WO2015030681A1 - Système multi-biocatalytique de synthèse in vitro pour la synthèse d'isoprénoïdes et de précurseurs d'isoprénoïdes - Google Patents

Système multi-biocatalytique de synthèse in vitro pour la synthèse d'isoprénoïdes et de précurseurs d'isoprénoïdes Download PDF

Info

Publication number
WO2015030681A1
WO2015030681A1 PCT/SG2014/000408 SG2014000408W WO2015030681A1 WO 2015030681 A1 WO2015030681 A1 WO 2015030681A1 SG 2014000408 W SG2014000408 W SG 2014000408W WO 2015030681 A1 WO2015030681 A1 WO 2015030681A1
Authority
WO
WIPO (PCT)
Prior art keywords
isolated
enzyme
diene
multienzyme mixture
amorpha
Prior art date
Application number
PCT/SG2014/000408
Other languages
English (en)
Inventor
Heng Phon Too
Xixian Chen
Ruiyang ZOU
Conqiang ZHANG
Original Assignee
National University Of Singapore
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by National University Of Singapore filed Critical National University Of Singapore
Publication of WO2015030681A1 publication Critical patent/WO2015030681A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P5/00—Preparation of hydrocarbons or halogenated hydrocarbons
    • C12P5/002—Preparation of hydrocarbons or halogenated hydrocarbons cyclic
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P9/00—Preparation of organic compounds containing a metal or atom other than H, N, C, O, S or halogen

