WO2015042741A1 - Protéine glissière à leucine bzip-6de thellungiella halophila, gène codant pour cette protéine, et utilisation du gène - Google Patents

Protéine glissière à leucine bzip-6de thellungiella halophila, gène codant pour cette protéine, et utilisation du gène Download PDF

Info

Publication number
WO2015042741A1
WO2015042741A1 PCT/CN2013/001160 CN2013001160W WO2015042741A1 WO 2015042741 A1 WO2015042741 A1 WO 2015042741A1 CN 2013001160 W CN2013001160 W CN 2013001160W WO 2015042741 A1 WO2015042741 A1 WO 2015042741A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
plant
gene
expression vector
plants
Prior art date
Application number
PCT/CN2013/001160
Other languages
English (en)
Chinese (zh)
Inventor
崔洪志
陈文华
孙超
Original Assignee
创世纪转基因技术有限公司
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 创世纪转基因技术有限公司 filed Critical 创世纪转基因技术有限公司
Priority to PCT/CN2013/001160 priority Critical patent/WO2015042741A1/fr
Priority to CN201380078592.2A priority patent/CN105452274A/zh
Publication of WO2015042741A1 publication Critical patent/WO2015042741A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance

Definitions

  • the present invention relates to plant proteins and coding genes thereof and applications thereof, and in particular to a leucine zipper protein Z ⁇ 7-6 derived from small salt mustard and a gene encoding the same, and a transgenic plant thereof for improving drought tolerance Application in .
  • BACKGROUND OF THE INVENTION Stresses such as temperature, salting and drought can cause serious damage to the growth and development of higher plants, resulting in reduced crop yields, degraded quality, and serious threats to agricultural production and the natural environment. Among them, the impact of drought on crop yields ranks first in many natural adversities, and its harm is equivalent to the sum of other disasters. Many regions are the bottleneck of agricultural development.
  • the world's arid and semi-arid regions account for 34% of the land area; China's arid and semi-arid regions account for 52% of the country's land area, and the annual drought-affected area amounts to 200-2.7 million hectares.
  • Cubic meters due to lack of water, less than 350-400 billion kilograms of grain; especially China's main grain-producing areas such as North China, Northeast China and Northwest China are the areas with the most water shortage in China, and the spring drought frequently reaches 10 years.
  • the first aspect of the present invention provides a gene encoding a leucine zipper protein of a small salt mustard (herein named ThbZIP-6); preferably, the sequence thereof is SEQ ID NO: 2.
  • a second aspect of the present invention provides a recombinant expression vector comprising the gene of the first aspect of the present invention, which is obtained by inserting the gene into a basic vector for constructing the recombinant expression vector, And the nucleotide sequence of the gene is operably linked to the expression control sequence of the base vector; preferably, the base vector is pCAMBIA2300; preferably, the recombinant expression vector is -ThbZIP as shown in FIG. -6-2K vector.
  • the third aspect of the invention provides a recombinant cell comprising the gene of the first aspect of the invention or the recombinant expression vector of the second aspect of the invention; preferably, the recombinant cell is a recombinant Agrobacterium cell.
  • a fourth aspect of the present invention provides a method for improving drought tolerance of a plant, comprising: introducing the gene of the first aspect of the invention or the recombinant expression vector of the second aspect of the invention into a plant or plant tissue and causing the gene Expression;
  • the plant is Arabidopsis thaliana.
  • a fifth aspect of the invention provides a method for producing a transgenic plant, comprising: cultivating a plant or a plant comprising the gene of the first aspect of the invention or the recombinant expression vector of the second aspect of the invention under conditions effective to produce a plant Tissue;
  • the plant is Arabidopsis thaliana.
  • a sixth aspect of the present invention provides the gene according to the first aspect of the present invention, the recombinant expression vector of the second aspect of the present invention or the recombinant cell of the third aspect of the present invention for improving drought tolerance of a plant and for use in plant breeding Use;
