/a GGCACCGCAACCGCAGCCCC soooossssssssssooss 100 336

619348 n/a 1515 n/a n/a n/a AGGCACCGCAACCGCAGCCC soooossssssssssooss 46 337

619349 n/a 1516 n/a n/a n/a CAGGCACCGCAACCGCAGCC soooossssssssssooss 100 338

619350 n/a 1517 n/a n/a n/a GCAGGCACCGCAACCGCAGC soooossssssssssooss 55 339

619351 n/a 1518 n/a n/a n/a CGCAGGCACCGCAACCGCAG soooossssssssssooss 63 340

619352 n/a 1519 n/a n/a n/a GCGCAGGCACCGCAACCGCA soooossssssssssooss 42 341

619353 n/a 1520 n/a n/a n/a GGCGCAGGCACCGCAACCGC soooossssssssssooss 95 342

619354 n/a 1521 n/a n/a n/a GGGCGCAGGCACCGCAACCG soooossssssssssooss 23 343

619355* 140 n/a n/a n/a n/a TCTCCTAAACCCACACCTGC soooossssssssssooss 94 384

619356* 141 n/a n/a n/a n/a ATCTCCTAAACCCACACCTG soooossssssssssooss 69 385

619357 142 n/a n/a n/a n/a TATCTCCTAAACCCACACCT soooossssssssssooss n.d. 386

619358* 143 n/a n/a n/a n/a ATATCTCCTAAACCCACACC soooossssssssssooss 53 387

619359 144 n/a n/a n/a n/a GATATCTCCTAAACCCACAC soooossssssssssooss n.d. 388

619360* 145 n/a n/a n/a n/a AGATATCTCCTAAACCCACA soooossssssssssooss 30 389

619361 * 146 n/a n/a n/a n/a GAGATATCTCCTAAACCCAC soooossssssssssooss 48 390

619362* 147 n/a n/a n/a n/a GGAGATATCTCCTAAACCCA soooossssssssssooss 60 391

619363* 148 n/a n/a n/a n/a CGGAGATATCTCCTAAACCC soooossssssssssooss 26 392

619364* 149 n/a n/a n/a n/a CCGGAGATATCTCCTAAACC soooossssssssssooss 97 393

619365* 150 n/a n/a n/a n/a TCCGGAGATATCTCCTAAAC soooossssssssssooss 60 394

619366* 151 n/a n/a n/a n/a CTCCGGAGATATCTCCTAAA soooossssssssssooss 34 395

619367 152 n/a n/a n/a n/a GCTCCGGAGATATCTCCTAA soooossssssssssooss n.d. 396

619368* 153 n/a n/a n/a n/a TGCTCCGGAGATATCTCCTA soooossssssssssooss 95 397

619369 154 n/a n/a n/a n/a ATGCTCCGGAGATATCTCCT soooossssssssssooss n.d. 398

619370* 155 n/a n/a n/a n/a AATGCTCCGGAGATATCTCC soooossssssssssooss 59 399

619371 * n/a n/a n/a 17 n/a TCTCTCTTTCCTAGCGGGAC soooossssssssssooss 0 344

619372* n/a n/a n/a 18 n/a ATCTCTCTTTCCTAGCGGGA soooossssssssssooss 8 345

619373* n/a n/a n/a 19 n/a TATCTCTCTTTCCTAGCGGG soooossssssssssooss 6 346

619374* n/a n/a n/a 20 n/a ATATCTCTCTTTCCTAGCGG soooossssssssssooss 0 347

619375* n/a n/a n/a 21 n/a GATATCTCTCTTTCCTAGCG soooossssssssssooss 8 348

619376* n/a n/a n/a 22 n/a AGATATCTCTCTTTCCTAGC soooossssssssssooss 0 349

619377* n/a n/a n/a 23 n/a GAGATATCTCTCTTTCCTAG soooossssssssssooss 89 350

619378* n/a n/a n/a 24 n/a GGAGATATCTCTCTTTCCTA soooossssssssssooss 1 351

619379* n/a n/a n/a 25 n/a CGGAGATATCTCTCTTTCCT soooossssssssssooss 0 352

619380 n/a n/a n/a 26 n/a CCGGAGATATCTCTCTTTCC soooossssssssssooss n.d. 353

619381 * n/a n/a n/a 27 n/a TCCGGAGATATCTCTCTTTC soooossssssssssooss 28 354

619382* n/a n/a n/a 28 n/a CTCCGGAGATATCTCTCTTT soooossssssssssooss 28 355

619383* n/a n/a n/a 29 n/a GCTCCGGAGATATCTCTCTT soooossssssssssooss 91 356

619384* n/a n/a n/a 30 n/a TGCTCCGGAGATATCTCTCT soooossssssssssooss 61 357

619385* n/a n/a n/a 31 n/a ATGCTCCGGAGATATCTCTC soooossssssssssooss 69 358

619386* n/a n/a n/a 32 n/a AATGCTCCGGAGATATCTCT soooossssssssssooss 75 359

619387 156 n/a n/a 33 n/a AAATGCTCCGGAGATATCTC soooossssssssssooss n.d. 400

619388* n/a n/a n/a n/a 18 TCTGCTCTTGCTAGACCCCG soooossssssssssooss 50 360

619389 n/a n/a n/a n/a 19 ATCTGCTCTTGCTAGACCCC soooossssssssssooss n.d. 361 619390* n/a n/a n/a n/a 20 TATCTGCTCTTGCTAGACCC soooossssssssssooss 5 362

619391 * n/a n/a n/a n/a 21 ATATCTGCTCTTGCTAGACC soooossssssssssooss 0 363

619392* n a n/a n/a n/a 22 GATATCTGCTCTTGCTAGAC soooossssssssssooss 0 364

619393* n/a n/a n/a n a 23 AGATATCTGCTCTTGCTAGA soooossssssssssooss 6 365

619394* n/a n/a n/a n/a 24 GAGATATCTGCTCTTGCTAG soooossssssssssooss 57 366

619395* n/a n/a n/a n/a 25 GGAGATATCTGCTCTTGCTA soooossssssssssooss 6 367

619396* n/a n/a n/a n/a 26 CGGAGATATCTGCTCTTGCT soooossssssssssooss 0 368

619397* n/a n/a n/a n/a 27 CCGGAGATATCTGCTCTTGC soooossssssssssooss 0 369

619398* n/a n/a n/a n/a 28 TCCGGAGATATCTGCTCTTG soooossssssssssooss 22 370

619399* n/a n/a n/a n/a 29 CTCCGGAGATATCTGCTCTT soooossssssssssooss 14 371

619400* n/a n a n a n/a 30 GCTCCGGAGATATCTGCTCT soooossssssssssooss 46 372

619401 * n/a n/a n/a n/a 31 TGCTCCGGAGATATCTGCTC soooossssssssssooss 40 373

619402* n/a n/a n/a n/a 32 ATGCTCCGGAGATATCTGCT soooossssssssssooss 79 374

619403* n/a n/a n/a n/a 33 AATGCTCCGGAGATATCTGC soooossssssssssooss 65 375

619404* n/a n/a n/a n/a 34 AAATGCTCCGGAGATATCTG soooossssssssssooss 22 376

619405* n/a n/a 75 n/a n/a TGCTCCGGAGATATCAAGCG soooossssssssssooss 18 377

619406* n/a n/a 76 n/a n/a ATGCTCCGGAGATATCAAGC soooossssssssssooss 21 378

619407* n/a n/a 77 n/a n/a AATGCTCCGGAGATATCAAG soooossssssssssooss 98 379

619408 n/a n/a 78 n/a n/a AAATGCTCCGGAGATATCAA soooossssssssssooss n.d. 380

619409* n/a n/a 79 n a n/a CAAATGCTCCGGAGATATCA soooossssssssssooss 98. 381

619421 3132 28251 n/a n a n/a GGGACACTACAAGGTAGTAT soooossssssssssooss 80 401

619422* n/a 3452 n/a n/a n/a GGTAACTTCAAACTCTTGGG soooossssssssssooss 85. 382

619423 n/a 13642 1013 n/a n/a GCCATGATTTCTTGTCTGGG soooossssssssssooss 67 383

Example 3: Dose-dependent antisense inhibition of a human C90RF72 mRNA variant in HepG2 cells

Antisense oligonucleotides from the study described above exhibiting significant in vitro inhibition of C90RF72 mRNA were selected and tested at various doses in HepG2 cells. ISIS 576816 and ISIS

577061, previously tested in US Application No. 61/714,132, filed October 15, 2012, were used as

benchmark oligonucleotides. ISIS 576816 and ISIS 577061 are 5-10-5 MOE gapmers with phosphorothioate linkages throughout. The antisense oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Cells were plated at a density of 20,000 cells per well and transfected using electrop oration with 78.1 nM, 312.5 nM, 1,250.0 nM, or 5,000.0 nM concentrations of antisense oligonucleotide. After a treatment period of approximately 16 hours, RNA was isolated from the cells and C90RF72 mRNA levels were measured by quantitative real-time PCR. Human C90RF72 primer probe set RTS3905 was used to measure the C90RF72 pathogenic associated mRNA variant. The levels of the C90RF72 pathogenic associated mRNA variant were adjusted according to total RNA content, as measured by RIBOGREEN^®. Results are presented as percent inhibition of variant C90RF72 levels, relative to untreated control cells. 'n.d.' means no data. The half maximal inhibitory concentration (IC₅o) of each oligonucleotide is also presented in the Tables below. As illustrated, the C90RF72 pathogenic associated mRNA variant levels were reduced in a dose-dependent manner in some of the antisense oligonucleotide treated cells.

Table 11

Dose-dependent inhibition of the C90RF72 pathogenic associated mRNA variant

Table 12

Dose-dependent inhibition of the C90RF72 pathogenic associated mRNA variant

619182 23 32 74 92 0.5

619183 0 26 44 96 1.0

619185 14 34 70 93 0.5

619186 8 32 71 98 0.6

619187 18 36 81 95 0.4

619253 17 22 61 97 0.7

619293 0 49 86 99 0.6

619413 8 48 84 95 0.4

619415 26 67 90 n.d. 0.2

Table 13

Dose-dependent inhibition of the C90RF72 pathogenic associated mRNA variant

Table 14

Dose-dependent inhibition of the C90RF72 pathogenic associated mRNA variant

619266 0 23 73 98 0.8

619268 5 29 77 97 0.6

619276 31 82 90 91 0.1

619278 35 83 97 99 0.1

619280 66 80 97 96 <0.07

619284 22 55 88 98 0.3

619292 37 79 85 94 0.1

619297 0 68 82 91 0.6

619298 47 89 93 91 <0.07

619307 37 71 96 98 0.1

619314 21 0 61 97 0.8

619316 13 37 71 91 0.5

619317 7 17 68 87 0.8

619336 17 51 64 90 0.5

619418 43 78 89 95 0.1

619419 43 68 94 95 0.1

619420 66 88 100 n.d. <0.07

Table 15

Dose-dependent inhibition of the C90RF72 pathogenic associated mRNA variant

78.1 312.5 1250.0 5000.0

ISIS No ic₅₀ nM nM nM nM ₍μΜ)

576816 8 48 91 91 0.4

577061 0 13 33 64 2.6

619293 32 77 85 95 0.1

619337 28 42 79 95 0.3

619338 11 55 83 91 0.4

619339 6 42 83 90 0.5

619341 17 14 66 83 0.8

619342 37 57 85 97 0.2

619343 25 51 87 96 0.3

619344 17 27 75 91 0.5

619345 0 18 50 88 1.2

619346 0 22 76 90 0.8

619347 1 8 41 76 1.7

619349 10 12 51 78 1.3

619350 16 46 84 91 0.4

619351 20 21 69 87 0.6

619353 0 13 52 76 1.4

619421 27 78 93 92 0.1

619423 0 53 87 93 0.5 Table 16

Gapmers chosen for further analysis

junction

intron:exonlB

619343 0.3 CCGCAACCGCAGCCCCGCCC 1510 332

junction

intron:exonlB

619344 0.5 ACCGCAACCGCAGCCCCGCC 1511 333

junction

intron:exonlB

619350 0.4 GCAGGCACCGCAACCGCAGC 1517 339

junction

intron:exonlB

619351 0.6 CGCAGGCACCGCAACCGCAG 1518 340

junction

Example 4: Antisense inhibition of C90RF72 by human-rhesus cross-reactive antisense

oligonucleotides in LLC-MK2 cells

Antisense oligonucleotides targeting a human C90RF72 nucleic acid and fully cross-reactive with a rhesus C90RF72 nucleic acid were designed and were tested for their effects on rhesus C90RF72 mRNA in vitro. ISIS 576816, previously tested in US Application No. 61/714,132, filed October 15, 2012, was used as a benchmark oligonucleotide. The antisense oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in the tables below. Cultured rhesus LLC-MK2 cells at a density of 20,000 cells per well were transfected using electroporation with 4,000 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and C90RF72 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3750 (forward sequence TGTGACAGTTGGAATGCAGTGA, designated herein as SEQ ID NO: 16; reverse sequence GCCACTTAAAGCAATCTCTGTCTTG, designated herein as SEQ ID NO: 17; probe sequence TCGACTCTTTGCCCACCGCCA, designated herein as SEQ ID NO : 18 - a TAQ-man primer probe set) was used to measure total C90RF72 mRNA levels. RTS3750 targets exon 2 of the mRNA transcripts and, therefore, measures total mRNA transcripts. C90RF72 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of C90RF72, relative to untreated control cells. The oligonucleotides marked with as asterisk (*) target the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of these oligonucleotides, 'n.d. ' indicates that there was no signal reading in the assay for that particular oligonucleotide. The antisense oligonucleotides were also tested in HepG2 cells in a series of experiments that had similar culture conditions. The results for each experiment are also presented in tables shown below. Cultured HepG2 cells at a density of 20,000 cells per well were transfected using electroporation with 4,000 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and C90RF72 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3905 was used to measure the C90RF72 pathogenic associated mRNA variant, which is the product of a pre-mRNA containing a hexanucleotide repeat. The levels of the C90RF72 pathogenic associated mRNA variant were normalized to the total RNA content of the cell, as measured by RIBOGREEN®. Results are presented as percent inhibition of C90RF72, relative to untreated control cells. 'n.d.' means no data.

The chimeric antisense oligonucleotides in the Tables below were designed as 5-10-5 MOE gapmers. The gapmers are 20 nucleosides in length, wherein the central gap segment comprises ten 2'- deoxynucleosides and is flanked by wing segments on both the 5' end and on the 3' end comprising five nucleosides each. Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment comprises a 2'-MOE group. All cytosine residues throughout each oligonucleotide are 5-methylcytosines. The internucleoside linkages for the gapmers are mixed phosphorothioate and phosphodiester linkages. The internucleoside linkages for each gapmer are presented in the Linkage column, where Ό' indicates a phosphodiester linkage and's' indicates a phosphorothioate linkage.

"Start site" indicates the 5 '-most nucleoside to which the gapmer is targeted in the human gene sequence. "Stop site" indicates the 3 '-most nucleoside to which the gapmer is targeted human gene sequence. Each antisense oligonucleotide listed in the Tables below is targeted to either human C90RF72 mRNA sequence, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM_001256054.1), the human C90RF72 genomic sequence, designated herein as SEQ ID NO: 2 (the complement of GENBANK Accession No. NT 008413.18 truncated from nucleosides 27535000 to 27565000), GENBANK Accession No. NM_018325.3 (incorporated herein as SEQ ID NO: 6), or all three, 'n/a' indicates that the antisense oligonucleotide does not target that particular gene sequence.

Table 17

Percent inhibition of human C90RF72 compared to PBS control by antisense oligonucleotides

targeting SEQ ID NOs: 1, 2, and 6

SEQ SEQ SEQ %

% inhibition

ID ID ID inhibition

(LLC- SEQ NO: NO: NO: (HepG2)

ISIS NO Sequence Linkage MO) ID

1 2 6 Primer

Primer NO

Start Start Start Probe

Probe

Site Site Site RTS3905

TS3750

576816 310 7990 215 GCCTTACTCTAGGACCAAGA sssssssssssssssssss 51 91 20

619343 n/a 1510 1 CCGCAACCGCAGCCCCGCCC soooossssssssssooss 0 96 332

619420 310 7990 215 GCCTTACTCTAGGACCAAGA soooossssssssssooss 59 100 20

625183 309 7989 214 CCTTACTCTAGGACCAAGAA soooossssssssssooss 27 92 484

625249 239 7919 144 AAAGCAATCTCTGTCTTGGC soooossssssssssooss 78 n.d. 465

625255 364 8044 269 AAGTTATTTCTCCATCACTG soooossssssssssooss 40 97 502

627833 321 8001 226 AGCCCAAATGTGCCTTACTC soooossssssssssooss 52 n.d. 487

627834 382 8062 287 GAGTGTGGTTGGCAAGAAAA soooossssssssssooss 0 61 506

655126 n/a 1548 39 CGCCACCGCCTGCGCCTCCG soooossssssssssooss 0 96 512

655127 n/a 1551 42 ACTCGCCACCGCCTGCGCCT soooossssssssssooss 11 93 513

655128 n/a n/a 45 TCCACTCGCCACCGCCTGCG soooossssssssssooss 0 60 514 655129 n/a n/a 48 ATATCCACTCGCCACCGCCT soooossssssssssooss 1 79 515

655130 n/a n/a 51 GAGATATCCACTCGCCACCG soooossssssssssooss 8 45 516

655131 * 167 7847 72 TCACATTATCCAAATGCTCC soooossssssssssooss 36 88 441

655132* 170 7850 75 CTGTCACATTATCCAAATGC soooossssssssssooss 20 79 442

655133* 173 7853 78 CAACTGTCACATTATCCAAA soooossssssssssooss 31 82 443

655134* 176 7856 81 TTCCAACTGTCACATTATCC soooossssssssssooss 43 90 444

655135* 180 7860 85 TGCATTCCAACTGTCACATT soooossssssssssooss 69 94 445

655136* 183 7863 88 CACTGCATTCCAACTGTCAC soooossssssssssooss 75 98 446

655137* 186 7866 91 CATCACTGCATTCCAACTGT soooossssssssssooss 71 95 447

655138 189 7869 94 CGACATCACTGCATTCCAAC soooossssssssssooss 85 n.d. 448

655139 192 7872 97 AGTCGACATCACTGCATTCC soooossssssssssooss 89 n.d. 449

655140* 195 7875 100 AAGAGTCGACATCACTGCAT soooossssssssssooss 81 100 450

655141 * 198 7878 103 GCAAAGAGTCGACATCACTG soooossssssssssooss 68 98 451

655142* 201 7881 106 TGGGCAAAGAGTCGACATCA soooossssssssssooss 60 98 452

655143* 204 7884 109 CGGTGGGCAAAGAGTCGACA soooossssssssssooss 69 99 453

655144* 207 7887 112 TGGCGGTGGGCAAAGAGTCG soooossssssssssooss 60 97 454

655145* 211 7891 116 GAGATGGCGGTGGGCAAAGA soooossssssssssooss 27 93 455

655146* 214 7894 119 CTGGAGATGGCGGTGGGCAA soooossssssssssooss 56 99 456

655147* 218 7898 123 ACAGCTGGAGATGGCGGTGG soooossssssssssooss 17 84 457

655148 221 7901 126 GCAACAGCTGGAGATGGCGG soooossssssssssooss 34 n.d. 458

655149 224 7904 129 TTGGCAACAGCTGGAGATGG soooossssssssssooss 27 n.d. 459

655150* 227 7907 132 GTCTTGGCAACAGCTGGAGA soooossssssssssooss 52 99 460

655151 230 7910 135 TCTGTCTTGGCAACAGCTGG soooossssssssssooss 60 n.d. 461

655152* 232 7912 137 TCTCTGTCTTGGCAACAGCT soooossssssssssooss 65 98 462

655153* 236 7916 141 GCAATCTCTGTCTTGGCAAC soooossssssssssooss 91 99 463

655154* 237 7917 142 AGCAATCTCTGTCTTGGCAA soooossssssssssooss 87 99 464

655155* 242 7922 147 CTTAAAGCAATCTCTGTCTT soooossssssssssooss 80 76 466

655156* 245 7925 150 CCACTTAAAGCAATCTCTGT soooossssssssssooss 74 86 467

655157 267 7947 172 AGCTGCTAATAAAGGTGATT soooossssssssssooss 27 90 468

655158 270 7950 175 AGTAGCTGCTAATAAAGGTG soooossssssssssooss 17 87 469

655159 273 7953 178 AAAAGTAGCTGCTAATAAAG soooossssssssssooss 6 48 470

655160 276 7956 181 AGCAAAAGTAGCTGCTAATA soooossssssssssooss 3 87 471

655161 279 7959 184 GTAAGCAAAAGTAGCTGCTA soooossssssssssooss 30 99 472

655162 282 7962 187 CCAGTAAGCAAAAGTAGCTG soooossssssssssooss 24 85 473

655163 285 7965 190 GTCCCAGTAAGCAAAAGTAG soooossssssssssooss 15 70 474

655164 286 7966 191 TGTCCCAGTAAGCAAAAGTA soooossssssssssooss 5 60 475

655165 288 7968 193 ATTGTCCCAGTAAGCAAAAG soooossssssssssooss 0 46 476

655166 290 7970 195 ATATTGTCCCAGTAAGCAAA soooossssssssssooss 0 54 477

655167 291 7971 196 AATATTGTCCCAGTAAGCAA soooossssssssssooss 16 60 478

655168 294 7974 199 AAGAATATTGTCCCAGTAAG soooossssssssssooss 0 52 479

655169 297 7977 202 ACCAAGAATATTGTCCCAGT soooossssssssssooss 20 82 480

655170 300 7980 205 AGGACCAAGAATATTGTCCC soooossssssssssooss 17 54 481

655171 303 7983 208 TCTAGGACCAAGAATATTGT soooossssssssssooss 0 36 482 655172 306 7986 211 TACTCTAGGACCAAGAATAT soooossssssssssooss 10 43 483

655173 312 7992 217 GTGCCTTACTCTAGGACCAA soooossssssssssooss 75 99 485

655174 315 7995 220 AATGTGCCTTACTCTAGGAC soooossssssssssooss 47 98 486

655175 327 8007 232 CTTTGGAGCCCAAATGTGCC soooossssssssssooss 21 86 488

655176 330 8010 235 TGTCTTTGGAGCCCAAATGT soooossssssssssooss 21 88 489

655177 333 8013 238 TTCTGTCTTTGGAGCCCAAA soooossssssssssooss 42 97 490

655178 334 8014 239 GTTCTGTCTTTGGAGCCCAA soooossssssssssooss 66 99 491

655179 336 8016 241 CTGTTCTGTCTTTGGAGCCC soooossssssssssooss 68 95 492

655180 339 8019 244 TACCTGTTCTGTCTTTGGAG soooossssssssssooss 29 92 493

655181 342 8022 247 AAGTACCTGTTCTGTCTTTG soooossssssssssooss 26 76 494

655182 345 8025 250 GAGAAGTACCTGTTCTGTCT soooossssssssssooss 38 94 495

655183 348 8028 253 ACTGAGAAGTACCTGTTCTG soooossssssssssooss 23 89 496

655184 350 8030 255 TCACTGAGAAGTACCTGTTC soooossssssssssooss 19 83 497

655185 351 8031 256 ATCACTGAGAAGTACCTGTT soooossssssssssooss 40 87 498

655186 354 8034 259 TCCATCACTGAGAAGTACCT soooossssssssssooss 46 97 499

655187 358 8038 263 TTTCTCCATCACTGAGAAGT soooossssssssssooss 36 94 500

655188 361 8041 266 TTATTTCTCCATCACTGAGA soooossssssssssooss 9 82 501

655189 367 8047 272 GAAAAGTTATTTCTCCATCA soooossssssssssooss 37 96 503

655190 376 8056 281 GGTTGGCAAGAAAAGTTATT soooossssssssssooss 15 74 504

655191 379 8059 284 TGTGGTTGGCAAGAAAAGTT soooossssssssssooss 15 62 505

655192 385 8065 290 TTAGAGTGTGGTTGGCAAGA soooossssssssssooss 12 63 507

655193 388 8068 293 CATTTAGAGTGTGGTTGGCA soooossssssssssooss 7 89 508

655194 389 8069 294 CCATTTAGAGTGTGGTTGGC soooossssssssssooss 31 93 509

655195 394 8074 299 TTTCTCCATTTAGAGTGTGG soooossssssssssooss 19 91 510

655196 397 8077 302 GGATTTCTCCATTTAGAGTG soooossssssssssooss 8 82 511

Table 18

targeting SEQ ID NOs: 1, 2, and 6

%

SEQ SEQ SEQ %

inhibition

ID ID ID inhibition

(LLC- SEQ

ISIS NO: NO: NO: (HepG2)

Sequence Linkage MK2) ID NO 1 2 6 Primer

Primer NO

Start Start Start Probe

Probe

Site Site Site RTS3905

RTS3750

576816 310 7990 215 GCCTTACTCTAGGACCAAGA sssssssssssssssssss 55 97 20

619420 310 7990 215 GCCTTACTCTAGGACCAAGA soooossssssssssooss 74 97 20

655197 403 8083 308 TTCGAAGGATTTCTCCATTT soooossssssssssooss 14 87 517

655198 406 8086 311 CATTTCGAAGGATTTCTCCA soooossssssssssooss 23 83 518

655199 409 8089 314 CTGCATTTCGAAGGATTTCT soooossssssssssooss 42 97 519

655200 412 8092 317 TCTCTGCATTTCGAAGGATT soooossssssssssooss 21 87 520

655201 415 8095 320 CACTCTCTGCATTTCGAAGG soooossssssssssooss 25 89 521

655202 418 8098 323 CACCACTCTCTGCATTTCGA soooossssssssssooss 54 96 522

655203 420 8100 325 AGCACCACTCTCTGCATTTC soooossssssssssooss 51 90 523 655204 421 8101 326 TAGCACCACTCTCTGCATTT soooossssssssssooss 28 94 524

655205 424 8104 329 CTATAGCACCACTCTCTGCA soooossssssssssooss 17 90 525

655206 427 8107 332 CATCTATAGCACCACTCTCT soooossssssssssooss 15 83 526

655207 433 8113 338 ACTTTACATCTATAGCACCA soooossssssssssooss 20 85 527

655208 436 8116 341 AAAACTTTACATCTATAGCA soooossssssssssooss 25 72 528

655209 443 8123 348 AAGACAAAAAACTTTACATC soooossssssssssooss 10 45 529

655210 444 8124 349 CAAGACAAAAAACTTTACAT soooossssssssssooss 0 56 530

655211 446 8126 351 GACAAGACAAAAAACTTTAC soooossssssssssooss 32 84 531

655212 449 8129 354 TCAGACAAGACAAAAAACTT soooossssssssssooss 10 74 532

655213 451 8131 356 TTTCAGACAAGACAAAAAAC soooossssssssssooss 7 54 533

655214 453 8133 358 CTTTTCAGACAAGACAAAAA soooossssssssssooss 7 57 534

655215 456 8136 361 TCCCTTTTCAGACAAGACAA soooossssssssssooss 32 91 535

655216 459 8139 364 CACTCCCTTTTCAGACAAGA soooossssssssssooss 39 91 536

655217 462 8142 367 AATCACTCCCTTTTCAGACA soooossssssssssooss 41 95 537

655218 465 8145 370 AATAATCACTCCCTTTTCAG soooossssssssssooss 13 63 538

655219 467 8147 372 ACAATAATCACTCCCTTTTC soooossssssssssooss 2 60 539

655220 468 8148 373 AACAATAATCACTCCCTTTT soooossssssssssooss 11 73 540

655221 471 8151 376 TGAAACAATAATCACTCCCT soooossssssssssooss 17 83 541

655222 474 8154 379 TAATGAAACAATAATCACTC soooossssssssssooss 1 79 542

655223 477 8157 382 GATTAATGAAACAATAATCA soooossssssssssooss 12 59 543

655224 482 8162 387 TCAAAGATTAATGAAACAAT soooossssssssssooss 0 9 544

655225 485 8165 390 CCATCAAAGATTAATGAAAC soooossssssssssooss 17 81 545

655226 488 8168 393 TTTCCATCAAAGATTAATGA soooossssssssssooss 14 87 546

655227 491 8171 396 CAGTTTCCATCAAAGATTAA soooossssssssssooss 7 69 547

655228 494 8174 399 TTCCAGTTTCCATCAAAGAT soooossssssssssooss 25 88 548

655229 497 8177 402 CCATTCCAGTTTCCATCAAA soooossssssssssooss 44 90 549

655230 500 8180 405 TCCCCATTCCAGTTTCCATC soooossssssssssooss 48 94 550

655231 503 8183 408 CGATCCCCATTCCAGTTTCC soooossssssssssooss 54 96 551

655232 506 8186 411 CTGCGATCCCCATTCCAGTT soooossssssssssooss 61 96 552

655233 509 8189 414 GTGCTGCGATCCCCATTCCA soooossssssssssooss 63 100 553

655234 512 8192 417 TATGTGCTGCGATCCCCATT soooossssssssssooss 34 94 554

655235 533 8213 438 GGAAGTATAATTGATAGTCC soooossssssssssooss 25 91 555

655236 536 8216 441 TGTGGAAGTATAATTGATAG soooossssssssssooss 13 66 556

655237 539 8219 444 GTCTGTGGAAGTATAATTGA soooossssssssssooss 24 83 557

655238 542 8222 447 TCTGTCTGTGGAAGTATAAT soooossssssssssooss 51 92 558

655239 545 8225 450 AGTTCTGTCTGTGGAAGTAT soooossssssssssooss 42 96 559

655240 548 8228 453 CTAAGTTCTGTCTGTGGAAG soooossssssssssooss 16 88 560

655241 551 8231 456 AAACTAAGTTCTGTCTGTGG soooossssssssssooss 25 93 561

655242 554 8234 459 TAGAAACTAAGTTCTGTCTG soooossssssssssooss 29 94 562

655243 557 8237 462 AGGTAGAAACTAAGTTCTGT soooossssssssssooss 43 85 563

655244 560 8240 465 GGGAGGTAGAAACTAAGTTC soooossssssssssooss 27 77 564

655245 563 8243 468 AGTGGGAGGTAGAAACTAAG soooossssssssssooss 22 77 565

655246 566 8246 471 TGAAGTGGGAGGTAGAAACT soooossssssssssooss 16 45 566 655247 569 8249 474 CTATGAAGTGGGAGGTAGAA soooossssssssssooss 14 60 567

655248 572 8252 477 ACTCTATGAAGTGGGAGGTA soooossssssssssooss 30 81 568

655249 574 8254 479 ACACTCTATGAAGTGGGAGG soooossssssssssooss 34 94 569

655250 575 8255 480 CACACTCTATGAAGTGGGAG soooossssssssssooss 46 98 570

655251 576 8256 481 ACACACTCTATGAAGTGGGA soooossssssssssooss 20 94 571

655252 578 8258 483 ACACACACTCTATGAAGTGG soooossssssssssooss 28 97 572

655253 581 8261 486 TCAACACACACTCTATGAAG soooossssssssssooss 12 62 573

655254 584 8264 489 CTATCAACACACACTCTATG soooossssssssssooss 6 68 574

655255 587 8267 492 AATCTATCAACACACACTCT soooossssssssssooss 16 87 575

655256 590 8270 495 GTTAATCTATCAACACACAC soooossssssssssooss 28 95 576

655257 592 8272 497 GTGTTAATCTATCAACACAC soooossssssssssooss 15 76 577

655258 593 8273 498 TGTGTTAATCTATCAACACA soooossssssssssooss 14 53 578

655259 595 8275 500 TATGTGTTAATCTATCAACA soooossssssssssooss 11 78 579

655260 596 8276 501 ATATGTGTTAATCTATCAAC soooossssssssssooss 25 79 580

655261 599 8279 504 ATTATATGTGTTAATCTATC soooossssssssssooss 11 71 581

655262 602 8282 507 CGGATTATATGTGTTAATCT soooossssssssssooss 21 91 582

655263 605 8285 510 TTCCGGATTATATGTGTTAA soooossssssssssooss 15 88 583

655264 608 8288 513 CCTTTCCGGATTATATGTGT soooossssssssssooss 12 83 584

655265 611 8291 516 CTTCCTTTCCGGATTATATG soooossssssssssooss 1 69 585

655266 614 8294 519 ATTCTTCCTTTCCGGATTAT soooossssssssssooss 15 76 586

655267 617 8297 522 CATATTCTTCCTTTCCGGAT soooossssssssssooss 17 69 587

655268 620 8300 525 ATCCATATTCTTCCTTTCCG soooossssssssssooss 21 67 588

655269 624 8304 529 ATGCATCCATATTCTTCCTT soooossssssssssooss 5 73 589

655270 626 8306 531 TTATGCATCCATATTCTTCC soooossssssssssooss 23 71 590

655271 629 n/a 534 TCCTTATGCATCCATATTCT soooossssssssssooss 15 64 591

655272 632 n/a 537 CTTTCCTTATGCATCCATAT soooossssssssssooss 24 66 592

655273 635 n/a 540 TGTCTTTCCTTATGCATCCA soooossssssssssooss 37 76 593

Table 19

targeting SEQ ID NOs: 1, 2, and 6

%

SEQ SEQ %

SEQ inhibition ID ID inhibition ID (LLC- SEQ

ISIS NO: NO: (HepG2)

NO: 2 Sequence Linkage MK2) ID NO 1 6 Primer

Start Primer NO

Start Start Probe

Site Probe

Site Site RTS3905

TS3750

576816 310 7990 215 GCCTTACTCTAGGACCAAGA sssssssssssssssssss 53 95 20

619253 n/a 1406 n/a TACAGGCTGCGGTTGTTTCC soooossssssssssooss 0 72 97

619293 n/a 1446 n/a CCCGGCCCCTAGCGCGCGAC soooossssssssssooss 0 95 98

619422 n/a 3452 n/a GGTAACTTCAAACTCTTGGG soooossssssssssooss 0 93 382

655329 n/a 2330 n/a AGGACCTCCCTCCTGTTTCT soooossssssssssooss 0 84 594

655330 n/a 2490 n/a AGAAGTAATGCCAGACAGAT soooossssssssssooss 0 75 595

655331 n/a 2901 n/a CTTTGTTTCTCTGAAAGCAA soooossssssssssooss 16 75 596 655332 n/a 3576 n/a GTGGTTGGTCCACTGCTATT soooossssssssssooss 28 94 597

655333 n/a 3801 n/a TTGAGGGAAGCCAAGATTCA soooossssssssssooss 10 77 598

655334 n/a 3975 n a AGAGCTGTACAATTATTTTA soooossssssssssooss 13 90 599

655335 n/a 4725 n a GGTAATGACACTACTGCTGT soooossssssssssooss 27 96 600

655336 n/a 5970 n/a GATCCTAATCCTGTCTATGC soooossssssssssooss 0 70 601

655337 n/a 7382 n/a ACTTGTGGGTTGAATTGTGT soooossssssssssooss 4 66 602

655338 n/a 8310 n a TACCTTATGCATCCATATTC soooossssssssssooss 11 62 603

655339 n/a 8409 n a GATGTTCACTGCATATAATT soooossssssssssooss 31 88 604

655340 n/a 8464 n/a CCAGATGTATTTGTATCTAA soooossssssssssooss 41 96 605

655341 n/a 8523 n/a TAATGTGGAGCTACCATTTC soooossssssssssooss 6 72 606

655342 n/a 8587 n/a GCTCCCAAGAAGAATCCAGG soooossssssssssooss 44 74 607

655343 n/a 8658 n a ACTTACACATAGTAGTAAGC soooossssssssssooss 16 88 608

655344 n/a 8716 n/a AAAGAGACCAAAGGCTACAT soooossssssssssooss 4 82 609

655345 n/a 8785 n/a GGAATTCTCTTGGGAACCAT soooossssssssssooss 9 80 610

619420 310 7990 215 GCCTTACTCTAGGACCAAGA soooossssssssssooss 51 98 20

655274 638 n/a 543 TCTTGTCTTTCCTTATGCAT soooossssssssssooss 0 73 611

655275 641 n/a 546 TTTTCTTGTCTTTCCTTATG soooossssssssssooss 10 61 612

625344 647 9413 552 TGGACATTTTCTTGTCTTTC soooossssssssssooss 32 94 613

655276 650 9416 555 TTCTGGACATTTTCTTGTCT soooossssssssssooss 8 79 614

655277 653 9419 558 ATCTTCTGGACATTTTCTTG soooossssssssssooss 0 60 615

655278 655 9421 560 TAATCTTCTGGACATTTTCT soooossssssssssooss 0 66 616

655279 659 9425 564 AAGATAATCTTCTGGACATT soooossssssssssooss 5 72 617

655280 662 9428 567 TCTAAGATAATCTTCTGGAC soooossssssssssooss 2 81 618

655281 665 9431 570 CCTTCTAAGATAATCTTCTG soooossssssssssooss 0 19 619

655282 668 9434 573 GTGCCTTCTAAGATAATCTT soooossssssssssooss 4 20 620

655283 671 9437 576 TCTGTGCCTTCTAAGATAAT soooossssssssssooss 9 27 621

655284 674 9440 579 CTCTCTGTGCCTTCTAAGAT soooossssssssssooss 0 35 622

655285 677 9443 582 ATTCTCTCTGTGCCTTCTAA soooossssssssssooss 7 40 623

655286 680 9446 585 TCCATTCTCTCTGTGCCTTC soooossssssssssooss 18 65 624

655287 683 9449 588 TCTTCCATTCTCTCTGTGCC soooossssssssssooss 14 67 625

655288 686 9452 591 TGATCTTCCATTCTCTCTGT soooossssssssssooss 7 65 626

655289 691 n/a 596 GACCCTGATCTTCCATTCTC soooossssssssssooss 12 89 627

655290 694 n/a 599 TCTGACCCTGATCTTCCATT soooossssssssssooss 13 81 628

655291 697 n/a 602 TACTCTGACCCTGATCTTCC soooossssssssssooss 0 82 629

655292 700 n/a 605 TAATACTCTGACCCTGATCT soooossssssssssooss 0 72 630

655293 703 n/a 608 GAATAATACTCTGACCCTGA soooossssssssssooss 0 77 631

655294 709 12529 614 GCATTGGAATAATACTCTGA soooossssssssssooss 0 79 632

655295 712 12532 617 TAAGCATTGGAATAATACTC soooossssssssssooss 8 79 633

655296 715 12535 620 CAGTAAGCATTGGAATAATA soooossssssssssooss 0 66 634

655297 718 12538 623 CTCCAGTAAGCATTGGAATA soooossssssssssooss 12 78 635

655298 721 12541 626 CTTCTCCAGTAAGCATTGGA soooossssssssssooss 0 81 636

655299 724 12544 629 TCACTTCTCCAGTAAGCATT soooossssssssssooss 0 70 637

655300 727 12547 632 GAATCACTTCTCCAGTAAGC soooossssssssssooss 0 75 638 655301 730 12550 635 CAGGAATCACTTCTCCAGTA soooossssssssssooss 20 85 639

655302 733 12553 638 TTACAGGAATCACTTCTCCA soooossssssssssooss 0 50 640

655303 736 12556 641 CCATTACAGGAATCACTTCT soooossssssssssooss 0 57 641

655304 744 12564 649 AAGCAGTTCCATTACAGGAA soooossssssssssooss 0 83 642

655305 747 12567 652 TGAAAGCAGTTCCATTACAG soooossssssssssooss 0 55 643

655306 750 12570 655 AGATGAAAGCAGTTCCATTA soooossssssssssooss 0 82 644

655307 753 12573 658 CATAGATGAAAGCAGTTCCA soooossssssssssooss 2 83 645

655308 756 12576 661 TTTCATAGATGAAAGCAGTT soooossssssssssooss 0 59 646

655309 762 12582 667 GTGTGATTTCATAGATGAAA soooossssssssssooss 0 39 647

655310 766 12586 671 CACTGTGTGATTTCATAGAT soooossssssssssooss 10 31 648

655311 769 12589 674 GAACACTGTGTGATTTCATA soooossssssssssooss 0 80 649

655312 772 12592 677 CAGGAACACTGTGTGATTTC soooossssssssssooss 0 53 650

655313 778 12598 683 TTTCTTCAGGAACACTGTGT soooossssssssssooss 0 45 651

655314 781 12601 686 CTATTTCTTCAGGAACACTG soooossssssssssooss 0 56 652

655315 784 n/a 689 TATCTATTTCTTCAGGAACA soooossssssssssooss 0 75 653

655316 787 n/a 692 CTATATCTATTTCTTCAGGA soooossssssssssooss 0 75 654

655317 790 n/a 695 CAGCTATATCTATTTCTTCA soooossssssssssooss 23 89 655

655318 793 n/a 698 TATCAGCTATATCTATTTCT soooossssssssssooss 7 80 656

655319 796 n/a 701 CTGTATCAGCTATATCTATT soooossssssssssooss 34 86 657

655320 799 n/a 704 GTACTGTATCAGCTATATCT soooossssssssssooss 42 88 658

655321 802 n/a 707 TGAGTACTGTATCAGCTATA soooossssssssssooss 31 87 659

655322 805 13356 710 CATTGAGTACTGTATCAGCT soooossssssssssooss 3 84 660

655323 808 13359 713 CATCATTGAGTACTGTATCA soooossssssssssooss 5 88 661

655324 811 13362 716 CATCATCATTGAGTACTGTA soooossssssssssooss 17 90 662

655325 814 13365 719 TATCATCATCATTGAGTACT soooossssssssssooss 2 84 663

655326 817 13368 722 CAATATCATCATCATTGAGT soooossssssssssooss 0 74 664

655327 822 13373 727 GTCACCAATATCATCATCAT soooossssssssssooss 6 78 665

655328 848 13399 753 TTGAGAAGAAAGCCTTCATG soooossssssssssooss 0 42 666

619421 3132 28251 3037 GGGACACTACAAGGTAGTAT soooossssssssssooss 0 94 401

Table 20

targeting SEQ ID NOs: 1, 2, and 6

%

SEQ SEQ %

SEQ inhibition ID ID inhibition ID (LLC- SEQ

ISIS NO: NO: (HepG2)

NO: 2 Sequence Linkage MK2) ID NO 1 6 Primer

Start Primer NO

Start Start Probe

Site Probe

Site Site RTS3905

RTS3750

576816 310 7990 215 GCCTTACTCTAGGACCAAGA sssssssssssssssssss 49 97 20

655346 n a 8861 n/a ACTATACTGAAATGTAAATA soooossssssssssooss 4 7 667

655347 n a 8915 n/a TATCAAACTGGAACACAGGA soooossssssssssooss 16 53 668

655348 n/a 8965 n/a TGGGCAAAAGCCTTTTAAAA soooossssssssssooss 13 63 669

655349 n/a 9017 n/a GCAAACATAGTAAAAAATTA soooossssssssssooss 6 7 670 655350 n/a 9067 n a TTCTCCTGATTTTAAGAGTT soooossssssssssooss 39 90 671