Definitions

  • Isoprenoids belong to the largest group of natural products found in living organisms. These lipids have highly diverse, complex and multicyclic structures and some have therapeutic value for antibacterial, antineoplastic, and other pharmaceutical uses.
  • isoprenoids are largely derived from isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP), and the ability of cells to synthesize IPP and DMAPP largely determines the amount of isoprenoids that can be produced.
  • IPP isopentenyl pyrophosphate
  • DMAPP dimethylallyl pyrophosphate
  • artemisin is a clinically useful isoprenoid natural product derived from IPP and DMAPP, and is a key ingredient in a potent treatment to malaria [2], a contagious disease that claims millions of lives annually and continues to infect more than 0.5% of the global population, especially in less developed nations [1].
  • traditional supply of artemisinin depends on extraction of artemisinin from the leaves of the sweet wormwood plant Artemisia annua [3]. Since the growth of crops is slow and .
  • the invention described herein relates to systems and methods for producing an isoprenoid precursor or an isoprenoid in vitro.
  • One embodiment is a method comprising providing a multienzyme mixture comprising at least a first isolated enzyme, a second isolated enzyme and a third isolated enzyme from the mevalonate pathway, wherein the at leasf a first, a second and a third isolated enzymes are consecutive enzymes in the mevalonate pathway and the first isolated enzyme is the first consecutive enzyme of the at least a first, a second and a third isolated enzymes in the mevalonate pathway present in the multienzyme mixture; and treating a substrate of the first isolated enzyme with the multienzyme mixture in a reaction medium for a sufficient period of time to convert the substrate into the isoprenoid precursor or the isoprenoid, thereby producing the isoprenoid precursor or the isoprenoid.
  • Another embodiment is a method of producing amorpha-4,11-diene, comprising providing a multienzyme mixture comprising at least isolated phosphomevalonate kinase, isolated diphosphomevalonate decarboxylase, isolated isopentenyl pyrophosphate isomerase, isolated farnesyl pyrophosphate synthase and isolated amorpha-4,11-diene synthase; and treating a substrate of an isolated enzyme in the multienzyme mixture with the multienzyme mixture in a reaction medium for a sufficient period of time to convert the substrate into amorpha-4, 11 -diene.
  • Yet another embodiment is a method for producing dihydroartemisinic acid, comprising providing a multienzyme mixture comprising isolated alcohol dehydrogenase, isolated double bond reductase, isolated aldehyde dehydrogenase and cytochrome P450; and treating amorpha-4,11-diene with the multienzyme mixture in a reaction medium for a sufficient period of time to convert amorpha-4,11-diene into dihydroartemisinic acid.
  • Another embodiment is a system comprising a multienzyme mixture comprising at least a first isolated enzyme, a second isolated enzyme and a third isolated enzyme from the mevalonate pathway, wherein the at least a first, a second and a third isolated enzymes are consecutive enzymes in the mevalonate pathway and the first isolated enzyme is the first consecutive enzyme of the at least a first, a second and a third isolated enzymes in the mevalonate pathway present in the multienzyme mixture.
  • Another embodiment is a system comprising a multienzyme mixture comprising at least isolated phosphomevalonate kinase, isolated diphosphomevalonate decarboxylase, isolated isopentenyl pyrophosphate isomerase, isolated famesyl pyrophosphate synthase and isolated amorpha-4, 11 -diene synthase.
  • Yet another embodiment is a system comprising a multienzyme mixture comprising isolated alcohol dehydrogenase, isolated double bond reductase, isolated aldehyde dehydrogenase and cytochrome P450.
  • the systems and methods disclosed herein provide complementary ways of producing valuable drug precursors, and enable the identification of limiting steps and the optimization of enzymatic flux in a metabolic pathway in an efficient manner.
  • FIG. 1 A is a depiction of the mevalonate pathway.
  • FIG. IB is a depiction of a pathway for amorpha-4,11-diene production (Ergl2: mevalonate kinase, Erg8: phosphomevalonate kinase, Ergl9: diphosphomevalonate decarboxylase, Idi: isopentenyl pyrophosphate isomerase, IspA: famesyl pyrophosphate synthase, Ads: amorpha-4, 11 -diene synthase, Pi: phosphate, Ppi: pyrophosphate).
  • Ergl2 mevalonate kinase
  • Erg8 phosphomevalonate kinase
  • Ergl9 diphosphomevalonate decarboxylase
  • Idi isopentenyl pyrophosphate isomerase
  • IspA famesyl pyrophosphate synthase
  • Ads amorpha-4, 11 -diene synthase
  • Pi
  • FIG. 2 is a graph of the amount of the indicated enzyme in the soluble and insoluble fractions.
  • FIG. 3 A shows the average values of each level of factors Erg 12, Erg8 and Idi on AD yield. This group of enzymes has a positive correlation with AD yield.
  • FIG. 3B shows the average values of each level of factors Erg 19 and IspA on
  • AD yield This group of enzymes has little or no effect on AD yield.
  • FIG. 3C is a half-normal plot and indicates the significant factors on AD yield.
  • Factors A, B and D represent Ergl2, Erg8 and Idi, respectively.
  • FIGS. 4A-4C show the inhibitory effect of IspA and an analysis of the precipitates.
  • a set of separate experiments was conducted to validate the inhibitory effect of IspA, which was attributed to the precipitation of famesyl pyrophosphate (FPP).
  • FIG. 4A shows the fold change in amorpha-4,11-diene (AD) yield when increasing IspA and Idi concentrations while keeping other enzymes at reference level. Fold change in AD yield was calculated by normalizing against AD yield obtained by reference enzyme levels, as indicated by the arrows. Presented data are average of triplicates and standard errors are drawn on the plot.
  • FIG. 4B shows the results of UPLC-(TOF)MS analysis of the
  • FIG. 4C is a SDS-PAGE analysis of enzymes in the precipitates. The molecular weight of the each band present in the protein marker is indicated.
  • FIG. 5 is a summary of optimization of amorpha-4,11-diene production.
  • EA equal activities of the enzyme, which their concentrations in terms of Taguchi coded levels are Ergl2(l), Erg8(l), Ergl9(l), Idi(l), IspA(l).
  • TO A optimized enzymatic activities by Taguchi orthogonal array method, which their concentrations in terms of Taguchi coded levels are Ergl2(4), Erg8(4), Ergl9(l), Idi(3), IspA(2). This combination of enzyme concentrations was used as the reference condition.
  • RSM response surface methodology suggested increasing Ads activity. The other five enzymes were kept at reference level.
  • FIGS. 6 A and 6B show the effects of monovalent ions.
  • Monovalent ions were used to increase the specific activity of amorpha-4,11-diene synthase (Ads) and hence the specific amorpha-4,11-diene (AD) yield of the multienzyme synthesis reaction.
  • FIG. 6 A is a titration of potassium chloride concentrations, and show its effects on Ads specific activity.
  • Presented data are average of triplicates and standard errors are drawn on the plots. Student's t-Test with paired two samples for means was used to calculate the p-value in the statistical analysis.
  • FIG. 6B is a titration of different monovalent ions concentrations, and shows their effects on AD yield by reference enzymatic levels. Fold change in AD yield was calculated by normalizing against AD yield obtained by reaction without addition of monovalent ions, as indicated by the arrow. Presented data are average of triplicates and standard errors are drawn on the plots.
  • FIG. 7 shows the optimization of buffer pH and magnesium concentration.
  • AD yield was calculated by normalizing against AD yield obtained with buffer pH 7.4 and 10 mM Mg 2+ , as indicated by the arrow. Presented data are average of triplicates and standard errors are drawn on the plot.
  • FIG. 8 is a depiction of a biochemical pathway to convert amorphadiene to dihydroartemisinic acid (DHAA) (CYP71AV1 : cytochrome P450, Adhl : alcohol dehydrogenase, Dbr: double bond reductase, Aldhl : aldehyde dehydrogenase).
  • DHAA dihydroartemisinic acid
  • FIG. 9A is a graph of Ads specific activity and FPP as a function of adenosine 5'-triphosphate (ATP) concentration, and shows that Ads activity was inhibited in the presence of ATP.
  • ATP adenosine 5'-triphosphate
  • FIG. 9B is a graph of Ads specific activity and FPP as a function of PPi concentration, and shows that ADS specific activity was inhibited in the presence of PPi.
  • FIG. 9C is a graph of AD production as a function of time in the presence of the indicated species and enzymes, and shows that more than 90% of the starting material was converted to AD within 4 hours with the additional enzymes pyruvate kinase (PyfK) and pyrophosphatase (Ppa).