  • the plant is Arabidopsis thaliana.
  • the seventh aspect of the present invention provides the gene-encoded protein according to the first aspect of the present invention, which has an amino acid sequence as shown in SEQ ID NO: 1.
  • Fig. 1 is a construction flow of the plant expression vector ⁇ 58- ⁇ ) ⁇ / ⁇ -6-2300 of ThbZIP-6 (Fig. la-lb).
  • Figure 2 is a plasmid map of the plant expression vector ⁇ ;358- ⁇ ) ⁇ / ⁇ -6-2300 of ThbZIP-6.
  • FIG. 3 shows the results of drought tolerance simulation experiments of ⁇ ) ⁇ / ⁇ -6 T1 transgenic Arabidopsis plants (T1N5 in the figure) and non-transgenic Arabidopsis plants (in the figure, CK) as controls.
  • Fig. 3a is an Arabidopsis plant that is normally grown for 20 days
  • Fig. 3b is an Arabidopsis plant that has been subjected to drought treatment for 14 days after normal growth for 20 days.
  • Fig. 4 Results of changes in ABA content of T1 transgenic Arabidopsis plants and control plants under drought stress and normal growth conditions.
  • T1N1, T1N2, T1N3, T1N4, T1N5, T1N6, CK wherein T1N1, T1N2, T1N3, T1N4, T1N5, T1N6 are transgenic plants, and CK is the control plant.
  • FIG. 5 shows the results of protein expression verification at the transcriptional level of transgenic T1 Arabidopsis plants and non-transgenic control plants.
  • M is DNA Ladder Marker (DL2000, TakaRa)
  • 1-7 is a drought-tolerant transgenic Arabidopsis T1 plant (in order: T1N1, T1N2 T1N3 T1N4, T1N5, T1N6, T1N7)
  • 8-11 is non-transgenic Arabidopsis thaliana Control
  • 12-15 is a drought-tolerant transgenic Arabidopsis thaliana T1 plant.
  • BEST MODE FOR CARRYING OUT THE INVENTION The present invention will be further described below in conjunction with non-limiting examples. The examples are for illustrative purposes only and are not intended to limit the scope of the invention.
  • a subtractive library was constructed by the method of inhibition subtractive hybridization using the method shown by Clontech's PCR-selectTM cDNA Subtraction Kit.
  • the mRNA of the leaves of the drought-treated salt mustard seedlings was used as a sample (Tester) during the experiment, and the mRNA of the leaves of the untreated small salt mustard seedlings was used as a control.
  • the specific steps are as follows:
  • TheUungie ha phila purchased from the Wulanbu and Desert Green Botanical Garden in the Bayanor City of Inner Mongolia, China, was planted on the vermiculite vermiculite at 25 °C, photoperiod 16 hours light / 8 Incubate under hours of darkness (light intensity 2000-3000 Lx) and pour 1/2MS medium per week ( 9.39 mM KN0 3 , 0.625 mM KH 2 P0 4 , 10.3 mM NH 4 N0 3 , 0.75 mM MgS0 4 , 1.5 mM CaCl 2 , 50 ⁇ KI, 100 ⁇ ⁇ 3 ⁇ 3 , 100 M MnSO 4 , 30 ⁇ ZnS0 4 , 1 ⁇ ⁇ 2 ⁇ 0 4 , 0.1 ⁇ CoCl 2 , 100 ⁇ Na 2 EDTA, 100 ⁇ FeS0 4 ). It was used for experiments when the seedlings were as high as 25-30 cm.
  • the test seedlings were divided into 2 groups, 4 pots per group and 1 pot per pot.
  • the first group was a control group, cultured at 25 ° C, photoperiod of 16 hours light / 8 hours dark, and normal watering.
  • the second group was the drought treatment group, cultured at 25 °C, photoperiod 16 hours light/8 hours dark, stopped watering, treated for 10 days, and cut in time after treatment.
  • the leaves of the top 1/3 of the two seedlings were taken and rapidly frozen with liquid nitrogen and stored in a -70 °C refrigerator.
  • this experiment In order to increase the validity of the Expressed sequence tag (EST) (Unigene), avoid the gene-free cleavage site and the obtained sequence in the untranslated region, this experiment simultaneously uses the endonuclease Haelll to tester cDNA according to the above steps.
  • the cDNA was digested with Driver cDNA and subjected to two forward subtractive hybridizations and two inhibitory PCR amplifications. Finally, the second inhibitory PCR products of the two groups of forward subtractive hybridization cDNA fragments were combined.
  • the second PCR product of the combined forward subtractive hybridization cDNA fragment (purified using QIAquick PCR Purification Kit, purchased from Qiagen) and pGEM-T Easy (purchased from Promega kit) according to the procedure of the pGEM-T Easy kit