655351 n/a 9117 n a AAGAATGACTTGCACTTTTC soooossssssssssooss 25 100 672

655352 n/a 9173 n/a AAAGATAACTTCACAGAAAA soooossssssssssooss 13 10 673

655353 n/a 9286 n a CTTTCTACTTTAGGGAAAAA soooossssssssssooss 16 64 674

655354 n/a 9336 n a TTTTTCAATAGACATGTTCT soooossssssssssooss 19 81 675

655355 n/a 9403 n a CTTGTCTTTCCTGAGCAAGA soooossssssssssooss 8 54 676

655356 n/a 9455 n/a ACCTGATCTTCCATTCTCTC soooossssssssssooss 22 81 677

655357 n/a 9576 n a CTCCATAAAAGCTCCATTAA soooossssssssssooss 34 52 678

655358 n/a 9640 n a TGTTTACTGATTTAACTCTT soooossssssssssooss 34 83 679

655359 n/a 9696 n a AACAGAAAAAAAAAGGGAGC soooossssssssssooss 18 22 680

655360 n/a 9772 n a GTACCTTAAAGAACATATCA soooossssssssssooss 34 100 681

655361 n/a 9920 n a AAATGTAAATTGCATGAGTC soooossssssssssooss 7 100 682

655362 n/a 9970 n a GGGTAAGAAATATCACTGAC soooossssssssssooss 43 63 683

655363 n/a 10055 n a AACCATGCTTCTCAAACTCT soooossssssssssooss 29 75 684

655364 n/a 10122 n a AAGAACTTCTCTGCTTTACA soooossssssssssooss 13 68 685

655365 n/a 10172 n a AATGGAAGTAAAAGTGAAGA soooossssssssssooss 7 13 686

655366 n/a 10233 n a AACAGCCATGTTTAAAATAT soooossssssssssooss 15 37 687

655367 n/a 10283 n a TTAAAGTATCATCTGTCTCA soooossssssssssooss 34 74 688

655368 n/a 10364 n a CAATTTGGTAAAGGAGATCA soooossssssssssooss 6 48 689

655369 n/a 10418 n a ACACAGAATAACTGTCTCTG soooossssssssssooss 16 64 690

655370 n/a 10491 n a GCTTATTGACCAGCAAATAA soooossssssssssooss 22 69 691

655371 n/a 10615 n a CCCAGTAAAAGCAGAATTTT soooossssssssssooss 24 57 692

655372 n/a 10665 n a ATTAATAGTAGTCAACTTAA soooossssssssssooss 20 10 693

655373 n/a 10730 n a ACTTGAACTTCTCAGCAGTA soooossssssssssooss 25 62 694

655374 n/a 10786 n a AGAAGAGGCTCTAAAAGAAA soooossssssssssooss 7 59 695

655375 n/a 10970 n a AAAGGCAACTCCTCCTTTTC soooossssssssssooss 13 78 696

655376 n/a 11020 n a ACAGTATTGTTCAAAATAAA soooossssssssssooss 18 100 697

655377 n/a 11070 n a CAGATGACAGCTACAACTGA soooossssssssssooss 16 49 698

655378 n/a 11121 n a GAATAATGACTAGATCCGTG soooossssssssssooss 26 88 699

655379 n/a 11171 n a ATAATTATCATGCCTGTTTA soooossssssssssooss 22 80 700

655380 n/a 11221 n a CTTTAGTAACCTCCACAACT soooossssssssssooss 19 26 701

655381 n/a 11313 n a GAATTTAAATGTGATGCTAC soooossssssssssooss 15 49 702

655382 n/a 11385 n a TGTCAGACCCAGGGCCATTT soooossssssssssooss 40 83 703

655383 n/a 11445 n a ACTTATTTTATGAAATGATT soooossssssssssooss 7 3 704

655384 n/a 11513 n a TTTTAGCTAAACATATTTTT soooossssssssssooss 2 1 705

655385 n/a 11591 n a CAGTCTCATCAGTTTTGTGA soooossssssssssooss 33 83 706

655386 n/a 11641 n a TGTAAAGTGTCTCAAATATG soooossssssssssooss 21 39 707

655387 n/a 11711 n a CTTGAAATTGTAATTTTGAA soooossssssssssooss 14 42 708

655388 n/a 11798 n a AATCAAAATCAGCACATATA soooossssssssssooss 8 46 709

655389 n/a 11871 n a ACCAAATAGGTAAGGAAAAC soooossssssssssooss 9 32 710

655390 n/a 11978 n a AAAGATCTCCTTTAAAATTT soooossssssssssooss 11 29 711

655391 n/a 12053 n a CTTTAGAGAGTATGGAATCA soooossssssssssooss 22 71 712

655392 n/a 12334 n a CAAAGCTCACTTTTATTCTT soooossssssssssooss 25 70 713 655393 n/a 12384 n a ACACAGTATCAAACAAGTCT soooossssssssssooss 29 45 714

655394 n/a 12459 n a AAGCTGGGCAATAAAAAATA soooossssssssssooss 0 24 715

655395 n/a 12513 n/a CTGACCCTGCACAATAAAGT soooossssssssssooss 17 0 716

655396 n/a 12604 n a CATCTATTTCTTCAGGAACA soooossssssssssooss 21 74 717

655397 n/a 12681 n a GAATATTAATAATATACATA soooossssssssssooss 0 16 718

655398 n/a 12765 n a AGGATTTTGTGTGTGCTTAT soooossssssssssooss 30 65 719

655399 n/a 12855 n/a TTTTAGGAATTATAAAAGTA soooossssssssssooss 7 61 720

655400 n/a 12924 n a ACACAGTTTTGTTTCAAAAG soooossssssssssooss 13 61 721

655401 n/a 12978 n a GGAAACTAAATTTGTGACTA soooossssssssssooss 21 56 722

655402 n/a 13028 n a CTCTTAACACTCATAGTGTG soooossssssssssooss 13 52 723

655403 n/a 13084 n a GAGACTAACCTAAATGACAA soooossssssssssooss 20 35 724

655404 n/a 13159 n/a CAAATGTGAAAGCTGGTCAA soooossssssssssooss 8 100 725

655405 n/a 13237 n a TAACACACTGCCTTCATTTC soooossssssssssooss 17 32 726

655406 n/a 13337 n a TATCTAAAATGCATCAAAAA soooossssssssssooss 2 6 727

655407 n/a 13400 n a CTTGAGAAGAAAGCCTTCAT soooossssssssssooss 23 42 728

655408 n/a 13471 n/a CCAAATCTTGTCATAGGTGA soooossssssssssooss 42 95 729

655409 n/a 13550 n a TAACACAAATTTAAGCAACA soooossssssssssooss 21 55 730

655410 n/a 13603 n a AAATAGCAAATGGAATAACA soooossssssssssooss 14 55 731

655411 n/a 13662 n a AAACCAGAATCAAGCAAGGG soooossssssssssooss 27 73 732

655412 n/a 13722 n a CATCTACAGTACAACTTAAT soooossssssssssooss 13 100 733

655413 n/a 13773 n/a AGATCAGTATAAATATGAAT soooossssssssssooss 1 43 734

655414 n/a 13823 n a GTTTAAGGGCACAAACTCTT soooossssssssssooss 27 78 735

655415 n/a 13884 n a AGGTGTATAGAGAATTCAGG soooossssssssssooss 43 89 736

655416 n/a 13955 n a TACTCAATGCTTATAACAAC soooossssssssssooss 26 84 737

655417 n/a 14089 n/a GGAACTAACATGTAGGCACT soooossssssssssooss 66 100 738

655418 n/a 14213 n a CATAAAAGTGAATACTTTAT soooossssssssssooss 13 0 739

655419 n/a 14281 n a AGGCTCTTAGGTTAAACACA soooossssssssssooss 16 79 740

655420 n/a 14331 n a GCTGACACTGAACAGATACA soooossssssssssooss 52 84 741

655421 n/a 14392 n/a CATGTAGAGAGATTAAGTGA soooossssssssssooss 27 42 742

655422 n/a 14452 n a ATCATTTAATTAATGTAT T soooossssssssssooss 13 0 743

619420 310 7990 215 GCCTTACTCTAGGACCAAGA soooossssssssssooss 76 98 20

Example 5: Dose-dependent antisense inhibition of human C90RF72 mRNA in LLC-MK2

Antisense oligonucleotides from the study described above exhibiting significant in vitro inhibition of C90RF72 mRNA were selected and tested at various doses in LLC-MK2 cells. ISIS 576816, previously tested in US Application No. 61/714,132, filed October 15, 2012, was used as a benchmark oligonucleotide. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 0.33 μΜ, 1.00 μΜ, 3.00 μΜ, or 9.00 μΜ concentrations of antisense oligonucleotide. After a treatment period of approximately 16 hours, RNA was isolated from the cells and C90RF72 mRNA levels were measured by quantitative real-time PCR. Human C90RF72 primer probe set RTS3750 was used to measure total C90RF72 mRNA levels. C90RF72 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN^®. Results are presented as percent inhibition of C90RF72 levels, relative to untreated control cells.

As shown in Table 21, total C90RF72 mRNA levels were reduced in a dose- dependent manner in antisense oligonucleotide treated cells.

Table 21

Dose-dependent inhibition of total C90RF72 mRNA transcript levels in LLC-MK2 cells

The antisense oligonucleotides were also selected and tested at various doses in HepG2 cells. . ISIS

576816, previously tested in US Application No. 61/714,132, filed October 15, 2012, was used as a benchmark oligonucleotide. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 0.11 μΜ, 0.33 μΜ, 1.00 μΜ, or 3.00 μΜ concentrations of antisense oligonucleotide. After a treatment period of approximately 16 hours, RNA was isolated from the cells and C90RF72 mRNA levels were measured by quantitative real-time PCR. Human C90RF72 primer probe set RTS3750 was used to measure total C90RF72 mRNA levels. C90RF72 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN^®. Results are presented as percent inhibition of C90RF72 levels, relative to untreated control cells. As shown in Table 22, total C90RF72 mRNA levels were reduced in a dose- dependent manner in the antisense oligonucleotide treated cells.

Table 22

Dose-dependent inhibition of total C90RF72 mRNA transcript levels in HepG2 cells

Example 6: Design of mixed backbone 5-8-5 MOE gapmers and deoxy, MOE, and cEt oligonucleotides targeting human C90RF72

Additional antisense oligonucleotides were designed targeting a C90RF72 nucleic acid. The newly designed chimeric antisense oligonucleotides in the Tables below were designed as 5-8-5 MOE gapmers, 5- 10-5 MOE gapmers, or deoxy, MOE, and cEt gapmers.

The 5-8-5 MOE gapmers are 18 nucleosides in length, wherein the central gap segment comprises of eight 2'-deoxynucleosides and is flanked by wing segments on the 5' direction and the 3' direction comprising five nucleosides each. Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment has a 2'-MOE modification. The linkages between the nucleosides are described in the

Linkage column; Ό' indicates a phosphodiester linkage and's' indicates a phosphorothioate linkage. All cytosine residues throughout each gapmer are 5-methylcytosines.

The 5-10-5 MOE gapmers are 20 nucleosides in length, wherein the central gap segment comprises of ten 2'-deoxynucleosides and is flanked by wing segments on the 5' direction and the 3' direction comprising five nucleosides each. Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment has a 2'-MOE modification. The linkages between the nucleosides are described in the Linkage column; Ό' indicates a phosphodiester linkage and's' indicates a phosphorothioate linkage. All cytosine residues throughout each gapmer are 5-methylcytosines.

The deoxy, MOE, and cEt oligonucleotides are 17 nucleosides in length wherein the nucleoside has either a MOE sugar modification, a cEt sugar modification, or a deoxyribose sugar. The 'Chemistry' column describes the sugar modifications of each oligonucleotide; 'k' indicates a cEt nucleoside; d' indicates deoxyribonucleosides, the number indicates the number of deoxyribonucleosides; and 'e' indicates a 2'-MOE nucleoside. The internucleoside linkages throughout each gapmer are either phosphorothioate linkages or phosphodiester linkages. The linkages between the nucleosides are described in the Linkage column; Ό' indicates a phosphodiester linkage and's' indicates a phosphorothioate linkage. All cytosine residues throughout each gapmer are 5-methylcytosines.

"Start site" indicates the 5'-most nucleoside to which the antisense oligonucleotide is targeted in the human gene sequence. "Stop site" indicates the 3 '-most nucleoside to which the antisense oligonucleotide is targeted in the human gene sequence. Each antisense oligonucleotide listed in the Tables 23-29 below is targeted to the human C90RF72 genomic sequence, designated herein as SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000. Table 30 presents a 5-10-5 gapmer that is targeted to C90RF72 mRNA sequence, SEQ ID NO: 1 (GENBANK Accession No. NM_001256054.1).

Table 23

5-8-5 MOE gapmers targeting SEQ ID NO: 2

672594 CTCAGCGAGTACTGTGAG sooosssssssssooss 1339 1356 757

672595 CCTCAGCGAGTACTGTGA sooosssssssssooss 1340 1357 758

672596 CCCTCAGCGAGTACTGTG sooosssssssssooss 1341 1358 759

672597 ACCCTCAGCGAGTACTGT sooosssssssssooss 1342 1359 760

672598 CACCCTCAGCGAGTACTG sooosssssssssooss 1343 1360 761

672599 TCACCCTCAGCGAGTACT sooosssssssssooss 1344 1361 762

672600 TTCACCCTCAGCGAGTAC sooosssssssssooss 1345 1362 763

672601 GTTCACCCTCAGCGAGTA sooosssssssssooss 1346 1363 764

672602 TGTTCACCCTCAGCGAGT sooosssssssssooss 1347 1364 765

672603 TTGTTCACCCTCAGCGAG sooosssssssssooss 1348 1365 766

672604 CTTGTTCACCCTCAGCGA sooosssssssssooss 1349 1366 767

672605 TCTTGTTCACCCTCAGCG sooosssssssssooss 1350 1367 768

672606 TTCTTGTTCACCCTCAGC sooosssssssssooss 1351 1368 769

672607 TTTCTTGTTCACCCTCAG sooosssssssssooss 1352 1369 770

672608 TTTTCTTGTTCACCCTCA sooosssssssssooss 1353 1370 771

672609 CTTTTCTTGTTCACCCTC sooosssssssssooss 1354 1371 772

672610 TCTTTTCTTGTTCACCCT sooosssssssssooss 1355 1372 773

672611 GTCTTTTCTTGTTCACCC sooosssssssssooss 1356 1373 774

672612 GGTCTTTTCTTGTTCACC sooosssssssssooss 1357 1374 775

672613 AGGTCTTTTCTTGTTCAC sooosssssssssooss 1358 1375 776

672614 CAGGTCTTTTCTTGTTCA sooosssssssssooss 1359 1376 777

672615 TCAGGTCTTTTCTTGTTC sooosssssssssooss 1360 1377 778

672616 ATCAGGTCTTTTCTTGTT sooosssssssssooss 1361 1378 779

672617 TATCAGGTCTTTTCTTGT sooosssssssssooss 1362 1379 780

672618 TTATCAGGTCTTTTCTTG sooosssssssssooss 1363 1380 781

672619 TTTATCAGGTCTTTTCTT sooosssssssssooss 1364 1381 782

672620 AATCTTTATCAGGTCTTT sooosssssssssooss 1368 1385 783

672621 TAATCTTTATCAGGTCTT sooosssssssssooss 1369 1386 784

672622 TTAATCTTTATCAGGTCT sooosssssssssooss 1370 1387 785

672623 GTTAATCTTTATCAGGTC sooosssssssssooss 1371 1388 786

672624 GGTTAATCTTTATCAGGT sooosssssssssooss 1372 1389 787

672625 TGGTTAATCTTTATCAGG sooosssssssssooss 1373 1390 788

672626 CTGGTTAATCTTTATCAG sooosssssssssooss 1374 1391 789

672627 TCTGGTTAATCTTTATCA sooosssssssssooss 1375 1392 790

672628 TTCTGGTTAATCTTTATC sooosssssssssooss 1376 1393 791

672629 TCCCTCCTTGTTTTCTTC sooosssssssssooss 1391 1408 792

672630 TTTCCCTCCTTGTTTTCT sooosssssssssooss 1393 1410 793

672631 GTTTCCCTCCTTGTTTTC sooosssssssssooss 1394 1411 794

672632 TGTTTCCCTCCTTGTTTT sooosssssssssooss 1395 1412 795

672633 TTGTTTCCCTCCTTGTTT sooosssssssssooss 1396 1413 796

672634 GTTGTTTCCCTCCTTGTT sooosssssssssooss 1397 1414 797 672635 GGTTGTTTCCCTCCTTGT sooosssssssssooss 1398 1415 798

672636 CGGTTGTTTCCCTCCTTG sooosssssssssooss 1399 1416 799

672637 GCGGTTGTTTCCCTCCTT sooosssssssssooss 1400 1417 800

672638 TGCGGTTGTTTCCCTCCT sooosssssssssooss 1401 1418 801

672639 CTGCGGTTGTTTCCCTCC sooosssssssssooss 1402 1419 802

672640 GCTGCGGTTGTTTCCCTC sooosssssssssooss 1403 1420 803

672641 GGCTGCGGTTGTTTCCCT sooosssssssssooss 1404 1421 804

672642 AGGCTGCGGTTGTTTCCC sooosssssssssooss 1405 1422 805

672643 CAGGCTGCGGTTGTTTCC sooosssssssssooss 1406 1423 806

672644 ACAGGCTGCGGTTGTTTC sooosssssssssooss 1407 1424 807

672645 TACAGGCTGCGGTTGTTT sooosssssssssooss 1408 1425 808

672646 CTACAGGCTGCGGTTGTT sooosssssssssooss 1409 1426 809

672647 GCTACAGGCTGCGGTTGT sooosssssssssooss 1410 1427 810

672648 TGCTACAGGCTGCGGTTG sooosssssssssooss 1411 1428 811

672649 TTGCTACAGGCTGCGGTT sooosssssssssooss 1412 1429 812

672650 CTTGCTACAGGCTGCGGT sooosssssssssooss 1413 1430 813

672651 GCTTGCTACAGGCTGCGG sooosssssssssooss 1414 1431 814

672652 AGCTTGCTACAGGCTGCG sooosssssssssooss 1415 1432 815

672653 GAGCTTGCTACAGGCTGC sooosssssssssooss 1416 1433 816

672654 AGAGCTTGCTACAGGCTG sooosssssssssooss 1417 1434 817

672655 CAGAGCTTGCTACAGGCT sooosssssssssooss 1418 1435 818

672656 CCAGAGCTTGCTACAGGC sooosssssssssooss 1419 1436 819

672657 TCCAGAGCTTGCTACAGG sooosssssssssooss 1420 1437 820

672658 TTCCAGAGCTTGCTACAG sooosssssssssooss 1421 1438 821

672659 GTTCCAGAGCTTGCTACA sooosssssssssooss 1422 1439 822

672660 AGTTCCAGAGCTTGCTAC sooosssssssssooss 1423 1440 823

672661 GAGTTCCAGAGCTTGCTA sooosssssssssooss 1424 1441 824

672662 TGAGTTCCAGAGCTTGCT sooosssssssssooss 1425 1442 825

672663 CTGAGTTCCAGAGCTTGC sooosssssssssooss 1426 1443 826

672664 CCTGAGTTCCAGAGCTTG sooosssssssssooss 1427 1444 827

672665 TCCTGAGTTCCAGAGCTT sooosssssssssooss 1428 1445 828

672666 CTCCTGAGTTCCAGAGCT sooosssssssssooss 1429 1446 829

672667 ACTCCTGAGTTCCAGAGC sooosssssssssooss 1430 1447 830

672668 GACTCCTGAGTTCCAGAG sooosssssssssooss 1431 1448 831

672669 CGACTCCTGAGTTCCAGA sooosssssssssooss 1432 1449 832

672670 GCGACTCCTGAGTTCCAG sooosssssssssooss 1433 1450 833

672671 CGCGACTCCTGAGTTCCA sooosssssssssooss 1434 1451 834

672672 GCGCGACTCCTGAGTTCC sooosssssssssooss 1435 1452 835

672673 CGCGCGACTCCTGAGTTC sooosssssssssooss 1436 1453 836

672674 GCGCGCGACTCCTGAGTT sooosssssssssooss 1437 1454 837

672675 AGCGCGCGACTCCTGAGT sooosssssssssooss 1438 1455 838 672676 TAGCGCGCGACTCCTGAG sooosssssssssooss 1439 1456 839

672677 CTAGCGCGCGACTCCTGA sooosssssssssooss 1440 1457 840

672678 CCTAGCGCGCGACTCCTG sooosssssssssooss 1441 1458 841

672679 CCCTAGCGCGCGACTCCT sooosssssssssooss 1442 1459 842

672680 CCCCTAGCGCGCGACTCC sooosssssssssooss 1443 1460 843

672681 GCCCCTAGCGCGCGACTC sooosssssssssooss 1444 1461 844

672682 GGCCCCTAGCGCGCGACT sooosssssssssooss 1445 1462 845

672683 CGGCCCCTAGCGCGCGAC sooosssssssssooss 1446 1463 846

672684 CCGGCCCCTAGCGCGCGA sooosssssssssooss 1447 1464 847

672685 CCCGGCCCCTAGCGCGCG sooosssssssssooss 1448 1465 848

672686 CCCCGGCCCCTAGCGCGC sooosssssssssooss 1449 1466 849

672687 GCCCCGGCCCCTAGCGCG sooosssssssssooss 1450 1467 850

672688 GGCCCCGGCCCCTAGCGC sooosssssssssooss 1451 1468 851

672689 CGGCCCCGGCCCCTAGCG sooosssssssssooss 1452 1469 852

672690 CCGGCCCCGGCCCCTAGC sooosssssssssooss 1453 1470 853

672691 CCCGGCCCCGGCCCCTAG sooosssssssssooss 1454 1471 854

672692 CCCCGGCCCCGGCCCCTA sooosssssssssooss 1455 1472 855

672693 ACGCCCCGGCCCCGGCCC sooosssssssssooss 1464 1481 856

672694 CACGCCCCGGCCCCGGCC sooosssssssssooss 1465 1482 857

672695 CCACGCCCCGGCCCCGGC sooosssssssssooss 1466 1483 858

672696 ACCACGCCCCGGCCCCGG sooosssssssssooss 1467 1484 859

672697 GACCACGCCCCGGCCCCG sooosssssssssooss 1468 1485 860

672698 CGACCACGCCCCGGCCCC sooosssssssssooss 1469 1486 861

672699 CCGACCACGCCCCGGCCC sooosssssssssooss 1470 1487 862

672700 CCCGACCACGCCCCGGCC sooosssssssssooss 1471 1488 863

672701 CCCCGACCACGCCCCGGC sooosssssssssooss 1472 1489 864

672702 GCCCCGACCACGCCCCGG sooosssssssssooss 1473 1490 865

672703 CGCCCCGACCACGCCCCG sooosssssssssooss 1474 1491 866

672704 CCGCCCCGACCACGCCCC sooosssssssssooss 1475 1492 867

672705 CCCGCCCCGACCACGCCC sooosssssssssooss 1476 1493 868

672706 GCCCGCCCCGACCACGCC sooosssssssssooss 1477 1494 869

672707 GGCCCGCCCCGACCACGC sooosssssssssooss 1478 1495 870

672708 GGGCCCGCCCCGACCACG sooosssssssssooss 1479 1496 871

672709 CGGGCCCGCCCCGACCAC sooosssssssssooss 1480 1497 872

672710 CCGGGCCCGCCCCGACCA sooosssssssssooss 1481 1498 873

672711 CCCGGGCCCGCCCCGACC sooosssssssssooss 1482 1499 874

672712 CCCCGGGCCCGCCCCGAC sooosssssssssooss 1483 1500 875

672713 AGCCCCGCCCCGGGCCCG sooosssssssssooss 1502 1519 876

672714 CAGCCCCGCCCCGGGCCC sooosssssssssooss 1503 1520 877

672715 GCAGCCCCGCCCCGGGCC sooosssssssssooss 1504 1521 878

672716 CGCAGCCCCGCCCCGGGC sooosssssssssooss 1505 1522 879 672717 CCGCAGCCCCGCCCCGGG sooosssssssssooss 1506 1523 880

672718 ACCGCAGCCCCGCCCCGG sooosssssssssooss 1507 1524 881

672719 AACCGCAGCCCCGCCCCG sooosssssssssooss 1508 1525 882

672720 CAACCGCAGCCCCGCCCC sooosssssssssooss 1509 1526 883

672721 GCAACCGCAGCCCCGCCC sooosssssssssooss 1510 1527 884

672722 CGCAACCGCAGCCCCGCC sooosssssssssooss 1511 1528 885

672723 CCGCAACCGCAGCCCCGC sooosssssssssooss 1512 1529 886

672724 ACCGCAACCGCAGCCCCG sooosssssssssooss 1513 1530 887

672725 CACCGCAACCGCAGCCCC sooosssssssssooss 1514 1531 888

672726 GCACCGCAACCGCAGCCC sooosssssssssooss 1515 1532 889

672727 GGCACCGCAACCGCAGCC sooosssssssssooss 1516 1533 890

672728 AGGCACCGCAACCGCAGC sooosssssssssooss 1517 1534 891

672729 CAGGCACCGCAACCGCAG sooosssssssssooss 1518 1535 892

672730 GCAGGCACCGCAACCGCA sooosssssssssooss 1519 1536 893

672731 CGCAGGCACCGCAACCGC sooosssssssssooss 1520 1537 894

672732 GCGCAGGCACCGCAACCG sooosssssssssooss 1521 1538 895

672733 GGCGCAGGCACCGCAACC sooosssssssssooss 1522 1539 896

672734 GGGCGCAGGCACCGCAAC sooosssssssssooss 1523 1540 897

Table 24

Deoxy, MOE and cEt oligonucleotides targeting SEQ ID NO: 2

SEQ SEQ

SEQ

ISIS ID NO: ID NO:

Sequence Chemistry Linkage ID NO 2 Start 2 Stop

NO

Site Site

672735 TGAGAGCAAGTAGTGGG eeekk-d7-kkeee soosssssssssooss 1326 1342 898

672736 GTGAGAGCAAGTAGTGG eeekk-d7-kkeee soosssssssssooss 1327 1343 899

672737 TGTGAGAGCAAGTAGTG eeekk-d7-kkeee soosssssssssooss 1328 1344 900

672738 CTGTGAGAGCAAGTAGT eeekk-d7-kkeee soosssssssssooss 1329 1345 901

672739 ACTGTGAGAGCAAGTAG eeekk-d7-kkeee soosssssssssooss 1330 1346 902

672740 TACTGTGAGAGCAAGTA eeekk-d7-kkeee soosssssssssooss 1331 1347 903

672741 GTACTGTGAGAGCAAGT eeekk-d7-kkeee soosssssssssooss 1332 1348 904

672742 AGTACTGTGAGAGCAAG eeekk-d7-kkeee soosssssssssooss 1333 1349 905

672743 GAGTACTGTGAGAGCAA eeekk-d7-kkeee soosssssssssooss 1334 1350 906

672744 CGAGTACTGTGAGAGCA eeekk-d7-kkeee soosssssssssooss 1335 1351 907

672745 GCGAGTACTGTGAGAGC eeekk-d7-kkeee soosssssssssooss 1336 1352 908

672746 AGCGAGTACTGTGAGAG eeekk-d7-kkeee soosssssssssooss 1337 1353 909

672747 CAGCGAGTACTGTGAGA eeekk-d7-kkeee soosssssssssooss 1338 1354 910

672748 TCAGCGAGTACTGTGAG eeekk-d7-kkeee soosssssssssooss 1339 1355 911

672749 CTCAGCGAGTACTGTGA eeekk-d7-kkeee soosssssssssooss 1340 1356 912

672750 CCTCAGCGAGTACTGTG eeekk-d7-kkeee soosssssssssooss 1341 1357 913

672751 CCCTCAGCGAGTACTGT eeekk-d7-kkeee soosssssssssooss 1342 1358 914 672752 ACCCTCAGCGAGTACTG eeekk-d7-kkeee soosssssssssooss 1343 1359 915

672753 CACCCTCAGCGAGTACT eeekk-d7-kkeee soosssssssssooss 1344 1360 916

672754 TCACCCTCAGCGAGTAC eeekk-d7-kkeee soosssssssssooss 1345 1361 917

672755 TTCACCCTCAGCGAGTA eeekk-d7-kkeee soosssssssssooss 1346 1362 918

672756 GTTCACCCTCAGCGAGT eeekk-d7-kkeee soosssssssssooss 1347 1363 919

672757 TGTTCACCCTCAGCGAG eeekk-d7-kkeee soosssssssssooss 1348 1364 920

672758 TTGTTCACCCTCAGCGA eeekk-d7-kkeee soosssssssssooss 1349 1365 921

672759 CTTGTTCACCCTCAGCG eeekk-d7-kkeee soosssssssssooss 1350 1366 922

672760 TCTTGTTCACCCTCAGC eeekk-d7-kkeee soosssssssssooss 1351 1367 923

672761 TTCTTGTTCACCCTCAG eeekk-d7-kkeee soosssssssssooss 1352 1368 924

672762 TTTCTTGTTCACCCTCA eeekk-d7-kkeee soosssssssssooss 1353 1369 925

672763 TTTTCTTGTTCACCCTC eeekk-d7-kkeee soosssssssssooss 1354 1370 926

672764 CTTTTCTTGTTCACCCT eeekk-d7-kkeee soosssssssssooss 1355 1371 927

672765 TCTTTTCTTGTTCACCC eeekk-d7-kkeee soosssssssssooss 1356 1372 928

672766 GTCTTTTCTTGTTCACC eeekk-d7-kkeee soosssssssssooss 1357 1373 929

672767 GGTCTTTTCTTGTTCAC eeekk-d7-kkeee soosssssssssooss 1358 1374 930

672768 AGGTCTTTTCTTGTTCA eeekk-d7-kkeee soosssssssssooss 1359 1375 931

672769 CAGGTCTTTTCTTGTTC eeekk-d7-kkeee soosssssssssooss 1360 1376 932

672770 TCAGGTCTTTTCTTGTT eeekk-d7-kkeee soosssssssssooss 1361 1377 933

672771 ATCAGGTCTTTTCTTGT eeekk-d7-kkeee soosssssssssooss 1362 1378 934

672772 TATCAGGTCTTTTCTTG eeekk-d7-kkeee soosssssssssooss 1363 1379 935

672773 TTATCAGGTCTTTTCTT eeekk-d7-kkeee soosssssssssooss 1364 1380 936

672774 ATCTTTATCAGGTCTTT eeekk-d7-kkeee soosssssssssooss 1368 1384 937

672775 AATCTTTATCAGGTCTT eeekk-d7-kkeee soosssssssssooss 1369 1385 938

672776 TAATCTTTATCAGGTCT eeekk-d7-kkeee soosssssssssooss 1370 1386 939

672777 TTAATCTTTATCAGGTC eeekk-d7-kkeee soosssssssssooss 1371 1387 940

672778 GTTAATCTTTATCAGGT eeekk-d7-kkeee soosssssssssooss 1372 1388 941

672779 GGTTAATCTTTATCAGG eeekk-d7-kkeee soosssssssssooss 1373 1389 942

672780 TGGTTAATCTTTATCAG eeekk-d7-kkeee soosssssssssooss 1374 1390 943

672781 CTGGTTAATCTTTATCA eeekk-d7-kkeee soosssssssssooss 1375 1391 944

672782 TCTGGTTAATCTTTATC eeekk-d7-kkeee soosssssssssooss 1376 1392 945

672783 CCCTCCTTGTTTTCTTC eeekk-d7-kkeee soosssssssssooss 1391 1407 946

672784 TCCCTCCTTGTTTTCTT eeekk-d7-kkeee soosssssssssooss 1392 1408 947

672785 TTCCCTCCTTGTTTTCT eeekk-d7-kkeee soosssssssssooss 1393 1409 948

672786 TTTCCCTCCTTGTTTTC eeekk-d7-kkeee soosssssssssooss 1394 1410 949

672787 GTTTCCCTCCTTGTTTT eeekk-d7-kkeee soosssssssssooss 1395 1411 950

672788 TGTTTCCCTCCTTGTTT eeekk-d7-kkeee soosssssssssooss 1396 1412 951

672789 TTGTTTCCCTCCTTGTT eeekk-d7-kkeee soosssssssssooss 1397 1413 952

672790 GGTTGTTTCCCTCCTTG eeekk-d7-kkeee soosssssssssooss 1399 1415 953

672791 CGGTTGTTTCCCTCCTT eeekk-d7-kkeee soosssssssssooss 1400 1416 954

672792 GCGGTTGTTTCCCTCCT eeekk-d7-kkeee soosssssssssooss 1401 1417 955 672793 TGCGGTTGTTTCCCTCC eeekk-d7-kkeee soosssssssssooss 1402 1418 956

672794 CTGCGGTTGTTTCCCTC eeekk-d7-kkeee soosssssssssooss 1403 1419 957

672795 GCTGCGGTTGTTTCCCT eeekk-d7-kkeee soosssssssssooss 1404 1420 958

672796 GGCTGCGGTTGTTTCCC eeekk-d7-kkeee soosssssssssooss 1405 1421 959

672797 AGGCTGCGGTTGTTTCC eeekk-d7-kkeee soosssssssssooss 1406 1422 960

672798 CAGGCTGCGGTTGTTTC eeekk-d7-kkeee soosssssssssooss 1407 1423 961

672799 ACAGGCTGCGGTTGTTT eeekk-d7-kkeee soosssssssssooss 1408 1424 962

672800 TACAGGCTGCGGTTGTT eeekk-d7-kkeee soosssssssssooss 1409 1425 963

672801 CTACAGGCTGCGGTTGT eeekk-d7-kkeee soosssssssssooss 1410 1426 964

672802 GCTACAGGCTGCGGTTG eeekk-d7-kkeee soosssssssssooss 1411 1427 965

672803 TGCTACAGGCTGCGGTT eeekk-d7-kkeee soosssssssssooss 1412 1428 966

672804 TTGCTACAGGCTGCGGT eeekk-d7-kkeee soosssssssssooss 1413 1429 967

672805 CTTGCTACAGGCTGCGG eeekk-d7-kkeee soosssssssssooss 1414 1430 968

672806 GCTTGCTACAGGCTGCG eeekk-d7-kkeee soosssssssssooss 1415 1431 969

672807 AGCTTGCTACAGGCTGC eeekk-d7-kkeee soosssssssssooss 1416 1432 970

672808 GAGCTTGCTACAGGCTG eeekk-d7-kkeee soosssssssssooss 1417 1433 971

672809 AGAGCTTGCTACAGGCT eeekk-d7-kkeee soosssssssssooss 1418 1434 972

672810 CAGAGCTTGCTACAGGC eeekk-d7-kkeee soosssssssssooss 1419 1435 973

672811 CCAGAGCTTGCTACAGG eeekk-d7-kkeee soosssssssssooss 1420 1436 974

672812 TCCAGAGCTTGCTACAG eeekk-d7-kkeee soosssssssssooss 1421 1437 975

672813 TTCCAGAGCTTGCTACA eeekk-d7-kkeee soosssssssssooss 1422 1438 976

672814 GTTCCAGAGCTTGCTAC eeekk-d7-kkeee soosssssssssooss 1423 1439 977

672815 AGTTCCAGAGCTTGCTA eeekk-d7-kkeee soosssssssssooss 1424 1440 978

672816 GAGTTCCAGAGCTTGCT eeekk-d7-kkeee soosssssssssooss 1425 1441 979

672817 TGAGTTCCAGAGCTTGC eeekk-d7-kkeee soosssssssssooss 1426 1442 980

672818 CTGAGTTCCAGAGCTTG eeekk-d7-kkeee soosssssssssooss 1427 1443 981

672819 CCTGAGTTCCAGAGCTT eeekk-d7-kkeee soosssssssssooss 1428 1444 982

672820 TCCTGAGTTCCAGAGCT eeekk-d7-kkeee soosssssssssooss 1429 1445 983

672821 CTCCTGAGTTCCAGAGC eeekk-d7-kkeee soosssssssssooss 1430 1446 984

672822 ACTCCTGAGTTCCAGAG eeekk-d7-kkeee soosssssssssooss 1431 1447 985

672823 GACTCCTGAGTTCCAGA eeekk-d7-kkeee soosssssssssooss 1432 1448 986

672824 CGACTCCTGAGTTCCAG eeekk-d7-kkeee soosssssssssooss 1433 1449 987

672825 GCGACTCCTGAGTTCCA eeekk-d7-kkeee soosssssssssooss 1434 1450 988

672826 CGCGACTCCTGAGTTCC eeekk-d7-kkeee soosssssssssooss 1435 1451 989

672827 GCGCGACTCCTGAGTTC eeekk-d7-kkeee soosssssssssooss 1436 1452 990

672828 CGCGCGACTCCTGAGTT eeekk-d7-kkeee soosssssssssooss 1437 1453 991

672829 GCGCGCGACTCCTGAGT eeekk-d7-kkeee soosssssssssooss 1438 1454 992

672830 AGCGCGCGACTCCTGAG eeekk-d7-kkeee soosssssssssooss 1439 1455 993

672831 TAGCGCGCGACTCCTGA eeekk-d7-kkeee soosssssssssooss 1440 1456 994

672832 CTAGCGCGCGACTCCTG eeekk-d7-kkeee soosssssssssooss 1441 1457 995

672833 CCTAGCGCGCGACTCCT eeekk-d7-kkeee soosssssssssooss 1442 1458 996 672834 CCCTAGCGCGCGACTCC eeekk-d7-kkeee soosssssssssooss 1443 1459 997

672835 CCCCTAGCGCGCGACTC eeekk-d7-kkeee soosssssssssooss 1444 1460 998

672836 GCCCCTAGCGCGCGACT eeekk-d7-kkeee soosssssssssooss 1445 1461 999

672837 GGCCCCTAGCGCGCGAC eeekk-d7-kkeee soosssssssssooss 1446 1462 1000

672838 CGGCCCCTAGCGCGCGA eeekk-d7-kkeee soosssssssssooss 1447 1463 1001

672839 CCGGCCCCTAGCGCGCG eeekk-d7-kkeee soosssssssssooss 1448 1464 1002

672840 CCCGGCCCCTAGCGCGC eeekk-d7-kkeee soosssssssssooss 1449 1465 1003

672841 CCCCGGCCCCTAGCGCG eeekk-d7-kkeee soosssssssssooss 1450 1466 1004

672842 GCCCCGGCCCCTAGCGC eeekk-d7-kkeee soosssssssssooss 1451 1467 1005

672843 GGCCCCGGCCCCTAGCG eeekk-d7-kkeee soosssssssssooss 1452 1468 1006

672844 CGGCCCCGGCCCCTAGC eeekk-d7-kkeee soosssssssssooss 1453 1469 1007

672845 CCGGCCCCGGCCCCTAG eeekk-d7-kkeee soosssssssssooss 1454 1470 1008

672846 CCCGGCCCCGGCCCCTA eeekk-d7-kkeee soosssssssssooss 1455 1471 1009

672847 ACGCCCCGGCCCCGGCC eeekk-d7-kkeee soosssssssssooss 1465 1481 1010

672848 CACGCCCCGGCCCCGGC eeekk-d7-kkeee soosssssssssooss 1466 1482 1011

672849 CCACGCCCCGGCCCCGG eeekk-d7-kkeee soosssssssssooss 1467 1483 1012

672850 ACCACGCCCCGGCCCCG eeekk-d7-kkeee soosssssssssooss 1468 1484 1013

672851 GACCACGCCCCGGCCCC eeekk-d7-kkeee soosssssssssooss 1469 1485 1014

672852 CGACCACGCCCCGGCCC eeekk-d7-kkeee soosssssssssooss 1470 1486 1015

672853 CCGACCACGCCCCGGCC eeekk-d7-kkeee soosssssssssooss 1471 1487 1016

672854 CCCGACCACGCCCCGGC eeekk-d7-kkeee soosssssssssooss 1472 1488 1017

672855 CCCCGACCACGCCCCGG eeekk-d7-kkeee soosssssssssooss 1473 1489 1018

672856 GCCCCGACCACGCCCCG eeekk-d7-kkeee soosssssssssooss 1474 1490 1019

672857 CGCCCCGACCACGCCCC eeekk-d7-kkeee soosssssssssooss 1475 1491 1020

672858 CCGCCCCGACCACGCCC eeekk-d7-kkeee soosssssssssooss 1476 1492 1021

672859 CCCGCCCCGACCACGCC eeekk-d7-kkeee soosssssssssooss 1477 1493 1022

672860 GCCCGCCCCGACCACGC eeekk-d7-kkeee soosssssssssooss 1478 1494 1023

672861 GGCCCGCCCCGACCACG eeekk-d7-kkeee soosssssssssooss 1479 1495 1024

672862 GGGCCCGCCCCGACCAC eeekk-d7-kkeee soosssssssssooss 1480 1496 1025

672863 CGGGCCCGCCCCGACCA eeekk-d7-kkeee soosssssssssooss 1481 1497 1026

672864 CCGGGCCCGCCCCGACC eeekk-d7-kkeee soosssssssssooss 1482 1498 1027

672865 CCCGGGCCCGCCCCGAC eeekk-d7-kkeee soosssssssssooss 1483 1499 1028

672866 GCAGCCCCGCCCCGGGC eeekk-d7-kkeee soosssssssssooss 1505 1521 1029

672867 CGCAGCCCCGCCCCGGG eeekk-d7-kkeee soosssssssssooss 1506 1522 1030

672868 CCGCAGCCCCGCCCCGG eeekk-d7-kkeee soosssssssssooss 1507 1523 1031

672869 ACCGCAGCCCCGCCCCG eeekk-d7-kkeee soosssssssssooss 1508 1524 1032

672870 AACCGCAGCCCCGCCCC eeekk-d7-kkeee soosssssssssooss 1509 1525 1033

672871 CAACCGCAGCCCCGCCC eeekk-d7-kkeee soosssssssssooss 1510 1526 1034

672872 GCAACCGCAGCCCCGCC eeekk-d7-kkeee soosssssssssooss 1511 1527 1035

672873 CGCAACCGCAGCCCCGC eeekk-d7-kkeee soosssssssssooss 1512 1528 1036

672874 CCGCAACCGCAGCCCCG eeekk-d7-kkeee soosssssssssooss 1513 1529 1037 672875 ACCGCAACCGCAGCCCC eeekk-d7-kkeee soosssssssssooss 1514 1530 1038