  • PyfK pyruvate kinase
  • Ppa pyrophosphatase
  • FIG. 1 OA is a schematic representation of immobilized multienzyme System I described in the Exemplification.
  • FIG. 10B is a schematic representation of immobilized multienzyme System II described in the Exemplification.
  • FIG. IOC is a schematic representation of immobilized multienzyme System III described in the Exemplification.
  • FIG. 10D is a bar graph of AD production and FPP concentration at 4 hours and 12 hours as a function of immobilized multienzyme system represented in FIGs. 10A, 10B and IOC, and shows that a significant improvement in AD yield was observed in the order of System III>System II>System I.
  • the concentration of FPP inversely correlated with AD yield.
  • FIG. 10E is a bar graph of AD production in each of the immobilized multienzyme systems represented in FIGs. 10A, 10B and IOC as a function of reaction cycle, and shows that more than 60% AD yield was retained in System II and System III, while less than 10% AD yield remained after the seventh cycle of the reaction in System I.
  • FIG. 11 A is a schematic representation of an in vitro biosynthetic reaction for producing artemisinic acid (AA) and dihydroartemisinic acid (DHAA), comprising extracted amorphadiene, whole-cell CYP15 enzyme and cell lysate mixture containing Adhl, Aldhl and Dbr2.
  • FIG. 1 IB is a bar graph, and shows the product distribution of the in vitro reaction represented in FIG. 11 A using different combinations of enzymes. Approximately 80% AD is converted to downstream oxidized products, about half of which is DHAA (AD: amorpha-4,1 1-diene, AO: artemisinic alcohol, AA: artemisinic acid, DHAA:
  • an enzyme can include a plurality of enzyme. Further, the plurality can comprise more than one of the same enzyme or a plurality of different enzymes.
  • a first embodiment of the invention is a method of producing an isoprenoid precursor or an isoprenoid.
  • the method comprises providing a multienzyme mixture comprising at least a first isolated enzyme, a second isolated enzyme and a third isolated enzyme from the mevalonate pathway, wherein the at least a first, a second and a third isolated enzymes are consecutive enzymes in the mevalonate pathway and the first isolated enzyme is the first consecutive enzyme of the at least a first, a second and a third isolated enzymes in the mevalonate pathway present in the multienzyme mixture; and treating a substrate of the at least a first, second and a third isolated enzymes (e.g., a substrate of the first isolated enzyme) with the multienzyme mixture in a reaction medium for a sufficient period of time to convert the substrate into the isoprenoid precursor or the isoprenoid, thereby producing the isoprenoid precursor or the isoprenoid.
  • Isoprenoid and terpenoid refer to an organic compound made up of two or more structural units derived from isoprene. Many isoprenoids and terpenoids are naturally occurring compounds. Non-limiting examples of isoprenoids include geranyl pyrophosphate (GPP), farnesyl pyrophosphate (FPP), squalene, taxol, amorphadiene and artemisinin. A preferred example of an isoprenoid is amorpha-4,11- diene (AD). Other preferred examples of isoprenoids include GPP and FPP, which are useful intermediates in the synthesis of more complex isoprenoids, including AD. Other examples of isoprenoids include artemisinic alcohol, artemisimc aldehyde, artemisinic acid, dihydroartemisinic aldehyde, dihydroartemisinic acid and artemisinin. In some examples of isoprenoids include artemisinic alcohol, artemisimc aldehyde
  • the isoprenoid is dihydroartemisinic acid.
  • Isoprenoid precursor refers to a substrate, intermediate or product that can be transformed into an isoprenoid by metabolism, for example, the mevalonate pathway.
  • isoprenoid precursors include the substrates and products of the mevalonate pathway depicted in FIG. 1 A.
  • Preferred examples of isoprenoid precursors include IPP and/or DMAPP.
  • the mevalonate pathway is depicted in FIG, 1 A and is one of two metabolic pathways associated with isoprenoid biosynthesis. As shown in FIG. 1 A, the mevalonate pathway consists of the metabolic processes responsible for transforming acetyl-CoA into dimethylallyl pyrophosphate (DMAPP), an isoprenoid precursor.
  • DMAPP dimethylallyl pyrophosphate
  • the steps involved in the mevalonate pathway include the transformation of acetyl-CoA into acetoacetyl-CoA by thiolase; the transformation of acetoacetyl-CoA into 3-hydroxy-3-methylglutaryl-CoA by HMG-CoA synthase; the transformation of 3-hydroxy-3-methylglutaryl-CoA into mevalonic acid by HMG-CoA reductase; the transformation of mevalonic acid into mevalonat-5-phosphate by mevalonate kinase (Ergl2); the transformation of mevalonate-5- phosphate into mevalonate-5-pyrophosphate by phosphomevalonate kinase (Erg8); the transformation of mevalonate-5 -pyrophosphate into isopentenyl-5 -pyrophosphate (IPP) by mevalonate-5 -pyrophosphate (or diphosphomevalonate) decarboxylase (Ergl9); and the transformation of IPP into dimethylallyl
  • isolated refers to an enzyme that exists outside of a cell and catalyzes a chemical reaction.
  • isolated precedes a particular enzyme, as in “isolated isopentenyl pyrophosphate isomerase,” it refers to isopentenyl pyrophosphate isomerase that exists outside of a cell and catalyzes a chemical reaction, for example, the reaction of IPP to DMAPP.
  • the molecule that an enzyme transforms during a chemical reaction is referred to herein as a "substrate” of the enzyme, and a molecule that results from a chemical reaction catalyzed by an enzyme is referred to herein as a "product" of the enzyme.
  • diphosphomevalomc acid is a substrate of Ergl9 and a product of Erg8 ⁇ see FIG. 1A).
  • Enzyme refers to a protein that acts as a catalyst to bring about a specific biochemical reaction.
  • Enzyme includes both wild-type enzymes (generated biosynthetically, by cells, or generated using chemical techniques, e.g., in a laboratory) and mutants thereof, so long as the mutations present in the mutant do not alter or do not significantly alter the ability of the protein to bring about the specific biochemical reaction catalyzed by the wild-type protein. Methods of producing mutant enzymes are well-known in the art, and exemplary methods are described in the Exemplification herein. It is to be understood that any enzyme specified herein, except in the Figures or the Exemplification, includes the wild-type enzyme or a mutant thereof.
  • the specified enzyme is a wild-type enzyme.
  • the specified enzyme is a mutant of the specified wild-type enzyme.
  • the specified enzyme is a wild-type enzyme.
  • Exemplary enzymes include thiolase, HMG-CoA synthase, HMG-CoA reductase, mevalonate kinase, phosphomevalonate kinase, diphosphomevalonate decarboxylase, isopentenyl pyrophosphate isomerase, farnesyl pyrophosphate synthase and amorpha-4,11- diene synthase.
  • exemplary enzymes include pyruvate kinase, pyrophosphatase, cytochrome P450, cytochrome P450 reductase, alcohol dehydrogenase, double bond reductase and aldehyde dehydrogenase.
  • Consecutive enzymes refers to two or more enzymes that catalyze successive steps in the mevalonate pathway. For example, Erg 19 and Idi, and Erg8, Erg 19 and Idi are consecutive enzymes. Idi and Erg8 are not consecutive enzymes.
  • First consecutive enzyme refers to the first occurring of the two or more enzymes in the mevalonate pathway depicted in FIG. 1 A.
  • Ergl9 is the first consecutive enzyme.
  • the first isolated enzyme is the first consecutive enzyme of the at least a first, a second and a third isolated enzymes in the mevalonate pathway present in the multienzyme mixture.
  • the first isolated enzyme is Erg 12 because Erg 12 is the first consecutive enzyme in the mevalonate pathway of the enzymes present in the multienzyme mixture. It also follows that if the first isolated enzyme is Erg 12, the first substrate of the first isolated enzyme is mevalonic acid.
  • the at least a first, a second and a third isolated enzymes are selected from the group consisting of thiolase, HMG-CoA synthase, HMG-CoA reductase, mevalonate kinase, phosphomevalonate kinase, diphosphomevalonate decarboxylase and isopentenyl pyrophosphate isomerase.
  • the at least a first, a second and a third isolated enzymes are selected from the group consisting of mevalonate kinase, phosphomevalonate kinase, diphosphomevalonate decarboxylase and isopentenyl pyrophosphate isomerase.
  • the at least a first, a second and a third enzymes comprise isolated isopentenyl pyrophosphate isomerase. In other aspects of the first embodiment, the at least a first, a second and a third enzymes comprise isolated mevalonate kinase, isolated phosphomevalonate kinase, isolated diphosphomevalonate decarboxylase and isolated isopentenyl pyrophosphate isomerase.