  • the vector is ligated, and the specific steps are as follows: The following components are sequentially added by using a 200 ⁇ PCR tube: The second PCR product of the purified forward subtractive hybridization cDNA fragment 3 ⁇ 1, 2 ⁇ 4 ligase buffer 5 , pGEM-T Easy vector 1 11, T4 DNA ligase 1 ⁇ , ligated overnight at 4 °C. Take 10 ligation reaction products, add to 100 competent E.
  • coli JM109 (purchased from TAKARA), ice bath for 30 minutes, heat shock for 60 seconds, ice bath for 2 minutes, and add 250 ⁇ L of LB medium (1% Tryptone from OXOID) , 0.5% Yeast Extract purchased from OXOID, 1% NaCl purchased from Sinopharm), placed in a 37 ° C water bath, shaken at 225 rpm for 30 minutes, take 200 ⁇
  • the bacterial solution was applied to LB (same as above)/X-gal/IPTG (X-gal/IPTG purchased from TAKARA, lg packaging) containing 50 g/mL ampicillin (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.).
  • the working concentration of 20 mg/ml mother liquor is: 200 ⁇ /100 ml LB medium above the mother liquor; IPTG is purchased from TaKaRa, and the 5g package is formulated into a mother liquor of 100 mM concentration.
  • the working concentration is: 100 ⁇ /lOOml of the above mother liquor LB culture Base) Incubate on solid culture plates for 18 hours at 37 °C. Count the number of clear white and blue colonies with a diameter > 1 mm in the culture plate and randomly pick 198 white colonies (number: Gh-B001 to Gh-B198).
  • sequence was SEQ ID No: 3. Sequence analysis indicated that the encoded protein of the sequence belonged to the leucine zipper protein.
  • the full-length coding gene corresponding to the clone YLS-47 was named as ThbZIP-6, its corresponding protein is named 6Zff-6.
  • SEQ ID No: 3 is the 3 terminal sequence of the coding gene bZIP-6. Based on the sequence of SEQ ID NO: 3 that has been obtained, the following three specific primers were designed as reverse transcription primers and specific primers for 5 'RACE.
  • the kit comes with universal primers:
  • AAP SEQ ID NO: 7 :
  • GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG AUAP SEQ ID NO: 8 :
  • the GGCCACGCGTCGACTAGTAC experimental procedure was performed according to the kit instructions (5' RACE System for Rapid Amplification of cDNA Ends kit purchased from Invitrogen).
  • YLS-47GSP1 (SEQ ID NO: 4) as a reverse transcription primer, reverse transcription using small salt mustard mRNA as a template to obtain a cDNA template, and then adding a Poly C tail according to the procedure in the above 5' RACE kit instructions.
  • the first round of PCR amplification was carried out using the product after tailing as a template.
  • the primer used was SEQ ID NO: 4 and the universal primer SEQ ID NO: 7 (the kit is self-contained, I is a hypoxanthine modified a, c, g or t), the specific steps are as follows:
  • PCR reaction system 5 ⁇ ⁇ ⁇ Buffer, 3 ⁇ 2.5 mM dNTP, 2.0 ⁇ mRNA reverse transcribed cDNA, 1.0 ⁇ Ex Taq (purchased from TAKARA), 10 ⁇ primers SEQ ID NO: 4 and SEQ ID NO: 7 each of 2.0 ⁇ l, and 35 ⁇ of double distilled water.
  • PCR reaction conditions pre-denaturation at 94 °C for 5 minutes, 33 cycles (94 °C for 50 seconds, 55 °C for 50 seconds, 72 °C for 1 minute), 72 °C for 10 minutes.
  • the obtained PCR product was diluted 50-fold with double distilled water, and 2.0 ⁇ L was used as a template, and the second round of PCR amplification was carried out using SEQ ID NO: 5 and the universal primer SEQ ID NO: 8.
  • the specific steps are as follows:
  • PCR reaction system 5 ⁇ ⁇ ⁇ Buffer, 3 ⁇ 2.5 mM dNTP, 2.0 ⁇ diluted first round PCR product, 1.0 l Ex Taq, 10 ⁇ primers SEQ ID NO: 5 and SEQ ID NO: 8 2.0 ⁇ l, and 35 ⁇ double distilled water.
  • PCR reaction conditions predenaturation at 94 °C for 5 minutes, 33 cycles (denaturation at 94 °C for 50 seconds, annealing at 55 °C for 50 seconds, extension at 72 °C for 1 minute), extension at 72 °C for 10 minutes.
  • a strip of approximately 870 bp in the second PCR product (Gel Extraction Kit from OMEGA) was recovered and ligated into pGEM-T Easy Vector, then converted to JM109 (specifically the same as above), and 8 whites were randomly picked. Colonies were inoculated separately with 50 g/mL ampicillin The penicillin was cultured in LB liquid medium, cultured at 37 ° C overnight, and then glycerin was added to a final concentration of 20% (v/v), and stored at -80 ° C until use.