672876 CACCGCAACCGCAGCCC eeekk-d7-kkeee soosssssssssooss 1515 1531 1039

672877 GCACCGCAACCGCAGCC eeekk-d7-kkeee soosssssssssooss 1516 1532 1040

672878 GGCACCGCAACCGCAGC eeekk-d7-kkeee soosssssssssooss 1517 1533 1041

672879 AGGCACCGCAACCGCAG eeekk-d7-kkeee soosssssssssooss 1518 1534 1042

672880 CAGGCACCGCAACCGCA eeekk-d7-kkeee soosssssssssooss 1519 1535 1043

672881 GCAGGCACCGCAACCGC eeekk-d7-kkeee soosssssssssooss 1520 1536 1044

672882 CGCAGGCACCGCAACCG eeekk-d7-kkeee soosssssssssooss 1521 1537 1045

672883 GCGCAGGCACCGCAACC eeekk-d7-kkeee soosssssssssooss 1522 1538 1046

672884 GGCGCAGGCACCGCAAC eeekk-d7-kkeee soosssssssssooss 1523 1539 1047

Table 25

Deoxy, MOE and cEt oligonucleotides targeting SEQ ID NO: 2

672909 CTTGTTCACCCTCAGCG eekk-d8-kkeee soosssssssssooss 1350 1366 922

672910 TCTTGTTCACCCTCAGC eekk-d8-kkeee soosssssssssooss 1351 1367 923

672911 TTCTTGTTCACCCTCAG eekk-d8-kkeee soosssssssssooss 1352 1368 924

672912 TTTCTTGTTCACCCTCA eekk-d8-kkeee soosssssssssooss 1353 1369 925

672913 TTTTCTTGTTCACCCTC eekk-d8-kkeee soosssssssssooss 1354 1370 926

672914 CTTTTCTTGTTCACCCT eekk-d8-kkeee soosssssssssooss 1355 1371 927

672915 TCTTTTCTTGTTCACCC eekk-d8-kkeee soosssssssssooss 1356 1372 928

672916 GTCTTTTCTTGTTCACC eekk-d8-kkeee soosssssssssooss 1357 1373 929

672917 GGTCTTTTCTTGTTCAC eekk-d8-kkeee soosssssssssooss 1358 1374 930

672918 AGGTCTTTTCTTGTTCA eekk-d8-kkeee soosssssssssooss 1359 1375 931

672919 CAGGTCTTTTCTTGTTC eekk-d8-kkeee soosssssssssooss 1360 1376 932

672920 TCAGGTCTTTTCTTGTT eekk-d8-kkeee soosssssssssooss 1361 1377 933

672921 ATCAGGTCTTTTCTTGT eekk-d8-kkeee soosssssssssooss 1362 1378 934

672922 TATCAGGTCTTTTCTTG eekk-d8-kkeee soosssssssssooss 1363 1379 935

672923 TTATCAGGTCTTTTCTT eekk-d8-kkeee soosssssssssooss 1364 1380 936

672924 ATCTTTATCAGGTCTTT eekk-d8-kkeee soosssssssssooss 1368 1384 937

672925 AATCTTTATCAGGTCTT eekk-d8-kkeee soosssssssssooss 1369 1385 938

672926 TAATCTTTATCAGGTCT eekk-d8-kkeee soosssssssssooss 1370 1386 939

672927 TTAATCTTTATCAGGTC eekk-d8-kkeee soosssssssssooss 1371 1387 940

672928 GTTAATCTTTATCAGGT eekk-d8-kkeee soosssssssssooss 1372 1388 941

672929 GGTTAATCTTTATCAGG eekk-d8-kkeee soosssssssssooss 1373 1389 942

672930 TGGTTAATCTTTATCAG eekk-d8-kkeee soosssssssssooss 1374 1390 943

672931 CTGGTTAATCTTTATCA eekk-d8-kkeee soosssssssssooss 1375 1391 944

672932 TCTGGTTAATCTTTATC eekk-d8-kkeee soosssssssssooss 1376 1392 945

672933 CCCTCCTTGTTTTCTTC eekk-d8-kkeee soosssssssssooss 1391 1407 946

672934 TCCCTCCTTGTTTTCTT eekk-d8-kkeee soosssssssssooss 1392 1408 947

672935 TTCCCTCCTTGTTTTCT eekk-d8-kkeee soosssssssssooss 1393 1409 948

672936 TTTCCCTCCTTGTTTTC eekk-d8-kkeee soosssssssssooss 1394 1410 949

672937 GTTTCCCTCCTTGTTTT eekk-d8-kkeee soosssssssssooss 1395 1411 950

672938 TGTTTCCCTCCTTGTTT eekk-d8-kkeee soosssssssssooss 1396 1412 951

672939 TTGTTTCCCTCCTTGTT eekk-d8-kkeee soosssssssssooss 1397 1413 952

672940 GGTTGTTTCCCTCCTTG eekk-d8-kkeee soosssssssssooss 1399 1415 953

672941 CGGTTGTTTCCCTCCTT eekk-d8-kkeee soosssssssssooss 1400 1416 954

672942 GCGGTTGTTTCCCTCCT eekk-d8-kkeee soosssssssssooss 1401 1417 955

672943 TGCGGTTGTTTCCCTCC eekk-d8-kkeee soosssssssssooss 1402 1418 956

672944 CTGCGGTTGTTTCCCTC eekk-d8-kkeee soosssssssssooss 1403 1419 957

672945 GCTGCGGTTGTTTCCCT eekk-d8-kkeee soosssssssssooss 1404 1420 958

672946 GGCTGCGGTTGTTTCCC eekk-d8-kkeee soosssssssssooss 1405 1421 959

672947 AGGCTGCGGTTGTTTCC eekk-d8-kkeee soosssssssssooss 1406 1422 960

672948 CAGGCTGCGGTTGTTTC eekk-d8-kkeee soosssssssssooss 1407 1423 961

672949 ACAGGCTGCGGTTGTTT eekk-d8-kkeee soosssssssssooss 1408 1424 962 672950 TACAGGCTGCGGTTGTT eekk-d8-kkeee soosssssssssooss 1409 1425 963

672951 CTACAGGCTGCGGTTGT eekk-d8-kkeee soosssssssssooss 1410 1426 964

672952 GCTACAGGCTGCGGTTG eekk-d8-kkeee soosssssssssooss 1411 1427 965

672953 TGCTACAGGCTGCGGTT eekk-d8-kkeee soosssssssssooss 1412 1428 966

672954 TTGCTACAGGCTGCGGT eekk-d8-kkeee soosssssssssooss 1413 1429 967

672955 CTTGCTACAGGCTGCGG eekk-d8-kkeee soosssssssssooss 1414 1430 968

672956 GCTTGCTACAGGCTGCG eekk-d8-kkeee soosssssssssooss 1415 1431 969

672957 AGCTTGCTACAGGCTGC eekk-d8-kkeee soosssssssssooss 1416 1432 970

672958 GAGCTTGCTACAGGCTG eekk-d8-kkeee soosssssssssooss 1417 1433 971

672959 AGAGCTTGCTACAGGCT eekk-d8-kkeee soosssssssssooss 1418 1434 972

672960 CAGAGCTTGCTACAGGC eekk-d8-kkeee soosssssssssooss 1419 1435 973

672961 CCAGAGCTTGCTACAGG eekk-d8-kkeee soosssssssssooss 1420 1436 974

672962 TCCAGAGCTTGCTACAG eekk-d8-kkeee soosssssssssooss 1421 1437 975

672963 TTCCAGAGCTTGCTACA eekk-d8-kkeee soosssssssssooss 1422 1438 976

672964 GTTCCAGAGCTTGCTAC eekk-d8-kkeee soosssssssssooss 1423 1439 977

672965 AGTTCCAGAGCTTGCTA eekk-d8-kkeee soosssssssssooss 1424 1440 978

672966 GAGTTCCAGAGCTTGCT eekk-d8-kkeee soosssssssssooss 1425 1441 979

672967 TGAGTTCCAGAGCTTGC eekk-d8-kkeee soosssssssssooss 1426 1442 980

672968 CTGAGTTCCAGAGCTTG eekk-d8-kkeee soosssssssssooss 1427 1443 981

672969 CCTGAGTTCCAGAGCTT eekk-d8-kkeee soosssssssssooss 1428 1444 982

672970 TCCTGAGTTCCAGAGCT eekk-d8-kkeee soosssssssssooss 1429 1445 983

672971 CTCCTGAGTTCCAGAGC eekk-d8-kkeee soosssssssssooss 1430 1446 984

672972 ACTCCTGAGTTCCAGAG eekk-d8-kkeee soosssssssssooss 1431 1447 985

672973 GACTCCTGAGTTCCAGA eekk-d8-kkeee soosssssssssooss 1432 1448 986

672974 CGACTCCTGAGTTCCAG eekk-d8-kkeee soosssssssssooss 1433 1449 987

672975 GCGACTCCTGAGTTCCA eekk-d8-kkeee soosssssssssooss 1434 1450 988

672976 CGCGACTCCTGAGTTCC eekk-d8-kkeee soosssssssssooss 1435 1451 989

672977 GCGCGACTCCTGAGTTC eekk-d8-kkeee soosssssssssooss 1436 1452 990

672978 CGCGCGACTCCTGAGTT eekk-d8-kkeee soosssssssssooss 1437 1453 991

672979 GCGCGCGACTCCTGAGT eekk-d8-kkeee soosssssssssooss 1438 1454 992

672980 AGCGCGCGACTCCTGAG eekk-d8-kkeee soosssssssssooss 1439 1455 993

672981 TAGCGCGCGACTCCTGA eekk-d8-kkeee soosssssssssooss 1440 1456 994

672982 CTAGCGCGCGACTCCTG eekk-d8-kkeee soosssssssssooss 1441 1457 995

672983 CCTAGCGCGCGACTCCT eekk-d8-kkeee soosssssssssooss 1442 1458 996

672984 CCCTAGCGCGCGACTCC eekk-d8-kkeee soosssssssssooss 1443 1459 997

672985 CCCCTAGCGCGCGACTC eekk-d8-kkeee soosssssssssooss 1444 1460 998

672986 GCCCCTAGCGCGCGACT eekk-d8-kkeee soosssssssssooss 1445 1461 999

672987 GGCCCCTAGCGCGCGAC eekk-d8-kkeee soosssssssssooss 1446 1462 1000

672988 CGGCCCCTAGCGCGCGA eekk-d8-kkeee soosssssssssooss 1447 1463 1001

672989 CCGGCCCCTAGCGCGCG eekk-d8-kkeee soosssssssssooss 1448 1464 1002

672990 CCCGGCCCCTAGCGCGC eekk-d8-kkeee soosssssssssooss 1449 1465 1003 672991 CCCCGGCCCCTAGCGCG eekk-d8-kkeee soosssssssssooss 1450 1466 1004

672992 GCCCCGGCCCCTAGCGC eekk-d8-kkeee soosssssssssooss 1451 1467 1005

672993 GGCCCCGGCCCCTAGCG eekk-d8-kkeee soosssssssssooss 1452 1468 1006

672994 CGGCCCCGGCCCCTAGC eekk-d8-kkeee soosssssssssooss 1453 1469 1007

672995 CCGGCCCCGGCCCCTAG eekk-d8-kkeee soosssssssssooss 1454 1470 1008

672996 CCCGGCCCCGGCCCCTA eekk-d8-kkeee soosssssssssooss 1455 1471 1009

672997 ACGCCCCGGCCCCGGCC eekk-d8-kkeee soosssssssssooss 1465 1481 1010

672998 CACGCCCCGGCCCCGGC eekk-d8-kkeee soosssssssssooss 1466 1482 1011

672999 CCACGCCCCGGCCCCGG eekk-d8-kkeee soosssssssssooss 1467 1483 1012

673000 ACCACGCCCCGGCCCCG eekk-d8-kkeee soosssssssssooss 1468 1484 1013

673001 GACCACGCCCCGGCCCC eekk-d8-kkeee soosssssssssooss 1469 1485 1014

673002 CGACCACGCCCCGGCCC eekk-d8-kkeee soosssssssssooss 1470 1486 1015

673003 CCGACCACGCCCCGGCC eekk-d8-kkeee soosssssssssooss 1471 1487 1016

673004 CCCGACCACGCCCCGGC eekk-d8-kkeee soosssssssssooss 1472 1488 1017

673005 CCCCGACCACGCCCCGG eekk-d8-kkeee soosssssssssooss 1473 1489 1018

673006 GCCCCGACCACGCCCCG eekk-d8-kkeee soosssssssssooss 1474 1490 1019

673007 CGCCCCGACCACGCCCC eekk-d8-kkeee soosssssssssooss 1475 1491 1020

673008 CCGCCCCGACCACGCCC eekk-d8-kkeee soosssssssssooss 1476 1492 1021

673009 CCCGCCCCGACCACGCC eekk-d8-kkeee soosssssssssooss 1477 1493 1022

673010 GCCCGCCCCGACCACGC eekk-d8-kkeee soosssssssssooss 1478 1494 1023

673011 GGCCCGCCCCGACCACG eekk-d8-kkeee soosssssssssooss 1479 1495 1024

673012 GGGCCCGCCCCGACCAC eekk-d8-kkeee soosssssssssooss 1480 1496 1025

673013 CGGGCCCGCCCCGACCA eekk-d8-kkeee soosssssssssooss 1481 1497 1026

673014 CCGGGCCCGCCCCGACC eekk-d8-kkeee soosssssssssooss 1482 1498 1027

673015 CCCGGGCCCGCCCCGAC eekk-d8-kkeee soosssssssssooss 1483 1499 1028

673016 GCAGCCCCGCCCCGGGC eekk-d8-kkeee soosssssssssooss 1505 1521 1029

673017 CGCAGCCCCGCCCCGGG eekk-d8-kkeee soosssssssssooss 1506 1522 1030

673018 CCGCAGCCCCGCCCCGG eekk-d8-kkeee soosssssssssooss 1507 1523 1031

673019 ACCGCAGCCCCGCCCCG eekk-d8-kkeee soosssssssssooss 1508 1524 1032

673020 AACCGCAGCCCCGCCCC eekk-d8-kkeee soosssssssssooss 1509 1525 1033

673021 CAACCGCAGCCCCGCCC eekk-d8-kkeee soosssssssssooss 1510 1526 1034

673022 GCAACCGCAGCCCCGCC eekk-d8-kkeee soosssssssssooss 1511 1527 1035

673023 CGCAACCGCAGCCCCGC eekk-d8-kkeee soosssssssssooss 1512 1528 1036

673024 CCGCAACCGCAGCCCCG eekk-d8-kkeee soosssssssssooss 1513 1529 1037

673025 ACCGCAACCGCAGCCCC eekk-d8-kkeee soosssssssssooss 1514 1530 1038

673026 CACCGCAACCGCAGCCC eekk-d8-kkeee soosssssssssooss 1515 1531 1039

673027 GCACCGCAACCGCAGCC eekk-d8-kkeee soosssssssssooss 1516 1532 1040

673028 GGCACCGCAACCGCAGC eekk-d8-kkeee soosssssssssooss 1517 1533 1041

673029 AGGCACCGCAACCGCAG eekk-d8-kkeee soosssssssssooss 1518 1534 1042

673030 CAGGCACCGCAACCGCA eekk-d8-kkeee soosssssssssooss 1519 1535 1043

673031 GCAGGCACCGCAACCGC eekk-d8-kkeee soosssssssssooss 1520 1536 1044 673032 CGCAGGCACCGCAACCG eekk-d8-kkeee soosssssssssooss 1521 1537 1045

673033 GCGCAGGCACCGCAACC eekk-d8-kkeee soosssssssssooss 1522 1538 1046

673034 GGCGCAGGCACCGCAAC eekk-d8-kkeee soosssssssssooss 1523 1539 1047

Table 26

Deoxy, MOE and cEt oligonucleotides targeting SEQ ID NO: 2

673067 GGTCTTTTCTTGTTCAC ek-d8-ekekeee sosssssssssoooss 1358 1374 930

673068 AGGTCTTTTCTTGTTCA ek-d8-ekekeee sosssssssssoooss 1359 1375 931

673069 CAGGTCTTTTCTTGTTC ek-d8-ekekeee sosssssssssoooss 1360 1376 932

673070 TCAGGTCTTTTCTTGTT ek-d8-ekekeee sosssssssssoooss 1361 1377 933

673071 ATCAGGTCTTTTCTTGT ek-d8-ekekeee sosssssssssoooss 1362 1378 934

673072 TATCAGGTCTTTTCTTG ek-d8-ekekeee sosssssssssoooss 1363 1379 935

673073 TTATCAGGTCTTTTCTT ek-d8-ekekeee sosssssssssoooss 1364 1380 936

673074 ATCTTTATCAGGTCTTT ek-d8-ekekeee sosssssssssoooss 1368 1384 937

673075 AATCTTTATCAGGTCTT ek-d8-ekekeee sosssssssssoooss 1369 1385 938

673076 TAATCTTTATCAGGTCT ek-d8-ekekeee sosssssssssoooss 1370 1386 939

673077 TTAATCTTTATCAGGTC ek-d8-ekekeee sosssssssssoooss 1371 1387 940

673078 GTTAATCTTTATCAGGT ek-d8-ekekeee sosssssssssoooss 1372 1388 941

673079 GGTTAATCTTTATCAGG ek-d8-ekekeee sosssssssssoooss 1373 1389 942

673080 TGGTTAATCTTTATCAG ek-d8-ekekeee sosssssssssoooss 1374 1390 943

673081 CTGGTTAATCTTTATCA ek-d8-ekekeee sosssssssssoooss 1375 1391 944

673082 TCTGGTTAATCTTTATC ek-d8-ekekeee sosssssssssoooss 1376 1392 945

673083 CCCTCCTTGTTTTCTTC ek-d8-ekekeee sosssssssssoooss 1391 1407 946

673084 TCCCTCCTTGTTTTCTT ek-d8-ekekeee sosssssssssoooss 1392 1408 947

673085 TTCCCTCCTTGTTTTCT ek-d8-ekekeee sosssssssssoooss 1393 1409 948

673086 TTTCCCTCCTTGTTTTC ek-d8-ekekeee sosssssssssoooss 1394 1410 949

673087 GTTTCCCTCCTTGTTTT ek-d8-ekekeee sosssssssssoooss 1395 1411 950

673088 TGTTTCCCTCCTTGTTT ek-d8-ekekeee sosssssssssoooss 1396 1412 951

673089 TTGTTTCCCTCCTTGTT ek-d8-ekekeee sosssssssssoooss 1397 1413 952

673090 GGTTGTTTCCCTCCTTG ek-d8-ekekeee sosssssssssoooss 1399 1415 953

673091 CGGTTGTTTCCCTCCTT ek-d8-ekekeee sosssssssssoooss 1400 1416 954

673092 GCGGTTGTTTCCCTCCT ek-d8-ekekeee sosssssssssoooss 1401 1417 955

673093 TGCGGTTGTTTCCCTCC ek-d8-ekekeee sosssssssssoooss 1402 1418 956

673094 CTGCGGTTGTTTCCCTC ek-d8-ekekeee sosssssssssoooss 1403 1419 957

673095 GCTGCGGTTGTTTCCCT ek-d8-ekekeee sosssssssssoooss 1404 1420 958

673096 GGCTGCGGTTGTTTCCC ek-d8-ekekeee sosssssssssoooss 1405 1421 959

673097 AGGCTGCGGTTGTTTCC ek-d8-ekekeee sosssssssssoooss 1406 1422 960

673098 CAGGCTGCGGTTGTTTC ek-d8-ekekeee sosssssssssoooss 1407 1423 961

673099 ACAGGCTGCGGTTGTTT ek-d8-ekekeee sosssssssssoooss 1408 1424 962

673100 TACAGGCTGCGGTTGTT ek-d8-ekekeee sosssssssssoooss 1409 1425 963

673101 CTACAGGCTGCGGTTGT ek-d8-ekekeee sosssssssssoooss 1410 1426 964

673102 GCTACAGGCTGCGGTTG ek-d8-ekekeee sosssssssssoooss 1411 1427 965

673103 TGCTACAGGCTGCGGTT ek-d8-ekekeee sosssssssssoooss 1412 1428 966

673104 TTGCTACAGGCTGCGGT ek-d8-ekekeee sosssssssssoooss 1413 1429 967

673105 CTTGCTACAGGCTGCGG ek-d8-ekekeee sosssssssssoooss 1414 1430 968

673106 GCTTGCTACAGGCTGCG ek-d8-ekekeee sosssssssssoooss 1415 1431 969

673107 AGCTTGCTACAGGCTGC ek-d8-ekekeee sosssssssssoooss 1416 1432 970

673108 GAGCTTGCTACAGGCTG ek-d8-ekekeee sosssssssssoooss 1417 1433 971

673109 AGAGCTTGCTACAGGCT ek-d8-ekekeee sosssssssssoooss 1418 1434 972 673110 CAGAGCTTGCTACAGGC ek-d8-ekekeee sosssssssssoooss 1419 1435 973

673111 CCAGAGCTTGCTACAGG ek-d8-ekekeee sosssssssssoooss 1420 1436 974

673112 TCCAGAGCTTGCTACAG ek-d8-ekekeee sosssssssssoooss 1421 1437 975

673113 TTCCAGAGCTTGCTACA ek-d8-ekekeee sosssssssssoooss 1422 1438 976

673114 GTTCCAGAGCTTGCTAC ek-d8-ekekeee sosssssssssoooss 1423 1439 977

673115 AGTTCCAGAGCTTGCTA ek-d8-ekekeee sosssssssssoooss 1424 1440 978

673116 GAGTTCCAGAGCTTGCT ek-d8-ekekeee sosssssssssoooss 1425 1441 979

673117 TGAGTTCCAGAGCTTGC ek-d8-ekekeee sosssssssssoooss 1426 1442 980

673118 CTGAGTTCCAGAGCTTG ek-d8-ekekeee sosssssssssoooss 1427 1443 981

673119 CCTGAGTTCCAGAGCTT ek-d8-ekekeee sosssssssssoooss 1428 1444 982

673120 TCCTGAGTTCCAGAGCT ek-d8-ekekeee sosssssssssoooss 1429 1445 983

673121 CTCCTGAGTTCCAGAGC ek-d8-ekekeee sosssssssssoooss 1430 1446 984

673122 ACTCCTGAGTTCCAGAG ek-d8-ekekeee sosssssssssoooss 1431 1447 985

673123 GACTCCTGAGTTCCAGA ek-d8-ekekeee sosssssssssoooss 1432 1448 986

673124 CGACTCCTGAGTTCCAG ek-d8-ekekeee sosssssssssoooss 1433 1449 987

673125 GCGACTCCTGAGTTCCA ek-d8-ekekeee sosssssssssoooss 1434 1450 988

673126 CGCGACTCCTGAGTTCC ek-d8-ekekeee sosssssssssoooss 1435 1451 989

673127 GCGCGACTCCTGAGTTC ek-d8-ekekeee sosssssssssoooss 1436 1452 990

673128 CGCGCGACTCCTGAGTT ek-d8-ekekeee sosssssssssoooss 1437 1453 991

673129 GCGCGCGACTCCTGAGT ek-d8-ekekeee sosssssssssoooss 1438 1454 992

673130 AGCGCGCGACTCCTGAG ek-d8-ekekeee sosssssssssoooss 1439 1455 993

673131 TAGCGCGCGACTCCTGA ek-d8-ekekeee sosssssssssoooss 1440 1456 994

673132 CTAGCGCGCGACTCCTG ek-d8-ekekeee sosssssssssoooss 1441 1457 995

673133 CCTAGCGCGCGACTCCT ek-d8-ekekeee sosssssssssoooss 1442 1458 996

673134 CCCTAGCGCGCGACTCC ek-d8-ekekeee sosssssssssoooss 1443 1459 997

673135 CCCCTAGCGCGCGACTC ek-d8-ekekeee sosssssssssoooss 1444 1460 998

673136 GCCCCTAGCGCGCGACT ek-d8-ekekeee sosssssssssoooss 1445 1461 999

673137 GGCCCCTAGCGCGCGAC ek-d8-ekekeee sosssssssssoooss 1446 1462 1000

673138 CGGCCCCTAGCGCGCGA ek-d8-ekekeee sosssssssssoooss 1447 1463 1001

673139 CCGGCCCCTAGCGCGCG ek-d8-ekekeee sosssssssssoooss 1448 1464 1002

673140 CCCGGCCCCTAGCGCGC ek-d8-ekekeee sosssssssssoooss 1449 1465 1003

673141 CCCCGGCCCCTAGCGCG ek-d8-ekekeee sosssssssssoooss 1450 1466 1004

673142 GCCCCGGCCCCTAGCGC ek-d8-ekekeee sosssssssssoooss 1451 1467 1005

673143 GGCCCCGGCCCCTAGCG ek-d8-ekekeee sosssssssssoooss 1452 1468 1006

673144 CGGCCCCGGCCCCTAGC ek-d8-ekekeee sosssssssssoooss 1453 1469 1007

673145 CCGGCCCCGGCCCCTAG ek-d8-ekekeee sosssssssssoooss 1454 1470 1008

673146 CCCGGCCCCGGCCCCTA ek-d8-ekekeee sosssssssssoooss 1455 1471 1009

673147 ACGCCCCGGCCCCGGCC ek-d8-ekekeee sosssssssssoooss 1465 1481 1010

673148 CACGCCCCGGCCCCGGC ek-d8-ekekeee sosssssssssoooss 1466 1482 1011

673149 CCACGCCCCGGCCCCGG ek-d8-ekekeee sosssssssssoooss 1467 1483 1012

673150 ACCACGCCCCGGCCCCG ek-d8-ekekeee sosssssssssoooss 1468 1484 1013

673151 GACCACGCCCCGGCCCC ek-d8-ekekeee sosssssssssoooss 1469 1485 1014

673152 CGACCACGCCCCGGCCC ek-d8-ekekeee sosssssssssoooss 1470 1486 1015 673153 CCGACCACGCCCCGGCC ek-d8-ekekeee sosssssssssoooss 1471 1487 1016

673154 CCCGACCACGCCCCGGC ek-d8-ekekeee sosssssssssoooss 1472 1488 1017

673155 CCCCGACCACGCCCCGG ek-d8-ekekeee sosssssssssoooss 1473 1489 1018

673156 GCCCCGACCACGCCCCG ek-d8-ekekeee sosssssssssoooss 1474 1490 1019

673157 CGCCCCGACCACGCCCC ek-d8-ekekeee sosssssssssoooss 1475 1491 1020

673158 CCGCCCCGACCACGCCC ek-d8-ekekeee sosssssssssoooss 1476 1492 1021

673159 CCCGCCCCGACCACGCC ek-d8-ekekeee sosssssssssoooss 1477 1493 1022

673160 GCCCGCCCCGACCACGC ek-d8-ekekeee sosssssssssoooss 1478 1494 1023

673161 GGCCCGCCCCGACCACG ek-d8-ekekeee sosssssssssoooss 1479 1495 1024

673162 GGGCCCGCCCCGACCAC ek-d8-ekekeee sosssssssssoooss 1480 1496 1025

673163 CGGGCCCGCCCCGACCA ek-d8-ekekeee sosssssssssoooss 1481 1497 1026

673164 CCGGGCCCGCCCCGACC ek-d8-ekekeee sosssssssssoooss 1482 1498 1027

673165 CCCGGGCCCGCCCCGAC ek-d8-ekekeee sosssssssssoooss 1483 1499 1028

673166 GCAGCCCCGCCCCGGGC ek-d8-ekekeee sosssssssssoooss 1505 1521 1029

673167 CGCAGCCCCGCCCCGGG ek-d8-ekekeee sosssssssssoooss 1506 1522 1030

673168 CCGCAGCCCCGCCCCGG ek-d8-ekekeee sosssssssssoooss 1507 1523 1031

673169 ACCGCAGCCCCGCCCCG ek-d8-ekekeee sosssssssssoooss 1508 1524 1032

673170 AACCGCAGCCCCGCCCC ek-d8-ekekeee sosssssssssoooss 1509 1525 1033

673171 CAACCGCAGCCCCGCCC ek-d8-ekekeee sosssssssssoooss 1510 1526 1034

673172 GCAACCGCAGCCCCGCC ek-d8-ekekeee sosssssssssoooss 1511 1527 1035

673173 CGCAACCGCAGCCCCGC ek-d8-ekekeee sosssssssssoooss 1512 1528 1036

673174 CCGCAACCGCAGCCCCG ek-d8-ekekeee sosssssssssoooss 1513 1529 1037

673175 ACCGCAACCGCAGCCCC ek-d8-ekekeee sosssssssssoooss 1514 1530 1038

673176 CACCGCAACCGCAGCCC ek-d8-ekekeee sosssssssssoooss 1515 1531 1039

673177 GCACCGCAACCGCAGCC ek-d8-ekekeee sosssssssssoooss 1516 1532 1040

673178 GGCACCGCAACCGCAGC ek-d8-ekekeee sosssssssssoooss 1517 1533 1041

673179 AGGCACCGCAACCGCAG ek-d8-ekekeee sosssssssssoooss 1518 1534 1042

673180 CAGGCACCGCAACCGCA ek-d8-ekekeee sosssssssssoooss 1519 1535 1043

673181 GCAGGCACCGCAACCGC ek-d8-ekekeee sosssssssssoooss 1520 1536 1044

673182 CGCAGGCACCGCAACCG ek-d8-ekekeee sosssssssssoooss 1521 1537 1045

673183 GCGCAGGCACCGCAACC ek-d8-ekekeee sosssssssssoooss 1522 1538 1046

673184 GGCGCAGGCACCGCAAC ek-d8-ekekeee sosssssssssoooss 1523 1539 1047

Table 27

Deoxy, MOE and cEt oligonucleotides targeting SEQ ID NO: 2

SEQ SEQ

ID ID

SEQ

ISIS NO: NO:

Sequence Chemistry Linkage ID NO 2 2

NO

Start Stop Site Site

673185 TGAGAGCAAGTAGTGGG keke-d8-ekeke soosssssssssooss 1326 1342 898

673186 GTGAGAGCAAGTAGTGG keke-d8-ekeke soosssssssssooss 1327 1343 899

673187 TGTGAGAGCAAGTAGTG keke-d8-ekeke soosssssssssooss 1328 1344 900 673188 CTGTGAGAGCAAGTAGT keke-d8-ekeke soosssssssssooss 1329 1345 901

673189 ACTGTGAGAGCAAGTAG keke-d8-ekeke soosssssssssooss 1330 1346 902

673190 TACTGTGAGAGCAAGTA keke-d8-ekeke soosssssssssooss 1331 1347 903

673191 GTACTGTGAGAGCAAGT keke-d8-ekeke soosssssssssooss 1332 1348 904

673192 AGTACTGTGAGAGCAAG keke-d8-ekeke soosssssssssooss 1333 1349 905

673193 GAGTACTGTGAGAGCAA keke-d8-ekeke soosssssssssooss 1334 1350 906

673194 CGAGTACTGTGAGAGCA keke-d8-ekeke soosssssssssooss 1335 1351 907

673195 GCGAGTACTGTGAGAGC keke-d8-ekeke soosssssssssooss 1336 1352 908

673196 AGCGAGTACTGTGAGAG keke-d8-ekeke soosssssssssooss 1337 1353 909

673197 CAGCGAGTACTGTGAGA keke-d8-ekeke soosssssssssooss 1338 1354 910

673198 TCAGCGAGTACTGTGAG keke-d8-ekeke soosssssssssooss 1339 1355 911

673199 CTCAGCGAGTACTGTGA keke-d8-ekeke soosssssssssooss 1340 1356 912

673200 CCTCAGCGAGTACTGTG keke-d8-ekeke soosssssssssooss 1341 1357 913

673201 CCCTCAGCGAGTACTGT keke-d8-ekeke soosssssssssooss 1342 1358 914

673202 ACCCTCAGCGAGTACTG keke-d8-ekeke soosssssssssooss 1343 1359 915

673203 CACCCTCAGCGAGTACT keke-d8-ekeke soosssssssssooss 1344 1360 916

673204 TCACCCTCAGCGAGTAC keke-d8-ekeke soosssssssssooss 1345 1361 917

673205 TTCACCCTCAGCGAGTA keke-d8-ekeke soosssssssssooss 1346 1362 918

673206 GTTCACCCTCAGCGAGT keke-d8-ekeke soosssssssssooss 1347 1363 919

673207 TGTTCACCCTCAGCGAG keke-d8-ekeke soosssssssssooss 1348 1364 920

673208 TTGTTCACCCTCAGCGA keke-d8-ekeke soosssssssssooss 1349 1365 921

673209 CTTGTTCACCCTCAGCG keke-d8-ekeke soosssssssssooss 1350 1366 922

673210 TCTTGTTCACCCTCAGC keke-d8-ekeke soosssssssssooss 1351 1367 923

673211 TTCTTGTTCACCCTCAG keke-d8-ekeke soosssssssssooss 1352 1368 924

673212 TTTCTTGTTCACCCTCA keke-d8-ekeke soosssssssssooss 1353 1369 925

673213 TTTTCTTGTTCACCCTC keke-d8-ekeke soosssssssssooss 1354 1370 926

673214 CTTTTCTTGTTCACCCT keke-d8-ekeke soosssssssssooss 1355 1371 927

673215 TCTTTTCTTGTTCACCC keke-d8-ekeke soosssssssssooss 1356 1372 928

673216 GTCTTTTCTTGTTCACC keke-d8-ekeke soosssssssssooss 1357 1373 929

673217 GGTCTTTTCTTGTTCAC keke-d8-ekeke soosssssssssooss 1358 1374 930

673218 AGGTCTTTTCTTGTTCA keke-d8-ekeke soosssssssssooss 1359 1375 931

673219 CAGGTCTTTTCTTGTTC keke-d8-ekeke soosssssssssooss 1360 1376 932

673220 TCAGGTCTTTTCTTGTT keke-d8-ekeke soosssssssssooss 1361 1377 933

673221 ATCAGGTCTTTTCTTGT keke-d8-ekeke soosssssssssooss 1362 1378 934

673222 TATCAGGTCTTTTCTTG keke-d8-ekeke soosssssssssooss 1363 1379 935

673223 TTATCAGGTCTTTTCTT keke-d8-ekeke soosssssssssooss 1364 1380 936

673224 ATCTTTATCAGGTCTTT keke-d8-ekeke soosssssssssooss 1368 1384 937

673225 AATCTTTATCAGGTCTT keke-d8-ekeke soosssssssssooss 1369 1385 938

673226 TAATCTTTATCAGGTCT keke-d8-ekeke soosssssssssooss 1370 1386 939

673227 TTAATCTTTATCAGGTC keke-d8-ekeke soosssssssssooss 1371 1387 940

673228 GTTAATCTTTATCAGGT keke-d8-ekeke soosssssssssooss 1372 1388 941 673229 GGTTAATCTTTATCAGG keke-d8-ekeke soosssssssssooss 1373 1389 942

673230 TGGTTAATCTTTATCAG keke-d8-ekeke soosssssssssooss 1374 1390 943

673231 CTGGTTAATCTTTATCA keke-d8-ekeke soosssssssssooss 1375 1391 944

673232 TCTGGTTAATCTTTATC keke-d8-ekeke soosssssssssooss 1376 1392 945

673233 CCCTCCTTGTTTTCTTC keke-d8-ekeke soosssssssssooss 1391 1407 946

673234 TCCCTCCTTGTTTTCTT keke-d8-ekeke soosssssssssooss 1392 1408 947

673235 TTCCCTCCTTGTTTTCT keke-d8-ekeke soosssssssssooss 1393 1409 948

673236 TTTCCCTCCTTGTTTTC keke-d8-ekeke soosssssssssooss 1394 1410 949

673237 GTTTCCCTCCTTGTTTT keke-d8-ekeke soosssssssssooss 1395 1411 950

673238 TGTTTCCCTCCTTGTTT keke-d8-ekeke soosssssssssooss 1396 1412 951

673239 TTGTTTCCCTCCTTGTT keke-d8-ekeke soosssssssssooss 1397 1413 952

673240 GGTTGTTTCCCTCCTTG keke-d8-ekeke soosssssssssooss 1399 1415 953

673241 CGGTTGTTTCCCTCCTT keke-d8-ekeke soosssssssssooss 1400 1416 954

673242 GCGGTTGTTTCCCTCCT keke-d8-ekeke soosssssssssooss 1401 1417 955

673243 TGCGGTTGTTTCCCTCC keke-d8-ekeke soosssssssssooss 1402 1418 956

673244 CTGCGGTTGTTTCCCTC keke-d8-ekeke soosssssssssooss 1403 1419 957

673245 GCTGCGGTTGTTTCCCT keke-d8-ekeke soosssssssssooss 1404 1420 958

673246 GGCTGCGGTTGTTTCCC keke-d8-ekeke soosssssssssooss 1405 1421 959

673247 AGGCTGCGGTTGTTTCC keke-d8-ekeke soosssssssssooss 1406 1422 960

673248 CAGGCTGCGGTTGTTTC keke-d8-ekeke soosssssssssooss 1407 1423 961

673249 ACAGGCTGCGGTTGTTT keke-d8-ekeke soosssssssssooss 1408 1424 962

673250 TACAGGCTGCGGTTGTT keke-d8-ekeke soosssssssssooss 1409 1425 963

673251 CTACAGGCTGCGGTTGT keke-d8-ekeke soosssssssssooss 1410 1426 964

673252 GCTACAGGCTGCGGTTG keke-d8-ekeke soosssssssssooss 1411 1427 965

673253 TGCTACAGGCTGCGGTT keke-d8-ekeke soosssssssssooss 1412 1428 966

673254 TTGCTACAGGCTGCGGT keke-d8-ekeke soosssssssssooss 1413 1429 967

673255 CTTGCTACAGGCTGCGG keke-d8-ekeke soosssssssssooss 1414 1430 968

673256 GCTTGCTACAGGCTGCG keke-d8-ekeke soosssssssssooss 1415 1431 969

673257 AGCTTGCTACAGGCTGC keke-d8-ekeke soosssssssssooss 1416 1432 970

673258 GAGCTTGCTACAGGCTG keke-d8-ekeke soosssssssssooss 1417 1433 971

673259 AGAGCTTGCTACAGGCT keke-d8-ekeke soosssssssssooss 1418 1434 972

673260 CAGAGCTTGCTACAGGC keke-d8-ekeke soosssssssssooss 1419 1435 973

673261 CCAGAGCTTGCTACAGG keke-d8-ekeke soosssssssssooss 1420 1436 974

673262 TCCAGAGCTTGCTACAG keke-d8-ekeke soosssssssssooss 1421 1437 975

673263 TTCCAGAGCTTGCTACA keke-d8-ekeke soosssssssssooss 1422 1438 976

673264 GTTCCAGAGCTTGCTAC keke-d8-ekeke soosssssssssooss 1423 1439 977

673265 AGTTCCAGAGCTTGCTA keke-d8-ekeke soosssssssssooss 1424 1440 978

673266 GAGTTCCAGAGCTTGCT keke-d8-ekeke soosssssssssooss 1425 1441 979

673267 TGAGTTCCAGAGCTTGC keke-d8-ekeke soosssssssssooss 1426 1442 980

673268 CTGAGTTCCAGAGCTTG keke-d8-ekeke soosssssssssooss 1427 1443 981

673269 CCTGAGTTCCAGAGCTT keke-d8-ekeke soosssssssssooss 1428 1444 982 673270 TCCTGAGTTCCAGAGCT keke-d8-ekeke soosssssssssooss 1429 1445 983

673271 CTCCTGAGTTCCAGAGC keke-d8-ekeke soosssssssssooss 1430 1446 984

673272 ACTCCTGAGTTCCAGAG keke-d8-ekeke soosssssssssooss 1431 1447 985

673273 GACTCCTGAGTTCCAGA keke-d8-ekeke soosssssssssooss 1432 1448 986

673274 CGACTCCTGAGTTCCAG keke-d8-ekeke soosssssssssooss 1433 1449 987

673275 GCGACTCCTGAGTTCCA keke-d8-ekeke soosssssssssooss 1434 1450 988

673276 CGCGACTCCTGAGTTCC keke-d8-ekeke soosssssssssooss 1435 1451 989

673277 GCGCGACTCCTGAGTTC keke-d8-ekeke soosssssssssooss 1436 1452 990

673278 CGCGCGACTCCTGAGTT keke-d8-ekeke soosssssssssooss 1437 1453 991

673279 GCGCGCGACTCCTGAGT keke-d8-ekeke soosssssssssooss 1438 1454 992

673280 AGCGCGCGACTCCTGAG keke-d8-ekeke soosssssssssooss 1439 1455 993

673281 TAGCGCGCGACTCCTGA keke-d8-ekeke soosssssssssooss 1440 1456 994

673282 CTAGCGCGCGACTCCTG keke-d8-ekeke soosssssssssooss 1441 1457 995

673283 CCTAGCGCGCGACTCCT keke-d8-ekeke soosssssssssooss 1442 1458 996

673284 CCCTAGCGCGCGACTCC keke-d8-ekeke soosssssssssooss 1443 1459 997

673285 CCCCTAGCGCGCGACTC keke-d8-ekeke soosssssssssooss 1444 1460 998

673286 GCCCCTAGCGCGCGACT keke-d8-ekeke soosssssssssooss 1445 1461 999

673287 GGCCCCTAGCGCGCGAC keke-d8-ekeke soosssssssssooss 1446 1462 1000

673288 CGGCCCCTAGCGCGCGA keke-d8-ekeke soosssssssssooss 1447 1463 1001

673289 CCGGCCCCTAGCGCGCG keke-d8-ekeke soosssssssssooss 1448 1464 1002

673290 CCCGGCCCCTAGCGCGC keke-d8-ekeke soosssssssssooss 1449 1465 1003

673291 CCCCGGCCCCTAGCGCG keke-d8-ekeke soosssssssssooss 1450 1466 1004

673292 GCCCCGGCCCCTAGCGC keke-d8-ekeke soosssssssssooss 1451 1467 1005

673293 GGCCCCGGCCCCTAGCG keke-d8-ekeke soosssssssssooss 1452 1468 1006

673294 CGGCCCCGGCCCCTAGC keke-d8-ekeke soosssssssssooss 1453 1469 1007

673295 CCGGCCCCGGCCCCTAG keke-d8-ekeke soosssssssssooss 1454 1470 1008

673296 CCCGGCCCCGGCCCCTA keke-d8-ekeke soosssssssssooss 1455 1471 1009

673297 ACGCCCCGGCCCCGGCC keke-d8-ekeke soosssssssssooss 1465 1481 1010

673298 CACGCCCCGGCCCCGGC keke-d8-ekeke soosssssssssooss 1466 1482 1011

673299 CCACGCCCCGGCCCCGG keke-d8-ekeke soosssssssssooss 1467 1483 1012

673300 ACCACGCCCCGGCCCCG keke-d8-ekeke soosssssssssooss 1468 1484 1013

673301 GACCACGCCCCGGCCCC keke-d8-ekeke soosssssssssooss 1469 1485 1014

673302 CGACCACGCCCCGGCCC keke-d8-ekeke soosssssssssooss 1470 1486 1015

673303 CCGACCACGCCCCGGCC keke-d8-ekeke soosssssssssooss 1471 1487 1016

673304 CCCGACCACGCCCCGGC keke-d8-ekeke soosssssssssooss 1472 1488 1017

673305 CCCCGACCACGCCCCGG keke-d8-ekeke soosssssssssooss 1473 1489 1018

673306 GCCCCGACCACGCCCCG keke-d8-ekeke soosssssssssooss 1474 1490 1019

673307 CGCCCCGACCACGCCCC keke-d8-ekeke soosssssssssooss 1475 1491 1020

673308 CCGCCCCGACCACGCCC keke-d8-ekeke soosssssssssooss 1476 1492 1021

673309 CCCGCCCCGACCACGCC keke-d8-ekeke soosssssssssooss 1477 1493 1022

673310 GCCCGCCCCGACCACGC keke-d8-ekeke soosssssssssooss 1478 1494 1023 673311 GGCCCGCCCCGACCACG keke-d8-ekeke soosssssssssooss 1479 1495 1024