  • the multienzyme mixture further comprises one or more isolated enzymes for transforming an isoprenoid precursor, for example, DMAPP, into an isoprenoid, such as geranyl pyrophosphate, farnesyl
  • the multienzyme mixture further comprises isolated farnesyl pyrophosphate synthase (IspA).
  • IspA isolated farnesyl pyrophosphate synthase
  • Ads isolated amorpha-4,11-diene synthase
  • the multienzyme mixture further comprises isolated ispA, isolated ADS and cytochrome P450 (e.g., isolated cytochrome P450).
  • the multienzyme mixture further comprises isolated ispA, isolated ADS, cytochrome P450 (e.g., isolated cytochrome P450) and isolated Adh. In some aspects of the first embodiment, the multienzyme mixture further comprises isolated ispA, isolated ADS, cytochrome P450 (e.g., isolated cytochrome P450), isolated Adh and isolated Aldh. In some aspects of the first embodiment, the multienzyme mixture further comprises isolated ispA, isolated ADS, cytochrome P450 (e.g., isolated cytochrome P450), isolated Adh, isolated Aldh and isolated Dbr.
  • a second embodiment of the invention is a method of producing amorpha-4,11- diene.
  • the method comprises providing a multienzyme mixture comprising at least isolated phosphomevalonate kinase, isolated diphosphomevalonate decarboxylase, isolated isopentenyl pyrophosphate isomerase, isolated farnesyl pyrophosphate synthase and isolated amorpha-4,11-diene synthase; and treating a substrate of an isolated enzyme in the multienzyme mixture with the multienzyme mixture in a reaction medium for a sufficient period of time to convert the substrate into amorpha-4,11-diene.
  • the substrate is the substrate of the first consecutive enzyme in the mevalonate pathway present in the multienzyme mixture (e.g., mevalonic acid or phosphomevalonic acid).
  • the mevalonate pathway present in the multienzyme mixture (e.g., mevalonic acid or phosphomevalonic acid).
  • a pathway for amorpha-4,11-diene production is depicted in FIG. IB.
  • multienzyme mixture further comprises isolated mevalonate kinase.
  • each isolated enzyme is present in the multienzyme mixture in an appropriate amount to achieve an enzymatic activity ratio for Erg8:Ergl9:Idi:IspA:Ads of 50-150:0.5-5:20-30:1-10:1-5.
  • each isolated enzyme is present in the multienzyme mixture in an appropriate amount to achieve an enzymatic activity ratio for Erg8:Ergl9:Idi:IspA:Ads of 75-125:0.5-2.5:23-27:3-7:1-3.
  • each isolated enzyme is present in the multienzyme mixture in an appropriate amount to achieve an enzymatic activity ratio for Erg8:Ergl9:Idi:IspA:Ads of about 100:about 1 :about 25:about 5: about 2, for example, 100: 1 :25:5:2.
  • each isolated enzyme is present in the multienzyme mixture in an appropriate amount to achieve an enzymatic activity ratio for Ergl2:Erg8:Ergl9:Idi:IspA:Ads of 50-150:50-150:0.5-5:20-30:1-10:1-5.
  • each isolated enzyme is present in the multienzyme mixture in an appropriate amount to achieve an enzymatic activity ratio for Ergl2:Erg8:Ergl9:Idi:IspA:Ads of 75- 125:75-125:0.5-2.5:23-27:3-7:1-3.
  • each isolated enzyme is present in the multienzyme mixture in an appropriate amount to achieve an enzymatic activity ratio for Ergl2:Erg8:Ergl9:Idi:IspA:Ads of about 100:about 100:about l :about 25:about 5:about 2, for example, 100:100:1 :25:5:2.
  • Activity ratio is based on the activity of 1 OOmg/L Ads (lxAA).
  • the activity of lOOmg/L Ads is approximately 0.08 ⁇ /8, based on the experimental K cat value and its theoretical polypeptide molecular weight. Therefore, the activity of lOOx AA for Erg 12, for example, is approximately 8 ⁇ /s, which calculates back to 75-80 mg/L.
  • concentrations of the enzymes in the ratio of 100 Ergl2:100 Erg8:l Ergl9:25 Idi:5 IspA:2 Ads are Ergl2: 70-80mg/L, Erg8: 18-22mg/L, Ergl9: 1.4-1.6mg/L, Idi: 40-50mg/L, IspA: 8-lOmg/L, Ads: 100-200mg/L.
  • a third embodiment of the invention is a method of producing artemisinic acid or dihydroartemisinic acid, preferably dihydroartemisinic acid.
  • the method comprises providing a multienzyme mixture comprising isolated alcohol dehydrogenase, isolated double bond reductase, isolated aldehyde dehydrogenase and cytochrome P450; and treating amorpha-4,11-diene with the multienzyme mixture in a reaction medium for a sufficient period of time to convert amorpha-4,11-diene into artemisinic acid or dihydroartemisinic acid, preferably dihydroartemisinic acid.
  • cytochrome P450 can be provided as an isolated enzyme or in vivo (e.g., by providing a yeast strain engineered to produce the enzyme).
  • the method further comprises producing AD in vivo.
  • Methods of producing AD in vivo are well-known in the art.
  • the method further comprises producing AD in vitro.
  • the method for producing AD in vitro is as described with respect to the second embodiment, or any aspect thereof.
  • the method comprises:
  • a multienzyme mixture comprising at least isolated phosphomevalonate kinase, isolated diphosphomevalonate decarboxylase, isolated isopentenyl pyrophosphate isomerase, isolated farnesyl pyrophosphate synthase, isolated amorpha-4,11-diene synthase, isolated alcohol dehydrogenase, isolated double bond reductase, isolated aldehyde dehydrogenase and cytochrome P450 (e.g. isolated cytochrome P450); treating a substrate of an isolated enzyme in the multienzyme mixture with the multienzyme mixture in a reaction medium for a sufficient period of time to convert the substrate into dihydroartemisinic acid.
  • the substrate is the substrate of the first consecutive enzyme in the mevalonate pathway present in the first multienzyme mixture.
  • the method comprises: providing a first multienzyme mixture comprising at least isolated
  • phosphomevalonate kinase isolated diphosphomevalonate decarboxylase, isolated isopentenyl pyrophosphate isomerase, isolated farnesyl pyrophosphate synthase and isolated amorpha-4,l l-diene synthase;
  • dehydrogenase isolated double bond reductase, isolated aldehyde dehydrogenase and cytochrome P450;
  • the substrate is the substrate of the first consecutive enzyme in the mevalonate pathway present in the first multienzyme mixture.
  • the methods described herein generally comprise treating a substrate with a multienzyme mixture in a reaction medium for a sufficient period of time to convert the substrate into an isoprenoid precursor or an isoprenoid.
  • the method further comprises isolating the isoprenoid precursor (e.g., isopentenyl pyrophosphate, dimethylallyl pyrophosphate) or the isoprenoid (e.g., AD, DHAA) from the multienzyme mixture and the reaction medium.
  • isoprenoid precursor e.g., isopentenyl pyrophosphate, dimethylallyl pyrophosphate
  • AD isoprenoid
  • DHAA isoprenoid from the multienzyme mixture and the reaction medium.
  • Methods for isolating a product, such as AD, from a reaction mixture are well-known in the art and include solid-phase extraction, such as that described in the Exemplification, extractive work-up, distilling the reaction medium away from the product or otherwise drying the product, for example, by lyophilization, and chromatographic techniques, such as high performance liquid chromatography.
  • the product such as AD
  • the product can be isolated by collecting the solid phase and rinsing the solid phase with a solvent, such as a non-polar and/or amphiphilic organic solvent (e.g., hexane), or a combination thereof.
  • a solvent such as a non-polar and/or amphiphilic organic solvent (e.g., hexane), or a combination thereof.
  • the reaction medium comprises a buffer.
  • Exemplary buffers include Tris, HEPES, PIPES, MOPS, phosphate buffered-saline and phosphate buffers.
  • the reaction medium is biphasic.
  • the reaction medium comprises an aqueous layer (e.g., a buffer) and an organic layer (e.g., an organic solvent) not miscible with the aqueous layer.
  • the organic layer can advantageously be used to dissolve and capture an isoprenoid produced according to the methods of the invention, particularly in cases in which the isoprenoid produced is volatile and, as a consequence, readily evaporates.
  • organic solvents for use in the organic layer include hydrocarbon solvents, such as hexanes, cyclohexane and dodecane.
  • the pH of the reaction medium is greater than about 6 to less than about 10. In preferred aspects, the pH of the reaction medium is about 7 to about 8.5.
  • the reaction medium comprises an alkali or alkaline earth metal salt (e.g., magnesium chloride, potassium chloride) or an ammonium salt (e.g. , ammonium chloride).
  • the alkali or alkaline earth metal salt or ammonium salt can be present in the reaction medium in a concentration of from about 25 ihM to about 500 mM, from about 25 mM to about 250 mM, from about 50 mM to about 200 mM, from about 75 mM to about 150 mM or about 100 mM.