  • the primers SEQ ID NO: 5 and the 3' primer SEQ ID NO: 6 were used for PCR amplification (reaction system and reaction conditions as above), and 6 positive clones were obtained, which were sent to Yingji Jieji (Shanghai) Trading Co., Ltd. for sequencing. Sequencing, a 5' end sequence of the cDNA of the gene was obtained.
  • the obtained 5' RACE product clone YL16-3 was sequenced to obtain the sequence of SEQ ID NO: 9:
  • SEQ ID NO: 10 is the full length sequence of ⁇ / ⁇ -6.
  • a pair of primers were designed according to the sequence of SEQ ID NO: 10 as follows:
  • ThbZIP-6F (SEQ ID NO: 1 1 ):
  • ThbZIP-6R SEQ ID NO: 12 :
  • TTACCACGGACCTGTAAGG AP SEQ ID NO: 13 :
  • ThbZIP-6 full-length coding sequence was cloned by SEQ ID NO: 11 and SEQ ID NO: 12.
  • the Arabidopsis thaliana RNA was extracted, and the primer SEQ ID NO: 13 was used as the reverse transcription primer to obtain the cDNA of the small salt mustard.
  • the PfuUltra II Fusion HS DNA Polymerase of Stratagene was used, and the PCR was carried out using the cDNA of the small salt mustard as a template.
  • 50 ⁇ PCR reaction system 5 ⁇ lO PfuUltra II reaction Buffer, 0.5 ⁇ 25 mM dNTP, 2.0 ⁇ cDNA, 1.0 ⁇ PfuUltra II Fusion HS DNA Polymerase 10 ⁇ primers SEQ ID NO: 11 and SEQ ID NO: 12 each 2.0 11, and 37.5 ⁇ of double distilled water.
  • PCR reaction conditions pre-denaturation at 95 °C for 2 minutes, 35 cycles (denaturation at 95 °C for 25 seconds, annealing at 52 °C for 25 seconds, extension at 72 °C for 1 min), and extension at 72 °C for 5 minutes.
  • PCR amplification product plus A tail PCR product hydration to 400 ⁇ 1, first remove the protein with chloroform once, add the supernatant to add 3 ⁇ sodium acetate solution 40 ⁇ l, add 2 times of absolute ethanol, -20 ° C for 10 minutes, Centrifuge, remove the supernatant, allow to dry, and dissolve in 21 ⁇ l of double distilled water. Add 2.5 ⁇ ⁇ Buffer, 0.5 ⁇ 5 mM dATP, 1.0 ⁇ Ex Taq. Reaction conditions: The reaction was carried out at 70 ° C for 30 minutes.
  • a DNA fragment of about 1 160 bp was recovered (Omega recovery kit), ligated into the pGEM T-easy vector (7 >Z/P-6-pGEM plasmid was obtained), and then transformed into JM109, and 6 white colonies were randomly picked.
  • the cells were inoculated in LB liquid medium containing 50 g/mL ampicillin, cultured at 37 ° C overnight, and then glycerin was added to a final concentration of 20% (v/v), and stored at -80 ° C until use.
  • the primers SEQ ID NO: 1 1 and SEQ ID NO: 12 were used for PCR amplification (reaction system and reaction conditions as above), and 4 positive clones were obtained and sent to Yingjie Jieji (Shanghai) Trading Co., Ltd. for sequencing, sequence.
  • SEQ ID NO: 2 the amino acid sequence of the protein encoded thereby is SEQ ID NO: 1.
  • Amino acid sequence of bZIP-6 protein SEQ ID NO: 1
  • the plant binary expression vector pCAMBIA2300 (purchased from Beijing Dingguo Changsheng Biotechnology Co., Ltd.) was selected as a plant expression vector, and the 35S promoter containing the double enhancer of the ⁇ gene was replaced with the Pnos promoter to reduce the expression of prion protein in plants. .
  • the 35S promoter containing the double enhancer and the terminator Tnos were selected as promoters and terminators of the ThbZIP-6 gene, respectively.
  • Pnos were amplified using the plant expression vector pBI121 (purchased from Beijing Huaxia Ocean Technology Co., Ltd.) using primers SEQ ID NO: 14 and SEQ ID NO: 15, using TaKaRa's PrimeSTAR HS DNA polymerase.
  • PCR reaction conditions pre-denaturation at 94 ° C for 5 minutes, 33 cycles (denaturation at 94 ° C for 30 seconds, annealing at 56 ° C for 30 seconds, extension at 72 ° C for 30 seconds), and extension at 72 ° C for 10 minutes.
  • the resulting PCR product was digested with EcoRI and Bglll and ligated into pCAMBIA2300 (Promega, T4 ligase cassette) to obtain pCAMBIA2300-1.
  • ATCCAGATCTAGATCCGGTGCAGATTATTTG SEQ ID NO: 16 and P SEQ ID NO: 17 Amplification of Tnos using pBI121 as a template, using PrimeSTAR HS DNA polymerase of TaKaRa. 50 ⁇ l ⁇ Reaction system: 10 ⁇ 5 > ⁇ PS Buffer, 3 ⁇ 2.5 mM dNTP, 1.0 ⁇ pBI121, 1.0 ⁇ Prime STAR, 10 ⁇ primer SEQ ID NO: 16 and P SEQ ID NO:
  • PCR reaction conditions pre-denaturation at 94 ° C for 5 minutes, 33 cycles (denaturation at 94 ° C for 30 seconds, annealing at 58 ° C for 30 seconds, extension at 72 ° C for 30 seconds), extension at 72 ° C for 10 minutes.
  • the resulting PCR product was digested with Sacl and EcoRI and ligated into the pCAMBIA2300-lCPromega T4 ligase cassette to obtain pCAMBIA2300-2.
  • SEQ ID NO: 18 and SEQ ID NO: 19 were used to amplify the Arabidopsis thaliana 35S promoter using the pCAMBIA2300 plasmid as a template.
  • PrimeSTAR HS DNA polymerase from TaKaRa was used. 50 ⁇ ⁇ Reaction system: 10 ⁇ 5 xPS Buffer, 3 ⁇ 2.5 mM dNTP, 1.0 ⁇ diluted 50-fold pCAMBIA2300 plasmid, 1.0 ⁇ PrimeSTAR, 10 ⁇ primers SEQ ID NO: 18 and SEQ ID NO: 19 each 2.0 ⁇ 1 , and 31 ⁇ of double distilled water.
  • PCR reaction conditions pre-denaturation at 94 ° C for 5 minutes, 33 cycles (denaturation at 94 ° C for 30 seconds, annealing at 50 ° C for 30 seconds, elongation at 72 ° C for 30 seconds), extension at 72 ° C for 10 minutes.
  • the resulting PCR product was ligated by HindIII and Pstl (connection method is the same as above)
  • pCAMBIA2300-2 obtained pCAMBIA2300-3
  • SEQ ID NO: 20 and SEQ ID NO: 21 Amplified ThbZIP-6 (template was the positive rMZ/P--pGEM plasmid obtained in Example 2) using Strafugene's PfuUltra II Fusion HS DNA Polymerase. 50 ⁇ PCR reaction system: 5 ⁇ lO PfuUltra II reaction Buffer, 0.5 ⁇ 1 25 mM dNTP, 2.0 ⁇
  • ThbZIP-6-pGEM plasmid 1.0 ⁇ PfuUltra II Fusion HS DNA Polymerase, 10 ⁇ primers SEQ ID NO: 20 and SEQ ID NO: 21 each 2.0 ⁇ l, and 37.5 ⁇ M double distilled water.
  • PCR reaction conditions pre-denaturation at 95 °C for 2 minutes, 35 cycles (denaturation at 95 °C for 25 seconds, annealing at 57 °C for 25 seconds, extension at 72 °C for 45 seconds, extension at 72 °C for 5 minutes. Digestion by Sall, Kpnl After the resulting PCR product is ligated (the connection method is the same as above) to lj
  • Agrobacterium LBA4404 (purchased from Biovector Science Lab, Inc) Preparation of Competent Cells: Agrobacterium LBA4404 was plated on LB solid medium containing 50 g/ml rifampicin and 50 g/ml streptomycin 1-2 days in advance Single spot inoculation, culture at 28 ° C for 1 to 2 days. Single colonies were picked and inoculated into 5 ml of LB liquid medium containing 50 ⁇ ⁇ / ⁇ 1 rifampicin and 50 ⁇ ⁇ / ⁇ 1 streptomycin, and cultured overnight (about 12-16 hours) to OD 6 at 28 °C with shaking. The K) value is 0.4, and a seed bacterial liquid is formed.
  • Transformation of Agrobacterium Thaw competent cells on ice, add 1 ⁇ of the positive 35S-7M)Z/P-6-2300 plasmid obtained in Example 3 to 40 ⁇ of competent cells, mix and mix, and ice bath about 10 minute.
  • the mixture of competent cells and plasmid DNA was transferred to an ice-cold electric shock cup with a pipette, and tapped to bring the suspension to the bottom, taking care not to have air bubbles.
  • Place the electric shock cup (purchased from Bio-Rad) on the slide of the electric shock chamber and push the slide to place the electric shock cup on the base electrode of the electric shock chamber.
  • Plants to be transformed Arabidopsis seeds (Columbia type, Arabidopsis thaliana Bioresource Center, Ohio State University) Seeded in peat soil, treated at 4 ° C for 3 days, placed at 23 ° C, 16 hours light Sprouting in an 8 hour dark incubator. 7 - 10 days later transplanted to peat soil and vermiculite (3:1 by volume) with a diameter of 7.5 cm In the plastic pot, 6 plants per pot were planted and grown in an incubator at 23 ° C, 16 hours light / 8 hours dark. 40 ml of nutrient solution per pot before transplanting, and the soil moisture should be replenished in time after transplanting. The nutrient solution is properly watered during the growth period.
  • Agrobacterium After removing the bacterial solution of the Agrobacterium-positive transformed clone preserved in Example 4, a single colony of Agrobacterium was picked and inoculated into 10 mL of sterile LB liquid medium (containing 75 mg/L rifampicin). 100 mg/L streptomycin and 100 mg/L kanamycin were shaken overnight at 250 rpm at 28 °C. Then, the obtained bacterial liquid was inoculated into 200 mL of LB liquid medium containing the above antibiotics at a ratio of 1% - 2% (v/v), and the concentration of Agrobacterium was reached at OD 6 (at a constant temperature of 28 °C).