673312 GGGCCCGCCCCGACCAC keke-d8-ekeke soosssssssssooss 1480 1496 1025

673313 CGGGCCCGCCCCGACCA keke-d8-ekeke soosssssssssooss 1481 1497 1026

673314 CCGGGCCCGCCCCGACC keke-d8-ekeke soosssssssssooss 1482 1498 1027

673315 CCCGGGCCCGCCCCGAC keke-d8-ekeke soosssssssssooss 1483 1499 1028

673316 GCAGCCCCGCCCCGGGC keke-d8-ekeke soosssssssssooss 1505 1521 1029

673317 CGCAGCCCCGCCCCGGG keke-d8-ekeke soosssssssssooss 1506 1522 1030

673318 CCGCAGCCCCGCCCCGG keke-d8-ekeke soosssssssssooss 1507 1523 1031

673319 ACCGCAGCCCCGCCCCG keke-d8-ekeke soosssssssssooss 1508 1524 1032

673320 AACCGCAGCCCCGCCCC keke-d8-ekeke soosssssssssooss 1509 1525 1033

673321 CAACCGCAGCCCCGCCC keke-d8-ekeke soosssssssssooss 1510 1526 1034

673322 GCAACCGCAGCCCCGCC keke-d8-ekeke soosssssssssooss 1511 1527 1035

673323 CGCAACCGCAGCCCCGC keke-d8-ekeke soosssssssssooss 1512 1528 1036

673324 CCGCAACCGCAGCCCCG keke-d8-ekeke soosssssssssooss 1513 1529 1037

673325 ACCGCAACCGCAGCCCC keke-d8-ekeke soosssssssssooss 1514 1530 1038

673326 CACCGCAACCGCAGCCC keke-d8-ekeke soosssssssssooss 1515 1531 1039

673327 GCACCGCAACCGCAGCC keke-d8-ekeke soosssssssssooss 1516 1532 1040

673328 GGCACCGCAACCGCAGC keke-d8-ekeke soosssssssssooss 1517 1533 1041

673329 AGGCACCGCAACCGCAG keke-d8-ekeke soosssssssssooss 1518 1534 1042

673330 CAGGCACCGCAACCGCA keke-d8-ekeke soosssssssssooss 1519 1535 1043

673331 GCAGGCACCGCAACCGC keke-d8-ekeke soosssssssssooss 1520 1536 1044

673332 CGCAGGCACCGCAACCG keke-d8-ekeke soosssssssssooss 1521 1537 1045

673333 GCGCAGGCACCGCAACC keke-d8-ekeke soosssssssssooss 1522 1538 1046

673334 GGCGCAGGCACCGCAAC keke-d8-ekeke soosssssssssooss 1523 1539 1047

Table 28

Deoxy, MOE and cEt oligonucleotides targeting SEQ ID NO: 2

SEQ SEQ ID ID SEQ

ISIS

Sequence Chemistry Linkage NO: 2 NO: 2 ID NO

Start Stop NO Site Site

673335 TGAGAGCAAGTAGTGGG ekek-d8-kekee soosssssssssooss 1326 1342 898

673336 GTGAGAGCAAGTAGTGG ekek-d8-kekee soosssssssssooss 1327 1343 899

673337 TGTGAGAGCAAGTAGTG ekek-d8-kekee soosssssssssooss 1328 1344 900

673338 CTGTGAGAGCAAGTAGT ekek-d8-kekee soosssssssssooss 1329 1345 901

673339 ACTGTGAGAGCAAGTAG ekek-d8-kekee soosssssssssooss 1330 1346 902

673340 TACTGTGAGAGCAAGTA ekek-d8-kekee soosssssssssooss 1331 1347 903

673341 GTACTGTGAGAGCAAGT ekek-d8-kekee soosssssssssooss 1332 1348 904

673342 AGTACTGTGAGAGCAAG ekek-d8-kekee soosssssssssooss 1333 1349 905

673343 GAGTACTGTGAGAGCAA ekek-d8-kekee soosssssssssooss 1334 1350 906

673344 CGAGTACTGTGAGAGCA ekek-d8-kekee soosssssssssooss 1335 1351 907 673345 GCGAGTACTGTGAGAGC ekek-d8-kekee soosssssssssooss 1336 1352 908

673346 AGCGAGTACTGTGAGAG ekek-d8-kekee soosssssssssooss 1337 1353 909

673347 CAGCGAGTACTGTGAGA ekek-d8-kekee soosssssssssooss 1338 1354 910

673348 TCAGCGAGTACTGTGAG ekek-d8-kekee soosssssssssooss 1339 1355 911

673349 CTCAGCGAGTACTGTGA ekek-d8-kekee soosssssssssooss 1340 1356 912

673350 CCTCAGCGAGTACTGTG ekek-d8-kekee soosssssssssooss 1341 1357 913

673351 CCCTCAGCGAGTACTGT ekek-d8-kekee soosssssssssooss 1342 1358 914

673352 ACCCTCAGCGAGTACTG ekek-d8-kekee soosssssssssooss 1343 1359 915

673353 CACCCTCAGCGAGTACT ekek-d8-kekee soosssssssssooss 1344 1360 916

673354 TCACCCTCAGCGAGTAC ekek-d8-kekee soosssssssssooss 1345 1361 917

673355 TTCACCCTCAGCGAGTA ekek-d8-kekee soosssssssssooss 1346 1362 918

673356 GTTCACCCTCAGCGAGT ekek-d8-kekee soosssssssssooss 1347 1363 919

673357 TGTTCACCCTCAGCGAG ekek-d8-kekee soosssssssssooss 1348 1364 920

673358 TTGTTCACCCTCAGCGA ekek-d8-kekee soosssssssssooss 1349 1365 921

673359 CTTGTTCACCCTCAGCG ekek-d8-kekee soosssssssssooss 1350 1366 922

673360 TCTTGTTCACCCTCAGC ekek-d8-kekee soosssssssssooss 1351 1367 923

673361 TTCTTGTTCACCCTCAG ekek-d8-kekee soosssssssssooss 1352 1368 924

673362 TTTCTTGTTCACCCTCA ekek-d8-kekee soosssssssssooss 1353 1369 925

673363 TTTTCTTGTTCACCCTC ekek-d8-kekee soosssssssssooss 1354 1370 926

673364 CTTTTCTTGTTCACCCT ekek-d8-kekee soosssssssssooss 1355 1371 927

673365 TCTTTTCTTGTTCACCC ekek-d8-kekee soosssssssssooss 1356 1372 928

673366 GTCTTTTCTTGTTCACC ekek-d8-kekee soosssssssssooss 1357 1373 929

673367 GGTCTTTTCTTGTTCAC ekek-d8-kekee soosssssssssooss 1358 1374 930

673368 AGGTCTTTTCTTGTTCA ekek-d8-kekee soosssssssssooss 1359 1375 931

673369 CAGGTCTTTTCTTGTTC ekek-d8-kekee soosssssssssooss 1360 1376 932

673370 TCAGGTCTTTTCTTGTT ekek-d8-kekee soosssssssssooss 1361 1377 933

673371 ATCAGGTCTTTTCTTGT ekek-d8-kekee soosssssssssooss 1362 1378 934

673372 TATCAGGTCTTTTCTTG ekek-d8-kekee soosssssssssooss 1363 1379 935

673373 TTATCAGGTCTTTTCTT ekek-d8-kekee soosssssssssooss 1364 1380 936

673374 ATCTTTATCAGGTCTTT ekek-d8-kekee soosssssssssooss 1368 1384 937

673375 AATCTTTATCAGGTCTT ekek-d8-kekee soosssssssssooss 1369 1385 938

673376 TAATCTTTATCAGGTCT ekek-d8-kekee soosssssssssooss 1370 1386 939

673377 TTAATCTTTATCAGGTC ekek-d8-kekee soosssssssssooss 1371 1387 940

673378 GTTAATCTTTATCAGGT ekek-d8-kekee soosssssssssooss 1372 1388 941

673379 GGTTAATCTTTATCAGG ekek-d8-kekee soosssssssssooss 1373 1389 942

673380 TGGTTAATCTTTATCAG ekek-d8-kekee soosssssssssooss 1374 1390 943

673381 CTGGTTAATCTTTATCA ekek-d8-kekee soosssssssssooss 1375 1391 944

673382 TCTGGTTAATCTTTATC ekek-d8-kekee soosssssssssooss 1376 1392 945

673383 CCCTCCTTGTTTTCTTC ekek-d8-kekee soosssssssssooss 1391 1407 946

673384 TCCCTCCTTGTTTTCTT ekek-d8-kekee soosssssssssooss 1392 1408 947

673385 TTCCCTCCTTGTTTTCT ekek-d8-kekee soosssssssssooss 1393 1409 948 673386 TTTCCCTCCTTGTTTTC ekek-d8-kekee soosssssssssooss 1394 1410 949

673387 GTTTCCCTCCTTGTTTT ekek-d8-kekee soosssssssssooss 1395 1411 950

673388 TGTTTCCCTCCTTGTTT ekek-d8-kekee soosssssssssooss 1396 1412 951

673389 TTGTTTCCCTCCTTGTT ekek-d8-kekee soosssssssssooss 1397 1413 952

673390 GGTTGTTTCCCTCCTTG ekek-d8-kekee soosssssssssooss 1399 1415 953

673391 CGGTTGTTTCCCTCCTT ekek-d8-kekee soosssssssssooss 1400 1416 954

673392 GCGGTTGTTTCCCTCCT ekek-d8-kekee soosssssssssooss 1401 1417 955

673393 TGCGGTTGTTTCCCTCC ekek-d8-kekee soosssssssssooss 1402 1418 956

673394 CTGCGGTTGTTTCCCTC ekek-d8-kekee soosssssssssooss 1403 1419 957

673395 GCTGCGGTTGTTTCCCT ekek-d8-kekee soosssssssssooss 1404 1420 958

673396 GGCTGCGGTTGTTTCCC ekek-d8-kekee soosssssssssooss 1405 1421 959

673397 AGGCTGCGGTTGTTTCC ekek-d8-kekee soosssssssssooss 1406 1422 960

673398 CAGGCTGCGGTTGTTTC ekek-d8-kekee soosssssssssooss 1407 1423 961

673399 ACAGGCTGCGGTTGTTT ekek-d8-kekee soosssssssssooss 1408 1424 962

673400 TACAGGCTGCGGTTGTT ekek-d8-kekee soosssssssssooss 1409 1425 963

673401 CTACAGGCTGCGGTTGT ekek-d8-kekee soosssssssssooss 1410 1426 964

673402 GCTACAGGCTGCGGTTG ekek-d8-kekee soosssssssssooss 1411 1427 965

673403 TGCTACAGGCTGCGGTT ekek-d8-kekee soosssssssssooss 1412 1428 966

673404 TTGCTACAGGCTGCGGT ekek-d8-kekee soosssssssssooss 1413 1429 967

673405 CTTGCTACAGGCTGCGG ekek-d8-kekee soosssssssssooss 1414 1430 968

673406 GCTTGCTACAGGCTGCG ekek-d8-kekee soosssssssssooss 1415 1431 969

673407 AGCTTGCTACAGGCTGC ekek-d8-kekee soosssssssssooss 1416 1432 970

673408 GAGCTTGCTACAGGCTG ekek-d8-kekee soosssssssssooss 1417 1433 971

673409 AGAGCTTGCTACAGGCT ekek-d8-kekee soosssssssssooss 1418 1434 972

673410 CAGAGCTTGCTACAGGC ekek-d8-kekee soosssssssssooss 1419 1435 973

673411 CCAGAGCTTGCTACAGG ekek-d8-kekee soosssssssssooss 1420 1436 974

673412 TCCAGAGCTTGCTACAG ekek-d8-kekee soosssssssssooss 1421 1437 975

673413 TTCCAGAGCTTGCTACA ekek-d8-kekee soosssssssssooss 1422 1438 976

673414 GTTCCAGAGCTTGCTAC ekek-d8-kekee soosssssssssooss 1423 1439 977

673415 AGTTCCAGAGCTTGCTA ekek-d8-kekee soosssssssssooss 1424 1440 978

673416 GAGTTCCAGAGCTTGCT ekek-d8-kekee soosssssssssooss 1425 1441 979

673417 TGAGTTCCAGAGCTTGC ekek-d8-kekee soosssssssssooss 1426 1442 980

673418 CTGAGTTCCAGAGCTTG ekek-d8-kekee soosssssssssooss 1427 1443 981

673419 CCTGAGTTCCAGAGCTT ekek-d8-kekee soosssssssssooss 1428 1444 982

673420 TCCTGAGTTCCAGAGCT ekek-d8-kekee soosssssssssooss 1429 1445 983

673421 CTCCTGAGTTCCAGAGC ekek-d8-kekee soosssssssssooss 1430 1446 984

673422 ACTCCTGAGTTCCAGAG ekek-d8-kekee soosssssssssooss 1431 1447 985

673423 GACTCCTGAGTTCCAGA ekek-d8-kekee soosssssssssooss 1432 1448 986

673424 CGACTCCTGAGTTCCAG ekek-d8-kekee soosssssssssooss 1433 1449 987

673425 GCGACTCCTGAGTTCCA ekek-d8-kekee soosssssssssooss 1434 1450 988

673426 CGCGACTCCTGAGTTCC ekek-d8-kekee soosssssssssooss 1435 1451 989 673427 GCGCGACTCCTGAGTTC ekek-d8-kekee soosssssssssooss 1436 1452 990

673428 CGCGCGACTCCTGAGTT ekek-d8-kekee soosssssssssooss 1437 1453 991

673429 GCGCGCGACTCCTGAGT ekek-d8-kekee soosssssssssooss 1438 1454 992

673430 AGCGCGCGACTCCTGAG ekek-d8-kekee soosssssssssooss 1439 1455 993

673431 TAGCGCGCGACTCCTGA ekek-d8-kekee soosssssssssooss 1440 1456 994

673432 CTAGCGCGCGACTCCTG ekek-d8-kekee soosssssssssooss 1441 1457 995

673433 CCTAGCGCGCGACTCCT ekek-d8-kekee soosssssssssooss 1442 1458 996

673434 CCCTAGCGCGCGACTCC ekek-d8-kekee soosssssssssooss 1443 1459 997

673435 CCCCTAGCGCGCGACTC ekek-d8-kekee soosssssssssooss 1444 1460 998

673436 GCCCCTAGCGCGCGACT ekek-d8-kekee soosssssssssooss 1445 1461 999

673437 GGCCCCTAGCGCGCGAC ekek-d8-kekee soosssssssssooss 1446 1462 1000

673438 CGGCCCCTAGCGCGCGA ekek-d8-kekee soosssssssssooss 1447 1463 1001

673439 CCGGCCCCTAGCGCGCG ekek-d8-kekee soosssssssssooss 1448 1464 1002

673440 CCCGGCCCCTAGCGCGC ekek-d8-kekee soosssssssssooss 1449 1465 1003

673441 CCCCGGCCCCTAGCGCG ekek-d8-kekee soosssssssssooss 1450 1466 1004

673442 GCCCCGGCCCCTAGCGC ekek-d8-kekee soosssssssssooss 1451 1467 1005

673443 GGCCCCGGCCCCTAGCG ekek-d8-kekee soosssssssssooss 1452 1468 1006

673444 CGGCCCCGGCCCCTAGC ekek-d8-kekee soosssssssssooss 1453 1469 1007

673445 CCGGCCCCGGCCCCTAG ekek-d8-kekee soosssssssssooss 1454 1470 1008

673446 CCCGGCCCCGGCCCCTA ekek-d8-kekee soosssssssssooss 1455 1471 1009

673447 ACGCCCCGGCCCCGGCC ekek-d8-kekee soosssssssssooss 1465 1481 1010

673448 CACGCCCCGGCCCCGGC ekek-d8-kekee soosssssssssooss 1466 1482 1011

673449 CCACGCCCCGGCCCCGG ekek-d8-kekee soosssssssssooss 1467 1483 1012

673450 ACCACGCCCCGGCCCCG ekek-d8-kekee soosssssssssooss 1468 1484 1013

673451 GACCACGCCCCGGCCCC ekek-d8-kekee soosssssssssooss 1469 1485 1014

673452 CGACCACGCCCCGGCCC ekek-d8-kekee soosssssssssooss 1470 1486 1015

673453 CCGACCACGCCCCGGCC ekek-d8-kekee soosssssssssooss 1471 1487 1016

673454 CCCGACCACGCCCCGGC ekek-d8-kekee soosssssssssooss 1472 1488 1017

673455 CCCCGACCACGCCCCGG ekek-d8-kekee soosssssssssooss 1473 1489 1018

673456 GCCCCGACCACGCCCCG ekek-d8-kekee soosssssssssooss 1474 1490 1019

673457 CGCCCCGACCACGCCCC ekek-d8-kekee soosssssssssooss 1475 1491 1020

673458 CCGCCCCGACCACGCCC ekek-d8-kekee soosssssssssooss 1476 1492 1021

673459 CCCGCCCCGACCACGCC ekek-d8-kekee soosssssssssooss 1477 1493 1022

673460 GCCCGCCCCGACCACGC ekek-d8-kekee soosssssssssooss 1478 1494 1023

673461 GGCCCGCCCCGACCACG ekek-d8-kekee soosssssssssooss 1479 1495 1024

673462 GGGCCCGCCCCGACCAC ekek-d8-kekee soosssssssssooss 1480 1496 1025

673463 CGGGCCCGCCCCGACCA ekek-d8-kekee soosssssssssooss 1481 1497 1026

673464 CCGGGCCCGCCCCGACC ekek-d8-kekee soosssssssssooss 1482 1498 1027

673465 CCCGGGCCCGCCCCGAC ekek-d8-kekee soosssssssssooss 1483 1499 1028

673466 GCAGCCCCGCCCCGGGC ekek-d8-kekee soosssssssssooss 1505 1521 1029

673467 CGCAGCCCCGCCCCGGG ekek-d8-kekee soosssssssssooss 1506 1522 1030 673468 CCGCAGCCCCGCCCCGG ekek-d8-kekee soosssssssssooss 1507 1523 1031

673469 ACCGCAGCCCCGCCCCG ekek-d8-kekee soosssssssssooss 1508 1524 1032

673470 AACCGCAGCCCCGCCCC ekek-d8-kekee soosssssssssooss 1509 1525 1033

673471 CAACCGCAGCCCCGCCC ekek-d8-kekee soosssssssssooss 1510 1526 1034

673472 GCAACCGCAGCCCCGCC ekek-d8-kekee soosssssssssooss 1511 1527 1035

673473 CGCAACCGCAGCCCCGC ekek-d8-kekee soosssssssssooss 1512 1528 1036

673474 CCGCAACCGCAGCCCCG ekek-d8-kekee soosssssssssooss 1513 1529 1037

673475 ACCGCAACCGCAGCCCC ekek-d8-kekee soosssssssssooss 1514 1530 1038

673476 CACCGCAACCGCAGCCC ekek-d8-kekee soosssssssssooss 1515 1531 1039

673477 GCACCGCAACCGCAGCC ekek-d8-kekee soosssssssssooss 1516 1532 1040

673478 GGCACCGCAACCGCAGC ekek-d8-kekee soosssssssssooss 1517 1533 1041

673479 AGGCACCGCAACCGCAG ekek-d8-kekee soosssssssssooss 1518 1534 1042

673480 CAGGCACCGCAACCGCA ekek-d8-kekee soosssssssssooss 1519 1535 1043

673481 GCAGGCACCGCAACCGC ekek-d8-kekee soosssssssssooss 1520 1536 1044

673482 CGCAGGCACCGCAACCG ekek-d8-kekee soosssssssssooss 1521 1537 1045

673483 GCGCAGGCACCGCAACC ekek-d8-kekee soosssssssssooss 1522 1538 1046

673484 GGCGCAGGCACCGCAAC ekek-d8-kekee soosssssssssooss 1523 1539 1047

Table 29

MOE gapmers targeting SEQ ID NO: 2

Example 7: In vivo rodent inhibition and tolerability with treatment of C90RF72 antisense oligonucleotides

In order to assess the tolerability of inhibition of C90RF72 expression in vivo, antisense

oligonucleotides targeting a murine C90RF72 nucleic acid were designed and assessed in mouse and rat models.

ISIS 571883 was designed as a 5-10-5 MOE gapmer, 20 nucleosides in length, wherein the central gap segment comprises ten 2'-deoxynucleosides and is flanked by wing segments on both the 5' end and on the 3' end comprising five nucleosides each. Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment has a MOE modification. The internucleoside linkages are phosphorothioate linkages. All cytosine residues throughout the gapmer are 5-methylcytosines. ISIS 571883 has a target start site of nucleoside 33704 on the murine C90RF72 genomic sequence, designated herein as SEQ ID NO: 11 (the complement of GENBAN Accession No. NT_166289.1 truncated from nucleosides 3587000 to 3625000).

ISIS 603538 was designed as a 5-10-5 MOE gapmer, 20 nucleosides in length, wherein the central gap segment comprises ten 2'-deoxynucleosides and is flanked by wing segments on both the 5' end and on the 3' end comprising five nucleosides each. Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment has a MOE modification. The internucleoside linkages are either phosphorothioate linkages or phosphate ester linkages (Gs Ao Co Co Gs Cs Ts Ts Gs As Gs Ts Ts Ts Gs Co Co Ao Cs A; wherein 's' denotes a phosphorothioate internucleoside linkage, Ό' denotes a phosphate ester linkage; and A, G, C, T denote the relevant nucleosides). All cytosine residues throughout the gapmer are 5-methylcytosines. ISIS 603538 has a target start site of nucleoside 2872 on the rat C90RF72 mRNA sequence, designated herein as SEQ ID NO: 12 (GENBANK Accession No. NM_001007702.1).

Mouse experiment 1

Groups of 4 C57BL/6 mice each were injected with 50 μg, 100 g, 300 μg, 500 μg, or 700 μg of ISIS

571883 administered via an intracerebroventricular bolus injection. A control group of four C57/BL6 mice were similarly treated with PBS. Animals were anesthetized with 3% isofluorane and placed in a stereotactic frame. After sterilizing the surgical site, each mouse was injected -0.2 mm anterio-posterior from the bregma na d 3 mm dorsoventral to the bregma with the above-mentioned doses of ISIS 571883 using a Hamilton syringe. The incision was closed with sutures. The mice were allowed to recover for 14 days, after which animals were euthanized according to a humane protocol approved by the Institutional Animal Care and Use Committee. Brain and spinal cord tissue were harvested and snap frozen in liquid nitrogen. Prior to freezing, brain tissue was cut transversely five sections using a mouse brain matrix.

RNA analysis RNA was extracted from a 2-3 mm brain section posterior to the injection site, from brain frontal cortex and from the lumbar section of the spinal cord tissue for analysis of C90RF72 mRNA expression. C90RF72 mRNA expression was measured by RT-PCR. The data is presented in Table 31. The results indicate that treatment with increasing doses of ISIS 571883 resulted in dose-dependent inhibition of C90RF72 mRNA expression.

The induction of the microglial marker AIF-1 as a measure of CNS toxicity was also assessed. The data is presented in Table 32. The results indicate that treatment with increasing doses of ISIS 571883 did not result in significant increases in AIF-1 mRNA expression. Hence, the injection of ISIS 571883 was deemed tolerable in this model.

Table 31

Percentage inhibition of C90RF72 mRNA expression compared to the PBS control

Table 32

Percentage expression of AIF-1 mRNA expression compared to the PBS control

Mouse experiment 2

Groups of 4 C57BL/6 mice each were injected with 500 μg of ISIS 571883 administered via an intracerebroventricular bolus injection in a procedure similar to that described above. A control group of four C57/BL6 mice were similarly treated with PBS. The mice were tested at regular time points after ICV administration.

Behavior analysis

Two standard assays to assess motor behavior were employed; the rotarod assay and grip strength assay. In case of the rotarod assays, the time of latency to fall was measured. The data for the assays is presented in Tables 33 and 34. The results indicate that there were no significant changes in the motor behavior of the mice as a result of antisense inhibition of ISIS 571883 or due to the ICV injection. Hence, antisense inhibition of C90RF72 was deemed tolerable in this model.

Table 33

Latency to fall (sec) in the rotarod assay

Table 34

Mean hindlimb grip strength (g) in the grip strength assay

Rat experiment

Groups of 4 Sprague-Dawley rats each were injected with 700 μg, 1,000 μg, or 3,000 μg of ISIS

603538 administered via an intrathecal bolus injection. A control group of four Sprague-Dawley rats were similarly treated with PBS. Animals were anesthetized with 3% isofluorane and placed in a stereotactic frame. After sterilizing the surgical site, each rat was injected with 30 μΐ. of ASO solution administered via 8 cm intrathecal catheter 2 cm into the spinal canal with a 50 flush. The rats were allowed to recover for 4 weeks, after which animals were euthanized according to a humane protocol approved by the Institutional Animal Care and Use Committee.

RNA analysis

RNA was extracted from a 2-3 mm brain section posterior to the injection stie, from brain frontal cortex, and from the cervical and lumbar sections of the spinal cord tissue for analysis of C90RF72 mRNA expression. C90RF72 mRNA expression was measured by RT-PCR. The data is presented in Table 35. The results indicate that treatment with increasing doses of ISIS 603538 resulted in dose-dependent inhibition of C90RF72 mRNA expression. The induction of the microglial marker AIF-1 as a measure of CNS toxicity was also assessed. The data is presented in Table 36. The results indicate that treatment with increasing doses of ISIS 603538 did not result in significant increases in AIF-1 mRNA expression. Hence, the injection of ISIS 603538 was deemed tolerable in this model.

Table 35

Percentage inhibition of C90RF72 mRNA expression compared to the PBS control

Table 36

Percentage expression of AIF-1 mRNA expression compared to the PBS control

Body weight analysis

Body weights of the rats were measured at regular time point intervals. The data is presented in Table 37. The results indicate that treatment with increasing doses of ISIS 603538 did not have any significant changes in the body weights of the rats.

Table 37

Body weights of the rats (% initial body weight)

Example 8: Antisense inhibition of C90RF72 by 5-8-5 MOE gapmers with mixed backbones and Deoxy, MOE and cEt antisense oligonucleotides with mixed backbones

Antisense oligonucleotides described in Example 6 hereinabove (see Table 23 and Table 24 hereinabove) were tested in HepG2 cells in a series of experiments that had similar culture conditions. ISIS 576816, previously tested in PCT/US2013/065073 (claiming priority to US Application No. 61/714,132, filed October 15, 2012, was used as a benchmark oligonucleotide for study with deoxy, MOE, and cEt antisense oligonucleotides. The results for each experiment are presented in tables shown below. Cultured HepG2 cells at a density of 20,000 cells per well were transfected using electrop oration with 500 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and C90RF72 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3905 was used to measure the C90RF72 pathogenic associated mRNA variant, which is the product of a pre- mRNA containing a hexanucleotide repeat. The levels of the C90RF72 pathogenic associated mRNA variant were normalized to the total RNA content of the cell, as measured by RIBOGREEN®. Results are presented as percent inhibition of C90RF72, relative to untreated control cells.

Table 38

Percent inhibition of the C90RF72 pathogenic associated mRNA variant compared to PBS control by 5-8-5 MOE gapmers with mixed backbones targeting SEQ ID NO: 2

SEQ ID SEQ ID

ISIS NO: 2 NO: 2 % SEQ ID

Sequence Linkage

NO Start Stop inhibition NO

Site Site

672581 GTGAGAGCAAGTAGTGGG sooosssssssssooss 1326 1343 11 744

672582 TGTGAGAGCAAGTAGTGG sooosssssssssooss 1327 1344 32 745

672583 CTGTGAGAGCAAGTAGTG sooosssssssssooss 1328 1345 14 746

672584 ACTGTGAGAGCAAGTAGT sooosssssssssooss 1329 1346 1 747

672585 TACTGTGAGAGCAAGTAG sooosssssssssooss 1330 1347 14 748

672586 GTACTGTGAGAGCAAGTA sooosssssssssooss 1331 1348 22 749

672587 AGTACTGTGAGAGCAAGT sooosssssssssooss 1332 1349 0 750

672588 GAGTACTGTGAGAGCAAG sooosssssssssooss 1333 1350 8 751

672589 CGAGTACTGTGAGAGCAA sooosssssssssooss 1334 1351 15 752

672590 GCGAGTACTGTGAGAGCA sooosssssssssooss 1335 1352 13 753

672591 AGCGAGTACTGTGAGAGC sooosssssssssooss 1336 1353 32 754

672592 CAGCGAGTACTGTGAGAG sooosssssssssooss 1337 1354 39 755

672593 TCAGCGAGTACTGTGAGA sooosssssssssooss 1338 1355 15 756

672594 CTCAGCGAGTACTGTGAG sooosssssssssooss 1339 1356 14 757

672595 CCTCAGCGAGTACTGTGA sooosssssssssooss 1340 1357 40 758

672596 CCCTCAGCGAGTACTGTG sooosssssssssooss 1341 1358 28 759

672597 ACCCTCAGCGAGTACTGT sooosssssssssooss 1342 1359 30 760

672598 CACCCTCAGCGAGTACTG sooosssssssssooss 1343 1360 46 761

672599 TCACCCTCAGCGAGTACT sooosssssssssooss 1344 1361 40 762

672600 TTCACCCTCAGCGAGTAC sooosssssssssooss 1345 1362 25 763

672601 GTTCACCCTCAGCGAGTA sooosssssssssooss 1346 1363 15 764

672602 TGTTCACCCTCAGCGAGT sooosssssssssooss 1347 1364 35 765

672603 TTGTTCACCCTCAGCGAG sooosssssssssooss 1348 1365 22 766

672604 CTTGTTCACCCTCAGCGA sooosssssssssooss 1349 1366 6 767

672605 TCTTGTTCACCCTCAGCG sooosssssssssooss 1350 1367 26 768 672606 TTCTTGTTCACCCTCAGC sooosssssssssooss 1351 1368 11 769

672607 TTTCTTGTTCACCCTCAG sooosssssssssooss 1352 1369 9 770

672608 TTTTCTTGTTCACCCTCA sooosssssssssooss 1353 1370 36 771

672609 CTTTTCTTGTTCACCCTC sooosssssssssooss 1354 1371 25 772

672610 TCTTTTCTTGTTCACCCT sooosssssssssooss 1355 1372 16 773

672611 GTCTTTTCTTGTTCACCC sooosssssssssooss 1356 1373 45 774

672612 GGTCTTTTCTTGTTCACC sooosssssssssooss 1357 1374 15 775

672613 AGGTCTTTTCTTGTTCAC sooosssssssssooss 1358 1375 10 776

672614 CAGGTCTTTTCTTGTTCA sooosssssssssooss 1359 1376 25 777

672615 TCAGGTCTTTTCTTGTTC sooosssssssssooss 1360 1377 21 778

672616 ATCAGGTCTTTTCTTGTT sooosssssssssooss 1361 1378 15 779

672617 TATCAGGTCTTTTCTTGT sooosssssssssooss 1362 1379 27 780

672618 TTATCAGGTCTTTTCTTG sooosssssssssooss 1363 1380 14 781

672619 TTTATCAGGTCTTTTCTT sooosssssssssooss 1364 1381 46 782

672620 AATCTTTATCAGGTCTTT sooosssssssssooss 1368 1385 31 783

672621 TAATCTTTATCAGGTCTT sooosssssssssooss 1369 1386 12 784

672622 TTAATCTTTATCAGGTCT sooosssssssssooss 1370 1387 27 785

672623 GTTAATCTTTATCAGGTC sooosssssssssooss 1371 1388 9 786

672624 GGTTAATCTTTATCAGGT sooosssssssssooss 1372 1389 53 787

672625 TGGTTAATCTTTATCAGG sooosssssssssooss 1373 1390 17 788

672626 CTGGTTAATCTTTATCAG sooosssssssssooss 1374 1391 11 789

672627 TCTGGTTAATCTTTATCA sooosssssssssooss 1375 1392 16 790

672628 TTCTGGTTAATCTTTATC sooosssssssssooss 1376 1393 22 791

672629 TCCCTCCTTGTTTTCTTC sooosssssssssooss 1391 1408 0 792

672630 TTTCCCTCCTTGTTTTCT sooosssssssssooss 1393 1410 8 793

672631 GTTTCCCTCCTTGTTTTC sooosssssssssooss 1394 1411 0 794

672632 TGTTTCCCTCCTTGTTTT sooosssssssssooss 1395 1412 25 795

672633 TTGTTTCCCTCCTTGTTT sooosssssssssooss 1396 1413 0 796

672634 GTTGTTTCCCTCCTTGTT sooosssssssssooss 1397 1414 10 797

672635 GGTTGTTTCCCTCCTTGT sooosssssssssooss 1398 1415 15 798

672636 CGGTTGTTTCCCTCCTTG sooosssssssssooss 1399 1416 49 799

672637 GCGGTTGTTTCCCTCCTT sooosssssssssooss 1400 1417 49 800

672638 TGCGGTTGTTTCCCTCCT sooosssssssssooss 1401 1418 23 801

672639 CTGCGGTTGTTTCCCTCC sooosssssssssooss 1402 1419 21 802

672640 GCTGCGGTTGTTTCCCTC sooosssssssssooss 1403 1420 52 803

672641 GGCTGCGGTTGTTTCCCT sooosssssssssooss 1404 1421 23 804

672642 AGGCTGCGGTTGTTTCCC sooosssssssssooss 1405 1422 35 805

672643 CAGGCTGCGGTTGTTTCC sooosssssssssooss 1406 1423 22 806

672644 ACAGGCTGCGGTTGTTTC sooosssssssssooss 1407 1424 27 807

672645 TACAGGCTGCGGTTGTTT sooosssssssssooss 1408 1425 21 808

672646 CTACAGGCTGCGGTTGTT sooosssssssssooss 1409 1426 18 809 672647 GCTACAGGCTGCGGTTGT sooosssssssssooss 1410 1427 16 810

672648 TGCTACAGGCTGCGGTTG sooosssssssssooss 1411 1428 10 811

672649 TTGCTACAGGCTGCGGTT sooosssssssssooss 1412 1429 0 812

672650 CTTGCTACAGGCTGCGGT sooosssssssssooss 1413 1430 27 813

672651 GCTTGCTACAGGCTGCGG sooosssssssssooss 1414 1431 53 814

672652 AGCTTGCTACAGGCTGCG sooosssssssssooss 1415 1432 38 815

672653 GAGCTTGCTACAGGCTGC sooosssssssssooss 1416 1433 7 816

672654 AGAGCTTGCTACAGGCTG sooosssssssssooss 1417 1434 7 817

672655 CAGAGCTTGCTACAGGCT sooosssssssssooss 1418 1435 15 818

672656 CCAGAGCTTGCTACAGGC sooosssssssssooss 1419 1436 22 819

672657 TCCAGAGCTTGCTACAGG sooosssssssssooss 1420 1437 43 820

672658 TTCCAGAGCTTGCTACAG sooosssssssssooss 1421 1438 20 821

672659 GTTCCAGAGCTTGCTACA sooosssssssssooss 1422 1439 12 822

672660 AGTTCCAGAGCTTGCTAC sooosssssssssooss 1423 1440 11 823

672661 GAGTTCCAGAGCTTGCTA sooosssssssssooss 1424 1441 39 824

672662 TGAGTTCCAGAGCTTGCT sooosssssssssooss 1425 1442 18 825

672663 CTGAGTTCCAGAGCTTGC sooosssssssssooss 1426 1443 26 826

672664 CCTGAGTTCCAGAGCTTG sooosssssssssooss 1427 1444 69 827

672665 TCCTGAGTTCCAGAGCTT sooosssssssssooss 1428 1445 56 828

672666 CTCCTGAGTTCCAGAGCT sooosssssssssooss 1429 1446 28 829

672667 ACTCCTGAGTTCCAGAGC sooosssssssssooss 1430 1447 51 830

672668 GACTCCTGAGTTCCAGAG sooosssssssssooss 1431 1448 39 831

672669 CGACTCCTGAGTTCCAGA sooosssssssssooss 1432 1449 32 832

672670 GCGACTCCTGAGTTCCAG sooosssssssssooss 1433 1450 66 833

672671 CGCGACTCCTGAGTTCCA sooosssssssssooss 1434 1451 67 834

672672 GCGCGACTCCTGAGTTCC sooosssssssssooss 1435 1452 48 835

672673 CGCGCGACTCCTGAGTTC sooosssssssssooss 1436 1453 38 836

672674 GCGCGCGACTCCTGAGTT sooosssssssssooss 1437 1454 53 837

672675 AGCGCGCGACTCCTGAGT sooosssssssssooss 1438 1455 58 838

672676 TAGCGCGCGACTCCTGAG sooosssssssssooss 1439 1456 55 839

672677 CTAGCGCGCGACTCCTGA sooosssssssssooss 1440 1457 47 840

672678 CCTAGCGCGCGACTCCTG sooosssssssssooss 1441 1458 56 841

672679 CCCTAGCGCGCGACTCCT sooosssssssssooss 1442 1459 74 842

672680 CCCCTAGCGCGCGACTCC sooosssssssssooss 1443 1460 43 843

672681 GCCCCTAGCGCGCGACTC sooosssssssssooss 1444 1461 53 844

672682 GGCCCCTAGCGCGCGACT sooosssssssssooss 1445 1462 42 845

672683 CGGCCCCTAGCGCGCGAC sooosssssssssooss 1446 1463 69 846

672684 CCGGCCCCTAGCGCGCGA sooosssssssssooss 1447 1464 29 847

672685 CCCGGCCCCTAGCGCGCG sooosssssssssooss 1448 1465 21 848

672686 CCCCGGCCCCTAGCGCGC sooosssssssssooss 1449 1466 35 849

672687 GCCCCGGCCCCTAGCGCG sooosssssssssooss 1450 1467 41 850 672688 GGCCCCGGCCCCTAGCGC sooosssssssssooss 1451 1468 46 851

672689 CGGCCCCGGCCCCTAGCG sooosssssssssooss 1452 1469 28 852

672690 CCGGCCCCGGCCCCTAGC sooosssssssssooss 1453 1470 33 853

672691 CCCGGCCCCGGCCCCTAG sooosssssssssooss 1454 1471 10 854

672692 CCCCGGCCCCGGCCCCTA sooosssssssssooss 1455 1472 35 855

672693 ACGCCCCGGCCCCGGCCC sooosssssssssooss 1464 1481 57 856

672694 CACGCCCCGGCCCCGGCC sooosssssssssooss 1465 1482 39 857

672695 CCACGCCCCGGCCCCGGC sooosssssssssooss 1466 1483 48 858

672696 ACCACGCCCCGGCCCCGG sooosssssssssooss 1467 1484 39 859

672697 GACCACGCCCCGGCCCCG sooosssssssssooss 1468 1485 54 860

672698 CGACCACGCCCCGGCCCC sooosssssssssooss 1469 1486 48 861

672699 CCGACCACGCCCCGGCCC sooosssssssssooss 1470 1487 52 862

672700 CCCGACCACGCCCCGGCC sooosssssssssooss 1471 1488 67 863

672701 CCCCGACCACGCCCCGGC sooosssssssssooss 1472 1489 42 864

672702 GCCCCGACCACGCCCCGG sooosssssssssooss 1473 1490 11 865

672703 CGCCCCGACCACGCCCCG sooosssssssssooss 1474 1491 23 866

672704 CCGCCCCGACCACGCCCC sooosssssssssooss 1475 1492 50 867

672705 CCCGCCCCGACCACGCCC sooosssssssssooss 1476 1493 23 868

672706 GCCCGCCCCGACCACGCC sooosssssssssooss 1477 1494 24 869

672707 GGCCCGCCCCGACCACGC sooosssssssssooss 1478 1495 44 870

672708 GGGCCCGCCCCGACCACG sooosssssssssooss 1479 1496 29 871

672709 CGGGCCCGCCCCGACCAC sooosssssssssooss 1480 1497 7 872

672710 CCGGGCCCGCCCCGACCA sooosssssssssooss 1481 1498 30 873

672711 CCCGGGCCCGCCCCGACC sooosssssssssooss 1482 1499 16 874

672712 CCCCGGGCCCGCCCCGAC sooosssssssssooss 1483 1500 14 875

672713 AGCCCCGCCCCGGGCCCG sooosssssssssooss 1502 1519 32 876

672714 CAGCCCCGCCCCGGGCCC sooosssssssssooss 1503 1520 22 877

672715 GCAGCCCCGCCCCGGGCC sooosssssssssooss 1504 1521 1 878

672716 CGCAGCCCCGCCCCGGGC sooosssssssssooss 1505 1522 29 879

672717 CCGCAGCCCCGCCCCGGG sooosssssssssooss 1506 1523 51 880

672718 ACCGCAGCCCCGCCCCGG sooosssssssssooss 1507 1524 45 881

672719 AACCGCAGCCCCGCCCCG sooosssssssssooss 1508 1525 12 882

672720 CAACCGCAGCCCCGCCCC sooosssssssssooss 1509 1526 7 883

672721 GCAACCGCAGCCCCGCCC sooosssssssssooss 1510 1527 38 884

672722 CGCAACCGCAGCCCCGCC sooosssssssssooss 1511 1528 34 885

672723 CCGCAACCGCAGCCCCGC sooosssssssssooss 1512 1529 58 886

672724 ACCGCAACCGCAGCCCCG sooosssssssssooss 1513 1530 39 887

672725 CACCGCAACCGCAGCCCC sooosssssssssooss 1514 1531 43 888

672726 GCACCGCAACCGCAGCCC sooosssssssssooss 1515 1532 41 889

672727 GGCACCGCAACCGCAGCC sooosssssssssooss 1516 1533 18 890

672728 AGGCACCGCAACCGCAGC sooosssssssssooss 1517 1534 53 891 672729 CAGGCACCGCAACCGCAG sooosssssssssooss 1518 1535 26 892

672730 GCAGGCACCGCAACCGCA sooosssssssssooss 1519 1536 54 893

672731 CGCAGGCACCGCAACCGC sooosssssssssooss 1520 1537 41 894

672732 GCGCAGGCACCGCAACCG sooosssssssssooss 1521 1538 46 895

672733 GGCGCAGGCACCGCAACC sooosssssssssooss 1522 1539 7 896

672734 GGGCGCAGGCACCGCAAC sooosssssssssooss 1523 1540 26 897

Table 39

Percent inhibition of the C90RF72 pathogenic associated mRNA variant compared to PBS control by

Deoxy, MOE and cEt antisense oligonucleotides with mixed backbones targeting SEQ ID NO: 2