  • the alkali or alkaline earth metal salt is a magnesium salt.
  • the multienzyme mixture further comprises an isolated enzyme for regenerating ATP (e.g., isolated pyruvate kinase) or an isolated enzyme for metabolizing pyrophosphate (e.g., isolated pyrophosphatase) or a combination of the foregoing (i.e., an isolated enzyme for regenerating ATP and an isolated enzyme for metabolizing pyrophosphate).
  • an isolated enzyme for regenerating ATP e.g., isolated pyruvate kinase
  • an isolated enzyme for metabolizing pyrophosphate e.g., isolated pyrophosphatase
  • a combination of the foregoing i.e., an isolated enzyme for regenerating ATP and an isolated enzyme for metabolizing pyrophosphate.
  • multienzyme mixture is immobilized on a solid surface.
  • immobilized refers to the attachment of an enzyme to a solid surface, typically, a resin. Attachment can be either covalent or non-covalent (e.g., can rely on a metal ion affinity, as in the Ni NTA-hexahistidine interaction; ion-exchange
  • each enzyme is immobilized on a separate solid surface.
  • Each solid surface in these aspects, can be the same type of solid surface or can be independently different from the other solid surfaces or any combination of the foregoing (e.g., two specific enzymes can be immobilized separately on the same type of solid surface, while a third specific enzyme is immobilized on a different type of solid surface from the first two specific enzymes).
  • the enzymes are immobilized together on a solid surface.
  • Exemplary solid surfaces include Ni-NTA resin, negatively charged resin, such as carboxymethyl-cellulose, positively charged resin, such as diethylaminoethyl-cellulose, and substrate and recognition binding protein resin, such as biotin resin, amylose resin and glutathione resin.
  • Enzymes immobilized on a solid surface can effectively be reused for additional reaction cycles, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 additional reaction cycles, often without significantly affecting the yield of the desired isoprenoid precursor or isoprenoid.
  • the method further comprises isolating the multienzyme mixture; and treating a substrate (e.g., amorpha-4,11-diene or a second substrate, which can be the same substrate or a substrate different from the original or first substrate, typically, the same substrate) of an enzyme (e.g., the first isolated enzyme, the first consecutive enzyme in the mevalonate pathway present in the multienzyme mixture) with the isolated multienzyme mixture in a reaction medium (e.g., a second reaction medium, which can be the same reaction medium or a reaction medium different from the original, or first, reaction medium, typically, the same reaction medium) for a - In sufficient period of time to convert the substrate into the isoprenoid precursor (e.g., IPP, DMAPP) or the isoprenoid (e.g., amorpha-4,1 1-diene, dihydroartemisinic acid).
  • a substrate e.g., amorpha-4,11-diene or a second substrate, which can be the
  • a multienzyme mixture comprising enzymes immobilized on a solid surface can be isolated by collecting the solid surface (e.g., by filtration, centrifugation) and, optionally, rinsing the surface to remove unbound or unattached species.
  • the enzymes immobilized on a solid surface maintain greater than about 60%, greater than about 75%, greater than about 90% or greater than about 95% of the original yield of the desired isoprenoid precursor or isoprenoid after 2 additional reaction cycles (3 reaction cycles total, wherein the original yield is calculated from reaction cycle 1). In some aspects, the enzymes immobilized on a solid surface maintain greater than about 35%, greater than about 50%, greater than about 60%, greater than about 75%, greater than about 90% or greater than about 95% of the original yield of the desired isoprenoid precursor or isoprenoid after 3 additional reaction cycles (4 reaction cycles total, wherein the original yield is calculated from reaction cycle 1).
  • the enzymes immobilized on a solid surface maintain greater than about 25%, greater than about 50%, greater than about 60%, greater than about 75%, greater than about 90% or greater than about 95% of the original yield of the desired isoprenoid precursor or isoprenoid after 4 additional reaction cycles (5 reaction cycles total, wherein the original yield is calculated from reaction cycle 1).
  • isolated phosphomevalonate kinase, isolated diphosphomevalonate decarboxylase and, optionally, isolated mevalonate kinase are immobilized together on a first solid surface and isolated isopentenyl pyrophosphate isomerase, isolated farnesyl pyrophosphate synthase and isolated amorpha-4,11-diene synthase are immobilized together on a second solid surface.
  • the multienzyme mixture further comprises an isolated enzyme for regenerating ATP (e.g., isolated pyruvate kinase) or an isolated enzyme for metabolizing pyrophosphate (e.g., isolated pyrophosphatase) or a combination of the foregoing, isolated enzyme for regenerating ATP, when present, is immobilized on the first solid surface (together with isolated phosphomevalonate kinase, isolated
  • immobilized together means that the specified enzymes are immobilized in a spatially localized manner, for example, on a particular resin bead.
  • the isolated phosphomevalonate kinase, isolated diphosphomevalonate decarboxylase and, optionally, isolated mevalonate kinase are immobilized on a first resin bead(s) while the isolated isopentenyl pyrophosphate isomerase, isolated famesyl pyrophosphate synthase and isolated amorpha-4,11-diene synthase are immobilized on a different resin bead(s).
  • the first and second solid surfaces e.g., first and second resins
  • the method is a method for producing an isoprenoid precursor (e.g., IPP, DMAPP) or isoprenoid (e.g., amorpha-4,11- diene, dihydroartemisinic acid) in vitro.
  • IPP isoprenoid precursor
  • DMAPP isoprenoid precursor
  • in vitro refers to reactions, such as biochemical reactions, performed outside of a cell,- typically, though not exclusively, under cell-free conditions.
  • a fourth embodiment of the invention is a system for producing an isoprenoid precursor or an isoprenoid.
  • the system comprises at least a first isolated enzyme, a second isolated enzyme and a third isolated enzyme from the mevalonate pathway, wherein the at least a first, a second and a third isolated enzymes are consecutive enzymes in the mevalonate pathway and the first isolated enzyme is the first consecutive enzyme of the at least a first, a second and a third isolated enzymes in the mevalonate pathway present in the multienzyme mixture.
  • system further comprises a substrate of the first isolated enzyme (e.g., mevalonic acid).
  • a substrate of the first isolated enzyme e.g., mevalonic acid
  • the at least a first, a second and a third isolated enzymes are selected from the group consisting of thiolase, HMG-CoA synthase, HMG-Co A reductase, mevalonate kinase, phosphomevalonate kinase, diphosphomevalonate decarboxylase and isopentenyl pyrophosphate isomerase.
  • the at least a first, a second and a third isolated enzymes are selected from the group consisting of mevalonate kinase, phosphomevalonate kinase, diphosphomevalonate decarboxylase and isopentenyl pyrophosphate isomerase.
  • the at least a first, a second and a third isolated enzymes comprise isolated isopentenyl pyrophosphate isomerase. In other aspects of the fourth embodiment, the at least a first, a second and a third enzymes comprise isolated mevalonate kinase, isolated phosphomevalonate kinase, isolated
  • diphosphomevalonate decarboxylase and isolated isopentenyl pyrophosphate isomerase.
  • the system further comprises one or more isolated enzymes for transforming an isoprenoid precursor, for example, DMAPP, into an isoprenoid, such as geranyl pyrophosphate, farnesyl pyrophosphate and/or amorpha- 4,11-diene.
  • an isoprenoid precursor for example, DMAPP
  • the multienzyme mixture further comprises isolated farnesyl pyrophosphate synthase (IspA).
  • the multienzyme mixture further comprises isolated IspA and isolated amorpha- 4,11-diene synthase (Ads).
  • the multienzyme mixture further comprises isolated ispA, isolated ADS and cytochrome P450 (e.g., isolated cytochrome P450). In some aspects of the fourth embodiment, the multienzyme mixture further comprises isolated ispA, isolated ADS, cytochrome P450 (e.g., isolated cytochrome P450) and isolated Adh. In some aspects of the fourth embodiment, the multienzyme mixture further comprises isolated ispA, isolated ADS, cytochrome P450 (e.g., isolated cytochrome P450), isolated Adh and isolated Aldh. In some aspects of the fourth embodiment, the multienzyme mixture further comprises isolated ispA, isolated ADS, "cytochrome P450 (e.g., isolated cytochrome P450), isolated Adh, isolated Aldh and isolated Dbr.