  • the infusion medium contains 5.0% (w/v) sucrose and 0.05% (500 ⁇ ⁇ Silwet L-77) Resuspend Agrobacterium and suspend it to 0D 6QQ about 0.80.
  • Inflorescence dip dyeing The above Agrobacterium-containing dyeing medium was added to a large-mouth container, and 200-300 mL of the Agrobacterium-containing dyeing medium was added to each container having a diameter of 9 cm for dip dyeing. Invert the plants so that all the aboveground tissues are immersed in the Agrobacterium suspension for 3 - 5 seconds and gently agitate. There should be a liquid film on the plant after infiltration. The immersed plants are placed in a plastic tray, covered with a clean plastic or plastic wrap to moisturize, and then placed in low light or dark overnight, taking care to prevent direct sunlight from the plant. Remove the cover approximately 12 - 24 hours after processing. The plants are cultured normally, and the plants are further grown for 3 - 5 weeks until the pods are browned and dried. Seeds were harvested and the seeds were dried in a centrifuge tube at 4 °C.
  • ThbZIP-6 was amplified with SEQ ID NO: 11: and SEQ ID NO: 12 (50 ⁇ PCR reaction system: 5 ⁇ ⁇ ⁇ Buffer, 3 ⁇ 2.5 mM dNTP, 2.0 ⁇ DNA, 1.0 ⁇ Ex Taq, 10 ⁇ primers SEQ ID NO: 11 and SEQ ID NO: 12 each 2.0 ⁇ l, and 35 ⁇ double distilled water.
  • PCR reaction conditions 94 °C predenaturation 5 Minutes, 33 cycles (94°C denaturation for 45 seconds, 52°C annealing for 45 seconds, 72°C extension for 1 minute), 72°C extension for 7 minutes), Plants identified as positive by PCR were numbered (T1N1-T1N12) and stored.
  • T1N1-T1N12 Plants identified as positive by PCR were numbered (T1N1-T1N12) and stored.
  • Example 6 Drought Tolerance Simulation Experiment and Functional Identification of Transgenic Arabidopsis Thaliana Plants Overexpressing ThbZIP-6 The sterilized vermiculite was soaked in 1/2 MS medium.
  • T1N1-T1N6 and control Arabidopsis seeds were planted on vermiculite, 10 seeds per pot, 25 °C, 10 hours light culture / 14 hours dark culture cycle, 1/2MS every 7 days, after 20 days of culture 4-5 seedlings of uniform size were kept in each pot for drought experiments.
  • T1 transgenic plants plants grown from seeds of TO transgenic plants
  • T1N5, T1NK T1N2 T1N3, TIC 4, T1N6 are similar to T1N5. Not shown).
  • Example 7 Determination of ABA changes after drought stress
  • ABA is recognized as a plant hormone associated with stress, which can act as a signaling molecule to regulate the expression of multiple stress-inducing genes, thereby improving the plant's resistance to stress.
  • T1N1, T1N2 T1N3 T1N4, T1N5, T1N6 transgenic plants
  • CK control plants
  • the kit purchased from Shanghai Ruigu Biotechnology Co., Ltd. was used to determine the ABA content (see Figure 4).
  • RNA extracted by the plant RNA extraction kit was 0.05 g each of the leaves.
  • the absorbance values of total RNA at 260 nm and 280 nm were measured by HITACHI's UV spectrophotometer U-2001 to calculate the individual RNA concentrations.
  • Reverse transcription was carried out according to the method shown by Invitrogen reverse transcription assay (2 g total RNA as a template, reverse transcription primer SEQ ID NO: 13). The relative expression of the protein was examined by amplifying ThbZIP-6 by SEQ ID NO: 11 and SEQ ID NO: 12.
  • the PCR reaction was carried out using reverse-transcribed cDNA as a template using TaKaRa's PrimeSTAR HS DNA polymerase.
  • 50 ⁇ l ⁇ Reaction system 10 ⁇ 5 xPS Buffer, 3 ⁇ 2.5 mM dNTP, 2.0 ⁇ cDNA, 1.0 ⁇ PrimeSTAR 10 ⁇ primers SEQ ID NO: 16 and P SEQ ID NO: 17 each 2.0 ⁇ l, and
  • PCR reaction conditions pre-denaturation at 94 ° C for 5 minutes, 29 cycles (denaturation at 94 ° C for 45 seconds, annealing at 52 ° C for 45 seconds, extension at 72 ° C for 1 minute), extension at 72 ° C for 10 minutes.
  • M is the DNA Ladder Marker (DL2000, TakaRa)
  • 1-7 is the drought-tolerant transgenic Arabidopsis T1 plant (in order: T1N1, T1N2 T1N3 T1N4, T1N5, T1N6, T1N7).
  • 8-11 is a non-transgenic Arabidopsis control
  • 12-15 is a drought-tolerant transgenic Arabidopsis thaliana T1 plant.
  • the size of the electrophoresis band of the PCR product shown in the figure is consistent with the size of 7)Z/P-6 (about 1160 bp).