SEQ

SEQ ID SEQ

ISIS ID NO: %

Sequence Chemistry Linkage NO: 2 ID NO 2 Start inhibition

Stop NO

Site

576816 GCCTTACTCTAGGACCAAGA eeeee-dlO-eeeee sssssssssssssssssss 7990 8009 71 20

672735 TGAGAGCAAGTAGTGGG eeekk-d7-kkeee soosssssssssooss 1326 1342 5 898

672736 GTGAGAGCAAGTAGTGG eeekk-d7-kkeee soosssssssssooss 1327 1343 35 899

672737 TGTGAGAGCAAGTAGTG eeekk-d7-kkeee soosssssssssooss 1328 1344 0 900

672738 CTGTGAGAGCAAGTAGT eeekk-d7-kkeee soosssssssssooss 1329 1345 63 901

672739 ACTGTGAGAGCAAGTAG eeekk-d7-kkeee soosssssssssooss 1330 1346 0 902

672740 TACTGTGAGAGCAAGTA eeekk-d7-kkeee soosssssssssooss 1331 1347 65 903

672741 GTACTGTGAGAGCAAGT eeekk-d7-kkeee soosssssssssooss 1332 1348 13 904

672742 AGTACTGTGAGAGCAAG eeekk-d7-kkeee soosssssssssooss 1333 1349 46 905

672743 GAGTACTGTGAGAGCAA eeekk-d7-kkeee soosssssssssooss 1334 1350 55 906

672744 CGAGTACTGTGAGAGCA eeekk-d7-kkeee soosssssssssooss 1335 1351 76 907

672745 GCGAGTACTGTGAGAGC eeekk-d7-kkeee soosssssssssooss 1336 1352 11 908

672746 AGCGAGTACTGTGAGAG eeekk-d7-kkeee soosssssssssooss 1337 1353 11 909

672747 CAGCGAGTACTGTGAGA eeekk-d7-kkeee soosssssssssooss 1338 1354 51 910

672748 TCAGCGAGTACTGTGAG eeekk-d7-kkeee soosssssssssooss 1339 1355 20 911

672749 CTCAGCGAGTACTGTGA eeekk-d7-kkeee soosssssssssooss 1340 1356 12 912

672750 CCTCAGCGAGTACTGTG eeekk-d7-kkeee soosssssssssooss 1341 1357 2 913

672751 CCCTCAGCGAGTACTGT eeekk-d7-kkeee soosssssssssooss 1342 1358 39 914

672752 ACCCTCAGCGAGTACTG eeekk-d7-kkeee soosssssssssooss 1343 1359 27 915

672753 CACCCTCAGCGAGTACT eeekk-d7-kkeee soosssssssssooss 1344 1360 33 916

672754 TCACCCTCAGCGAGTAC eeekk-d7-kkeee soosssssssssooss 1345 1361 0 917

672755 TTCACCCTCAGCGAGTA eeekk-d7-kkeee soosssssssssooss 1346 1362 13 918

672756 GTTCACCCTCAGCGAGT eeekk-d7-kkeee soosssssssssooss 1347 1363 45 919

672757 TGTTCACCCTCAGCGAG eeekk-d7-kkeee soosssssssssooss 1348 1364 11 920

672758 TTGTTCACCCTCAGCGA eeekk-d7-kkeee soosssssssssooss 1349 1365 0 921

672759 CTTGTTCACCCTCAGCG eeekk-d7-kkeee soosssssssssooss 1350 1366 12 922

672760 TCTTGTTCACCCTCAGC eeekk-d7-kkeee soosssssssssooss 1351 1367 21 923 672761 TTCTTGTTCACCCTCAG eeekk-d7-kkeee soosssssssssooss 1352 1368 0 924

672762 TTTCTTGTTCACCCTCA eeekk-d7-kkeee soosssssssssooss 1353 1369 34 925

672763 TTTTCTTGTTCACCCTC eeekk-d7-kkeee soosssssssssooss 1354 1370 16 926

672764 CTTTTCTTGTTCACCCT eeekk-d7-kkeee soosssssssssooss 1355 1371 2 927

672765 TCTTTTCTTGTTCACCC eeekk-d7-kkeee soosssssssssooss 1356 1372 24 928

672766 GTCTTTTCTTGTTCACC eeekk-d7-kkeee soosssssssssooss 1357 1373 28 929

672767 GGTCTTTTCTTGTTCAC eeekk-d7-kkeee soosssssssssooss 1358 1374 30 930

672768 AGGTCTTTTCTTGTTCA eeekk-d7-kkeee soosssssssssooss 1359 1375 14 931

672769 CAGGTCTTTTCTTGTTC eeekk-d7-kkeee soosssssssssooss 1360 1376 20 932

672770 TCAGGTCTTTTCTTGTT eeekk-d7-kkeee soosssssssssooss 1361 1377 2 933

672771 ATCAGGTCTTTTCTTGT eeekk-d7-kkeee soosssssssssooss 1362 1378 0 934

672772 TATCAGGTCTTTTCTTG eeekk-d7-kkeee soosssssssssooss 1363 1379 23 935

672773 TTATCAGGTCTTTTCTT eeekk-d7-kkeee soosssssssssooss 1364 1380 39 936

672774 ATCTTTATCAGGTCTTT eeekk-d7-kkeee soosssssssssooss 1368 1384 92 937

672775 AATCTTTATCAGGTCTT eeekk-d7-kkeee soosssssssssooss 1369 1385 61 938

672776 TAATCTTTATCAGGTCT eeekk-d7-kkeee soosssssssssooss 1370 1386 2 939

672777 TTAATCTTTATCAGGTC eeekk-d7-kkeee soosssssssssooss 1371 1387 33 940

672778 GTTAATCTTTATCAGGT eeekk-d7-kkeee soosssssssssooss 1372 1388 53 941

672779 GGTTAATCTTTATCAGG eeekk-d7-kkeee soosssssssssooss 1373 1389 40 942

672780 TGGTTAATCTTTATCAG eeekk-d7-kkeee soosssssssssooss 1374 1390 26 943

672781 CTGGTTAATCTTTATCA eeekk-d7-kkeee soosssssssssooss 1375 1391 25 944

672782 TCTGGTTAATCTTTATC eeekk-d7-kkeee soosssssssssooss 1376 1392 44 945

672783 CCCTCCTTGTTTTCTTC eeekk-d7-kkeee soosssssssssooss 1391 1407 37 946

672784 TCCCTCCTTGTTTTCTT eeekk-d7-kkeee soosssssssssooss 1392 1408 10 947

672785 TTCCCTCCTTGTTTTCT eeekk-d7-kkeee soosssssssssooss 1393 1409 0 948

672786 TTTCCCTCCTTGTTTTC eeekk-d7-kkeee soosssssssssooss 1394 1410 0 949

672787 GTTTCCCTCCTTGTTTT eeekk-d7-kkeee soosssssssssooss 1395 1411 0 950

672788 TGTTTCCCTCCTTGTTT eeekk-d7-kkeee soosssssssssooss 1396 1412 0 951

672789 TTGTTTCCCTCCTTGTT eeekk-d7-kkeee soosssssssssooss 1397 1413 0 952

672790 GGTTGTTTCCCTCCTTG eeekk-d7-kkeee soosssssssssooss 1399 1415 33 953

672791 CGGTTGTTTCCCTCCTT eeekk-d7-kkeee soosssssssssooss 1400 1416 0 954

672792 GCGGTTGTTTCCCTCCT eeekk-d7-kkeee soosssssssssooss 1401 1417 23 955

672793 TGCGGTTGTTTCCCTCC eeekk-d7-kkeee soosssssssssooss 1402 1418 0 956

672794 CTGCGGTTGTTTCCCTC eeekk-d7-kkeee soosssssssssooss 1403 1419 25 957

672795 GCTGCGGTTGTTTCCCT eeekk-d7-kkeee soosssssssssooss 1404 1420 5 958

672796 GGCTGCGGTTGTTTCCC eeekk-d7-kkeee soosssssssssooss 1405 1421 16 959

672797 AGGCTGCGGTTGTTTCC eeekk-d7-kkeee soosssssssssooss 1406 1422 7 960

672798 CAGGCTGCGGTTGTTTC eeekk-d7-kkeee soosssssssssooss 1407 1423 0 961

672799 ACAGGCTGCGGTTGTTT eeekk-d7-kkeee soosssssssssooss 1408 1424 28 962

672800 TACAGGCTGCGGTTGTT eeekk-d7-kkeee soosssssssssooss 1409 1425 33 963

672801 CTACAGGCTGCGGTTGT eeekk-d7-kkeee soosssssssssooss 1410 1426 53 964 672802 GCTACAGGCTGCGGTTG eeekk-d7-kkeee soosssssssssooss 1411 1427 0 965

672803 TGCTACAGGCTGCGGTT eeekk-d7-kkeee soosssssssssooss 1412 1428 0 966

672804 TTGCTACAGGCTGCGGT eeekk-d7-kkeee soosssssssssooss 1413 1429 0 967

672805 CTTGCTACAGGCTGCGG eeekk-d7-kkeee soosssssssssooss 1414 1430 1 968

672806 GCTTGCTACAGGCTGCG eeekk-d7-kkeee soosssssssssooss 1415 1431 58 969

672807 AGCTTGCTACAGGCTGC eeekk-d7-kkeee soosssssssssooss 1416 1432 0 970

672808 GAGCTTGCTACAGGCTG eeekk-d7-kkeee soosssssssssooss 1417 1433 0 971

672809 AGAGCTTGCTACAGGCT eeekk-d7-kkeee soosssssssssooss 1418 1434 71 972

672810 CAGAGCTTGCTACAGGC eeekk-d7-kkeee soosssssssssooss 1419 1435 18 973

672811 CCAGAGCTTGCTACAGG eeekk-d7-kkeee soosssssssssooss 1420 1436 0 974

672812 TCCAGAGCTTGCTACAG eeekk-d7-kkeee soosssssssssooss 1421 1437 19 975

672813 TTCCAGAGCTTGCTACA eeekk-d7-kkeee soosssssssssooss 1422 1438 19 976

672814 GTTCCAGAGCTTGCTAC eeekk-d7-kkeee soosssssssssooss 1423 1439 0 977

672815 AGTTCCAGAGCTTGCTA eeekk-d7-kkeee soosssssssssooss 1424 1440 0 978

672816 GAGTTCCAGAGCTTGCT eeekk-d7-kkeee soosssssssssooss 1425 1441 14 979

672817 TGAGTTCCAGAGCTTGC eeekk-d7-kkeee soosssssssssooss 1426 1442 31 980

672818 CTGAGTTCCAGAGCTTG eeekk-d7-kkeee soosssssssssooss 1427 1443 21 981

672819 CCTGAGTTCCAGAGCTT eeekk-d7-kkeee soosssssssssooss 1428 1444 19 982

672820 TCCTGAGTTCCAGAGCT eeekk-d7-kkeee soosssssssssooss 1429 1445 46 983

672821 CTCCTGAGTTCCAGAGC eeekk-d7-kkeee soosssssssssooss 1430 1446 7 984

672822 ACTCCTGAGTTCCAGAG eeekk-d7-kkeee soosssssssssooss 1431 1447 13 985

672823 GACTCCTGAGTTCCAGA eeekk-d7-kkeee soosssssssssooss 1432 1448 19 986

672824 CGACTCCTGAGTTCCAG eeekk-d7-kkeee soosssssssssooss 1433 1449 23 987

672825 GCGACTCCTGAGTTCCA eeekk-d7-kkeee soosssssssssooss 1434 1450 0 988

672826 CGCGACTCCTGAGTTCC eeekk-d7-kkeee soosssssssssooss 1435 1451 19 989

672827 GCGCGACTCCTGAGTTC eeekk-d7-kkeee soosssssssssooss 1436 1452 31 990

672828 CGCGCGACTCCTGAGTT eeekk-d7-kkeee soosssssssssooss 1437 1453 63 991

672829 GCGCGCGACTCCTGAGT eeekk-d7-kkeee soosssssssssooss 1438 1454 28 992

672830 AGCGCGCGACTCCTGAG eeekk-d7-kkeee soosssssssssooss 1439 1455 58 993

672831 TAGCGCGCGACTCCTGA eeekk-d7-kkeee soosssssssssooss 1440 1456 42 994

672832 CTAGCGCGCGACTCCTG eeekk-d7-kkeee soosssssssssooss 1441 1457 42 995

672833 CCTAGCGCGCGACTCCT eeekk-d7-kkeee soosssssssssooss 1442 1458 24 996

672834 CCCTAGCGCGCGACTCC eeekk-d7-kkeee soosssssssssooss 1443 1459 58 997

672835 CCCCTAGCGCGCGACTC eeekk-d7-kkeee soosssssssssooss 1444 1460 40 998

672836 GCCCCTAGCGCGCGACT eeekk-d7-kkeee soosssssssssooss 1445 1461 0 999

672837 GGCCCCTAGCGCGCGAC eeekk-d7-kkeee soosssssssssooss 1446 1462 2 1000

672838 CGGCCCCTAGCGCGCGA eeekk-d7-kkeee soosssssssssooss 1447 1463 72 1001

672839 CCGGCCCCTAGCGCGCG eeekk-d7-kkeee soosssssssssooss 1448 1464 0 1002

672840 CCCGGCCCCTAGCGCGC eeekk-d7-kkeee soosssssssssooss 1449 1465 28 1003

672841 CCCCGGCCCCTAGCGCG eeekk-d7-kkeee soosssssssssooss 1450 1466 28 1004

672842 GCCCCGGCCCCTAGCGC eeekk-d7-kkeee soosssssssssooss 1451 1467 0 1005 672843 GGCCCCGGCCCCTAGCG eeekk-d7-kkeee soosssssssssooss 1452 1468 23 1006

672844 CGGCCCCGGCCCCTAGC eeekk-d7-kkeee soosssssssssooss 1453 1469 26 1007

672845 CCGGCCCCGGCCCCTAG eeekk-d7-kkeee soosssssssssooss 1454 1470 24 1008

672846 CCCGGCCCCGGCCCCTA eeekk-d7-kkeee soosssssssssooss 1455 1471 9 1009

672847 ACGCCCCGGCCCCGGCC eeekk-d7-kkeee soosssssssssooss 1465 1481 3 1010

672848 CACGCCCCGGCCCCGGC eeekk-d7-kkeee soosssssssssooss 1466 1482 19 1011

672849 CCACGCCCCGGCCCCGG eeekk-d7-kkeee soosssssssssooss 1467 1483 50 1012

672850 ACCACGCCCCGGCCCCG eeekk-d7-kkeee soosssssssssooss 1468 1484 0 1013

672851 GACCACGCCCCGGCCCC eeekk-d7-kkeee soosssssssssooss 1469 1485 3 1014

672852 CGACCACGCCCCGGCCC eeekk-d7-kkeee soosssssssssooss 1470 1486 9 1015

672853 CCGACCACGCCCCGGCC eeekk-d7-kkeee soosssssssssooss 1471 1487 24 1016

672854 CCCGACCACGCCCCGGC eeekk-d7-kkeee soosssssssssooss 1472 1488 9 1017

672855 CCCCGACCACGCCCCGG eeekk-d7-kkeee soosssssssssooss 1473 1489 18 1018

672856 GCCCCGACCACGCCCCG eeekk-d7-kkeee soosssssssssooss 1474 1490 8 1019

672857 CGCCCCGACCACGCCCC eeekk-d7-kkeee soosssssssssooss 1475 1491 0 1020

672858 CCGCCCCGACCACGCCC eeekk-d7-kkeee soosssssssssooss 1476 1492 48 1021

672859 CCCGCCCCGACCACGCC eeekk-d7-kkeee soosssssssssooss 1477 1493 28 1022

672860 GCCCGCCCCGACCACGC eeekk-d7-kkeee soosssssssssooss 1478 1494 0 1023

672861 GGCCCGCCCCGACCACG eeekk-d7-kkeee soosssssssssooss 1479 1495 33 1024

672862 GGGCCCGCCCCGACCAC eeekk-d7-kkeee soosssssssssooss 1480 1496 32 1025

672863 CGGGCCCGCCCCGACCA eeekk-d7-kkeee soosssssssssooss 1481 1497 0 1026

672864 CCGGGCCCGCCCCGACC eeekk-d7-kkeee soosssssssssooss 1482 1498 0 1027

672865 CCCGGGCCCGCCCCGAC eeekk-d7-kkeee soosssssssssooss 1483 1499 11 1028

672866 GCAGCCCCGCCCCGGGC eeekk-d7-kkeee soosssssssssooss 1505 1521 23 1029

672867 CGCAGCCCCGCCCCGGG eeekk-d7-kkeee soosssssssssooss 1506 1522 26 1030

672868 CCGCAGCCCCGCCCCGG eeekk-d7-kkeee soosssssssssooss 1507 1523 2 1031

672869 ACCGCAGCCCCGCCCCG eeekk-d7-kkeee soosssssssssooss 1508 1524 8 1032

672870 AACCGCAGCCCCGCCCC eeekk-d7-kkeee soosssssssssooss 1509 1525 7 1033

672871 CAACCGCAGCCCCGCCC eeekk-d7-kkeee soosssssssssooss 1510 1526 1 1034

672872 GCAACCGCAGCCCCGCC eeekk-d7-kkeee soosssssssssooss 1511 1527 37 1035

672873 CGCAACCGCAGCCCCGC eeekk-d7-kkeee soosssssssssooss 1512 1528 20 1036

672874 CCGCAACCGCAGCCCCG eeekk-d7-kkeee soosssssssssooss 1513 1529 23 1037

672875 ACCGCAACCGCAGCCCC eeekk-d7-kkeee soosssssssssooss 1514 1530 8 1038

672876 CACCGCAACCGCAGCCC eeekk-d7-kkeee soosssssssssooss 1515 1531 22 1039

672877 GCACCGCAACCGCAGCC eeekk-d7-kkeee soosssssssssooss 1516 1532 19 1040

672878 GGCACCGCAACCGCAGC eeekk-d7-kkeee soosssssssssooss 1517 1533 25 1041

672879 AGGCACCGCAACCGCAG eeekk-d7-kkeee soosssssssssooss 1518 1534 21 1042

672880 CAGGCACCGCAACCGCA eeekk-d7-kkeee soosssssssssooss 1519 1535 12 1043

672881 GCAGGCACCGCAACCGC eeekk-d7-kkeee soosssssssssooss 1520 1536 18 1044

672882 CGCAGGCACCGCAACCG eeekk-d7-kkeee soosssssssssooss 1521 1537 15 1045

672883 GCGCAGGCACCGCAACC eeekk-d7-kkeee soosssssssssooss 1522 1538 0 1046 GGCGCAGGCACCGCAAC eeekk-d7-kkeee soosssssssssooss 1523 1539 0 1047

Example 9: Dose-dependent antisense inhibition of human C90RF72 mRNA in HepG2 cells

Antisense oligonucleotides from the study described in Example 8 hereinabove exhibiting significant in vitro inhibition of C90RF72 mRNA were selected and tested at various doses in HepG2 cells. ISIS

576816, previously tested in PCT/US2013/065073 (claiming priority to US Application No. 61/714,132, filed October 15, 2012, was used as a benchmark oligonucleotide. Cells were plated at a density of 20,000 cells per well and transfected using electrop oration with 0.11 μΜ, 0.33 μΜ, 1.00 μΜ, or 3.00 μΜ concentrations of antisense oligonucleotide. After a treatment period of approximately 16 hours, RNA was isolated from the cells and C90RF72 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3905 was used to measure the C90RF72 pathogenic associated mRNA variant, which is the product of a pre-mRNA containing a hexanucleotide repeat. C90RF72 mRNA levels were adjusted according to total

RNA content, as measured by RIBOGREEN^®. Results are presented as percent inhibition of C90RF72 levels, relative to untreated control cells.

As shown in Tables 39 and 40, total C90RF72 mRNA levels were reduced in a dose-dependent manner in some of the antisense oligonucleotide treated cells.

Table 39

Dose-dependent inhibition of the C90RF72 pathogenic associated mRNA variant transcript levels in

HepG2 cells

672619 8 12 6 0

672608 12 45 37 59

672598 21 9 55 69

672642 28 35 59 72

Table 40

HepG2 cells

Example 10: Antisense inhibition of C90RF72 by Deoxy, MOE and cEt antisense oligonucleotides with mixed backbones

Antisense oligonucleotides described in Example 6 hereinabove (see Tables 25-28 hereinabove) were tested in HepG2 cells in a series of experiments that had similar culture conditions. ISIS 576816, which was previously tested in PCT/US2013/065073 (claiming priority to US Application No. 61/714,132, filed October 15, 2012) was used as a benchmark oligonucleotide for study with deoxy, MOE, and cEt antisense oligonucleotides. The results for each experiment are presented in tables shown below. Cultured HepG2 cells at a density of 20,000 cells per well were transfected using electrop oration with 700 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and C90RF72 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3905 was used to measure the C90RF72 pathogenic associated mRNA variant, which is the product of a pre- mRNA containing a hexanucleotide repeat. The levels of the C90RF72 pathogenic associated mRNA variant were normalized to the total RNA content of the cell, as measured by RIBOGREEN®. Results are presented as percent inhibition of C90RF72, relative to untreated control cells.

Table 41

672903 CACCCTCAGCGAGTACT eekk-d8-kkeee soosssssssssooss 1344 1360 59 916

672904 TCACCCTCAGCGAGTAC eekk-d8-kkeee soosssssssssooss 1345 1361 52 917

672905 TTCACCCTCAGCGAGTA eekk-d8-kkeee soosssssssssooss 1346 1362 50 918

672906 GTTCACCCTCAGCGAGT eekk-d8-kkeee soosssssssssooss 1347 1363 38 919

672907 TGTTCACCCTCAGCGAG eekk-d8-kkeee soosssssssssooss 1348 1364 20 920

672908 TTGTTCACCCTCAGCGA eekk-d8-kkeee soosssssssssooss 1349 1365 57 921

672909 CTTGTTCACCCTCAGCG eekk-d8-kkeee soosssssssssooss 1350 1366 66 922

672910 TCTTGTTCACCCTCAGC eekk-d8-kkeee soosssssssssooss 1351 1367 47 923

672911 TTCTTGTTCACCCTCAG eekk-d8-kkeee soosssssssssooss 1352 1368 37 924

672912 TTTCTTGTTCACCCTCA eekk-d8-kkeee soosssssssssooss 1353 1369 36 925

672913 TTTTCTTGTTCACCCTC eekk-d8-kkeee soosssssssssooss 1354 1370 34 926

672914 CTTTTCTTGTTCACCCT eekk-d8-kkeee soosssssssssooss 1355 1371 35 927

672915 TCTTTTCTTGTTCACCC eekk-d8-kkeee soosssssssssooss 1356 1372 41 928

672916 GTCTTTTCTTGTTCACC eekk-d8-kkeee soosssssssssooss 1357 1373 34 929

672917 GGTCTTTTCTTGTTCAC eekk-d8-kkeee soosssssssssooss 1358 1374 23 930

672918 AGGTCTTTTCTTGTTCA eekk-d8-kkeee soosssssssssooss 1359 1375 31 931

672919 CAGGTCTTTTCTTGTTC eekk-d8-kkeee soosssssssssooss 1360 1376 51 932

672920 TCAGGTCTTTTCTTGTT eekk-d8-kkeee soosssssssssooss 1361 1377 15 933

672921 ATCAGGTCTTTTCTTGT eekk-d8-kkeee soosssssssssooss 1362 1378 0 934

672922 TATCAGGTCTTTTCTTG eekk-d8-kkeee soosssssssssooss 1363 1379 31 935

672923 TTATCAGGTCTTTTCTT eekk-d8-kkeee soosssssssssooss 1364 1380 14 936

672924 ATCTTTATCAGGTCTTT eekk-d8-kkeee soosssssssssooss 1368 1384 71 937

672925 AATCTTTATCAGGTCTT eekk-d8-kkeee soosssssssssooss 1369 1385 72 938

672926 TAATCTTTATCAGGTCT eekk-d8-kkeee soosssssssssooss 1370 1386 40 939

672927 TTAATCTTTATCAGGTC eekk-d8-kkeee soosssssssssooss 1371 1387 66 940

672928 GTTAATCTTTATCAGGT eekk-d8-kkeee soosssssssssooss 1372 1388 56 941

672929 GGTTAATCTTTATCAGG eekk-d8-kkeee soosssssssssooss 1373 1389 80 942

672930 TGGTTAATCTTTATCAG eekk-d8-kkeee soosssssssssooss 1374 1390 48 943

672931 CTGGTTAATCTTTATCA eekk-d8-kkeee soosssssssssooss 1375 1391 48 944

672932 TCTGGTTAATCTTTATC eekk-d8-kkeee soosssssssssooss 1376 1392 54 945

672933 CCCTCCTTGTTTTCTTC eekk-d8-kkeee soosssssssssooss 1391 1407 18 946

672934 TCCCTCCTTGTTTTCTT eekk-d8-kkeee soosssssssssooss 1392 1408 7 947

672935 TTCCCTCCTTGTTTTCT eekk-d8-kkeee soosssssssssooss 1393 1409 10 948 672936 TTTCCCTCCTTGTTTTC eekk-d8-kkeee soosssssssssooss 1394 1410 0 949

672937 GTTTCCCTCCTTGTTTT eekk-d8-kkeee soosssssssssooss 1395 1411 0 950

672938 TGTTTCCCTCCTTGTTT eekk-d8-kkeee soosssssssssooss 1396 1412 9 951

672939 TTGTTTCCCTCCTTGTT eekk-d8-kkeee soosssssssssooss 1397 1413 27 952

672940 GGTTGTTTCCCTCCTTG eekk-d8-kkeee soosssssssssooss 1399 1415 49 953

672941 CGGTTGTTTCCCTCCTT eekk-d8-kkeee soosssssssssooss 1400 1416 17 954

672942 GCGGTTGTTTCCCTCCT eekk-d8-kkeee soosssssssssooss 1401 1417 10 955

672943 TGCGGTTGTTTCCCTCC eekk-d8-kkeee soosssssssssooss 1402 1418 33 956

672944 CTGCGGTTGTTTCCCTC eekk-d8-kkeee soosssssssssooss 1403 1419 29 957

672945 GCTGCGGTTGTTTCCCT eekk-d8-kkeee soosssssssssooss 1404 1420 23 958

672946 GGCTGCGGTTGTTTCCC eekk-d8-kkeee soosssssssssooss 1405 1421 15 959

672947 AGGCTGCGGTTGTTTCC eekk-d8-kkeee soosssssssssooss 1406 1422 24 960

672948 CAGGCTGCGGTTGTTTC eekk-d8-kkeee soosssssssssooss 1407 1423 49 961

672949 ACAGGCTGCGGTTGTTT eekk-d8-kkeee soosssssssssooss 1408 1424 35 962

672950 TACAGGCTGCGGTTGTT eekk-d8-kkeee soosssssssssooss 1409 1425 37 963

672951 CTACAGGCTGCGGTTGT eekk-d8-kkeee soosssssssssooss 1410 1426 4 964

672952 GCTACAGGCTGCGGTTG eekk-d8-kkeee soosssssssssooss 1411 1427 4 965

672953 TGCTACAGGCTGCGGTT eekk-d8-kkeee soosssssssssooss 1412 1428 24 966

672954 TTGCTACAGGCTGCGGT eekk-d8-kkeee soosssssssssooss 1413 1429 8 967

672955 CTTGCTACAGGCTGCGG eekk-d8-kkeee soosssssssssooss 1414 1430 28 968

672956 GCTTGCTACAGGCTGCG eekk-d8-kkeee soosssssssssooss 1415 1431 8 969

672957 AGCTTGCTACAGGCTGC eekk-d8-kkeee soosssssssssooss 1416 1432 5 970

672958 GAGCTTGCTACAGGCTG eekk-d8-kkeee soosssssssssooss 1417 1433 4 971

672959 AGAGCTTGCTACAGGCT eekk-d8-kkeee soosssssssssooss 1418 1434 0 972

672960 CAGAGCTTGCTACAGGC eekk-d8-kkeee soosssssssssooss 1419 1435 12 973

672961 CCAGAGCTTGCTACAGG eekk-d8-kkeee soosssssssssooss 1420 1436 36 974

672962 TCCAGAGCTTGCTACAG eekk-d8-kkeee soosssssssssooss 1421 1437 0 975

672963 TTCCAGAGCTTGCTACA eekk-d8-kkeee soosssssssssooss 1422 1438 11 976

672964 GTTCCAGAGCTTGCTAC eekk-d8-kkeee soosssssssssooss 1423 1439 8 977

672965 AGTTCCAGAGCTTGCTA eekk-d8-kkeee soosssssssssooss 1424 1440 19 978

672966 GAGTTCCAGAGCTTGCT eekk-d8-kkeee soosssssssssooss 1425 1441 48 979

672967 TGAGTTCCAGAGCTTGC eekk-d8-kkeee soosssssssssooss 1426 1442 41 980

672968 CTGAGTTCCAGAGCTTG eekk-d8-kkeee soosssssssssooss 1427 1443 54 981 672969 CCTGAGTTCCAGAGCTT eekk-d8-kkeee soosssssssssooss 1428 1444 58 982

672970 TCCTGAGTTCCAGAGCT eekk-d8-kkeee soosssssssssooss 1429 1445 12 983

672971 CTCCTGAGTTCCAGAGC eekk-d8-kkeee soosssssssssooss 1430 1446 23 984

672972 ACTCCTGAGTTCCAGAG eekk-d8-kkeee soosssssssssooss 1431 1447 30 985

672973 GACTCCTGAGTTCCAGA eekk-d8-kkeee soosssssssssooss 1432 1448 39 986

672974 CGACTCCTGAGTTCCAG eekk-d8-kkeee soosssssssssooss 1433 1449 41 987

672975 GCGACTCCTGAGTTCCA eekk-d8-kkeee soosssssssssooss 1434 1450 31 988

672976 CGCGACTCCTGAGTTCC eekk-d8-kkeee soosssssssssooss 1435 1451 56 989

672977 GCGCGACTCCTGAGTTC eekk-d8-kkeee soosssssssssooss 1436 1452 31 990

672978 CGCGCGACTCCTGAGTT eekk-d8-kkeee soosssssssssooss 1437 1453 45 991

672979 GCGCGCGACTCCTGAGT eekk-d8-kkeee soosssssssssooss 1438 1454 29 992

672980 AGCGCGCGACTCCTGAG eekk-d8-kkeee soosssssssssooss 1439 1455 48 993

672981 TAGCGCGCGACTCCTGA eekk-d8-kkeee soosssssssssooss 1440 1456 68 994

672982 CTAGCGCGCGACTCCTG eekk-d8-kkeee soosssssssssooss 1441 1457 59 995

672983 CCTAGCGCGCGACTCCT eekk-d8-kkeee soosssssssssooss 1442 1458 62 996

672984 CCCTAGCGCGCGACTCC eekk-d8-kkeee soosssssssssooss 1443 1459 69 997

672985 CCCCTAGCGCGCGACTC eekk-d8-kkeee soosssssssssooss 1444 1460 65 998

672986 GCCCCTAGCGCGCGACT eekk-d8-kkeee soosssssssssooss 1445 1461 34 999

672987 GGCCCCTAGCGCGCGAC eekk-d8-kkeee soosssssssssooss 1446 1462 22 1000

672988 CGGCCCCTAGCGCGCGA eekk-d8-kkeee soosssssssssooss 1447 1463 16 1001

672989 CCGGCCCCTAGCGCGCG eekk-d8-kkeee soosssssssssooss 1448 1464 24 1002

672990 CCCGGCCCCTAGCGCGC eekk-d8-kkeee soosssssssssooss 1449 1465 10 1003

672991 CCCCGGCCCCTAGCGCG eekk-d8-kkeee soosssssssssooss 1450 1466 24 1004

672992 GCCCCGGCCCCTAGCGC eekk-d8-kkeee soosssssssssooss 1451 1467 29 1005

672993 GGCCCCGGCCCCTAGCG eekk-d8-kkeee soosssssssssooss 1452 1468 24 1006

672994 CGGCCCCGGCCCCTAGC eekk-d8-kkeee soosssssssssooss 1453 1469 25 1007

672995 CCGGCCCCGGCCCCTAG eekk-d8-kkeee soosssssssssooss 1454 1470 28 1008

672996 CCCGGCCCCGGCCCCTA eekk-d8-kkeee soosssssssssooss 1455 1471 25 1009

672997 ACGCCCCGGCCCCGGCC eekk-d8-kkeee soosssssssssooss 1465 1481 21 1010

672998 CACGCCCCGGCCCCGGC eekk-d8-kkeee soosssssssssooss 1466 1482 17 1011

672999 CCACGCCCCGGCCCCGG eekk-d8-kkeee soosssssssssooss 1467 1483 30 1012

673000 ACCACGCCCCGGCCCCG eekk-d8-kkeee soosssssssssooss 1468 1484 29 1013

673001 GACCACGCCCCGGCCCC eekk-d8-kkeee soosssssssssooss 1469 1485 25 1014 673002 CGACCACGCCCCGGCCC eekk-d8-kkeee soosssssssssooss 1470 1486 37 1015

673003 CCGACCACGCCCCGGCC eekk-d8-kkeee soosssssssssooss 1471 1487 23 1016

673004 CCCGACCACGCCCCGGC eekk-d8-kkeee soosssssssssooss 1472 1488 21 1017

673005 CCCCGACCACGCCCCGG eekk-d8-kkeee soosssssssssooss 1473 1489 9 1018

673006 GCCCCGACCACGCCCCG eekk-d8-kkeee soosssssssssooss 1474 1490 13 1019

673007 CGCCCCGACCACGCCCC eekk-d8-kkeee soosssssssssooss 1475 1491 17 1020

673008 CCGCCCCGACCACGCCC eekk-d8-kkeee soosssssssssooss 1476 1492 20 1021

673009 CCCGCCCCGACCACGCC eekk-d8-kkeee soosssssssssooss 1477 1493 36 1022

673010 GCCCGCCCCGACCACGC eekk-d8-kkeee soosssssssssooss 1478 1494 16 1023

673011 GGCCCGCCCCGACCACG eekk-d8-kkeee soosssssssssooss 1479 1495 3 1024

673012 GGGCCCGCCCCGACCAC eekk-d8-kkeee soosssssssssooss 1480 1496 21 1025

673013 CGGGCCCGCCCCGACCA eekk-d8-kkeee soosssssssssooss 1481 1497 4 1026

673014 CCGGGCCCGCCCCGACC eekk-d8-kkeee soosssssssssooss 1482 1498 21 1027

673015 CCCGGGCCCGCCCCGAC eekk-d8-kkeee soosssssssssooss 1483 1499 15 1028

673016 GCAGCCCCGCCCCGGGC eekk-d8-kkeee soosssssssssooss 1505 1521 3 1029

673017 CGCAGCCCCGCCCCGGG eekk-d8-kkeee soosssssssssooss 1506 1522 7 1030

673018 CCGCAGCCCCGCCCCGG eekk-d8-kkeee soosssssssssooss 1507 1523 7 1031

673019 ACCGCAGCCCCGCCCCG eekk-d8-kkeee soosssssssssooss 1508 1524 8 1032

673020 AACCGCAGCCCCGCCCC eekk-d8-kkeee soosssssssssooss 1509 1525 42 1033

673021 CAACCGCAGCCCCGCCC eekk-d8-kkeee soosssssssssooss 1510 1526 58 1034

673022 GCAACCGCAGCCCCGCC eekk-d8-kkeee soosssssssssooss 1511 1527 44 1035

673023 CGCAACCGCAGCCCCGC eekk-d8-kkeee soosssssssssooss 1512 1528 46 1036

673024 CCGCAACCGCAGCCCCG eekk-d8-kkeee soosssssssssooss 1513 1529 26 1037

673025 ACCGCAACCGCAGCCCC eekk-d8-kkeee soosssssssssooss 1514 1530 20 1038

673026 CACCGCAACCGCAGCCC eekk-d8-kkeee soosssssssssooss 1515 1531 52 1039

673027 GCACCGCAACCGCAGCC eekk-d8-kkeee soosssssssssooss 1516 1532 22 1040

673028 GGCACCGCAACCGCAGC eekk-d8-kkeee soosssssssssooss 1517 1533 32 1041

673029 AGGCACCGCAACCGCAG eekk-d8-kkeee soosssssssssooss 1518 1534 27 1042

673030 CAGGCACCGCAACCGCA eekk-d8-kkeee soosssssssssooss 1519 1535 32 1043

673031 GCAGGCACCGCAACCGC eekk-d8-kkeee soosssssssssooss 1520 1536 38 1044

673032 CGCAGGCACCGCAACCG eekk-d8-kkeee soosssssssssooss 1521 1537 54 1045

673033 GCGCAGGCACCGCAACC eekk-d8-kkeee soosssssssssooss 1522 1538 24 1046

673034 GGCGCAGGCACCGCAAC eekk-d8-kkeee soosssssssssooss 1523 1539 17 1047 Table 42

Percent inhibition of the C90RF72 pathogenic associated mRNA variant compared to PBS control by Deoxy, MOE and cEt antisense oligonucleotides with mixed backbones targeting SEQ ID NO: 2

673060 TCTTGTTCACCCTCAGC ek-d8-ekekeee sosssssssssoooss 1351 1367 41 923

673061 TTCTTGTTCACCCTCAG ek-d8-ekekeee sosssssssssoooss 1352 1368 14 924

673062 TTTCTTGTTCACCCTCA ek-d8-ekekeee sosssssssssoooss 1353 1369 28 925

673063 TTTTCTTGTTCACCCTC ek-d8-ekekeee sosssssssssoooss 1354 1370 38 926

673064 CTTTTCTTGTTCACCCT ek-d8-ekekeee sosssssssssoooss 1355 1371 38 927

673065 TCTTTTCTTGTTCACCC ek-d8-ekekeee sosssssssssoooss 1356 1372 30 928

673066 GTCTTTTCTTGTTCACC ek-d8-ekekeee sosssssssssoooss 1357 1373 47 929

673067 GGTCTTTTCTTGTTCAC ek-d8-ekekeee sosssssssssoooss 1358 1374 63 930

673068 AGGTCTTTTCTTGTTCA ek-d8-ekekeee sosssssssssoooss 1359 1375 71 931

673069 CAGGTCTTTTCTTGTTC ek-d8-ekekeee sosssssssssoooss 1360 1376 41 932

673070 TCAGGTCTTTTCTTGTT ek-d8-ekekeee sosssssssssoooss 1361 1377 24 933

673071 ATCAGGTCTTTTCTTGT ek-d8-ekekeee sosssssssssoooss 1362 1378 53 934

673072 TATCAGGTCTTTTCTTG ek-d8-ekekeee sosssssssssoooss 1363 1379 44 935

673073 TTATCAGGTCTTTTCTT ek-d8-ekekeee sosssssssssoooss 1364 1380 28 936

673074 ATCTTTATCAGGTCTTT ek-d8-ekekeee sosssssssssoooss 1368 1384 57 937

673075 AATCTTTATCAGGTCTT ek-d8-ekekeee sosssssssssoooss 1369 1385 49 938

673076 TAATCTTTATCAGGTCT ek-d8-ekekeee sosssssssssoooss 1370 1386 40 939

673077 TTAATCTTTATCAGGTC ek-d8-ekekeee sosssssssssoooss 1371 1387 33 940

673078 GTTAATCTTTATCAGGT ek-d8-ekekeee sosssssssssoooss 1372 1388 46 941

673079 GGTTAATCTTTATCAGG ek-d8-ekekeee sosssssssssoooss 1373 1389 87 942

673080 TGGTTAATCTTTATCAG ek-d8-ekekeee sosssssssssoooss 1374 1390 35 943

673081 CTGGTTAATCTTTATCA ek-d8-ekekeee sosssssssssoooss 1375 1391 56 944

673082 TCTGGTTAATCTTTATC ek-d8-ekekeee sosssssssssoooss 1376 1392 59 945

673083 CCCTCCTTGTTTTCTTC ek-d8-ekekeee sosssssssssoooss 1391 1407 11 946

673084 TCCCTCCTTGTTTTCTT ek-d8-ekekeee sosssssssssoooss 1392 1408 10 947

673085 TTCCCTCCTTGTTTTCT ek-d8-ekekeee sosssssssssoooss 1393 1409 8 948

673086 TTTCCCTCCTTGTTTTC ek-d8-ekekeee sosssssssssoooss 1394 1410 26 949

673087 GTTTCCCTCCTTGTTTT ek-d8-ekekeee sosssssssssoooss 1395 1411 25 950

673088 TGTTTCCCTCCTTGTTT ek-d8-ekekeee sosssssssssoooss 1396 1412 62 951

673089 TTGTTTCCCTCCTTGTT ek-d8-ekekeee sosssssssssoooss 1397 1413 51 952

673090 GGTTGTTTCCCTCCTTG ek-d8-ekekeee sosssssssssoooss 1399 1415 34 953

673091 CGGTTGTTTCCCTCCTT ek-d8-ekekeee sosssssssssoooss 1400 1416 13 954

673092 GCGGTTGTTTCCCTCCT ek-d8-ekekeee sosssssssssoooss 1401 1417 37 955 673093 TGCGGTTGTTTCCCTCC ek-d8-ekekeee sosssssssssoooss 1402 1418 49 956

673094 CTGCGGTTGTTTCCCTC ek-d8-ekekeee sosssssssssoooss 1403 1419 15 957

673095 GCTGCGGTTGTTTCCCT ek-d8-ekekeee sosssssssssoooss 1404 1420 17 958

673096 GGCTGCGGTTGTTTCCC ek-d8-ekekeee sosssssssssoooss 1405 1421 33 959

673097 AGGCTGCGGTTGTTTCC ek-d8-ekekeee sosssssssssoooss 1406 1422 43 960

673098 CAGGCTGCGGTTGTTTC ek-d8-ekekeee sosssssssssoooss 1407 1423 53 961

673099 ACAGGCTGCGGTTGTTT ek-d8-ekekeee sosssssssssoooss 1408 1424 21 962

673100 TACAGGCTGCGGTTGTT ek-d8-ekekeee sosssssssssoooss 1409 1425 23 963

673101 CTACAGGCTGCGGTTGT ek-d8-ekekeee sosssssssssoooss 1410 1426 16 964

673102 GCTACAGGCTGCGGTTG ek-d8-ekekeee sosssssssssoooss 1411 1427 24 965

673103 TGCTACAGGCTGCGGTT ek-d8-ekekeee sosssssssssoooss 1412 1428 41 966

673104 TTGCTACAGGCTGCGGT ek-d8-ekekeee sosssssssssoooss 1413 1429 30 967

673105 CTTGCTACAGGCTGCGG ek-d8-ekekeee sosssssssssoooss 1414 1430 13 968

673106 GCTTGCTACAGGCTGCG ek-d8-ekekeee sosssssssssoooss 1415 1431 7 969

673107 AGCTTGCTACAGGCTGC ek-d8-ekekeee sosssssssssoooss 1416 1432 7 970

673108 GAGCTTGCTACAGGCTG ek-d8-ekekeee sosssssssssoooss 1417 1433 23 971

673109 AGAGCTTGCTACAGGCT ek-d8-ekekeee sosssssssssoooss 1418 1434 38 972

673110 CAGAGCTTGCTACAGGC ek-d8-ekekeee sosssssssssoooss 1419 1435 22 973

673111 CCAGAGCTTGCTACAGG ek-d8-ekekeee sosssssssssoooss 1420 1436 14 974

673112 TCCAGAGCTTGCTACAG ek-d8-ekekeee sosssssssssoooss 1421 1437 11 975

673113 TTCCAGAGCTTGCTACA ek-d8-ekekeee sosssssssssoooss 1422 1438 24 976

673114 GTTCCAGAGCTTGCTAC ek-d8-ekekeee sosssssssssoooss 1423 1439 37 977

673115 AGTTCCAGAGCTTGCTA ek-d8-ekekeee sosssssssssoooss 1424 1440 34 978

673116 GAGTTCCAGAGCTTGCT ek-d8-ekekeee sosssssssssoooss 1425 1441 21 979

673117 TGAGTTCCAGAGCTTGC ek-d8-ekekeee sosssssssssoooss 1426 1442 47 980

673118 CTGAGTTCCAGAGCTTG ek-d8-ekekeee sosssssssssoooss 1427 1443 27 981

673119 CCTGAGTTCCAGAGCTT ek-d8-ekekeee sosssssssssoooss 1428 1444 44 982

673120 TCCTGAGTTCCAGAGCT ek-d8-ekekeee sosssssssssoooss 1429 1445 39 983

673121 CTCCTGAGTTCCAGAGC ek-d8-ekekeee sosssssssssoooss 1430 1446 37 984

673122 ACTCCTGAGTTCCAGAG ek-d8-ekekeee sosssssssssoooss 1431 1447 40 985

673123 GACTCCTGAGTTCCAGA ek-d8-ekekeee sosssssssssoooss 1432 1448 26 986

673124 CGACTCCTGAGTTCCAG ek-d8-ekekeee sosssssssssoooss 1433 1449 36 987

673125 GCGACTCCTGAGTTCCA ek-d8-ekekeee sosssssssssoooss 1434 1450 55 988 673126 CGCGACTCCTGAGTTCC ek-d8-ekekeee sosssssssssoooss 1435 1451 55 989