  • the at least a first, a second and a third enzymes comprise at least isolated phosphomevalonate kinase, isolated
  • the at least a first, a second and a third enzymes further comprise mevalonate kinase.
  • a fifth embodiment of the invention is a system for producing amorph-4,11- diene.
  • the system comprises a multienzyme mixture comprising at least isolated phosphomevalonate kinase, isolated diphosphomevalonate decarboxylase, isolated isopentenyl pyrophosphate isomerase, isolated farnesyl pyrophosphate synthase and isolated amorpha-4,l l-diene synthase.
  • the system further comprises a substrate of an isolated enzyme in the multienzyme mixture.
  • the substrate is the substrate of the first consecutive enzyme in the mevalonate pathway present in the multienzyme mixture (e.g., mevalonic acid or phosphomevalonic acid).
  • the multienzyme mixture further comprises isolated mevalonate kinase.
  • each isolated enzyme is present in the multienzyme mixture in an appropriate amount to achieve an enzymatic activity ratio for Erg8:Ergl9:Idi:IspA:Ads of 50-150:0.5-5:20-30:1-10:1-5.
  • each isolated enzyme is present in the multienzyme mixture in an appropriate amount to achieve an enzymatic activity ratio for Erg8:Ergl9:Idi:IspA:Ads of 75-125:0.5-2.5:23-27:3-7:1-3.
  • each isolated enzyme is present in the multienzyme mixture in an appropriate amount to achieve an enzymatic activity ratio for Erg8:Ergl9:Idi:IspA:Ads of about 100:about l :about 25:about 5: about 2, for example, 100:1 :25:5:2.
  • each isolated enzyme is present in the multienzyme mixture in an appropriate amount to achieve an enzymatic activity ratio for Ergl2:Erg8:Ergl9:Idi:IspA:Ads of 50-150:50-150:0.5-5:20-30:1-10:1-5.
  • each isolated enzyme is present in the multienzyme mixture in an appropriate amount to achieve an enzymatic activity ratio for Ergl2:Erg8:Ergl9:Idi:IspA:Ads of 75- 125:75-125:0.5-2.5:23-27:3-7:1-3.
  • each isolated enzyme is present in the multienzyme mixture in an appropriate amount to achieve an enzymatic activity ratio for Ergl2:Erg8:Ergl9:Idi:IspA:Ads of about 100:about 100:about l :about 25:about 5:about 2, for example, 100:100:1 :25:5:2.
  • a sixth embodiment of the invention is a system for producing artemisinic acid or dihydroartemisinic acid, preferably dihydroartemisinic acid.
  • the system comprises a multienzyme mixture comprising isolated alcohol dehydrogenase, isolated double bond reductase and isolated aldehyde dehydrogenase, and cytochrome P450.
  • the system further comprises amorph- 4,11-diene.
  • the method further comprises a system accordingly to the fifth embodiment, or any aspect thereof.
  • the multienzyme mixture further comprises isolated phosphomevalonate kinase, isolated diphosphomevalonate
  • system further comprises a substrate of an isolated enzyme in the multienzyme mixture, preferably, the substrate of the first consecutive enzyme in the mevalonate pathway present in the multienzyme mixture.
  • the multienzyme mixture further comprises an isolated enzyme for regenerating ATP (e.g., isolated pyruvate kinase) or an isolated enzyme for metabolizing pyrophosphate (e.g., isolated pyrophosphatase) or a combination of the foregoing.
  • an isolated enzyme for regenerating ATP e.g., isolated pyruvate kinase
  • an isolated enzyme for metabolizing pyrophosphate e.g., isolated pyrophosphatase
  • each enzyme is immobilized on a separate solid surface.
  • Each solid surface in these aspects, can be the same type of solid surface or can be independently different from the other solid surfaces or any combination of the foregoing (e.g., two specific enzymes can be immobilized separately on the same type of solid surface, while a third specific enzyme is immobilized on a different type of solid surface from the first two specific enzymes).
  • the enzymes are immobilized together on a solid surface. Exemplary solid surfaces are as described above.
  • systems comprising enzymes immobilized on a solid surface maintain greater than about 60%, greater than about 75%, greater than about 90% or greater than about 95% of the original yield of the desired isoprenoid precursor or isoprenoid after 2 additional reaction cycles. In some aspects, systems comprising enzymes immobilized on a solid surface maintain greater than about 35%, greater than about 50%, greater than about 60%, greater than about 75%, greater than about 90% or greater than about 95%» of the original yield of the desired isoprenoid precursor or isoprenoid after 3 additional reaction cycles.
  • systems comprising enzymes immobilized on a solid surface maintain greater than about 25%, greater than about 50%, greater than about 60%, greater than about 75%, greater than about 90% or greater than about 95% of the original yield of the desired isoprenoid precursor or isoprenoid after 4 additional reaction cycles.
  • isolated phosphomevalonate kinase, isolated diphosphomevalonate decarboxylase and, optionally, isolated mevalonate kinase are immobilized together on a first solid surface and isolated isopentenyl pyrophosphate isomerase, isolated famesyl pyrophosphate synthase and isolated amorpha-4,11-diene synthase are immobilized together on a second solid surface.
  • the multienzyme mixture further comprises isolated enzyme for regenerating ATP (e.g., isolated pyruvate kinase) or an isolated enzyme for metabolizing pyrophosphate (e.g., isolated pyrophosphatase) or a combination of the foregoing, isolated enzyme for regenerating ATP, when present, is immobilized on the first solid surface (together with isolated phosphomevalonate kinase, isolated
  • the system further comprises a reaction medium.
  • exemplary reaction media are as described hereinabove with respect to the methods.
  • Taguchi orthogonal array design identified the local optimum enzymatic activity ratio for Ergl2:Erg8:Ergl9:Idi:IspA to be 100:100:1 :25:5, with a constant concentration of amorpha- 4,11-diene synthase (Ads, 100 mg/L).
  • the model also identified an unexpected inhibitory effect of farnesyl pyrophosphate synthase (IspA), where the activity was negatively correlated with AD yield. This was due to the precipitation of farnesyl pyrophosphate (FPP), the product of IspA.
  • Bacteria strains and plasmids used in this study are summarized in Table 1.
  • the pET-1 la (Stratagene, CA) was modified by replacing the T7 promoter with Lacl promoter to facilitate the transfer of the plasmids among different strains.
  • a 5' SacI site and a 3' Xhol site were introduced downstream from the 6xHis open reading frame.
  • the mevalonate pathway enzymes namely mevalonate kinase (Erg 12), phosphomevalonate kinase (Erg8) and pyrophosphomevalonate decarboxylase (Ergl9), were amplified from S. cerevisiae genomic DNA with forward and reverse primers that contain corresponding Sacl and Xhol sites.
  • the PCR products were ligated into the modified pET-1 la vector (Stratagene, CA) and transformed into competent E. coli strain DH10B. Isopentenyl pyrophosphate isomerase (Idi) and IspA were from our previous study [13].
  • Ads gene was codon optimized and synthesized by Genescript with sequences encoding C-terminal 6xHis-tag, and subsequently cloned into a modified pBAD-B vector (Invitrogen, CA) using 5' Sacl site and 3' Xhol site. The primers used for amplification of the genes are listed in Table 2. All the plasmids were transformed and harboured from E. coli XLlO-gold (Stratagene, CA) and then transformed to strains for enzyme overexpression (Table 1).
  • SacI-Ec ispA Forward GCTTAGAGCTCGACTTTCCGCAGCAACT 9
  • IPTG isopropyl-l-thio- -D-galactopyranoside
  • the enzymes were further concentrated by 3K Amicon ultra-0.5 mL centrifugal filter unit (Millipore, MA), and the protein concentrations were measured by Micro BCA protein assay kit (Thermo scientific, MA). The purified enzymes were further confirmed by sodium dodecyl sulfate- 12% polyacrylamide gel electrophoresis (Bio-Rad, CA).
  • Bacteria culture was grown in 2xPY medium at 20 °C until stationary phase after Ads expression was induced with 10 mM L-arabinose.
  • the cells were harvested by high speed centrifugation and resuspended in phosphate-buffered saline (PBS).
  • PBS phosphate-buffered saline
  • To purify Ads cells were lysed by three rapid freeze-thaw cycles by -80 °C freezer and 37 °C incubator. The released enzyme was separated from cell debris by centrifuging at 3000 g for 15 min, and purified by Ni-NTA resin as described above.
  • the pathway enzyme kinetics were determined individually by initial rate measurements.
  • the substrates and cofactors were added to 100 mM Tris/HCl reaction buffer (pH 7.4), and the reaction was initiated by adding pre-determined enzyme amount to ensure less than 10% substrate was consumed in 15 minutes at 30 °C.
  • the substrate concentrations were varied in equal steps in reciprocal space from 0.1 to T mM.