Abstract

L'invention concerne une protéine glissière à leucine, bZIP-6, issue de Thellungiella halophila. Elle concerne un gène codant pour ladite protéine, et une utilisation du gène dans la culture d'une plante transgénique présentant une tolérance accrue à la sécheresse.
PCT/CN2013/001160 2013-09-26 2013-09-26 Protéine glissière à leucine bzip-6de thellungiella halophila, gène codant pour cette protéine, et utilisation du gène WO2015042741A1 (fr)

Priority Applications (2)

Application Number Priority Date Filing Date Title
PCT/CN2013/001160 WO2015042741A1 (fr) 2013-09-26 2013-09-26 Protéine glissière à leucine bzip-6de thellungiella halophila, gène codant pour cette protéine, et utilisation du gène
CN201380078592.2A CN105452274A (zh) 2013-09-26 2013-09-26 一种小盐芥亮氨酸拉链蛋白bZIP-6及其编码基因与应用

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/CN2013/001160 WO2015042741A1 (fr) 2013-09-26 2013-09-26 Protéine glissière à leucine bzip-6de thellungiella halophila, gène codant pour cette protéine, et utilisation du gène

Publications (1)

Publication Number Publication Date
WO2015042741A1 true WO2015042741A1 (fr) 2015-04-02

Family

ID=52741706

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2013/001160 WO2015042741A1 (fr) 2013-09-26 2013-09-26 Protéine glissière à leucine bzip-6de thellungiella halophila, gène codant pour cette protéine, et utilisation du gène

Country Status (2)

Country Link
CN (1) CN105452274A (fr)
WO (1) WO2015042741A1 (fr)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101704884A (zh) * 2009-11-13 2010-05-12 北京市农林科学院 一种植物抗旱、耐盐相关蛋白EeABF6及其编码基因和应用