673127 GCGCGACTCCTGAGTTC ek-d8-ekekeee sosssssssssoooss 1436 1452 64 990

673128 CGCGCGACTCCTGAGTT ek-d8-ekekeee sosssssssssoooss 1437 1453 59 991

673129 GCGCGCGACTCCTGAGT ek-d8-ekekeee sosssssssssoooss 1438 1454 42 992

673130 AGCGCGCGACTCCTGAG ek-d8-ekekeee sosssssssssoooss 1439 1455 60 993

673131 TAGCGCGCGACTCCTGA ek-d8-ekekeee sosssssssssoooss 1440 1456 59 994

673132 CTAGCGCGCGACTCCTG ek-d8-ekekeee sosssssssssoooss 1441 1457 49 995

673133 CCTAGCGCGCGACTCCT ek-d8-ekekeee sosssssssssoooss 1442 1458 62 996

673134 CCCTAGCGCGCGACTCC ek-d8-ekekeee sosssssssssoooss 1443 1459 62 997

673135 CCCCTAGCGCGCGACTC ek-d8-ekekeee sosssssssssoooss 1444 1460 65 998

673136 GCCCCTAGCGCGCGACT ek-d8-ekekeee sosssssssssoooss 1445 1461 27 999

673137 GGCCCCTAGCGCGCGAC ek-d8-ekekeee sosssssssssoooss 1446 1462 6 1000

673138 CGGCCCCTAGCGCGCGA ek-d8-ekekeee sosssssssssoooss 1447 1463 26 1001

673139 CCGGCCCCTAGCGCGCG ek-d8-ekekeee sosssssssssoooss 1448 1464 15 1002

673140 CCCGGCCCCTAGCGCGC ek-d8-ekekeee sosssssssssoooss 1449 1465 24 1003

673141 CCCCGGCCCCTAGCGCG ek-d8-ekekeee sosssssssssoooss 1450 1466 27 1004

673142 GCCCCGGCCCCTAGCGC ek-d8-ekekeee sosssssssssoooss 1451 1467 28 1005

673143 GGCCCCGGCCCCTAGCG ek-d8-ekekeee sosssssssssoooss 1452 1468 28 1006

673144 CGGCCCCGGCCCCTAGC ek-d8-ekekeee sosssssssssoooss 1453 1469 49 1007

673145 CCGGCCCCGGCCCCTAG ek-d8-ekekeee sosssssssssoooss 1454 1470 24 1008

673146 CCCGGCCCCGGCCCCTA ek-d8-ekekeee sosssssssssoooss 1455 1471 32 1009

673147 ACGCCCCGGCCCCGGCC ek-d8-ekekeee sosssssssssoooss 1465 1481 12 1010

673148 CACGCCCCGGCCCCGGC ek-d8-ekekeee sosssssssssoooss 1466 1482 4 1011

673149 CCACGCCCCGGCCCCGG ek-d8-ekekeee sosssssssssoooss 1467 1483 18 1012

673150 ACCACGCCCCGGCCCCG ek-d8-ekekeee sosssssssssoooss 1468 1484 5 1013

673151 GACCACGCCCCGGCCCC ek-d8-ekekeee sosssssssssoooss 1469 1485 20 1014

673152 CGACCACGCCCCGGCCC ek-d8-ekekeee sosssssssssoooss 1470 1486 52 1015

673153 CCGACCACGCCCCGGCC ek-d8-ekekeee sosssssssssoooss 1471 1487 4 1016

673154 CCCGACCACGCCCCGGC ek-d8-ekekeee sosssssssssoooss 1472 1488 9 1017

673155 CCCCGACCACGCCCCGG ek-d8-ekekeee sosssssssssoooss 1473 1489 23 1018

673156 GCCCCGACCACGCCCCG ek-d8-ekekeee sosssssssssoooss 1474 1490 9 1019

673157 CGCCCCGACCACGCCCC ek-d8-ekekeee sosssssssssoooss 1475 1491 22 1020

673158 CCGCCCCGACCACGCCC ek-d8-ekekeee sosssssssssoooss 1476 1492 27 1021 673159 CCCGCCCCGACCACGCC ek-d8-ekekeee sosssssssssoooss 1477 1493 49 1022

673160 GCCCGCCCCGACCACGC ek-d8-ekekeee sosssssssssoooss 1478 1494 33 1023

673161 GGCCCGCCCCGACCACG ek-d8-ekekeee sosssssssssoooss 1479 1495 7 1024

673162 GGGCCCGCCCCGACCAC ek-d8-ekekeee sosssssssssoooss 1480 1496 8 1025

673163 CGGGCCCGCCCCGACCA ek-d8-ekekeee sosssssssssoooss 1481 1497 12 1026

673164 CCGGGCCCGCCCCGACC ek-d8-ekekeee sosssssssssoooss 1482 1498 2 1027

673165 CCCGGGCCCGCCCCGAC ek-d8-ekekeee sosssssssssoooss 1483 1499 13 1028

673166 GCAGCCCCGCCCCGGGC ek-d8-ekekeee sosssssssssoooss 1505 1521 7 1029

673167 CGCAGCCCCGCCCCGGG ek-d8-ekekeee sosssssssssoooss 1506 1522 14 1030

673168 CCGCAGCCCCGCCCCGG ek-d8-ekekeee sosssssssssoooss 1507 1523 17 1031

673169 ACCGCAGCCCCGCCCCG ek-d8-ekekeee sosssssssssoooss 1508 1524 44 1032

673170 AACCGCAGCCCCGCCCC ek-d8-ekekeee sosssssssssoooss 1509 1525 40 1033

673171 CAACCGCAGCCCCGCCC ek-d8-ekekeee sosssssssssoooss 1510 1526 45 1034

673172 GCAACCGCAGCCCCGCC ek-d8-ekekeee sosssssssssoooss 1511 1527 28 1035

673173 CGCAACCGCAGCCCCGC ek-d8-ekekeee sosssssssssoooss 1512 1528 31 1036

673174 CCGCAACCGCAGCCCCG ek-d8-ekekeee sosssssssssoooss 1513 1529 38 1037

673175 ACCGCAACCGCAGCCCC ek-d8-ekekeee sosssssssssoooss 1514 1530 47 1038

673176 CACCGCAACCGCAGCCC ek-d8-ekekeee sosssssssssoooss 1515 1531 37 1039

673177 GCACCGCAACCGCAGCC ek-d8-ekekeee sosssssssssoooss 1516 1532 41 1040

673178 GGCACCGCAACCGCAGC ek-d8-ekekeee sosssssssssoooss 1517 1533 34 1041

673179 AGGCACCGCAACCGCAG ek-d8-ekekeee sosssssssssoooss 1518 1534 19 1042

673180 CAGGCACCGCAACCGCA ek-d8-ekekeee sosssssssssoooss 1519 1535 36 1043

673181 GCAGGCACCGCAACCGC ek-d8-ekekeee sosssssssssoooss 1520 1536 33 1044

673182 CGCAGGCACCGCAACCG ek-d8-ekekeee sosssssssssoooss 1521 1537 37 1045

673183 GCGCAGGCACCGCAACC ek-d8-ekekeee sosssssssssoooss 1522 1538 6 1046

673184 GGCGCAGGCACCGCAAC ek-d8-ekekeee sosssssssssoooss 1523 1539 11 1047

Table 43

673210 TCTTGTTCACCCTCAGC keke-d8-ekeke soosssssssssooss 1351 1367 61 923

673211 TTCTTGTTCACCCTCAG keke-d8-ekeke soosssssssssooss 1352 1368 49 924

673212 TTTCTTGTTCACCCTCA keke-d8-ekeke soosssssssssooss 1353 1369 42 925

673213 TTTTCTTGTTCACCCTC keke-d8-ekeke soosssssssssooss 1354 1370 36 926

673214 CTTTTCTTGTTCACCCT keke-d8-ekeke soosssssssssooss 1355 1371 41 927

673215 TCTTTTCTTGTTCACCC keke-d8-ekeke soosssssssssooss 1356 1372 41 928

673216 GTCTTTTCTTGTTCACC keke-d8-ekeke soosssssssssooss 1357 1373 36 929

673217 GGTCTTTTCTTGTTCAC keke-d8-ekeke soosssssssssooss 1358 1374 29 930

673218 AGGTCTTTTCTTGTTCA keke-d8-ekeke soosssssssssooss 1359 1375 50 931

673219 CAGGTCTTTTCTTGTTC keke-d8-ekeke soosssssssssooss 1360 1376 60 932

673220 TCAGGTCTTTTCTTGTT keke-d8-ekeke soosssssssssooss 1361 1377 34 933

673221 ATCAGGTCTTTTCTTGT keke-d8-ekeke soosssssssssooss 1362 1378 33 934

673222 TATCAGGTCTTTTCTTG keke-d8-ekeke soosssssssssooss 1363 1379 31 935

673223 TTATCAGGTCTTTTCTT keke-d8-ekeke soosssssssssooss 1364 1380 10 936

673224 ATCTTTATCAGGTCTTT keke-d8-ekeke soosssssssssooss 1368 1384 61 937

673225 AATCTTTATCAGGTCTT keke-d8-ekeke soosssssssssooss 1369 1385 74 938

673226 TAATCTTTATCAGGTCT keke-d8-ekeke soosssssssssooss 1370 1386 62 939

673227 TTAATCTTTATCAGGTC keke-d8-ekeke soosssssssssooss 1371 1387 51 940

673228 GTTAATCTTTATCAGGT keke-d8-ekeke soosssssssssooss 1372 1388 73 941

673229 GGTTAATCTTTATCAGG keke-d8-ekeke soosssssssssooss 1373 1389 66 942

673230 TGGTTAATCTTTATCAG keke-d8-ekeke soosssssssssooss 1374 1390 38 943

673231 CTGGTTAATCTTTATCA keke-d8-ekeke soosssssssssooss 1375 1391 41 944

673232 TCTGGTTAATCTTTATC keke-d8-ekeke soosssssssssooss 1376 1392 37 945

673233 CCCTCCTTGTTTTCTTC keke-d8-ekeke soosssssssssooss 1391 1407 26 946

673234 TCCCTCCTTGTTTTCTT keke-d8-ekeke soosssssssssooss 1392 1408 10 947

673235 TTCCCTCCTTGTTTTCT keke-d8-ekeke soosssssssssooss 1393 1409 20 948

673236 TTTCCCTCCTTGTTTTC keke-d8-ekeke soosssssssssooss 1394 1410 1 949

673237 GTTTCCCTCCTTGTTTT keke-d8-ekeke soosssssssssooss 1395 1411 η 950

673238 TGTTTCCCTCCTTGTTT keke-d8-ekeke soosssssssssooss 1396 1412 26 951

673239 TTGTTTCCCTCCTTGTT keke-d8-ekeke soosssssssssooss 1397 1413 28 952

673240 GGTTGTTTCCCTCCTTG keke-d8-ekeke soosssssssssooss 1399 1415 70 953

673241 CGGTTGTTTCCCTCCTT keke-d8-ekeke soosssssssssooss 1400 1416 36 954

673242 GCGGTTGTTTCCCTCCT keke-d8-ekeke soosssssssssooss 1401 1417 21 955 673243 TGCGGTTGTTTCCCTCC keke-d8-ekeke soosssssssssooss 1402 1418 24 956

673244 CTGCGGTTGTTTCCCTC keke-d8-ekeke soosssssssssooss 1403 1419 41 957

673245 GCTGCGGTTGTTTCCCT keke-d8-ekeke soosssssssssooss 1404 1420 23 958

673246 GGCTGCGGTTGTTTCCC keke-d8-ekeke soosssssssssooss 1405 1421 39 959

673247 AGGCTGCGGTTGTTTCC keke-d8-ekeke soosssssssssooss 1406 1422 50 960

673248 CAGGCTGCGGTTGTTTC keke-d8-ekeke soosssssssssooss 1407 1423 32 961

673249 ACAGGCTGCGGTTGTTT keke-d8-ekeke soosssssssssooss 1408 1424 28 962

673250 TACAGGCTGCGGTTGTT keke-d8-ekeke soosssssssssooss 1409 1425 41 963

673251 CTACAGGCTGCGGTTGT keke-d8-ekeke soosssssssssooss 1410 1426 18 964

673252 GCTACAGGCTGCGGTTG keke-d8-ekeke soosssssssssooss 1411 1427 28 965

673253 TGCTACAGGCTGCGGTT keke-d8-ekeke soosssssssssooss 1412 1428 28 966

673254 TTGCTACAGGCTGCGGT keke-d8-ekeke soosssssssssooss 1413 1429 9 967

673255 CTTGCTACAGGCTGCGG keke-d8-ekeke soosssssssssooss 1414 1430 34 968

673256 GCTTGCTACAGGCTGCG keke-d8-ekeke soosssssssssooss 1415 1431 28 969

673257 AGCTTGCTACAGGCTGC keke-d8-ekeke soosssssssssooss 1416 1432 25 970

673258 GAGCTTGCTACAGGCTG keke-d8-ekeke soosssssssssooss 1417 1433 23 971

673259 AGAGCTTGCTACAGGCT keke-d8-ekeke soosssssssssooss 1418 1434 0 972

673260 CAGAGCTTGCTACAGGC keke-d8-ekeke soosssssssssooss 1419 1435 4 973

673261 CCAGAGCTTGCTACAGG keke-d8-ekeke soosssssssssooss 1420 1436 40 974

673262 TCCAGAGCTTGCTACAG keke-d8-ekeke soosssssssssooss 1421 1437 35 975

673263 TTCCAGAGCTTGCTACA keke-d8-ekeke soosssssssssooss 1422 1438 23 976

673264 GTTCCAGAGCTTGCTAC keke-d8-ekeke soosssssssssooss 1423 1439 36 977

673265 AGTTCCAGAGCTTGCTA keke-d8-ekeke soosssssssssooss 1424 1440 54 978

673266 GAGTTCCAGAGCTTGCT keke-d8-ekeke soosssssssssooss 1425 1441 32 979

673267 TGAGTTCCAGAGCTTGC keke-d8-ekeke soosssssssssooss 1426 1442 32 980

673268 CTGAGTTCCAGAGCTTG keke-d8-ekeke soosssssssssooss 1427 1443 44 981

673269 CCTGAGTTCCAGAGCTT keke-d8-ekeke soosssssssssooss 1428 1444 70 982

673270 TCCTGAGTTCCAGAGCT keke-d8-ekeke soosssssssssooss 1429 1445 43 983

673271 CTCCTGAGTTCCAGAGC keke-d8-ekeke soosssssssssooss 1430 1446 41 984

673272 ACTCCTGAGTTCCAGAG keke-d8-ekeke soosssssssssooss 1431 1447 23 985

673273 GACTCCTGAGTTCCAGA keke-d8-ekeke soosssssssssooss 1432 1448 48 986

673274 CGACTCCTGAGTTCCAG keke-d8-ekeke soosssssssssooss 1433 1449 34 987

673275 GCGACTCCTGAGTTCCA keke-d8-ekeke soosssssssssooss 1434 1450 64 988 673276 CGCGACTCCTGAGTTCC keke-d8-ekeke soosssssssssooss 1435 1451 65 989

673277 GCGCGACTCCTGAGTTC keke-d8-ekeke soosssssssssooss 1436 1452 62 990

673278 CGCGCGACTCCTGAGTT keke-d8-ekeke soosssssssssooss 1437 1453 45 991

673279 GCGCGCGACTCCTGAGT keke-d8-ekeke soosssssssssooss 1438 1454 52 992

673280 AGCGCGCGACTCCTGAG keke-d8-ekeke soosssssssssooss 1439 1455 65 993

673281 TAGCGCGCGACTCCTGA keke-d8-ekeke soosssssssssooss 1440 1456 89 994

673282 CTAGCGCGCGACTCCTG keke-d8-ekeke soosssssssssooss 1441 1457 69 995

673283 CCTAGCGCGCGACTCCT keke-d8-ekeke soosssssssssooss 1442 1458 68 996

673284 CCCTAGCGCGCGACTCC keke-d8-ekeke soosssssssssooss 1443 1459 73 997

673285 CCCCTAGCGCGCGACTC keke-d8-ekeke soosssssssssooss 1444 1460 70 998

673286 GCCCCTAGCGCGCGACT keke-d8-ekeke soosssssssssooss 1445 1461 45 999

673287 GGCCCCTAGCGCGCGAC keke-d8-ekeke soosssssssssooss 1446 1462 33 1000

673288 CGGCCCCTAGCGCGCGA keke-d8-ekeke soosssssssssooss 1447 1463 29 1001

673289 CCGGCCCCTAGCGCGCG keke-d8-ekeke soosssssssssooss 1448 1464 0 1002

673290 CCCGGCCCCTAGCGCGC keke-d8-ekeke soosssssssssooss 1449 1465 31 1003

673291 CCCCGGCCCCTAGCGCG keke-d8-ekeke soosssssssssooss 1450 1466 28 1004

673292 GCCCCGGCCCCTAGCGC keke-d8-ekeke soosssssssssooss 1451 1467 12 1005

673293 GGCCCCGGCCCCTAGCG keke-d8-ekeke soosssssssssooss 1452 1468 29 1006

673294 CGGCCCCGGCCCCTAGC keke-d8-ekeke soosssssssssooss 1453 1469 39 1007

673295 CCGGCCCCGGCCCCTAG keke-d8-ekeke soosssssssssooss 1454 1470 28 1008

673296 CCCGGCCCCGGCCCCTA keke-d8-ekeke soosssssssssooss 1455 1471 4 1009

673297 ACGCCCCGGCCCCGGCC keke-d8-ekeke soosssssssssooss 1465 1481 17 1010

673298 CACGCCCCGGCCCCGGC keke-d8-ekeke soosssssssssooss 1466 1482 35 1011

673299 CCACGCCCCGGCCCCGG keke-d8-ekeke soosssssssssooss 1467 1483 28 1012

673300 ACCACGCCCCGGCCCCG keke-d8-ekeke soosssssssssooss 1468 1484 21 1013

673301 GACCACGCCCCGGCCCC keke-d8-ekeke soosssssssssooss 1469 1485 28 1014

673302 CGACCACGCCCCGGCCC keke-d8-ekeke soosssssssssooss 1470 1486 46 1015

673303 CCGACCACGCCCCGGCC keke-d8-ekeke soosssssssssooss 1471 1487 40 1016

673304 CCCGACCACGCCCCGGC keke-d8-ekeke soosssssssssooss 1472 1488 16 1017

673305 CCCCGACCACGCCCCGG keke-d8-ekeke soosssssssssooss 1473 1489 11 1018

673306 GCCCCGACCACGCCCCG keke-d8-ekeke soosssssssssooss 1474 1490 13 1019

673307 CGCCCCGACCACGCCCC keke-d8-ekeke soosssssssssooss 1475 1491 43 1020

673308 CCGCCCCGACCACGCCC keke-d8-ekeke soosssssssssooss 1476 1492 20 1021 673309 CCCGCCCCGACCACGCC keke-d8-ekeke soosssssssssooss 1477 1493 16 1022

673310 GCCCGCCCCGACCACGC keke-d8-ekeke soosssssssssooss 1478 1494 44 1023

673311 GGCCCGCCCCGACCACG keke-d8-ekeke soosssssssssooss 1479 1495 33 1024

673312 GGGCCCGCCCCGACCAC keke-d8-ekeke soosssssssssooss 1480 1496 1 1025

673313 CGGGCCCGCCCCGACCA keke-d8-ekeke soosssssssssooss 1481 1497 0 1026

673314 CCGGGCCCGCCCCGACC keke-d8-ekeke soosssssssssooss 1482 1498 0 1027

673315 CCCGGGCCCGCCCCGAC keke-d8-ekeke soosssssssssooss 1483 1499 8 1028

673316 GCAGCCCCGCCCCGGGC keke-d8-ekeke soosssssssssooss 1505 1521 31 1029

673317 CGCAGCCCCGCCCCGGG keke-d8-ekeke soosssssssssooss 1506 1522 4 1030

673318 CCGCAGCCCCGCCCCGG keke-d8-ekeke soosssssssssooss 1507 1523 18 1031

673319 ACCGCAGCCCCGCCCCG keke-d8-ekeke soosssssssssooss 1508 1524 16 1032

673320 AACCGCAGCCCCGCCCC keke-d8-ekeke soosssssssssooss 1509 1525 39 1033

673321 CAACCGCAGCCCCGCCC keke-d8-ekeke soosssssssssooss 1510 1526 50 1034

673322 GCAACCGCAGCCCCGCC keke-d8-ekeke soosssssssssooss 1511 1527 45 1035

673323 CGCAACCGCAGCCCCGC keke-d8-ekeke soosssssssssooss 1512 1528 56 1036

673324 CCGCAACCGCAGCCCCG keke-d8-ekeke soosssssssssooss 1513 1529 10 1037

673325 ACCGCAACCGCAGCCCC keke-d8-ekeke soosssssssssooss 1514 1530 43 1038

673326 CACCGCAACCGCAGCCC keke-d8-ekeke soosssssssssooss 1515 1531 49 1039

673327 GCACCGCAACCGCAGCC keke-d8-ekeke soosssssssssooss 1516 1532 35 1040

673328 GGCACCGCAACCGCAGC keke-d8-ekeke soosssssssssooss 1517 1533 24 1041

673329 AGGCACCGCAACCGCAG keke-d8-ekeke soosssssssssooss 1518 1534 52 1042

673330 CAGGCACCGCAACCGCA keke-d8-ekeke soosssssssssooss 1519 1535 38 1043

673331 GCAGGCACCGCAACCGC keke-d8-ekeke soosssssssssooss 1520 1536 51 1044

673332 CGCAGGCACCGCAACCG keke-d8-ekeke soosssssssssooss 1521 1537 59 1045

673333 GCGCAGGCACCGCAACC keke-d8-ekeke soosssssssssooss 1522 1538 24 1046

673334 GGCGCAGGCACCGCAAC keke-d8-ekeke soosssssssssooss 1523 1539 18 1047

Table 44

673360 TCTTGTTCACCCTCAGC ekek-d8-kekee soosssssssssooss 1351 1367 26 923

673361 TTCTTGTTCACCCTCAG ekek-d8-kekee soosssssssssooss 1352 1368 36 924

673362 TTTCTTGTTCACCCTCA ekek-d8-kekee soosssssssssooss 1353 1369 29 925

673363 TTTTCTTGTTCACCCTC ekek-d8-kekee soosssssssssooss 1354 1370 29 926

673364 CTTTTCTTGTTCACCCT ekek-d8-kekee soosssssssssooss 1355 1371 23 927

673365 TCTTTTCTTGTTCACCC ekek-d8-kekee soosssssssssooss 1356 1372 36 928

673366 GTCTTTTCTTGTTCACC ekek-d8-kekee soosssssssssooss 1357 1373 27 929

673367 GGTCTTTTCTTGTTCAC ekek-d8-kekee soosssssssssooss 1358 1374 21 930

673368 AGGTCTTTTCTTGTTCA ekek-d8-kekee soosssssssssooss 1359 1375 29 931

673369 CAGGTCTTTTCTTGTTC ekek-d8-kekee soosssssssssooss 1360 1376 65 932

673370 TCAGGTCTTTTCTTGTT ekek-d8-kekee soosssssssssooss 1361 1377 2 933

673371 ATCAGGTCTTTTCTTGT ekek-d8-kekee soosssssssssooss 1362 1378 23 934

673372 TATCAGGTCTTTTCTTG ekek-d8-kekee soosssssssssooss 1363 1379 40 935

673373 TTATCAGGTCTTTTCTT ekek-d8-kekee soosssssssssooss 1364 1380 13 936

673374 ATCTTTATCAGGTCTTT ekek-d8-kekee soosssssssssooss 1368 1384 76 937

673375 AATCTTTATCAGGTCTT ekek-d8-kekee soosssssssssooss 1369 1385 62 938

673376 TAATCTTTATCAGGTCT ekek-d8-kekee soosssssssssooss 1370 1386 39 939

673377 TTAATCTTTATCAGGTC ekek-d8-kekee soosssssssssooss 1371 1387 71 940

673378 GTTAATCTTTATCAGGT ekek-d8-kekee soosssssssssooss 1372 1388 61 941

673379 GGTTAATCTTTATCAGG ekek-d8-kekee soosssssssssooss 1373 1389 74 942

673380 TGGTTAATCTTTATCAG ekek-d8-kekee soosssssssssooss 1374 1390 24 943

673381 CTGGTTAATCTTTATCA ekek-d8-kekee soosssssssssooss 1375 1391 32 944

673382 TCTGGTTAATCTTTATC ekek-d8-kekee soosssssssssooss 1376 1392 38 945

673383 CCCTCCTTGTTTTCTTC ekek-d8-kekee soosssssssssooss 1391 1407 21 946

673384 TCCCTCCTTGTTTTCTT ekek-d8-kekee soosssssssssooss 1392 1408 0 947

673385 TTCCCTCCTTGTTTTCT ekek-d8-kekee soosssssssssooss 1393 1409 0 948

673386 TTTCCCTCCTTGTTTTC ekek-d8-kekee soosssssssssooss 1394 1410 5 949

673387 GTTTCCCTCCTTGTTTT ekek-d8-kekee soosssssssssooss 1395 1411 0 950

673388 TGTTTCCCTCCTTGTTT ekek-d8-kekee soosssssssssooss 1396 1412 0 951

673389 TTGTTTCCCTCCTTGTT ekek-d8-kekee soosssssssssooss 1397 1413 22 952

673390 GGTTGTTTCCCTCCTTG ekek-d8-kekee soosssssssssooss 1399 1415 55 953

673391 CGGTTGTTTCCCTCCTT ekek-d8-kekee soosssssssssooss 1400 1416 25 954

673392 GCGGTTGTTTCCCTCCT ekek-d8-kekee soosssssssssooss 1401 1417 19 955 673393 TGCGGTTGTTTCCCTCC ekek-d8-kekee soosssssssssooss 1402 1418 0 956

673394 CTGCGGTTGTTTCCCTC ekek-d8-kekee soosssssssssooss 1403 1419 13 957

673395 GCTGCGGTTGTTTCCCT ekek-d8-kekee soosssssssssooss 1404 1420 19 958

673396 GGCTGCGGTTGTTTCCC ekek-d8-kekee soosssssssssooss 1405 1421 27 959

673397 AGGCTGCGGTTGTTTCC ekek-d8-kekee soosssssssssooss 1406 1422 13 960

673398 CAGGCTGCGGTTGTTTC ekek-d8-kekee soosssssssssooss 1407 1423 22 961

673399 ACAGGCTGCGGTTGTTT ekek-d8-kekee soosssssssssooss 1408 1424 5 962

673400 TACAGGCTGCGGTTGTT ekek-d8-kekee soosssssssssooss 1409 1425 0 963

673401 CTACAGGCTGCGGTTGT ekek-d8-kekee soosssssssssooss 1410 1426 0 964

673402 GCTACAGGCTGCGGTTG ekek-d8-kekee soosssssssssooss 1411 1427 39 965

673403 TGCTACAGGCTGCGGTT ekek-d8-kekee soosssssssssooss 1412 1428 20 966

673404 TTGCTACAGGCTGCGGT ekek-d8-kekee soosssssssssooss 1413 1429 24 967

673405 CTTGCTACAGGCTGCGG ekek-d8-kekee soosssssssssooss 1414 1430 0 968

673406 GCTTGCTACAGGCTGCG ekek-d8-kekee soosssssssssooss 1415 1431 18 969

673407 AGCTTGCTACAGGCTGC ekek-d8-kekee soosssssssssooss 1416 1432 3 970

673408 GAGCTTGCTACAGGCTG ekek-d8-kekee soosssssssssooss 1417 1433 13 971

673409 AGAGCTTGCTACAGGCT ekek-d8-kekee soosssssssssooss 1418 1434 29 972

673410 CAGAGCTTGCTACAGGC ekek-d8-kekee soosssssssssooss 1419 1435 22 973

673411 CCAGAGCTTGCTACAGG ekek-d8-kekee soosssssssssooss 1420 1436 24 974

673412 TCCAGAGCTTGCTACAG ekek-d8-kekee soosssssssssooss 1421 1437 4 975

673413 TTCCAGAGCTTGCTACA ekek-d8-kekee soosssssssssooss 1422 1438 0 976

673414 GTTCCAGAGCTTGCTAC ekek-d8-kekee soosssssssssooss 1423 1439 19 977

673415 AGTTCCAGAGCTTGCTA ekek-d8-kekee soosssssssssooss 1424 1440 0 978

673416 GAGTTCCAGAGCTTGCT ekek-d8-kekee soosssssssssooss 1425 1441 48 979

673417 TGAGTTCCAGAGCTTGC ekek-d8-kekee soosssssssssooss 1426 1442 14 980

673418 CTGAGTTCCAGAGCTTG ekek-d8-kekee soosssssssssooss 1427 1443 37 981

673419 CCTGAGTTCCAGAGCTT ekek-d8-kekee soosssssssssooss 1428 1444 80 982

673420 TCCTGAGTTCCAGAGCT ekek-d8-kekee soosssssssssooss 1429 1445 26 983

673421 CTCCTGAGTTCCAGAGC ekek-d8-kekee soosssssssssooss 1430 1446 5 984

673422 ACTCCTGAGTTCCAGAG ekek-d8-kekee soosssssssssooss 1431 1447 23 985

673423 GACTCCTGAGTTCCAGA ekek-d8-kekee soosssssssssooss 1432 1448 37 986

673424 CGACTCCTGAGTTCCAG ekek-d8-kekee soosssssssssooss 1433 1449 5 987

673425 GCGACTCCTGAGTTCCA ekek-d8-kekee soosssssssssooss 1434 1450 39 988 673426 CGCGACTCCTGAGTTCC ekek-d8-kekee soosssssssssooss 1435 1451 46 989

673427 GCGCGACTCCTGAGTTC ekek-d8-kekee soosssssssssooss 1436 1452 50 990

673428 CGCGCGACTCCTGAGTT ekek-d8-kekee soosssssssssooss 1437 1453 19 991

673429 GCGCGCGACTCCTGAGT ekek-d8-kekee soosssssssssooss 1438 1454 13 992

673430 AGCGCGCGACTCCTGAG ekek-d8-kekee soosssssssssooss 1439 1455 51 993

673431 TAGCGCGCGACTCCTGA ekek-d8-kekee soosssssssssooss 1440 1456 83 994

673432 CTAGCGCGCGACTCCTG ekek-d8-kekee soosssssssssooss 1441 1457 60 995

673433 CCTAGCGCGCGACTCCT ekek-d8-kekee soosssssssssooss 1442 1458 37 996

673434 CCCTAGCGCGCGACTCC ekek-d8-kekee soosssssssssooss 1443 1459 60 997

673435 CCCCTAGCGCGCGACTC ekek-d8-kekee soosssssssssooss 1444 1460 62 998

673436 GCCCCTAGCGCGCGACT ekek-d8-kekee soosssssssssooss 1445 1461 41 999

673437 GGCCCCTAGCGCGCGAC ekek-d8-kekee soosssssssssooss 1446 1462 8 1000

673438 CGGCCCCTAGCGCGCGA ekek-d8-kekee soosssssssssooss 1447 1463 31 1001

673439 CCGGCCCCTAGCGCGCG ekek-d8-kekee soosssssssssooss 1448 1464 18 1002

673440 CCCGGCCCCTAGCGCGC ekek-d8-kekee soosssssssssooss 1449 1465 6 1003

673441 CCCCGGCCCCTAGCGCG ekek-d8-kekee soosssssssssooss 1450 1466 23 1004

673442 GCCCCGGCCCCTAGCGC ekek-d8-kekee soosssssssssooss 1451 1467 8 1005

673443 GGCCCCGGCCCCTAGCG ekek-d8-kekee soosssssssssooss 1452 1468 18 1006

673444 CGGCCCCGGCCCCTAGC ekek-d8-kekee soosssssssssooss 1453 1469 28 1007

673445 CCGGCCCCGGCCCCTAG ekek-d8-kekee soosssssssssooss 1454 1470 9 1008

673446 CCCGGCCCCGGCCCCTA ekek-d8-kekee soosssssssssooss 1455 1471 5 1009

673447 ACGCCCCGGCCCCGGCC ekek-d8-kekee soosssssssssooss 1465 1481 23 1010

673448 CACGCCCCGGCCCCGGC ekek-d8-kekee soosssssssssooss 1466 1482 14 1011

673449 CCACGCCCCGGCCCCGG ekek-d8-kekee soosssssssssooss 1467 1483 35 1012

673450 ACCACGCCCCGGCCCCG ekek-d8-kekee soosssssssssooss 1468 1484 30 1013

673451 GACCACGCCCCGGCCCC ekek-d8-kekee soosssssssssooss 1469 1485 0 1014

673452 CGACCACGCCCCGGCCC ekek-d8-kekee soosssssssssooss 1470 1486 15 1015

673453 CCGACCACGCCCCGGCC ekek-d8-kekee soosssssssssooss 1471 1487 42 1016

673454 CCCGACCACGCCCCGGC ekek-d8-kekee soosssssssssooss 1472 1488 19 1017

673455 CCCCGACCACGCCCCGG ekek-d8-kekee soosssssssssooss 1473 1489 21 1018

673456 GCCCCGACCACGCCCCG ekek-d8-kekee soosssssssssooss 1474 1490 9 1019

673457 CGCCCCGACCACGCCCC ekek-d8-kekee soosssssssssooss 1475 1491 45 1020

673458 CCGCCCCGACCACGCCC ekek-d8-kekee soosssssssssooss 1476 1492 14 1021 673459 CCCGCCCCGACCACGCC ekek-d8-kekee soosssssssssooss 1477 1493 2 1022

673460 GCCCGCCCCGACCACGC ekek-d8-kekee soosssssssssooss 1478 1494 28 1023

673461 GGCCCGCCCCGACCACG ekek-d8-kekee soosssssssssooss 1479 1495 19 1024

673462 GGGCCCGCCCCGACCAC ekek-d8-kekee soosssssssssooss 1480 1496 26 1025

673463 CGGGCCCGCCCCGACCA ekek-d8-kekee soosssssssssooss 1481 1497 12 1026

673464 CCGGGCCCGCCCCGACC ekek-d8-kekee soosssssssssooss 1482 1498 18 1027

673465 CCCGGGCCCGCCCCGAC ekek-d8-kekee soosssssssssooss 1483 1499 19 1028

673466 GCAGCCCCGCCCCGGGC ekek-d8-kekee soosssssssssooss 1505 1521 11 1029

673467 CGCAGCCCCGCCCCGGG ekek-d8-kekee soosssssssssooss 1506 1522 40 1030

673468 CCGCAGCCCCGCCCCGG ekek-d8-kekee soosssssssssooss 1507 1523 12 1031

673469 ACCGCAGCCCCGCCCCG ekek-d8-kekee soosssssssssooss 1508 1524 26 1032

673470 AACCGCAGCCCCGCCCC ekek-d8-kekee soosssssssssooss 1509 1525 36 1033

673471 CAACCGCAGCCCCGCCC ekek-d8-kekee soosssssssssooss 1510 1526 63 1034

673472 GCAACCGCAGCCCCGCC ekek-d8-kekee soosssssssssooss 1511 1527 35 1035

673473 CGCAACCGCAGCCCCGC ekek-d8-kekee soosssssssssooss 1512 1528 51 1036

673474 CCGCAACCGCAGCCCCG ekek-d8-kekee soosssssssssooss 1513 1529 27 1037

673475 ACCGCAACCGCAGCCCC ekek-d8-kekee soosssssssssooss 1514 1530 49 1038

673476 CACCGCAACCGCAGCCC ekek-d8-kekee soosssssssssooss 1515 1531 34 1039

673477 GCACCGCAACCGCAGCC ekek-d8-kekee soosssssssssooss 1516 1532 36 1040

673478 GGCACCGCAACCGCAGC ekek-d8-kekee soosssssssssooss 1517 1533 22 1041

673479 AGGCACCGCAACCGCAG ekek-d8-kekee soosssssssssooss 1518 1534 23 1042

673480 CAGGCACCGCAACCGCA ekek-d8-kekee soosssssssssooss 1519 1535 27 1043

673481 GCAGGCACCGCAACCGC ekek-d8-kekee soosssssssssooss 1520 1536 41 1044

673482 CGCAGGCACCGCAACCG ekek-d8-kekee soosssssssssooss 1521 1537 60 1045

673483 GCGCAGGCACCGCAACC ekek-d8-kekee soosssssssssooss 1522 1538 22 1046

673484 GGCGCAGGCACCGCAAC ekek-d8-kekee soosssssssssooss 1523 1539 11 1047

Example 11: Dose-dependent antisense inhibition of human C90RF72 mRNA in HepG2 cells

Antisense oligonucleotides from the study described in Example 10 hereinabove exhibiting significant in vitro inhibition of C90RF72 mRNA were selected and tested at various doses in HepG2 cells. ISIS 576816, which was previously tested in PCT/US2013/065073 (claiming priority to US Application No. 61/714,132, filed October 15, 2012) was used as a benchmark oligonucleotide. Cells were plated at a density of 20,000 cells per well and transfected using electrop oration with 0.185 μΜ, 0.56 μΜ, 1.67 μΜ, or 5.00 μΜ concentrations of antisense oligonucleotide. After a treatment period of approximately 16 hours, RNA was isolated from the cells and C90RF72 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3905 was used to measure the C90RF72 pathogenic associated mRNA variant, which is the product of a pre-mRNA containing a hexanucleotide repeat. C90RF72 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN^®. Results are presented as percent inhibition of C90RF72 levels, relative to untreated control cells.

As shown in Tables 45-52, total C90RF72 mRNA levels were reduced in a dose- dependent manner in some of the antisense oligonucleotide treated cells.

Table 45

HepG2 cells

Table 46

HepG2 cells

Table 47

HepG2 cells

673057 37 67 64 81 0.3

673058 35 62 79 87 0.4

673067 59 74 98 97 <0.2

673068 37 71 85 95 0.3

673071 43 5 59 64 1.9

673074 37 44 89 89 0.4

673079 41 71 89 95 0.2

673081 21 37 80 76 0.8

673082 27 58 87 92 0.4

673088 63 79 96 97 <0.2

673089 11 41 71 83 0.9

673098 15 61 68 93 0.6

Table 48

HepG2 cells

Table 49

HepG2 cells

Table 50

HepG2 cells

0.185 0.56 1.67 5.00 IC₅₀

ISIS No

μΜ μΜ μΜ μΜ (μΜ)

576816 31 65 81 89 0.4

673265 24 43 73 83 0.7

673269 12 58 81 89 0.6

673275 31 57 63 94 0.5

673276 33 56 69 91 0.5

673277 37 51 65 66 0.6

673279 11 57 68 86 0.8 673280 38 60 80 95 0.3

673281 51 83 92 86 <0.2

673282 60 73 93 95 <0.2

673283 59 66 94 96 <0.2

673284 45 59 78 91 0.3

673285 30 59 78 86 0.4

673321 10 44 72 79 0.9

673323 43 54 76 86 0.3

673326 0 46 72 81 0.8

673329 15 30 64 76 1.2

673331 47 40 66 79 0.5

673332 58 49 71 78 <0.2

Table 51

HepG2 cells

Table 52

HepG2 cells

Example 12: Antisense inhibition of C90RF72 by human-rhesus cross-reactive antisense

oligonucleotides in LLC-MK2 cells by mixed backbone 5-8-5 MOE and 5-10-5 MOE gapmers

Antisense oligonucleotides targeting a human C90RF72 nucleic acid and cross-reactive with a rhesus C90RF72 nucleic acid were designed and tested for their effects on rhesus C90RF72 mRNA expression in vitro. ISIS 576816, previously tested in US Application No. 61/714,132, filed October 15,

2012, was used as a benchmark oligonucleotide. ISIS 619420, which is the mixed backbone version of ISIS 576816, described in Example 2 hereinabove was also tested. The antisense oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Cultured LLC-MK2 cells at a density of 20,000 cells per well were transfected using electroporation with 3,500 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and C90RF72 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3750 (a TAQ-man primer probe set) was used to measure total C90RF72 mRNA levels. RTS3750 targets exon 2 of the mRNA transcripts and, therefore, measures total mRNA transcripts. In cases where the oligonucleotide overlapped the amplicon of the primer probe set RTS3750 (see, e.g., Table 53), an alternative primer probe set, RTS3760 MGB (forward sequence

TTCCAATGCTTACTGGAGAAGTGA, designated herein as SEQ ID NO: 1546; reverse sequence GGAACACTGTGTGATTTCATAGATGA, designated herein as SEQ ID NO: 1547; probe sequence TCCTGTAATGGAACTGC, designated herein as SEQ ID NO: 1548 - a TAQ-man primer probe set) was used to measure total mRNA transcripts. The levels of the C90RF72 mRNA were normalized to the total RNA content of the cell, as measured by RIBOGREEN®. Results are presented as percent inhibition of rhesus C90RF72 mRNA expression, relative to untreated control cells. The oligonucleotides marked with as asterisk (*) target the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of these oligonucleotides, 'n.d.' indicates that there was no signal reading in the assay for that particular oligonucleotide.

The newly designed chimeric antisense oligonucleotides in the Tables below were designed as 5-8-5 MOE gapmers and 5-10-5 MOE gapmers.

The 5-8-5 MOE gapmers are 18 nucleosides in length, wherein the central gap segment comprises eight 2'-deoxynucleosides and is flanked by wing segments on boht the 5' end and the 3' end comprising five nucleosides each. Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment has a 2'-MOE group. All cytosine residues throughout each gapmer are 5-methylcytosines. The internucleoside linkages for the gapmers are mixed phosphorothioate and phosphodiester linkages. The internucleoside linkages for each gapmer are presented in the Linkage column, where Ό' indicates a phosphodiester linkage and's' indicates a phosphorothioate linkage.

The 5-10-5 MOE gapmers are 20 nucleosides in length, wherein the central gap segment comprises ten 2'-deoxynucleosides and is flanked by wing segments on boht the 5' end and the 3' end comprising five nucleosides each. Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment has a 2'-MOE group. All cytosine residues throughout each gapmer are 5-methylcytosines. The internucleoside linkages for the gapmers are mixed phosphorothioate and phosphodiester linkages. The internucleoside linkages for each gapmer are presented in the Linkage column, where Ό' indicates a phosphodiester linkage and's' indicates a phosphorothioate linkage.

"Start site" indicates the 5'-most nucleoside to which the gapmer is targeted in the gene sequence.