  • the reaction was terminated by adding equal volume of 1% ammonium hydroxide and diluted 10 times into cold methanol. After high speed centrifugation, the supernatant was subject to LTPLC-(TOF)MS analysis. Double-reciprocal plots of each enzymatic activity were constructed for the determination of K m and K cat values for the respective substrates. The calculated values for K m and K cat as well as enxyme yield are shown in Table 3. Table 3. Purification and characterizations of individual pathway enzymes from bacterial culture.
  • the bracket contains the specific substrate that the K m is measured for.
  • the enzyme yield is defined as the final amount of enzyme obtained after purification from a liter of bacterial culture. The results have been repeated more than three times.
  • the multienzyme reaction was carried out in a buffer (25 ⁇ ) that consisted of Tris/HCl (100 mM, pH7.4), MgCl 2 (10 mM), ( ⁇ )Mevalonic acid (10 mM), ATP (15 mM) and the purified enzymes.
  • the reaction was performed at 30 °C with an overlay of dodecane phase that contained trans-caryophyllene (50 mg/L) as an internal standard.
  • the dodecane phase was diluted 10 times in ethyl acetate and subject to GCMS analysis.
  • the ( ⁇ )mevalonic acid was prepared by complete alkaline hydrolysis of 2 M ( ⁇ )mevalonolactone (Sigma, MO) with equal volume of 2 M KOH at 37 °C for 1.5 h, and neutralized by adding 1 M hydrochloric acid to pH 7 [14].
  • Taguchi orthogonal array design and response surface methodology with central composite design were calculated using Design Expert® V8 Software (Stat-Ease, Inc).
  • Taguchi L 16 (4 5 ) orthogonal array was constructed, which can accommodate five control factors corresponding to the five pathway enzymes, each varied at four levels of concentrations (Table 4).
  • the four enzymatic levels were normalized against Ads activity (AA), ranging from IxAA, 5xAA, 25xAA and lOOxAA to achieve sufficient coverage. The lowest level was equalized enzymatic activity, whereas the highest level was comparable enzymatic concentrations.
  • the level of Idi was varied according to IspA. 16 randomized experimental runs were conducted to maximize AD yield (Equation 1).
  • the specific AD yield (Equation 2) was another indicator of the pathway productivity but was not considered in the design experiment.
  • the two dimensionless readouts were calculated as follows:
  • Table 5 shows the details of the Tagushi L 16 (4 5 ) orthogonal array design as well as the results of the array.
  • Electrospray ionization was used and mass spectrometry was operated to scan 50-800 m/z in negative mode with 2500 V end plate voltage and 3200 V capillary voltage. Nebulizer gas was provided in 2 bar, dry gas flow rate was 9 mL/min, and dry gas temperature was 200 °C. Under the assay conditions, all the intermediates were detected in the form [M-H] ⁇ Retention time was subsequently determined for each intermediate with respective synthetic standards and the set m/z extraction range. The peak area was calculated and subsequently used to compute the intermediate concentrations with the software provided by the manufacturer. The calibration curves were constructed with synthetic standards prepared under similar reaction conditions without enzymes. Linearity of the assays were determined individually with . coefficients of determinants (R 2 ) greater than 0.90.
  • FIG. 3 A and 3B show the average values of each level of the five enzymes on the AD yield.
  • the five enzymes could be classified into two main groups: A (Ergl2), B (Erg8) and D (Idi) positively enhanced AD yield when their activities were increased (FIG. 3 A), while varying the activities of Ergl9 and IspA did not have appreciable effect on AD yield (FIG. 3B).
  • the half normal plot (FIG. 3C) clearly indicates that Ergl2, Erg8 and Idi were three main factors that had stronger influence to maximize AD yield. Therefore, among the 16 runs, higher AD yield was obtained from combinations where all the three main enzymes were at higher activities (run 14 and run 12).
  • the model predicted the maximum AD yield would be achieved when the first four enzymes were at their highest activities (Table 5). Attempts to validate this finding showed no significant improvement over AD yield (Table 5), suggesting that the activity ratio of
  • AD -0.096 - 0.18 IspA + 3.68 ⁇ Ads m Enhancement Ads specific activity by buffer optimization
  • FIGS. 6 A and 6B show the change in Ads specific activity and the fold change in AD yield with respect to the reference condition respectively. As predicted, Ads specific activity was found to be enhanced approximately twice with 100 mM potassium ion (FIG. 6A).
  • FIG. 7 shows the fold change in AD yield with respect to the reference condition, when either pH or Mg concentrations was varied.
  • AD yield increased 3 times when the pH increased from 7.4 to 8.2, and there was no amorpha-4,11- diene detected when the pH was reduced to 6.
  • the optimum Mg 2+ concentration was found to be 15 mM, which resulted in a moderate 1.8 fold improvement of AD yield.
  • no synergistic effect was observed at pH 8.2 and 15 mM Mg 2+ .
  • the optimum condition found was at pH8.2 with 10 mM Mg , which significantly enhanced specific AD yield three times (FIG. 7).
  • the specific AD yield was further enhanced, demonstrating the flexibility of the in vitro system conditions often intolerable to cells.
  • Monovalent ions were found to be effective in improving both the specific activity of Ads and the specific AD yield by 2 and 3 fold, respectively. Monovalent ions are well known to be required for many enzymatic activities [34]. Whether the monovalent ions may act as an allosteric activator to Ads by binding to specific secondary structures, e.g. Hl-a loop of the enzyme [20], remains to be verified.
  • Cell-free synthesis complements in vivo biosynthesis, especially when the downstream compounds are cytotoxic. Many isoprenoids are secondary metabolites isolated from plants. Overexpression of plant enzymes in microorganisms can result in undue stress to the host cell. As a result, metabolite production can be compromised due to impaired cell growth. Coupled in vivo and in vitro biosynthesis represents a potential solution to this challenge. For example, small molecules can be produced in vivo and subsequently converted to more complex molecules via in vitro/semi-in vitro synthesis. Specifically, the in vitro synthesis method has been demonstrated with the downstream cytochrome enzyme, CYP71 AVI, that oxidizes AD to artemisinic acid (AA). The biochemical pathway to convert AD to AA and DHAA is depicted in FIG. 8.
  • a canonical modelling method Lin-log approximation, is promising to predict the regulatory patterns of the biochemical pathway based on steady state fluxes [35]. It was employed to unravel the regulatory behavior of in vitro reconstituted AD synthesis pathway in order to increase the productivity of the pathway. The use of reconstituted pathway is advantageous, since it is highly reproducible and open to manipulation by changing
  • FIG. 9A shows a statistically significant decrease in Ads specific activity when 0.2mM of ATP was
  • the pathway enzymes for AD biosynthesis were engineered with a hexahistidine- tag and conveniently co-immobilized on Ni-NTA modified solid surface.
  • Initial attempts to recycle the co-immobilized AD synthesis pathway did not yield satisfactory productivity and recyclability (FIG. 10A).
  • FIG. 10D approximately 40% AD yield was achieved after 12 hours incubation. Less than 10% AD yield was maintained after seventh cycle of reaction (FIG. 10E). This was likely due to the presence of high concentrations of ATP and pyrophosphate.
  • pyruvate kinase and inorganic pyrophosphatase were implemented and co-immobilized in a random fashion (FIG.
  • DHAA dihydroartemisinic acid
  • AD CYP71AV1 enzyme in separate host cells
  • FIG. 11A in vitro AD production was optimized. The secreted AD was extracted by solid phase CI 8 beads and then eluted using hexane. The hexane solvent was then removed by evaporation and the AD dissolved in DMSO, which was miscible with the aqueous reaction phase. Approximately 50% of the AD produced in vivo could be recovered by this method.
  • CYP71 AVI isolated from Artemisia annua, has been engineered by replacing the first N-terminal 15 amino acid (CYP15) with a short leading sequence from bovine CYP450. Moreover, its electron-donating partner, cytochrome p450 reductase from Artemisia annua (CPRaa) was fused to CYP15 for more efficient electron transfer. This enzyme was then transformed into yeast with deleted cell-wall protein (dCWP2) (BY4741, MATa; his3A 1; leu2A 0; metl5A 0; ura3A 0; Y L096w-a::kanMX4) and overexpressed under the control of Gall promoter.
  • dCWP2 deleted cell-wall protein