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101351556B (zh) * 2005-11-07 2013-07-10 克罗普迪塞恩股份有限公司 具有改良生长特性的植物及其制备方法
DE112008001044T5 (de) * 2007-05-03 2010-09-02 Basf Plant Science Gmbh Pflanzen mit verbesserten Ertragsmerkmalen und Verfahren zu ihrer Herstellung

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101704884A (zh) * 2009-11-13 2010-05-12 北京市农林科学院 一种植物抗旱、耐盐相关蛋白EeABF6及其编码基因和应用

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK 24 July 2012 (2012-07-24), accession no. FN84600 *
VYSOTSKII DA ET AL.: "ABF transcription factors of Thellungiella salsuginea: Structure, expression profiles and interaction with 14-3-3 regulatory proteins", PLANT SIGNAL BEHAV, vol. 8, no. 1, 1 January 2013 (2013-01-01), pages E22672-64 - E22672-70 *

Also Published As

Publication number Publication date
CN105452274A (zh) 2016-03-30

Similar Documents

Publication Publication Date Title
WO2013185258A1 (fr) Protéine hkt du coton et gène codant pour celle-ci, et leur utilisation
WO2014172852A1 (fr) Facteur de transcription myb myb1-1 du coton et son gène codant, et son utilisation
WO2015042742A1 (fr) Protéine de type calcineurine b cbl-3 du coton, gène codant pour celle-ci et utilisation associée
CN112391406B (zh) 促进草莓生长的方法及其所用生物材料
WO2015042740A1 (fr) Protéine de type calcineurine b cbl-4 de thellungiella halophila, gène codant pour celle-ci et application associée
WO2014169472A1 (fr) Protéine bzip-3 de coton de type glissière à leucine, gènes codant pour celle-ci, et application
WO2014172847A1 (fr) Facteur de transcription myb1-2 de type myb de thellungiella salsuginea et gene codant, et son utilisation
WO2014172826A1 (fr) Pyrophosphatase de tonoplaste vp1 issue de thellungiella halophila, ainsi que gène codant et application associés
WO2014107863A1 (fr) Protéine à fermeture éclair de leucine homéotique du coton hdbzip-1 et gène codant et utilisation de celle-ci
WO2015024143A1 (fr) Protéine à doigts de zinc zat10-1 provenant du coton, gène codant et applications associés
WO2015042738A1 (fr) Protéine glissière à leucine homéotique hdbzip-3 issue de thellungiella halophila, gène codant pour cette protéine, et utilisation du gène
WO2015042741A1 (fr) Protéine glissière à leucine bzip-6de thellungiella halophila, gène codant pour cette protéine, et utilisation du gène
WO2014172842A1 (fr) Cystéine protéase cysp1-2 du coton et son gène codant, et son utilisation
WO2014082280A1 (fr) Protéine en doigt de zinc (czf4) de coton, gène la codant et son application
WO2014101153A1 (fr) Isopentényl transférase ipt2 de coton, gène codant pour celle-ci et application de celle-ci
WO2015042739A1 (fr) Protéine glissière à leucine thellungiella halophila bzip-5, gène codant pour celle-ci, et application associée
WO2015042743A1 (fr) Protéine de type calcineurine b cbl-8 de thellungiella halophila, gène codant pour celle-ci et application associée
WO2015042737A1 (fr) Protéine à glissière à leucine bzip-4 de thellungiella halophila, gène codant pour celle-ci et utilisation associée
WO2015042745A1 (fr) Protéine de type déhydrine dh2 de thellungiella halophila, gène codant pour celle-ci et application associée
WO2013185257A1 (fr) Facteur de transcription analogue à dreb1, issu du coton et gène codant pour celui-ci, et leur utilisation
WO2014082285A1 (fr) Protéine à doigt de zinc du coton (czf5) et son gène codant et son utilisation
WO2014205598A1 (fr) Protéine de transport d'ions potassium haute affinité hkt1 obtenue à partir de thellungiella halophila, et gène codant et utilisation correspondante
WO2015039272A1 (fr) Tréhalose synthase tps-2 de coton, gène codant et utilisation correspondants
WO2014172825A1 (fr) Anti-protéine nhx2 sodium-hydrogène tonoplastique de thellungiella halophila, son gène codant et son utilisation
WO2014169482A1 (fr) Enzyme sulfurisée d'un cofacteur enzymatique à molybdène de thellungiella halophila mcsu-2, gènes codant pour elle, et ses applications

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 201380078592.2

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13894312

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13894312

Country of ref document: EP

Kind code of ref document: A1