"Stop site" indicates the 3 '-most nucleoside to which the gapmer is targeted in the gene sequence. Each gapmer listed in the Tables below is targeted to one or more of human C90RF72 mRNA sequence, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM 001256054.1), human C90RF72 genomic sequence, designated herein as SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000), and rhesus C90RF72 genomic sequence designated herein as SEQ ID NO : 19 (GENBANK Accession No. NW 001 101662.1 truncated from nucleosides 8522000 to 8552000). The 'Mismatches' column indicates the number of mismatches the human antisense oligonucleotide has with the rhesus genomic sequence, 'n/a' in the rhesus 5 sequence columns indicates that the human oligonucleotide has more than 3 mismatches with the rhesus genomic sequence. Where the 'Mismtaches' column is not provided in a Table, it is understood that the human oligonucleotides of the Table are fully cross-reactive with the rhesus genomic sequence.

Table 53

Percent inhibition of the C90RF72 mRNA levels compared to PBS control by antisense oligonucleotides targeting SEQ ID NOs: 1, 2 and 19

688027* 243 7923 7976 TTAAAGCAATCTCTGTCT sooosssssssssooss 5-8-5 32 18 1079

688028* 244 7924 7977 CTTAAAGCAATCTCTGTC sooosssssssssooss 5-8-5 41 4 1080

688029* 245 7925 7978 ACTTAAAGCAATCTCTGT sooosssssssssooss 5-8-5 63 0 1081

688030* 246 7926 7979 CACTTAAAGCAATCTCTG sooosssssssssooss 5-8-5 26 31 1082

688031* 247 7927 7980 CCACTTAAAGCAATCTCT sooosssssssssooss 5-8-5 73 33 1083

688032 267 7947 8000 CTGCTAATAAAGGTGATT sooosssssssssooss 5-8-5 24 34 1084

688033 268 7948 8001 GCTGCTAATAAAGGTGAT sooosssssssssooss 5-8-5 11 18 1085

688034 269 7949 8002 AGCTGCTAATAAAGGTGA sooosssssssssooss 5-8-5 40 34 1086

688035 270 7950 8003 TAGCTGCTAATAAAGGTG sooosssssssssooss 5-8-5 46 1 1087

688036 271 7951 8004 GTAGCTGCTAATAAAGGT sooosssssssssooss 5-8-5 13 17 1088

688037 272 7952 8005 AGTAGCTGCTAATAAAGG sooosssssssssooss 5-8-5 0 0 1089

688038 273 7953 8006 AAGTAGCTGCTAATAAAG sooosssssssssooss 5-8-5 0 0 1090

688039 274 7954 8007 AAAGTAGCTGCTAATAAA sooosssssssssooss 5-8-5 0 3 1091

688040 275 7955 8008 AAAAGTAGCTGCTAATAA sooosssssssssooss 5-8-5 0 0 1092

688041 276 7956 8009 CAAAAGTAGCTGCTAATA sooosssssssssooss 5-8-5 0 0 1093

688042 277 7957 8010 GCAAAAGTAGCTGCTAAT sooosssssssssooss 5-8-5 32 31 1094

688043 278 7958 8011 AGCAAAAGTAGCTGCTAA sooosssssssssooss 5-8-5 18 14 1095

688044 279 7959 8012 AAGCAAAAGTAGCTGCTA sooosssssssssooss 5-8-5 17 24 1096

688045 280 7960 8013 TAAGCAAAAGTAGCTGCT sooosssssssssooss 5-8-5 38 7 1097

688046 281 7961 8014 GTAAGCAAAAGTAGCTGC sooosssssssssooss 5-8-5 37 38 1098

688047 282 7962 8015 AGTAAGCAAAAGTAGCTG sooosssssssssooss 5-8-5 12 33 1099

688048 283 7963 8016 CAGTAAGCAAAAGTAGCT sooosssssssssooss 5-8-5 17 29 1100

688049 284 7964 8017 CCAGTAAGCAAAAGTAGC sooosssssssssooss 5-8-5 17 0 1101

688050 285 7965 8018 CCCAGTAAGCAAAAGTAG sooosssssssssooss 5-8-5 7 27 1102

688051 286 7966 8019 TCCCAGTAAGCAAAAGTA sooosssssssssooss 5-8-5 0 0 1103

688052 287 7967 8020 GTCCCAGTAAGCAAAAGT sooosssssssssooss 5-8-5 16 24 1104

688053 288 7968 8021 TGTCCCAGTAAGCAAAAG sooosssssssssooss 5-8-5 0 0 1105

688054 289 7969 8022 TTGTCCCAGTAAGCAAAA sooosssssssssooss 5-8-5 9 10 1106

688055 290 7970 8023 ATTGTCCCAGTAAGCAAA sooosssssssssooss 5-8-5 6 15 1107

688056 291 7971 8024 TATTGTCCCAGTAAGCAA sooosssssssssooss 5-8-5 21 0 1108

688057 292 7972 8025 ATATTGTCCCAGTAAGCA sooosssssssssooss 5-8-5 11 4 1109

688058 293 7973 8026 AATATTGTCCCAGTAAGC sooosssssssssooss 5-8-5 23 29 1110

688059 294 7974 8027 GAATATTGTCCCAGTAAG sooosssssssssooss 5-8-5 5 13 1111

688060 295 7975 8028 AGAATATTGTCCCAGTAA sooosssssssssooss 5-8-5 0 31 1112

688061 296 7976 8029 AAGAATATTGTCCCAGTA sooosssssssssooss 5-8-5 0 16 1113

688062 297 7977 8030 CAAGAATATTGTCCCAGT sooosssssssssooss 5-8-5 29 0 1114

688063 298 7978 8031 CCAAGAATATTGTCCCAG sooosssssssssooss 5-8-5 26 42 1115

688064 299 7979 8032 ACCAAGAATATTGTCCCA sooosssssssssooss 5-8-5 19 11 1116

688065 300 7980 8033 GACCAAGAATATTGTCCC sooosssssssssooss 5-8-5 31 26 1117

688066 301 7981 8034 GGACCAAGAATATTGTCC sooosssssssssooss 5-8-5 0 0 1118

688067 302 7982 8035 AGGACCAAGAATATTGTC sooosssssssssooss 5-8-5 5 10 1119

688068 303 7983 8036 TAGGACCAAGAATATTGT sooosssssssssooss 5-8-5 20 13 1120

688069 304 7984 8037 CTAGGACCAAGAATATTG sooosssssssssooss 5-8-5 0 22 1121 688070 305 7985 8038 TCTAGGACCAAGAATATT sooosssssssssooss 5-8-5 0 0 1122

688071 306 7986 8039 CTCTAGGACCAAGAATAT sooosssssssssooss 5-8-5 5 18 1123

688072 307 7987 8040 ACTCTAGGACCAAGAATA sooosssssssssooss 5-8-5 17 27 1124

688073 308 7988 8041 TACTCTAGGACCAAGAAT sooosssssssssooss 5-8-5 13 8 1125

688074 309 7989 8042 TTACTCTAGGACCAAGAA sooosssssssssooss 5-8-5 0 0 1126

688075 310 7990 8043 CTTACTCTAGGACCAAGA sooosssssssssooss 5-8-5 0 0 1127

688076 311 7991 8044 CCTTACTCTAGGACCAAG sooosssssssssooss 5-8-5 45 71 1128

688077 312 7992 8045 GCCTTACTCTAGGACCAA sooosssssssssooss 5-8-5 62 67 1129

688078 313 7993 8046 TGCCTTACTCTAGGACCA sooosssssssssooss 5-8-5 33 30 1130

688079 314 7994 8047 GTGCCTTACTCTAGGACC sooosssssssssooss 5-8-5 59 49 1131

688080 315 7995 8048 TGTGCCTTACTCTAGGAC sooosssssssssooss 5-8-5 47 41 1132

688081 316 7996 8049 ATGTGCCTTACTCTAGGA sooosssssssssooss 5-8-5 44 13 1133

688082 317 7997 8050 AATGTGCCTTACTCTAGG sooosssssssssooss 5-8-5 6 0 1134

Table 54

Percent inhibition of the C90RF72 mRNA levels compared to PBS control by antisense

oligonucleotides targeting SEQ ID NOs: 1, 2 and 19

688100 335 8015 8068 TTCTGTCTTTGGAGCCCA sooosssssssssooss 5-8-5 61 1 152

688101 336 8016 8069 GTTCTGTCTTTGGAGCCC sooosssssssssooss 5-8-5 77 1 153

688102 337 8017 8070 TGTTCTGTCTTTGGAGCC sooosssssssssooss 5-8-5 58 1 154

688103 338 8018 8071 CTGTTCTGTCTTTGGAGC sooosssssssssooss 5-8-5 57 1 155

688104 339 8019 8072 CCTGTTCTGTCTTTGGAG sooosssssssssooss 5-8-5 55 1 156

688105 340 8020 8073 ACCTGTTCTGTCTTTGGA sooosssssssssooss 5-8-5 51 1 157

688106 341 8021 8074 TACCTGTTCTGTCTTTGG sooosssssssssooss 5-8-5 42 1 158

688107 342 8022 8075 GTACCTGTTCTGTCTTTG sooosssssssssooss 5-8-5 49 1 159

688108 343 8023 8076 AGTACCTGTTCTGTCTTT sooosssssssssooss 5-8-5 25 1 160

688109 344 8024 8077 AAGTACCTGTTCTGTCTT sooosssssssssooss 5-8-5 22 1 161

6881 10 345 8025 8078 GAAGTACCTGTTCTGTCT sooosssssssssooss 5-8-5 42 1 162

6881 1 1 346 8026 8079 AGAAGTACCTGTTCTGTC sooosssssssssooss 5-8-5 21 1 163

6881 12 347 8027 8080 GAGAAGTACCTGTTCTGT sooosssssssssooss 5-8-5 22 1 164

6881 13 348 8028 8081 TGAGAAGTACCTGTTCTG sooosssssssssooss 5-8-5 13 1 165

6881 14 349 8029 8082 CTGAGAAGTACCTGTTCT sooosssssssssooss 5-8-5 25 1 166

6881 15 350 8030 8083 ACTGAGAAGTACCTGTTC sooosssssssssooss 5-8-5 14 1 167

6881 16 351 8031 8084 CACTGAGAAGTACCTGTT sooosssssssssooss 5-8-5 36 1 168

6881 17 352 8032 8085 TCACTGAGAAGTACCTGT sooosssssssssooss 5-8-5 28 1 169

6881 18 353 8033 8086 ATCACTGAGAAGTACCTG sooosssssssssooss 5-8-5 36 1 170

6881 19 354 8034 8087 CATCACTGAGAAGTACCT sooosssssssssooss 5-8-5 32 1 171

688120 355 8035 8088 CCATCACTGAGAAGTACC sooosssssssssooss 5-8-5 44 1 172

688121 356 8036 8089 TCCATCACTGAGAAGTAC sooosssssssssooss 5-8-5 31 1 173

688122 357 8037 8090 CTCCATCACTGAGAAGTA sooosssssssssooss 5-8-5 56 1 174

688123 358 8038 8091 TCTCCATCACTGAGAAGT sooosssssssssooss 5-8-5 53 1 175

688124 359 8039 8092 TTCTCCATCACTGAGAAG sooosssssssssooss 5-8-5 14 1 176

688125 360 8040 8093 TTTCTCCATCACTGAGAA sooosssssssssooss 5-8-5 12 1 177

688126 361 8041 8094 ATTTCTCCATCACTGAGA sooosssssssssooss 5-8-5 18 1 178

688127 362 8042 8095 TATTTCTCCATCACTGAG sooosssssssssooss 5-8-5 11 1 179

688128 364 8044 8097 GTTATTTCTCCATCACTG sooosssssssssooss 5-8-5 40 1 180

688129 365 8045 8098 AGTTATTTCTCCATCACT sooosssssssssooss 5-8-5 37 1 181

688130 366 8046 8099 AAGTTATTTCTCCATCAC sooosssssssssooss 5-8-5 20 1 182

688131 367 8047 8100 AAAGTTATTTCTCCATCA sooosssssssssooss 5-8-5 22 1 183

688132 368 8048 8101 AAAAGTTATTTCTCCATC sooosssssssssooss 5-8-5 31 1 184

688133 369 8049 8102 GAAAAGTTATTTCTCCAT sooosssssssssooss 5-8-5 19 1 185

688134 371 8051 8104 AAGAAAAGTTATTTCTCC sooosssssssssooss 5-8-5 34 1 186

688135 372 8052 8105 CAAGAAAAGTTATTTCTC sooosssssssssooss 5-8-5 0 1 187

688136 373 8053 8106 GCAAGAAAAGTTATTTCT sooosssssssssooss 5-8-5 21 1 188

688137 374 8054 8107 GGCAAGAAAAGTTATTTC sooosssssssssooss 5-8-5 51 1 189

688138 375 8055 8108 TGGCAAGAAAAGTTATTT sooosssssssssooss 5-8-5 42 1 190

688139 376 8056 8109 TTGGCAAGAAAAGTTATT sooosssssssssooss 5-8-5 13 1 191

688140 377 8057 81 10 GTTGGCAAGAAAAGTTAT sooosssssssssooss 5-8-5 16 1 192

688141 378 8058 81 11 GGTTGGCAAGAAAAGTTA sooosssssssssooss 5-8-5 23 1 193

688142 379 8059 81 12 TGGTTGGCAAGAAAAGTT sooosssssssssooss 5-8-5 7 1 194 688143 380 8060 8113 GTGGTTGGCAAGAAAAGT sooosssssssssooss 5-8-5 30 1195

688144 381 8061 8114 TGTGGTTGGCAAGAAAAG sooosssssssssooss 5-8-5 12 1196

688145 382 8062 8115 GTGTGGTTGGCAAGAAAA sooosssssssssooss 5-8-5 7 1197

688146 383 8063 8116 AGTGTGGTTGGCAAGAAA sooosssssssssooss 5-8-5 0 1198

688147 384 8064 8117 GAGTGTGGTTGGCAAGAA sooosssssssssooss 5-8-5 27 1199

688148 385 8065 8118 AGAGTGTGGTTGGCAAGA sooosssssssssooss 5-8-5 17 1200

688149 386 8066 8119 TAGAGTGTGGTTGGCAAG sooosssssssssooss 5-8-5 17 1201

688150 387 8067 8120 TTAGAGTGTGGTTGGCAA sooosssssssssooss 5-8-5 20 1202

688151 388 8068 8121 TTTAGAGTGTGGTTGGCA sooosssssssssooss 5-8-5 22 1203

688152 389 8069 8122 ATTTAGAGTGTGGTTGGC sooosssssssssooss 5-8-5 47 1204

688153 390 8070 8123 CATTTAGAGTGTGGTTGG sooosssssssssooss 5-8-5 21 1205

688154 391 8071 8124 CCATTTAGAGTGTGGTTG sooosssssssssooss 5-8-5 23 1206

688155 392 8072 8125 TCCATTTAGAGTGTGGTT sooosssssssssooss 5-8-5 9 1207

688156 393 8073 8126 CTCCATTTAGAGTGTGGT sooosssssssssooss 5-8-5 25 1208

688157 394 8074 8127 TCTCCATTTAGAGTGTGG sooosssssssssooss 5-8-5 41 1209

688158 395 8075 8128 TTCTCCATTTAGAGTGTG sooosssssssssooss 5-8-5 19 1210

688159 396 8076 8129 TTTCTCCATTTAGAGTGT sooosssssssssooss 5-8-5 0 1211

Table 55

oligonucleotides targeting SEQ ID NOs: 1, 2 and 19

688173 410 8090 8143 TGCATTTCGAAGGATTTC sooosssssssssooss 5-8-5 0 1225

688174 411 8091 8144 CTGCATTTCGAAGGATTT sooosssssssssooss 5-8-5 25 1226

688175 412 8092 8145 TCTGCATTTCGAAGGATT sooosssssssssooss 5-8-5 33 1227

688176 413 8093 8146 CTCTGCATTTCGAAGGAT sooosssssssssooss 5-8-5 12 1228

688177 414 8094 8147 TCTCTGCATTTCGAAGGA sooosssssssssooss 5-8-5 14 1229

688178 415 8095 8148 CTCTCTGCATTTCGAAGG sooosssssssssooss 5-8-5 5 1230

688179 416 8096 8149 ACTCTCTGCATTTCGAAG sooosssssssssooss 5-8-5 0 1231

688180 417 8097 8150 CACTCTCTGCATTTCGAA sooosssssssssooss 5-8-5 12 1232

688181 418 8098 8151 CCACTCTCTGCATTTCGA sooosssssssssooss 5-8-5 40 1233

688182 419 8099 8152 ACCACTCTCTGCATTTCG sooosssssssssooss 5-8-5 40 1234

688183 420 8100 8153 CACCACTCTCTGCATTTC sooosssssssssooss 5-8-5 45 1235

688184 421 8101 8154 GCACCACTCTCTGCATTT sooosssssssssooss 5-8-5 24 1236

688185 422 8102 8155 AGCACCACTCTCTGCATT sooosssssssssooss 5-8-5 12 1237

688186 423 8103 8156 TAGCACCACTCTCTGCAT sooosssssssssooss 5-8-5 21 1238

688187 424 8104 8157 ATAGCACCACTCTCTGCA sooosssssssssooss 5-8-5 25 1239

688188 425 8105 8158 TATAGCACCACTCTCTGC sooosssssssssooss 5-8-5 12 1240

688189 426 8106 8159 CTATAGCACCACTCTCTG sooosssssssssooss 5-8-5 0 1241

688190 427 8107 8160 TCTATAGCACCACTCTCT sooosssssssssooss 5-8-5 0 1242

688191 428 8108 8161 ATCTATAGCACCACTCTC sooosssssssssooss 5-8-5 20 1243

688192 429 8109 8162 CATCTATAGCACCACTCT sooosssssssssooss 5-8-5 0 1244

688193 430 8110 8163 ACATCTATAGCACCACTC sooosssssssssooss 5-8-5 31 1245

688194 431 8111 8164 TACATCTATAGCACCACT sooosssssssssooss 5-8-5 4 1246

688195 432 8112 8165 TTACATCTATAGCACCAC sooosssssssssooss 5-8-5 32 1247

688196 433 8113 8166 TTTACATCTATAGCACCA sooosssssssssooss 5-8-5 37 1248

688197 434 8114 8167 CTTTACATCTATAGCACC sooosssssssssooss 5-8-5 25 1249

688198 435 8115 8168 ACTTTACATCTATAGCAC sooosssssssssooss 5-8-5 0 1250

688199 436 8116 8169 AACTTTACATCTATAGCA sooosssssssssooss 5-8-5 9 1251

688200 437 8117 8170 AAACTTTACATCTATAGC sooosssssssssooss 5-8-5 8 1252

688201 438 8118 8171 AAAACTTTACATCTATAG sooosssssssssooss 5-8-5 4 1253

688202 440 8120 8173 AAAAAACTTTACATCTAT sooosssssssssooss 5-8-5 8 1254

688203 441 8121 8174 CAAAAAACTTTACATCTA sooosssssssssooss 5-8-5 4 1255

688204 442 8122 8175 ACAAAAAACTTTACATCT sooosssssssssooss 5-8-5 0 1256

688205 443 8123 8176 GACAAAAAACTTTACATC sooosssssssssooss 5-8-5 0 1257

688206 446 8126 8179 CAAGACAAAAAACTTTAC sooosssssssssooss 5-8-5 5 1258

688207 448 8128 8181 GACAAGACAAAAAACTTT sooosssssssssooss 5-8-5 27 1259

688208 449 8129 8182 AGACAAGACAAAAAACTT sooosssssssssooss 5-8-5 9 1260

688209 450 8130 8183 CAGACAAGACAAAAAACT sooosssssssssooss 5-8-5 0 1261

688210 451 8131 8184 TCAGACAAGACAAAAAAC sooosssssssssooss 5-8-5 11 1262

688211 452 8132 8185 TTCAGACAAGACAAAAAA sooosssssssssooss 5-8-5 0 1263

688212 454 8134 8187 TTTTCAGACAAGACAAAA sooosssssssssooss 5-8-5 0 1264

688213 455 8135 8188 CTTTTCAGACAAGACAAA sooosssssssssooss 5-8-5 0 1265

688214 456 8136 8189 CCTTTTCAGACAAGACAA sooosssssssssooss 5-8-5 30 1266

688215 457 8137 8190 CCCTTTTCAGACAAGACA sooosssssssssooss 5-8-5 31 1267 688216 458 8138 8191 TCCCTTTTCAGACAAGAC sooosssssssssooss 54 i-5 24 1268

688217 459 8139 8192 CTCCCTTTTCAGACAAGA sooosssssssssooss 5-i i-5 47 1269

688218 460 8140 8193 ACTCCCTTTTCAGACAAG sooosssssssssooss 5-i i-5 34 1270

688219 461 8141 8194 CACTCCCTTTTCAGACAA sooosssssssssooss 5-1 i-5 5 1271

688220 462 8142 8195 TCACTCCCTTTTCAGACA sooosssssssssooss 5-i i-5 15 1272

688221 463 8143 8196 ATCACTCCCTTTTCAGAC sooosssssssssooss 5-i i-5 14 1273

688222 464 8144 8197 AATCACTCCCTTTTCAGA sooosssssssssooss 5-i i-5 18 1274

688223 465 8145 8198 TAATCACTCCCTTTTCAG sooosssssssssooss 5-i i-5 14 1275

688224 466 8146 8199 ATAATCACTCCCTTTTCA sooosssssssssooss 5-i i-5 15 1276

688225 467 8147 8200 AATAATCACTCCCTTTTC sooosssssssssooss 5-i i-5 8 1277

688226 468 8148 8201 CAATAATCACTCCCTTTT sooosssssssssooss 5-i i-5 9 1278

688227 469 8149 8202 ACAATAATCACTCCCTTT sooosssssssssooss 5-i i-5 24 1279

688228 470 8150 8203 AACAATAATCACTCCCTT sooosssssssssooss 5-i i-5 21 1280

688229 471 8151 8204 AAACAATAATCACTCCCT sooosssssssssooss 5-i i-5 21 1281

688230 472 8152 8205 GAAACAATAATCACTCCC sooosssssssssooss 5-i i-5 36 1282

688231 473 8153 8206 TGAAACAATAATCACTCC sooosssssssssooss 5-i i-5 7 1283

688232 474 8154 8207 ATGAAACAATAATCACTC sooosssssssssooss 5-i i-5 20 1284

688233 475 8155 8208 AATGAAACAATAATCACT sooosssssssssooss 5-i i-5 0 1285

688234 476 8156 8209 TAATGAAACAATAATCAC sooosssssssssooss 5-i i-5 16 1286

688235 477 8157 8210 TTAATGAAACAATAATCA sooosssssssssooss 5-i i-5 0 1287

688236 478 8158 821 1 ATTAATGAAACAATAATC sooosssssssssooss 5-i i-5 0 1288

Table 56

688246 494 8174 8227 CCAGTTTCCATCAAAGAT sooosssssssssooss 5-8-5 46 1298

688247 495 8175 8228 TCCAGTTTCCATCAAAGA sooosssssssssooss 5-8-5 46 1299

688248 496 8176 8229 TTCCAGTTTCCATCAAAG sooosssssssssooss 5-8-5 59 1300

688249 497 8177 8230 ATTCCAGTTTCCATCAAA sooosssssssssooss 5-8-5 48 1301

688250 498 8178 8231 CATTCCAGTTTCCATCAA sooosssssssssooss 5-8-5 54 1302

688251 499 8179 8232 CCATTCCAGTTTCCATCA sooosssssssssooss 5-8-5 59 1303

688252 500 8180 8233 CCCATTCCAGTTTCCATC sooosssssssssooss 5-8-5 67 1304

688253 501 8181 8234 CCCCATTCCAGTTTCCAT sooosssssssssooss 5-8-5 58 1305

688254 502 8182 8235 TCCCCATTCCAGTTTCCA sooosssssssssooss 5-8-5 55 1306

688255 503 8183 8236 ATCCCCATTCCAGTTTCC sooosssssssssooss 5-8-5 61 1307

688256 504 8184 8237 GATCCCCATTCCAGTTTC sooosssssssssooss 5-8-5 51 1308

688257 505 8185 8238 CGATCCCCATTCCAGTTT sooosssssssssooss 5-8-5 49 1309

688258 506 8186 8239 GCGATCCCCATTCCAGTT sooosssssssssooss 5-8-5 43 1310

688259 507 8187 8240 TGCGATCCCCATTCCAGT sooosssssssssooss 5-8-5 51 1311

688260 508 8188 8241 CTGCGATCCCCATTCCAG sooosssssssssooss 5-8-5 70 1312

688261 509 8189 8242 GCTGCGATCCCCATTCCA sooosssssssssooss 5-8-5 72 1313

688262 510 8190 8243 TGCTGCGATCCCCATTCC sooosssssssssooss 5-8-5 49 1314

688263 511 8191 8244 GTGCTGCGATCCCCATTC sooosssssssssooss 5-8-5 0 1315

688264 512 8192 8245 TGTGCTGCGATCCCCATT sooosssssssssooss 5-8-5 58 1316

688265 513 8193 8246 ATGTGCTGCGATCCCCAT sooosssssssssooss 5-8-5 66 1317

688266 514 8194 8247 TATGTGCTGCGATCCCCA sooosssssssssooss 5-8-5 63 1318

688267 533 8213 8266 AAGTATAATTGATAGTCC sooosssssssssooss 5-8-5 49 1319

688268 534 8214 8267 GAAGTATAATTGATAGTC sooosssssssssooss 5-8-5 50 1320

688269 535 8215 8268 GGAAGTATAATTGATAGT sooosssssssssooss 5-8-5 39 1321

688270 536 8216 8269 TGGAAGTATAATTGATAG sooosssssssssooss 5-8-5 43 1322

688271 537 8217 8270 GTGGAAGTATAATTGATA sooosssssssssooss 5-8-5 49 1323

688272 538 8218 8271 TGTGGAAGTATAATTGAT sooosssssssssooss 5-8-5 40 1324

688273 539 8219 8272 CTGTGGAAGTATAATTGA sooosssssssssooss 5-8-5 34 1325

688274 540 8220 8273 TCTGTGGAAGTATAATTG sooosssssssssooss 5-8-5 0 1326

688275 541 8221 8274 GTCTGTGGAAGTATAATT sooosssssssssooss 5-8-5 0 1327

688276 542 8222 8275 TGTCTGTGGAAGTATAAT sooosssssssssooss 5-8-5 66 1328

688277 543 8223 8276 CTGTCTGTGGAAGTATAA sooosssssssssooss 5-8-5 0 1329

688278 544 8224 8277 TCTGTCTGTGGAAGTATA sooosssssssssooss 5-8-5 63 1330

688279 545 8225 8278 TTCTGTCTGTGGAAGTAT sooosssssssssooss 5-8-5 55 1331

688280 546 8226 8279 GTTCTGTCTGTGGAAGTA sooosssssssssooss 5-8-5 78 1332

688281 547 8227 8280 AGTTCTGTCTGTGGAAGT sooosssssssssooss 5-8-5 63 1333

688282 548 8228 8281 AAGTTCTGTCTGTGGAAG sooosssssssssooss 5-8-5 50 1334

688283 549 8229 8282 TAAGTTCTGTCTGTGGAA sooosssssssssooss 5-8-5 0 1335

688284 550 8230 8283 CTAAGTTCTGTCTGTGGA sooosssssssssooss 5-8-5 55 1336

688285 551 8231 8284 ACTAAGTTCTGTCTGTGG sooosssssssssooss 5-8-5 69 1337

688286 552 8232 8285 AACTAAGTTCTGTCTGTG sooosssssssssooss 5-8-5 66 1338

688287 553 8233 8286 AAACTAAGTTCTGTCTGT sooosssssssssooss 5-8-5 43 1339

688288 554 8234 8287 GAAACTAAGTTCTGTCTG sooosssssssssooss 5-8-5 37 1340 688289 555 8235 8288 AGAAACTAAGTTCTGTCT sooosssssssssooss 5-8-5 47 1341

688290 556 8236 8289 TAGAAACTAAGTTCTGTC sooosssssssssooss 5-8-5 50 1342

688291 557 8237 8290 GTAGAAACTAAGTTCTGT sooosssssssssooss 5-8-5 47 1343

688292 558 8238 8291 GGTAGAAACTAAGTTCTG sooosssssssssooss 5-8-5 46 1344

688293 559 8239 8292 AGGTAGAAACTAAGTTCT sooosssssssssooss 5-8-5 59 1345

688294 560 8240 8293 GAGGTAGAAACTAAGTTC sooosssssssssooss 5-8-5 48 1346

688295 561 8241 8294 GGAGGTAGAAACTAAGTT sooosssssssssooss 5-8-5 47 1347

688296 562 8242 8295 GGGAGGTAGAAACTAAGT sooosssssssssooss 5-8-5 43 1348

688297 563 8243 8296 TGGGAGGTAGAAACTAAG sooosssssssssooss 5-8-5 49 1349

688298 564 8244 8297 GTGGGAGGTAGAAACTAA sooosssssssssooss 5-8-5 51 1350

688299 565 8245 8298 AGTGGGAGGTAGAAACTA sooosssssssssooss 5-8-5 45 1351

688300 566 8246 8299 AAGTGGGAGGTAGAAACT sooosssssssssooss 5-8-5 40 1352

688301 567 8247 8300 GAAGTGGGAGGTAGAAAC sooosssssssssooss 5-8-5 39 1353

688302 568 8248 8301 TGAAGTGGGAGGTAGAAA sooosssssssssooss 5-8-5 0 1354

688303 569 8249 8302 ATGAAGTGGGAGGTAGAA sooosssssssssooss 5-8-5 42 1355

688304 570 8250 8303 TATGAAGTGGGAGGTAGA sooosssssssssooss 5-8-5 32 1356

688305 571 8251 8304 CTATGAAGTGGGAGGTAG sooosssssssssooss 5-8-5 47 1357

688306 572 8252 8305 TCTATGAAGTGGGAGGTA sooosssssssssooss 5-8-5 33 1358

688307 573 8253 8306 CTCTATGAAGTGGGAGGT sooosssssssssooss 5-8-5 55 1359

688308 574 8254 8307 ACTCTATGAAGTGGGAGG sooosssssssssooss 5-8-5 51 1360

688309 575 8255 8308 CACTCTATGAAGTGGGAG sooosssssssssooss 5-8-5 59 1361

688310 576 8256 8309 ACACTCTATGAAGTGGGA sooosssssssssooss 5-8-5 58 1362

688311 577 8257 8310 CACACTCTATGAAGTGGG sooosssssssssooss 5-8-5 59 1363

688312 578 8258 8311 ACACACTCTATGAAGTGG sooosssssssssooss 5-8-5 42 1364

688313 579 8259 8312 CACACACTCTATGAAGTG sooosssssssssooss 5-8-5 40 1365

Table 57

oligonucleotides targeting SEQ ID NOs: 1, 2 and 19

688320 696 n a n a n/a TCTGACCCTGATCTTCCA sooosssssssssooss 5-8-5 11 1372

688321 697 n a n a n/a CTCTGACCCTGATCTTCC sooosssssssssooss 5-8-5 21 1373

688322 698 n a n a n/a ACTCTGACCCTGATCTTC sooosssssssssooss 5-8-5 26 1374

688323 699 n a n a n/a TACTCTGACCCTGATCTT sooosssssssssooss 5-8-5 6 1375

688324 700 n a 12554 3 ATACTCTGACCCTGATCT sooosssssssssooss 5-8-5 7 1376

688325 701 n a 12555 2 AATACTCTGACCCTGATC sooosssssssssooss 5-8-5 0 1377

687955 n/a 13641 13680 0 ATGATTTCTTGTCTGGGA sooosssssssssooss 5-8-5 31 1378

687956 n/a 13642 13681 0 CATGATTTCTTGTCTGGG sooosssssssssooss 5-8-5 38 1379

687957 n/a 13643 13682 0 CCATGATTTCTTGTCTGG sooosssssssssooss 5-8-5 12 1380

687958 n/a 13644 13683 0 GCCATGATTTCTTGTCTG sooosssssssssooss 5-8-5 27 1381

687959 n/a 13645 13684 0 GGCCATGATTTCTTGTCT sooosssssssssooss 5-8-5 26 1382

687960 n/a 13646 13685 0 GGGCCATGATTTCTTGTC sooosssssssssooss 5-8-5 18 1383

687961 n/a 14089 14136 0 AACTAACATGTAGGCACT sooosssssssssooss 5-8-5 38 1384

687962 n/a 14090 14137 0 GAACTAACATGTAGGCAC sooosssssssssooss 5-8-5 57 1385

687963 n/a 14091 14138 0 GGAACTAACATGTAGGCA sooosssssssssooss 5-8-5 63 1386

687964 n/a 14092 14139 0 AGGAACTAACATGTAGGC sooosssssssssooss 5-8-5 29 1387

687965 n/a 14302 14349 0 CTTCTGATTCAAGCCATT sooosssssssssooss 5-8-5 25 1388

687966 n/a 14303 14350 0 GCTTCTGATTCAAGCCAT sooosssssssssooss 5-8-5 51 1389

687967 n/a 14304 14351 0 TGCTTCTGATTCAAGCCA sooosssssssssooss 5-8-5 46 1390

687968 n/a 14305 14352 0 GTGCTTCTGATTCAAGCC sooosssssssssooss 5-8-5 21 1391

687969 n/a 14306 14353 0 AGTGCTTCTGATTCAAGC sooosssssssssooss 5-8-5 36 1392

687970 n/a 14307 14354 0 AAGTGCTTCTGATTCAAG sooosssssssssooss 5-8-5 25 1393

687971 n/a 14308 14355 0 AAAGTGCTTCTGATTCAA sooosssssssssooss 5-8-5 28 1394

687972 n/a 14309 14356 0 TAAAGTGCTTCTGATTCA sooosssssssssooss 5-8-5 0 1395

687973 n/a 14310 14357 0 CTAAAGTGCTTCTGATTC sooosssssssssooss 5-8-5 25 1396

687974 n/a 14311 14358 0 ACTAAAGTGCTTCTGATT sooosssssssssooss 5-8-5 17 1397

687975 n/a 14312 14359 0 GACTAAAGTGCTTCTGAT sooosssssssssooss 5-8-5 33 1398

687976 n/a 14313 14360 0 GGACTAAAGTGCTTCTGA sooosssssssssooss 5-8-5 47 1399

687977 n/a 14314 14361 0 AGGACTAAAGTGCTTCTG sooosssssssssooss 5-8-5 44 1400

687978 n/a 14315 14362 0 CAGGACTAAAGTGCTTCT sooosssssssssooss 5-8-5 57 1401

687979 n/a 14316 14363 0 ACAGGACTAAAGTGCTTC sooosssssssssooss 5-8-5 31 1402

687980 n/a 14317 14364 0 TACAGGACTAAAGTGCTT sooosssssssssooss 5-8-5 24 1403

687981 n/a 14318 14365 0 ATACAGGACTAAAGTGCT sooosssssssssooss 5-8-5 21 1404

687982 n/a 14319 14366 0 GATACAGGACTAAAGTGC sooosssssssssooss 5-8-5 15 1405

687983 n/a 14320 14367 0 AGATACAGGACTAAAGTG sooosssssssssooss 5-8-5 8 1406

687984 n/a 14321 14368 0 CAGATACAGGACTAAAGT sooosssssssssooss 5-8-5 1 1407

687985 n/a 14322 14369 0 ACAGATACAGGACTAAAG sooosssssssssooss 5-8-5 10 1408

687986 n/a 14323 14370 0 AACAGATACAGGACTAAA sooosssssssssooss 5-8-5 11 1409

687987 n/a 14324 14371 0 GAACAGATACAGGACTAA sooosssssssssooss 5-8-5 20 1410

687988 n/a 14325 14372 0 TGAACAGATACAGGACTA sooosssssssssooss 5-8-5 25 1411

687989 n/a 14326 14373 0 CTGAACAGATACAGGACT sooosssssssssooss 5-8-5 12 1412

687990 n/a 14327 14374 0 ACTGAACAGATACAGGAC sooosssssssssooss 5-8-5 25 1413

687991 n/a 14328 14375 0 CACTGAACAGATACAGGA sooosssssssssooss 5-8-5 8 1414 687992 n/a 14329 14376 0 ACACTGAACAGATACAGG sooosssssssssooss 5-i i-5 10 1415

687993 n/a 14330 14377 0 GACACTGAACAGATACAG sooosssssssssooss 5-i i-5 13 1416

687994 n/a 14331 14378 0 TGACACTGAACAGATACA sooosssssssssooss 5-i i-5 25 1417

687995 n/a 14332 14379 0 CTGACACTGAACAGATAC sooosssssssssooss 5-i i-5 35 1418

687996 n/a 14333 14380 0 GCTGACACTGAACAGATA sooosssssssssooss 5-i i-5 24 1419

687997 n/a 14334 14381 0 GGCTGACACTGAACAGAT sooosssssssssooss 5-i i-5 40 1420

687998 n/a 14335 14382 0 AGGCTGACACTGAACAGA sooosssssssssooss 5-i i-5 10 1421

687999 n/a 14336 14383 0 AAGGCTGACACTGAACAG sooosssssssssooss 5-i i-5 3 1422

688000 n/a 14337 14384 0 AAAGGCTGACACTGAACA sooosssssssssooss 5-i i-5 18 1423

688001 n/a 14338 14385 0 GAAAGGCTGACACTGAAC sooosssssssssooss 5-i i-5 17 1424

688002 n/a 14339 14386 0 TGAAAGGCTGACACTGAA sooosssssssssooss 5-i i-5 12 1425

688003 n/a 14358 14405 0 TGGGATTTAAAATGATGT sooosssssssssooss 5-i i-5 17 1426

688004 n/a 14359 14406 0 ATGGGATTTAAAATGATG sooosssssssssooss 5-i i-5 1 1 1427

688326 n/a 13402 13443 0 CTTGAGAAGAAAGCCTTC sooosssssssssooss 5-i i-5 6 1428

688327 n/a 14287 14334 0 ATTAAGGCTCTTAGGTTA sooosssssssssooss 5-i i-5 0 1429

688328 n/a 13499 13530 0 GTAGACAGTCTGTTATTT sooosssssssssooss 5-i i-5 27 1430

688329 n/a 14397 14444 0 TGACATGTAGAGAGATTA sooosssssssssooss 5-i i-5 43 1431

688330 n/a 13827 13866 0 TGGTTTAAGGGCACAAAC sooosssssssssooss 5-i i-5 0 1432

688331 n/a 13403 13444 0 ACTTGAGAAGAAAGCCTT sooosssssssssooss 5-i i-5 27 1433

688332 n/a 14257 14304 0 CCTCTGATACTCCATCAT sooosssssssssooss 5-i i-5 28 1434

688333 n/a 13471 13502 0 AAATCTTGTCATAGGTGA sooosssssssssooss 5-i i-5 21 1435

688334 n/a 13410 13451 0 AATTCTTACTTGAGAAGA sooosssssssssooss 5-i i-5 7 1436

688335 n/a 13885 13924 0 GGTGTATAGAGAATTCAG sooosssssssssooss 5-i i-5 41 1437

688336 n/a 14250 14297 0 TACTCCATCATGAGCCTA sooosssssssssooss 5-i i-5 35 1438

688337 n/a 13788 13827 0 GCTGGATGGAAAAAGATC sooosssssssssooss 5-i i-5 12 1439

688338 n/a 13517 13548 0 GTCCCTAGAACAATCTAA sooosssssssssooss 5-i i-5 28 1440

688339 n/a 14405 14452 0 GAAGAAATTGACATGTAG sooosssssssssooss 5-i i-5 12 1441

688340 n/a 13724 13763 0 CATCTACAGTACAACTTA sooosssssssssooss 5-i i-5 4 1442

Table 58

oligonucleotides targeting SEQ ID NOs: 1, 2 and 19

688344 238 7918 7971 AAGCAATCTCTGTCTTGGCA soooossssssssssooss 5-10-5 83 1446

655172 306 7986 8039 TACTCTAGGACCAAGAATAT soooossssssssssooss 5-10-5 10 483

688345 307 7987 8040 TTACTCTAGGACCAAGAATA soooossssssssssooss 5-10-5 1 1447

688346 308 7988 8041 CTTACTCTAGGACCAAGAAT soooossssssssssooss 5-10-5 10 1448

625183 309 7989 8042 CCTTACTCTAGGACCAAGAA soooossssssssssooss 5-10-5 44 484

576816 310 7990 8043 GCCTTACTCTAGGACCAAGA sssssssssssssssssss 5-10-5 56 20

619420 310 7990 8043 GCCTTACTCTAGGACCAAGA soooossssssssssooss 5-10-5 73 20

688347 311 7991 8044 TGCCTTACTCTAGGACCAAG soooossssssssssooss 5-10-5 62 1449

655173 312 7992 8045 GTGCCTTACTCTAGGACCAA soooossssssssssooss 5-10-5 59 485

688348 313 7993 8046 TGTGCCTTACTCTAGGACCA soooossssssssssooss 5-10-5 62 1450

688349 314 7994 8047 ATGTGCCTTACTCTAGGACC soooossssssssssooss 5-10-5 62 1451

655174 315 7995 8048 AATGTGCCTTACTCTAGGAC soooossssssssssooss 5-10-5 60 486

688350 319 7999 8052 CCCAAATGTGCCTTACTCTA soooossssssssssooss 5-10-5 41 1452

688351 320 8000 8053 GCCCAAATGTGCCTTACTCT soooossssssssssooss 5-10-5 62 1453

627833 321 8001 8054 AGCCCAAATGTGCCTTACTC soooossssssssssooss 5-10-5 51 487

688352 322 8002 8055 GAGCCCAAATGTGCCTTACT soooossssssssssooss 5-10-5 66 1454

688353 323 8003 8056 GGAGCCCAAATGTGCCTTAC soooossssssssssooss 5-10-5 48 1455

619411 324 8004 8057 TGGAGCCCAAATGTGCCTTA soooossssssssssooss 5-10-5 67 51

688354 325 8005 8058 TTGGAGCCCAAATGTGCCTT soooossssssssssooss 5-10-5 53 1456

627608 326 8006 8059 TTTGGAGCCCAAATGTGCCT soooossssssssssooss 5-10-5 42 1457

655175 327 8007 8060 CTTTGGAGCCCAAATGTGCC soooossssssssssooss 5-10-5 26 488

655176 330 8010 8063 TGTCTTTGGAGCCCAAATGT soooossssssssssooss 5-10-5 33 489

688355 331 8011 8064 CTGTCTTTGGAGCCCAAATG soooossssssssssooss 5-10-5 56 1458

619412 332 8012 8065 TCTGTCTTTGGAGCCCAAAT soooossssssssssooss 5-10-5 60 53

655177 333 8013 8066 TTCTGTCTTTGGAGCCCAAA soooossssssssssooss 5-10-5 47 490

655178 334 8014 8067 GTTCTGTCTTTGGAGCCCAA soooossssssssssooss 5-10-5 67 491

688356 335 8015 8068 TGTTCTGTCTTTGGAGCCCA soooossssssssssooss 5-10-5 60 1459

655179 336 8016 8069 CTGTTCTGTCTTTGGAGCCC soooossssssssssooss 5-10-5 59 492

688357 337 8017 8070 CCTGTTCTGTCTTTGGAGCC soooossssssssssooss 5-10-5 50 1460

688358 338 8018 8071 ACCTGTTCTGTCTTTGGAGC soooossssssssssooss 5-10-5 44 1461

655180 339 8019 8072 TACCTGTTCTGTCTTTGGAG soooossssssssssooss 5-10-5 42 493

619413 340 8020 8073 GTACCTGTTCTGTCTTTGGA soooossssssssssooss 5-10-5 56 135

688359 341 8021 8074 AGTACCTGTTCTGTCTTTGG soooossssssssssooss 5-10-5 38 1462

655181 342 8022 8075 AAGTACCTGTTCTGTCTTTG soooossssssssssooss 5-10-5 31 494

655185 351 8031 8084 ATCACTGAGAAGTACCTGTT soooossssssssssooss 5-10-5 32 498

688360 352 8032 8085 CATCACTGAGAAGTACCTGT soooossssssssssooss 5-10-5 53 1463

619414 353 8033 8086 CCATCACTGAGAAGTACCTG soooossssssssssooss 5-10-5 48 136

655186 354 8034 8087 TCCATCACTGAGAAGTACCT soooossssssssssooss 5-10-5 56 499

688361 355 8035 8088 CTCCATCACTGAGAAGTACC soooossssssssssooss 5-10-5 54 1464

655201 415 8095 8148 CACTCTCTGCATTTCGAAGG soooossssssssssooss 5-10-5 32 521

688362 416 8096 8149 CCACTCTCTGCATTTCGAAG soooossssssssssooss 5-10-5 39 1465

688363 417 8097 8150 ACCACTCTCTGCATTTCGAA soooossssssssssooss 5-10-5 37 1466

655202 418 8098 8151 CACCACTCTCTGCATTTCGA soooossssssssssooss 5-10-5 50 522 688364 419 8099 8152 GCACCACTCTCTGCATTTCG soooossssssssssooss 5-10-5 56 1467

655203 420 8100 8153 AGCACCACTCTCTGCATTTC soooossssssssssooss 5-10-5 56 523

655204 421 8101 8154 TAGCACCACTCTCTGCATTT soooossssssssssooss 5-10-5 25 524

688365 422 8102 8155 ATAGCACCACTCTCTGCATT soooossssssssssooss 5-10-5 29 1468

688366 423 8103 8156 TATAGCACCACTCTCTGCAT soooossssssssssooss 5-10-5 31 1469

655206 427 8107 8160 CATCTATAGCACCACTCTCT soooossssssssssooss 5-10-5 20 526

688367 428 8108 8161 ACATCTATAGCACCACTCTC soooossssssssssooss 5-10-5 28 1470

688368 429 8109 8162 TACATCTATAGCACCACTCT soooossssssssssooss 5-10-5 24 1471

671081 430 8110 8163 TTACATCTATAGCACCACTC soooossssssssssooss 5-10-5 26 1052

688369 431 8111 8164 TTTACATCTATAGCACCACT soooossssssssssooss 5-10-5 40 1472

688370 432 8112 8165 CTTTACATCTATAGCACCAC soooossssssssssooss 5-10-5 43 1473

655207 433 8113 8166 ACTTTACATCTATAGCACCA soooossssssssssooss 5-10-5 33 527

688371 434 8114 8167 AACTTTACATCTATAGCACC soooossssssssssooss 5-10-5 15 1474

688372 435 8115 8168 AAACTTTACATCTATAGCAC soooossssssssssooss 5-10-5 24 1475

655208 436 8116 8169 AAAACTTTACATCTATAGCA soooossssssssssooss 5-10-5 28 528

655215 456 8136 8189 TCCCTTTTCAGACAAGACAA soooossssssssssooss 5-10-5 35 535

688373 457 8137 8190 CTCCCTTTTCAGACAAGACA soooossssssssssooss 5-10-5 42 1476

688374 458 8138 8191 ACTCCCTTTTCAGACAAGAC soooossssssssssooss 5-10-5 57 1477

655216 459 8139 8192 CACTCCCTTTTCAGACAAGA soooossssssssssooss 5-10-5 51 536

671082 460 8140 8193 TCACTCCCTTTTCAGACAAG soooossssssssssooss 5-10-5 45 1053

688375 461 8141 8194 ATCACTCCCTTTTCAGACAA soooossssssssssooss 5-10-5 39 1478

655217 462 8142 8195 AATCACTCCCTTTTCAGACA soooossssssssssooss 5-10-5 45 537

688376 463 8143 8196 TAATCACTCCCTTTTCAGAC soooossssssssssooss 5-10-5 7 1479

688377 464 8144 8197 ATAATCACTCCCTTTTCAGA soooossssssssssooss 5-10-5 1 1480

655218 465 8145 8198 AATAATCACTCCCTTTTCAG soooossssssssssooss 5-10-5 23 538

655230 500 8180 8233 TCCCCATTCCAGTTTCCATC soooossssssssssooss 5-10-5 57 550

688378 501 8181 8234 ATCCCCATTCCAGTTTCCAT soooossssssssssooss 5-10-5 60 1481

688379 502 8182 8235 GATCCCCATTCCAGTTTCCA soooossssssssssooss 5-10-5 55 1482

655231 503 8183 8236 CGATCCCCATTCCAGTTTCC soooossssssssssooss 5-10-5 58 551

688380 504 8184 8237 GCGATCCCCATTCCAGTTTC soooossssssssssooss 5-10-5 56 1483

688381 505 8185 8238 TGCGATCCCCATTCCAGTTT soooossssssssssooss 5-10-5 46 1484

Table 59

oligonucleotides targeting SEQ ID NOs: 1, 2 and 19

655232 506 8186 8239 0 CTGCGATCCCCATTCCAGTT soooossssssssssooss 5-10-5 46 552

688382 507 8187 8240 0 GCTGCGATCCCCATTCCAGT soooossssssssssooss 5-10-5 65 1485

688383 508 8188 8241 0 TGCTGCGATCCCCATTCCAG soooossssssssssooss 5-10-5 60 1486

655233 509 8189 8242 0 GTGCTGCGATCCCCATTCCA soooossssssssssooss 5-10-5 57 553

688384 510 8190 8243 0 TGTGCTGCGATCCCCATTCC soooossssssssssooss 5-10-5 45 1487

688385 511 8191 8244 0 ATGTGCTGCGATCCCCATTC soooossssssssssooss 5-10-5 68 1488

655234 512 8192 8245 0 TATGTGCTGCGATCCCCATT soooossssssssssooss 5-10-5 32 554

655240 548 8228 8281 0 CTAAGTTCTGTCTGTGGAAG soooossssssssssooss 5-10-5 23 560

688386 549 8229 8282 0 ACTAAGTTCTGTCTGTGGAA soooossssssssssooss 5-10-5 45 1489

671083 550 8230 8283 0 AACTAAGTTCTGTCTGTGGA soooossssssssssooss 5-10-5 41 1054

655241 551 8231 8284 0 AAACTAAGTTCTGTCTGTGG soooossssssssssooss 5-10-5 28 561

688387 552 8232 8285 0 GAAACTAAGTTCTGTCTGTG soooossssssssssooss 5-10-5 49 1490

688388 553 8233 8286 0 AGAAACTAAGTTCTGTCTGT soooossssssssssooss 5-10-5 46 1491

655242 554 8234 8287 0 TAGAAACTAAGTTCTGTCTG soooossssssssssooss 5-10-5 25 562

655289 691 n/a 9505 3 GACCCTGATCTTCCATTCTC soooossssssssssooss 5-10-5 34 627

688389 692 n/a 9506 3 TGACCCTGATCTTCCATTCT soooossssssssssooss 5-10-5 19 1492

688390 693 n/a n/a n/a CTGACCCTGATCTTCCATTC soooossssssssssooss 5-10-5 21 1493

655290 694 n/a n/a n/a TCTGACCCTGATCTTCCATT soooossssssssssooss 5-10-5 67 628

672561 695 n/a n/a n/a CTCTGACCCTGATCTTCCAT soooossssssssssooss 5-10-5 25 1056

625345 696 n/a n/a n/a ACTCTGACCCTGATCTTCCA soooossssssssssooss 5-10-5 15 1494

655291 697 n/a n/a n/a TACTCTGACCCTGATCTTCC soooossssssssssooss 5-10-5 18 629

688391 698 n/a n/a n/a ATACTCTGACCCTGATCTTC soooossssssssssooss 5-10-5 40 1495

688392 699 n/a n/a n/a AATACTCTGACCCTGATCTT soooossssssssssooss 5-10-5 8 1496

619423 n/a 13642 13681 0 GCCATGATTTCTTGTCTGGG soooossssssssssooss 5-10-5 77 383

655417 n/a 14089 14136 0 GGAACTAACATGTAGGCACT soooossssssssssooss 5-10-5 83 738

655420 n/a 14331 14378 0 GCTGACACTGAACAGATACA soooossssssssssooss 5-10-5 51 741

655422 n/a 14452 14499 0 ATCATTTAATTAATGTATTT soooossssssssssooss 5-10-5 33 743

671084 n/a 14316 14363 0 ATACAGGACTAAAGTGCTTC soooossssssssssooss 5-10-5 74 1055

688393 n/a 13641 13680 0 CCATGATTTCTTGTCTGGGA soooossssssssssooss 5-10-5 54 1497

688394 n/a 13643 13682 0 GGCCATGATTTCTTGTCTGG soooossssssssssooss 5-10-5 52 1498

688395 n/a 13644 13683 0 GGGCCATGATTTCTTGTCTG soooossssssssssooss 5-10-5 46 1499

688396 n/a 13731 13770 0 ACTTAAGTTCATCTACAGTA soooossssssssssooss 5-10-5 18 1500

688397 n/a 13792 13831 0 TCCACTGCTGGATGGAAAAA soooossssssssssooss 5-10-5 20 1501

688398 n/a 13968 14007 0 ATATTATTTATCTTACTCAA soooossssssssssooss 5-10-5 32 1502

688399 n/a 13982 14021 0 GTTCTAAGTGCTTTATATTA soooossssssssssooss 5-10-5 30 1503

688400 n/a 14090 14137 0 AGGAACTAACATGTAGGCAC soooossssssssssooss 5-10-5 87 1504

688401 n/a 14122 14169 0 ATATAAGATAATACATGTAA soooossssssssssooss 5-10-5 6 1505

688402 n/a 14243 14290 0 CATCATGAGCCTAAAGGAAA soooossssssssssooss 5-10-5 22 1506

688403 n/a 14244 14291 0 CCATCATGAGCCTAAAGGAA soooossssssssssooss 5-10-5 37 1507

688404 n/a 14300 14347 0 CTTCTGATTCAAGCCATTAA soooossssssssssooss 5-10-5 76 1508

688405 n/a 14302 14349 0 TGCTTCTGATTCAAGCCATT soooossssssssssooss 5-10-5 55 1509

688406 n/a 14303 14350 0 GTGCTTCTGATTCAAGCCAT soooossssssssssooss 5-10-5 50 1510

688407 n/a 14304 14351 0 AGTGCTTCTGATTCAAGCCA soooossssssssssooss 5-10-5 68 1511 688408 n/a 14305 14352 0 AAGTGCTTCTGATTCAAGCC soooossssssssssooss 5- 10-5 41 1512

688409 n/a 14306 14353 0 AAAGTGCTTCTGATTCAAGC soooossssssssssooss 5- 10-5 18 1513

688410 n/a 14307 14354 0 TAAAGTGCTTCTGATTCAAG soooossssssssssooss 5- 10-5 29 1514

688411 n/a 14308 14355 0 CTAAAGTGCTTCTGATTCAA soooossssssssssooss 5- 10-5 43 1515

688412 n/a 14309 14356 0 ACTAAAGTGCTTCTGATTCA soooossssssssssooss 5- 10-5 33 1516

688413 n/a 14310 14357 0 GACTAAAGTGCTTCTGATTC soooossssssssssooss 5- 10-5 49 1517

688414 n/a 14311 14358 0 GGACTAAAGTGCTTCTGATT soooossssssssssooss 5- 10-5 49 1518

688415 n/a 14312 14359 0 AGGACTAAAGTGCTTCTGAT soooossssssssssooss 5- 10-5 55 1519

688416 n/a 14313 14360 0 CAGGACTAAAGTGCTTCTGA soooossssssssssooss 5- 10-5 71 1520

688417 n/a 14314 14361 0 ACAGGACTAAAGTGCTTCTG soooossssssssssooss 5- 10-5 66 1521

688418 n/a 14315 14362 0 TACAGGACTAAAGTGCTTCT soooossssssssssooss 5- 10-5 61 1522

688419 n/a 14317 14364 0 GATACAGGACTAAAGTGCTT soooossssssssssooss 5- 10-5 76 1523

688420 n/a 14318 14365 0 AGATACAGGACTAAAGTGCT soooossssssssssooss 5- 10-5 46 1524

688421 n/a 14319 14366 0 CAGATACAGGACTAAAGTGC soooossssssssssooss 5- 10-5 53 1525

688422 n/a 14320 14367 0 ACAGATACAGGACTAAAGTG soooossssssssssooss 5- 10-5 23 1526

688423 n/a 14321 14368 0 AACAGATACAGGACTAAAGT soooossssssssssooss 5- 10-5 28 1527

688424 n/a 14322 14369 0 GAACAGATACAGGACTAAAG soooossssssssssooss 5- 10-5 26 1528

688425 n/a 14323 14370 0 TGAACAGATACAGGACTAAA soooossssssssssooss 5- 10-5 13 1529

688426 n/a 14324 14371 0 CTGAACAGATACAGGACTAA soooossssssssssooss 5- 10-5 27 1530

688427 n/a 14325 14372 0 ACTGAACAGATACAGGACTA soooossssssssssooss 5- 10-5 37 1531

688428 n/a 14326 14373 0 CACTGAACAGATACAGGACT soooossssssssssooss 5- 10-5 35 1532

688429 n/a 14327 14374 0 ACACTGAACAGATACAGGAC soooossssssssssooss 5- 10-5 28 1533

688430 n/a 14328 14375 0 GACACTGAACAGATACAGGA soooossssssssssooss 5- 10-5 39 1534

688431 n/a 14329 14376 0 TGACACTGAACAGATACAGG soooossssssssssooss 5- 10-5 38 1535

688432 n/a 14330 14377 0 CTGACACTGAACAGATACAG soooossssssssssooss 5- 10-5 64 1536

688433 n/a 14332 14379 0 GGCTGACACTGAACAGATAC soooossssssssssooss 5- 10-5 50 1537

688434 n/a 14333 14380 0 AGGCTGACACTGAACAGATA soooossssssssssooss 5- 10-5 18 1538

688435 n/a 14334 14381 0 AAGGCTGACACTGAACAGAT soooossssssssssooss 5- 10-5 45 1539

688436 n/a 14335 14382 0 AAAGGCTGACACTGAACAGA soooossssssssssooss 5- 10-5 28 1540

688437 n/a 14336 14383 0 GAAAGGCTGACACTGAACAG soooossssssssssooss 5- 10-5 18 1541

688438 n/a 14337 14384 0 TGAAAGGCTGACACTGAACA soooossssssssssooss 5- 10-5 23 1542

688439 n/a 14358 14405 0 AATGGGATTTAAAATGATGT soooossssssssssooss 5- 10-5 26 1543

688440 n/a 14359 14406 0 AAATGGGATTTAAAATGATG soooossssssssssooss 5- 10-5 30 1544

688441 n/a 14360 14407 0 CAAATGGGATTTAAAATGAT soooossssssssssooss 5- 10-5 16 1545

Table 60

oligonucleotides targeting SEQ ID NOs: 1, 2 and 19

Site Site Site

576816 310 7990 8043 GCCTTACTCTAGGACCAAGA sssssssssssssssssss 5-10-5 62 20

619420 310 7990 8043 GCCTTACTCTAGGACCAAGA soooossssssssssooss 5-10-5 75 20

688078 313 7993 8046 TGCCTTACTCTAGGACCA sooosssssssssooss 5-8-5 67 1130

688237 485 8165 8218 ATCAAAGATTAATGAAAC sooosssssssssooss 5-8-5 42 1289

688238 486 8166 8219 CATCAAAGATTAATGAAA sooosssssssssooss 5-8-5 0 1290

688239 487 8167 8220 CCATCAAAGATTAATGAA sooosssssssssooss 5-8-5 39 1291

688240 488 8168 8221 TCCATCAAAGATTAATGA sooosssssssssooss 5-8-5 45 1292

688241 489 8169 8222 TTCCATCAAAGATTAATG sooosssssssssooss 5-8-5 0 1293

688242 490 8170 8223 TTTCCATCAAAGATTAAT sooosssssssssooss 5-8-5 53 1294

688243 491 8171 8224 GTTTCCATCAAAGATTAA sooosssssssssooss 5-8-5 46 1295

688244 492 8172 8225 AGTTTCCATCAAAGATTA sooosssssssssooss 5-8-5 43 1296

688245 493 8173 8226 CAGTTTCCATCAAAGATT sooosssssssssooss 5-8-5 0 1297

688246 494 8174 8227 CCAGTTTCCATCAAAGAT sooosssssssssooss 5-8-5 44 1298

688247 495 8175 8228 TCCAGTTTCCATCAAAGA sooosssssssssooss 5-8-5 46 1299

688248 496 8176 8229 TTCCAGTTTCCATCAAAG sooosssssssssooss 5-8-5 58 1300

688249 497 8177 8230 ATTCCAGTTTCCATCAAA sooosssssssssooss 5-8-5 46 1301

688250 498 8178 8231 CATTCCAGTTTCCATCAA sooosssssssssooss 5-8-5 50 1302

688251 499 8179 8232 CCATTCCAGTTTCCATCA sooosssssssssooss 5-8-5 58 1303

688252 500 8180 8233 CCCATTCCAGTTTCCATC sooosssssssssooss 5-8-5 66 1304

688253 501 8181 8234 CCCCATTCCAGTTTCCAT sooosssssssssooss 5-8-5 59 1305

688254 502 8182 8235 TCCCCATTCCAGTTTCCA sooosssssssssooss 5-8-5 52 1306

688255 503 8183 8236 ATCCCCATTCCAGTTTCC sooosssssssssooss 5-8-5 61 1307

688256 504 8184 8237 GATCCCCATTCCAGTTTC sooosssssssssooss 5-8-5 50 1308

688257 505 8185 8238 CGATCCCCATTCCAGTTT sooosssssssssooss 5-8-5 48 1309

688258 506 8186 8239 GCGATCCCCATTCCAGTT sooosssssssssooss 5-8-5 44 1310

688259 507 8187 8240 TGCGATCCCCATTCCAGT sooosssssssssooss 5-8-5 49 1311

688260 508 8188 8241 CTGCGATCCCCATTCCAG sooosssssssssooss 5-8-5 70 1312

688261 509 8189 8242 GCTGCGATCCCCATTCCA sooosssssssssooss 5-8-5 72 1313

688262 510 8190 8243 TGCTGCGATCCCCATTCC sooosssssssssooss 5-8-5 47 1314

688263 511 8191 8244 GTGCTGCGATCCCCATTC sooosssssssssooss 5-8-5 0 1315

688264 512 8192 8245 TGTGCTGCGATCCCCATT sooosssssssssooss 5-8-5 56 1316

688265 513 8193 8246 ATGTGCTGCGATCCCCAT sooosssssssssooss 5-8-5 65 1317

688266 514 8194 8247 TATGTGCTGCGATCCCCA sooosssssssssooss 5-8-5 61 1318

688267 533 8213 8266 AAGTATAATTGATAGTCC sooosssssssssooss 5-8-5 47 1319

688268 534 8214 8267 GAAGTATAATTGATAGTC sooosssssssssooss 5-8-5 48 1320

688269 535 8215 8268 GGAAGTATAATTGATAGT sooosssssssssooss 5-8-5 35 1321

688270 536 8216 8269 TGGAAGTATAATTGATAG sooosssssssssooss 5-8-5 41 1322

688271 537 8217 8270 GTGGAAGTATAATTGATA sooosssssssssooss 5-8-5 48 1323

688272 538 8218 8271 TGTGGAAGTATAATTGAT sooosssssssssooss 5-8-5 42 1324 688273 539 8219 8272 CTGTGGAAGTATAATTGA sooosssssssssooss 5-8-5 32 1325

688274 540 8220 8273 TCTGTGGAAGTATAATTG sooosssssssssooss 5-8-5 0 1326

688275 541 8221 8274 GTCTGTGGAAGTATAATT sooosssssssssooss 5-8-5 0 1327

688276 542 8222 8275 TGTCTGTGGAAGTATAAT sooosssssssssooss 5-8-5 65 1328

688277 543 8223 8276 CTGTCTGTGGAAGTATAA sooosssssssssooss 5-8-5 0 1329

688278 544 8224 8277 TCTGTCTGTGGAAGTATA sooosssssssssooss 5-8-5 62 1330

688279 545 8225 8278 TTCTGTCTGTGGAAGTAT sooosssssssssooss 5-8-5 55 1331

688280 546 8226 8279 GTTCTGTCTGTGGAAGTA sooosssssssssooss 5-8-5 77 1332

688281 547 8227 8280 AGTTCTGTCTGTGGAAGT sooosssssssssooss 5-8-5 63 1333

688282 548 8228 8281 AAGTTCTGTCTGTGGAAG sooosssssssssooss 5-8-5 49 1334

688283 549 8229 8282 TAAGTTCTGTCTGTGGAA sooosssssssssooss 5-8-5 0 1335

688284 550 8230 8283 CTAAGTTCTGTCTGTGGA sooosssssssssooss 5-8-5 54 1336

688285 551 8231 8284 ACTAAGTTCTGTCTGTGG sooosssssssssooss 5-8-5 69 1337

688286 552 8232 8285 AACTAAGTTCTGTCTGTG sooosssssssssooss 5-8-5 65 1338

688287 553 8233 8286 AAACTAAGTTCTGTCTGT sooosssssssssooss 5-8-5 40 1339

688288 554 8234 8287 GAAACTAAGTTCTGTCTG sooosssssssssooss 5-8-5 36 1340

688289 555 8235 8288 AGAAACTAAGTTCTGTCT sooosssssssssooss 5-8-5 47 1341

688290 556 8236 8289 TAGAAACTAAGTTCTGTC sooosssssssssooss 5-8-5 48 1342

688291 557 8237 8290 GTAGAAACTAAGTTCTGT sooosssssssssooss 5-8-5 45 1343

688292 558 8238 8291 GGTAGAAACTAAGTTCTG sooosssssssssooss 5-8-5 44 1344

688293 559 8239 8292 AGGTAGAAACTAAGTTCT sooosssssssssooss 5-8-5 58 1345

688294 560 8240 8293 GAGGTAGAAACTAAGTTC sooosssssssssooss 5-8-5 45 1346

688295 561 8241 8294 GGAGGTAGAAACTAAGTT sooosssssssssooss 5-8-5 47 1347

688296 562 8242 8295 GGGAGGTAGAAACTAAGT sooosssssssssooss 5-8-5 44 1348

688297 563 8243 8296 TGGGAGGTAGAAACTAAG sooosssssssssooss 5-8-5 47 1349

688298 564 8244 8297 GTGGGAGGTAGAAACTAA sooosssssssssooss 5-8-5 53 1350

688299 565 8245 8298 AGTGGGAGGTAGAAACTA sooosssssssssooss 5-8-5 43 1351

688300 566 8246 8299 AAGTGGGAGGTAGAAACT sooosssssssssooss 5-8-5 36 1352

688301 567 8247 8300 GAAGTGGGAGGTAGAAAC sooosssssssssooss 5-8-5 41 1353

688302 568 8248 8301 TGAAGTGGGAGGTAGAAA sooosssssssssooss 5-8-5 0 1354

688303 569 8249 8302 ATGAAGTGGGAGGTAGAA sooosssssssssooss 5-8-5 41 1355

688304 570 8250 8303 TATGAAGTGGGAGGTAGA sooosssssssssooss 5-8-5 31 1356

688305 571 8251 8304 CTATGAAGTGGGAGGTAG sooosssssssssooss 5-8-5 46 1357

688306 572 8252 8305 TCTATGAAGTGGGAGGTA sooosssssssssooss 5-8-5 30 1358

688307 573 8253 8306 CTCTATGAAGTGGGAGGT sooosssssssssooss 5-8-5 54 1359

688308 574 8254 8307 ACTCTATGAAGTGGGAGG sooosssssssssooss 5-8-5 50 1360

688309 575 8255 8308 CACTCTATGAAGTGGGAG sooosssssssssooss 5-8-5 60 1361

688310 576 8256 8309 ACACTCTATGAAGTGGGA sooosssssssssooss 5-8-5 56 1362

688311 577 8257 8310 CACACTCTATGAAGTGGG sooosssssssssooss 5-8-5 57 1363

688312 578 8258 8311 ACACACTCTATGAAGTGG sooosssssssssooss 5-8-5 41 1364

688313 579 8259 8312 CACACACTCTATGAAGTG sooosssssssssooss 5-8-5 38 1365 Example 13: Dose-dependent antisense inhibition of human C90RF72 mRNA in HepG2 cells

Antisense oligonucleotides from the study described above exhibiting significant in vitro inhibition of C90RF72 mRNA were selected and tested at various doses in HepG2 cells. ISIS 619420 described in Example 2 hereinabove was also tested. The antisense oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 0.33 μΜ, 1.00 μΜ, 3.00 μΜ, or 9.00 μΜ concentrations of antisense oligonucleotide. After a treatment period of approximately 16 hours, RNA was isolated from the cells and C90RF72 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3750 was used to measure the total C90RF72 mRNA levels. C90RF72 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN^®. Results are presented as percent inhibition of C90RF72 levels, relative to untreated control cells.

The half maximal inhibitory concentration (IC⁵⁰) of each oligonucleotide is also presented in the Tables below. As shown in the Tables below, total C90RF72 mRNA levels were reduced in a dose- dependent manner in some of the antisense oligonucleotide treated cells.

Table 61

Dose-dependent inhibition of total C90RF72 mRNA levels in HepG2 cells

Table 62

Dose-dependent inhibition of total C90RF72 mRNA levels in HepG2 cells

Table 63

Dose-dependent inhibition of total C90RF72 mRNA levels in HepG2 cells

688400 61 81 85 85 <0.3

688404 38 62 78 81 0.6

688407 37 53 71 85 0.8

688415 43 18 79 73 1.3

688416 48 74 73 81 <0.3

688417 33 61 67 74 0.8

688418 34 55 77 82 0.8

Example 14: Tolerability of antisense oligonucleotides targeting human C90RF72 in mice

Antisense oligonucleotides from the Examples above were tested in a standard mouse model to assess tolerability of the oligonucleotides. The rodents were assessed by standard FOB assays and measurement of GFAP and/or AIF expression levels.

Groups of mice were administered a single ICV dose of 700 μg of ISIS oligonucleotides.

Mouse FOB assay

At 3 hours, one week, 2 weeks, 4 weeks, 6 weeks, and 8 weeks post injection, each mouse was evaluated according to 7 different criteria. The 7 criteria are (1) the mouse was bright, alert, and responsive; (2) the mouse was standing or hunched without stimuli; (3) the mouse showed any movement without stimuli (4) the mouse demonstrated forward movement after it was lifted; (5) the mouse demonstrated any movement after it was lifted; (6) the mouse responded to a tail pinch; (7) regular breathing. For each of the 7 different criteria, each mouse was given a sub-score of 0 if it met the criteria or 1 if it did not. After all of the 7 criteria were evaluated, the sub- scores were summed for each mouse and then averaged for each group. For example, if a mouse was bright, alert, and responsive 3 hours after the 700 μg ICV dose, and met all other other criteria, it would get a summed score of 0. If another mouse was not bright, alert, and responsive 3 hours after the 700 μg ICV dose but met all other criteria, it would receive a score of 1.

The results are presented as individual scores for each mouse in each group. The expression levels of GFAP and AIF1 in the thoracic spinal cord of the mice were assessed by qRT-PCR after 8 weeks.

Study 1 with cEt oligonucleotides

The oligonucleotides tested in this study are presented in the Table below. The FOB scores are given below.

Table 64

Antisense oligonucleotides targeted to SEQ ID NO: 2 ISIS No Start Site

672744 1335

672747 1338

672774 1368

672775 1369

672778 1372

672779 1373

672831 1440

672908 1349

672909 1350

672919 1360

672924 1368

672925 1369

672927 1371

672928 1372

672929 1373

672976 1435

672980 1439

672981 1440

Table 65

FOB scores in C57/B16 mice

672980 2, 2, 2, 2

672981 6, 6, 6, 6

Study 2 with cEt oligonucleotides

The oligonucleotides tested in this study are presented in the Table below. The FOB are given below.

Table 66

Antisense oligonucleotides targeted to SEQ ID NO: 2

Table 67

FOB scores in C57/B16 mice

Study 3 with cEt oligonucleotides

Table 68

Antisense oligonucleotides targeted to SEQ ID NO: 2

673229 1373

673275 1434

673276 1435

673280 1439

Table 69

FOB scores in C57/B16 mice

Study 4 with cEt oligonucleotides

Table 70

Antisense oligonucleotides targeted to SEQ ID NO: 2

673283 1442

673284 1443

673285 1444

673323 1512

673331 1520

673332 1521

673374 1368

673375 1369

673377 1371

673378 1372

673379 1373

673430 1439

673431 1440

673432 1441

673434 1443

Table 71

FOB scores in C57/B16 mice

Study 1 with MOE oligonucleotides

Table 72

Antisense oligonucleotides targeted to SEQ ID NO: 2

655016 5,5,3,3

655017 0,0,0,0

Study 2 with MOE oligonucleotides

Table 74

Antisense oligonucleotides targeted to SEQ ID NO: 2

Table 75

FOB scores in C57/B16 mice

619191 5,5,3,5

619201 3,3,3,1

619202 6,6,6,6

619203 5,1,5,5

619216 4,4,4,4

619217 2,2,2,2

Study 3 with MOE oligonucleotides

Table 76

Antisense oligonucleotides targeted to SEQ ID NO: 2

Table 77

FOB scores in C57/B16 mice

619246 4,5,5,4

619247 1,1,1,1

619251 4,7,4,4

619252 6,6,6,0

619259 6,6,4,5

619260 4,4,4,4

619276 3,3,4,4

619278 4,7,2,7

619280 7,7,7,7

619284 0,0,0,0

619292 6,5,5,5

619297 7,4,4,4

619298 0,0,0,0

619307 0,0,0,0

Study 4 with MOE oligonucleotides

Table 78

Antisense oligonucleotides targeted to SEQ ID NO: 2

Table 79

FOB scores in C57/B16 mice

Example 15: Tolerability of antisense oligonucleotides targeting human C90RF72 in rats

Antisense oligonucleotides from the Examples above were tested in a standard rat model to assess tolerability of the oligonucleotides. The rodents were assessed by standard FOB assays and measurement of GFAP and/or AIF expression levels. Groups of Sprague-Dawley rats were administered intrathecally with 2,000 g or 3,000 μg of ISIS oligonucleotide as specified in the Tables below.

Rat FOB assay

At 3 hours, one week, 2 weeks, 4 weeks, 6 weeks, and 8 weeks post injection the movement of 7 different parts of the body was evaluated for each rat. The 7 body parts were (1) the rat's tail; (2) the rat's posterior posture; (3) the rat's hind limbs; (4) the rat's hind paws; (5) the rat's forepaws; (6) the rat's anterior posture; and (7) the rat's head. For each of the 7 different body parts, each rat was given a sub-score of 0 if the body part was moving or 1 if the body part was paralyzed. After each of the 7 body parts was evaluated, the sub-scores were summed for each rat and then averaged for each group. Saline treated rats generally receive a score of 0.

Study 1 with 5-10-5 MOE oligonucleotides at 3.000 μζ. The oligonucleotides tested in this study are presented in the Table below. The FOB scores are given below.

Table 80

Antisense oligonucleotides targeted to SEQ ID NO: 2

Table 81

FOB scores in Sprague-Dawley rats

619268 6,6,6

619278 6,6,6

619284 1

619346 0,0,6

619350 4,0,3

619351 3,3,3

Study 2 with 5-10-5 MOE oligonucleotides at 3,000 μ£

Table 82

Antisense oligonucleotides targeted to SEQ ID NO: 2

Table 83

FOB scores in Sprague-Dawley rats

619293 ND

619307 ND

619317 6,6,7

619338 7,7,7

619339 7,6,3

619342 6,6,6

Study 3 with 5-8-5 MOE oligonucleotides at 3,000 μζ

Table 84

Antisense oligonucleotides targeted to SEQ ID NO: 2

Table 85

FOB scores in Sprague-Dawley rats

Study 4 with 5-8-5 MOE oligonucleotides at 3,000 μg

Table 86

Antisense oligonucleotides targeted to SEQ ID NO: 2

Table 87

FOB scores in Sprague-Dawley rats

672683 0, 2, 5, 5, 0, 4

672693 ND

672697 6, 6, 6, 6

672699 0, 0, 3, 4, 4, 1

672700 4, 7, 4, 4

672723 4, 4, 4, 4

672730 2, 2, 3, 3

The oligonucleotides tested in this study are presented in the Table below. The FOB are given below and indicate that several oligonucleotides were tolerable in this model.

Table 88

Antisense oligonucleotides targeted to SEQ ID NO: 2

Start Site of SEQ

ISIS No

ID NO: 2

61941 1 8004

619412 8012

627833 8001

655153 7916

655173 7992

655178 8014

655179 8016

655202 8098

655231 8183

655232 8186

655233 8189

655417 14089

655420 14331

671081 81 10

671082 8140

671083 8230

671084 14316

672561 mRNA

Table 89

FOB scores in Sprague-Daw

3 hr

PBS 0,0,0,0

61941 1 6,6,6,6

619412 4,6,6,0

627833 6,6,6,1

Study 6 with 5-8-5 MOE oligonucleotides at 2,000 μζ

Table 90

Antisense oligonucleotides targeted to SEQ ID NO: 2

Table 91

FOB scores in Sprague-Dawley rats

Study 7 with 5-8-5 and 5-10-5 MOE oligonucleotides at 2.000 μg

Table 92

Antisense oligonucleotides targeted to SEQ ID NO: 2

Table 93

FOB scores in Sprague-Dawley rats

3 hr

PBS 0, 0, 0, 0

688101 3, 2, 2, 2

688348 2, 1, 2, 2

688356 3, 3, 3, 3

688380 0, 0, 1, 0

688382 2, 2, 2, 2

688400 0, 3, 3, 3

688407 2, 2, 2, 2

688415 3, 0, 3, 3

688416 3, 3, 3, 3 688417 I 4, 4, 3, 3

Example 16: Acute Tolerability of oligonucleotides from WO 2014/062691

Oligonucleotides described in WO 2014/062691 were tested in an acute tolerability study in mice. The tested oligonucletoides include ISIS 576816, ISIS 576974, ISIS 577061, ISIS 577065, and ISIS 577083, which are 5-10-5 MOE gapmers with a full phosphorothioate backbone and each cytosine is a 5-methylcytosine. The sequences are provided in the Table below. Mice were separated into groups of 3 or 4 mice. Each mouse in each group of mice was administered a single ICV dose of either 700ug of the oligonucleotides in the table below. At 3 hours post injection, each mouse was evaluated according to 7 different criteria. The 7 criteria are (1) the mouse was bright, alert, and responsive; (2) the mouse was standing or hunched without stimuli; (3) the mouse shows any movement without stimuli (4) the mouse demonstrates forward movement after its lifted;

(5) the mouse demonstrates any movement after its lifted; (6) the mouse responds to a tail pinch; (7) regular breathing. For each of the 7 different criteria, each mouse was given a sub-score of 0 if it met the criteria or 1 if it did not. After all of the 7 criteria were evaluated, the sub-scores were summed for each mouse and then averaged for each group. For example, if a mouse was bright, alert, and responsive 3 hours after the ICV dose, and met all other other criteria, it would get a summed score of 0. If another mouse was not bright, alert, and responsive 3 hours after the dose but met all other criteria, it would receive a score of 1. Saline treated mice generally receive a score of 0. Results are presented as the average score for each treatment group in the Table below. These results demonstrate that ISIS 576816, ISIS 576974, ISIS 577061, ISIS 577065, and ISIS 577083 were poorly tolerated.

Table 94

Antisense oligonucleotides from WO 2014/062691

Table 95

FOB scores in mice

Gapmers from the studies described above, including compounds ISIS 576816, ISIS 576974, ISIS 577061, ISIS 577065, and ISIS 577083 which were previously disclosed in WO 2014/062691, are tested for tolerability in Sprague-Dawley rats. Rats are injected intrathecally with 3 mg of a single dose of ISIS oligonucleotide. A control group of rats is injected intrathecally with PBS. Acute tolerability is assessed 3 hours post-dose using a functional observational battery (FOB). This score is used to evaluate the acute tolerability of a compound with lower scores denoting better tolerated compounds. Control animals usually have a score of '0' or ' Γ. At 3 hours post injection, the rats are observed by placing each rat on the cage top and evaluating certain functions, assigning a number of '0' or Ί ' depending on whether the rat exhibits normal function in the region of interest (0) or does not (1) for each function, and then adding the total scores. Seven regions are assessed, including tail, hind paws, hind legs, hind end, front posture, fore paws, and head. Poor acute tolerability in mice is generally predictive of poor acute tolerability in rats. For example, ISIS 619185 (see Example 14 hereinabove) had an acute tolerability score of 7,6,6,6 (4 animals) in mouse, and an acute tolerability score of 7,7,6 (3 animals) in rats (See Example 15 hereinabove). ISIS 619342 (see Example 14 hereinabove) had an acute tolerability score of 6,6,6,6 (4 animals) in mouse, and an acute tolerability score of 6,6,6 (3 animals) in rats (see Example 1 hereinabove). Both compounds were deemed to be poorly tolerated acutely. It is therefore expected that the compounds ISIS 576816, ISIS 576974, ISIS 577061, ISIS 577065, and ISIS 577083, which were previously disclosed in WO 2014/062691, will show similarly high FOB scores in rats as they did in mice.

Claims

CLAIMS What is claimed is:

1. A compound, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 20-401 and 441-1545.

2. A compound, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 1107-1520 of SEQ ID NO: 2.

3. A compound, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 1111-1200 of SEQ ID NO: 2.

4. A compound, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 1211-1318 of SEQ ID NO: 2.

5. A compound, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 1326-1540 of SEQ ID NO: 2.

6. A compound, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 1331-1375 of SEQ ID NO: 2.

7. A compound, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 1368-1391 of SEQ ID NO: 2.

8. A compound, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 1398-1424 of SEQ ID NO: 2.

9. A compound, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 1411-1440 of SEQ ID NO: 2.

10. A compound, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 1429-1481 of SEQ ID NO: 2.

11. A compound, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 1502-1539 of SEQ ID NO: 2.

12. A compound, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 1508-1539 of SEQ ID NO: 2.

13. The compound of claims 2-5, wherein the nucleobase sequence of the modified oligonucleotide is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to SEQ ID NO: 1.

14. The compound of any preceding claim, consisting of a single-stranded modified oligonucleotide.

15. The compound of any preceding claim, wherein at least one internucleoside linkage is a modified internucleoside linkage.

16. The compound of claim 8, wherein at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.

17. The compound of claim 8, wherein each modified internucleoside linkage is a phosphorothioate internucleoside linkage.

18. The compound of any preceding claim, wherein at least one internucleoside linkage is a phosphodiester internucleoside linkage.

19. The compound of any preceding claim, wherein at least one internucleoside linkage is a phosphorothioate linkage and at least one internucleoside linkage is a phosphodiester linkage.

20. The compound of any preceding claim, wherein at least one nucleoside comprises a modified nucleobase.

21. The compound of claim 13, wherein the modified nucleobase is a 5-methylcytosine.

22. The compound of any preceding claim, wherein at least one nucleoside of the modified oligonucleotide comprises a modified sugar.

23. The compound of claim 15, wherein the at least one modified sugar is a bicyclic sugar.

24. The compound of claim 16, wherein the bicyclic sugar comprises a chemical link between the 2' and 4' position of the sugar 4'-CH2-N(R)-0-2' bridge wherein R is, independently, H, CI -CI 2 alkyl, or a protecting group.

25. The compound of claim 16, wherein the bicyclic sugar comprises a 4'-CH2-N(R)-0- 2' bridge wherein R is, independently, H, CI -CI 2 alkyl, or a protecting group.

26. The compound of claim 15, wherein at least one modified sugar comprises a 2'-0- methoxyethyl group.

27. The compound of claim 15, wherein the modified sugar comprises a 2'-0(CH₂)2- OCH₃ group.

28. The compound of any preceding claim, wherein the modified oligonucleotide comprises:

a gap segment consisting of 10 linked deoxynucleosides;

a 5' wing segment consisting of 5 linked nucleosides; and

a 3' wing segment consisting of 5 linked nucleosides;

29. The compound of any preceding claim, wherein the modified oligonucleotide comprises:

a gap segment consisting of 8 linked deoxynucleosides;

a 5' wing segment consisting of 5 linked nucleosides; and

a 3' wing segment consisting of 5 linked nucleosides;

30. The compound of any preceeding claim, wherein the modified oligonucleotide comprises sugar modifications in any of the following patterns: eeekkdddddddkkeee, eekkddddddddkkeee, ekddddddddekekeee, kekeddddddddekeke, and ekekddddddddkekee; wherein, e = a 2'-0-methoxyethyl modified nucleoside

d = a 2'-deoxynucleoside, and

k = a cEt nucleoside.

31. The compound of any preceeding claim, wherein the modified oligonucleotide comprises internucleoside linkages in any of the following patterns: soooossssssssssooss, sooosssssssssooss, soosssssssssooss, and sosssssssssoooss; wherein,

s = a phosphorothioate linkage, and

o = a phosphodiester linkage.

32. The compound of any preceding claim, wherein the modified oligonucleotide consists of 20 linked nucleosides.

33. The compound of any preceding claim, wherein the modified oligonucleotide consists of 19 linked nucleosides.

34. The compound of any preceding claim, wherein the modified oligonucleotide consists of 18 linked nucleosides.

35. The compound of any preceding claim, wherein the modified oligonucleotide consists of 17 linked nucleosides.

36. A composition comprising the compound of any preceding claim or salt thereof and at least one of a pharmaceutically acceptable carrier or diluent.

37. A method comprising administering to an animal the compound or composition of any preceding claim.

38. The method of claim 37, wherein the animal is a human.

39. The method of claim 38, wherein administering the compound prevents, treats, ameliorates, or slows progression of a C90RF72 associated disease, disorder or condition.

40. The method of claim 38, wherein administering the compound prevents, treats, ameliorates, or slows progression of a C90RF72 hexanucleotide repeat expansion associated disease, disorder or condition.

41. The method of claim 39 or 40, wherein the disease, disorder or condition is amyotrophic lateral sclerosis (ALS), irontotemporal dementia (FTD), corticalbasal degeneration syndrome (CBD), atypical Parkinsonian syndrome, and olivopontocerellar degeneration (OPCD).

42. The method of claim 37, wherein the administering reduces nuclear foci.

43. The method of claim 37, wherein the administering reduces expression of C90RF72 associated RAN translation products.

44. The method claim claim 43, wherein the C90RF72 associated RAN translation products are any of poly-(glycine-proline), poly-(glycine-alanine), and poly-(glycine-arginine).

45. Use of the compound or composition of any preceding claim for the manufacture of a medicament for treating a neurodegenerative disorder.

46. A method of selectively inhibiting a C90RF72 pathogenic associated mRNA variant by administering an antisense compound targeting the region beginning at the start site of exon 1A to the start site of exon IB of a C90RF72 pre-mRNA.