Abstract

L'invention concerne des systèmes multi-biocatalytiques in vitro pour la synthèse d'isoprénoïdes et de précurseurs d'isoprénoïdes, ainsi que des procédés de production d'isoprénoïdes ou de précurseurs d'isoprénoïdes in vitro au moyen des systèmes de l'invention.
PCT/SG2014/000408 2013-08-30 2014-08-29 Système multi-biocatalytique de synthèse in vitro pour la synthèse d'isoprénoïdes et de précurseurs d'isoprénoïdes WO2015030681A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201361871940P 2013-08-30 2013-08-30
US61/871,940 2013-08-30

Publications (1)

Publication Number Publication Date
WO2015030681A1 true WO2015030681A1 (fr) 2015-03-05

Family

ID=52587065

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/SG2014/000408 WO2015030681A1 (fr) 2013-08-30 2014-08-29 Système multi-biocatalytique de synthèse in vitro pour la synthèse d'isoprénoïdes et de précurseurs d'isoprénoïdes

Country Status (1)

Country Link
WO (1) WO2015030681A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10662415B2 (en) 2017-12-07 2020-05-26 Zymergen Inc. Engineered biosynthetic pathways for production of (6E)-8-hydroxygeraniol by fermentation
US10696991B2 (en) 2017-12-21 2020-06-30 Zymergen Inc. Nepetalactol oxidoreductases, nepetalactol synthases, and microbes capable of producing nepetalactone

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
S HIMANE. M. ET AL.: "Mevalonate-dependent enzymatic synthesis of amorphadiene driven by an ATP-regeneration system using polyphosphate kinase''.", BIOSCIENCE BIOTECHNOLOGY BIOCHEMISTRY, vol. 76, no. 8, 2012, pages 1558 - 1560 *
SUGAI. Y. ET AL.: "Enzymatic total synthesis of gibberellin A4 from acetate''.", BIOSCIENCE BIOTECHNOLOGY BIOCHEMISTRY, vol. 75, no. 1, 2011, pages 128 - 135 *
SUTHERLIN. A. ET AL.: "Multienzyme mevalonate pathway bioreactor''.", BIOTECHNOLOGY AND BIOENGINEERING, vol. 87, no. 4, 2004, pages 546 - 551 *
WESTFALL. P. ET AL.: "Production of amorphadiene in yeast and its conversion to dihydroartemisinic acid, precursor to the antimalarial drug artemisinin''.", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 109, no. 3, 2012, pages E111 - E118 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10662415B2 (en) 2017-12-07 2020-05-26 Zymergen Inc. Engineered biosynthetic pathways for production of (6E)-8-hydroxygeraniol by fermentation
US10696991B2 (en) 2017-12-21 2020-06-30 Zymergen Inc. Nepetalactol oxidoreductases, nepetalactol synthases, and microbes capable of producing nepetalactone
US11193150B2 (en) 2017-12-21 2021-12-07 Zymergen Inc. Nepetalactol oxidoreductases, nepetalactol synthases, and microbes capable of producing nepetalactone

Similar Documents

Publication Publication Date Title
Chen et al. Statistical experimental design guided optimization of a one-pot biphasic multienzyme total synthesis of amorpha-4, 11-diene
EP3622080B1 (fr) Procédés améliorés pour la production d'isobutène à partir d'acide 3-méthylcrotonique
Zurbriggen et al. Isoprene production via the mevalonic acid pathway in Escherichia coli (Bacteria)
Wolf et al. A systems biology approach reveals major metabolic changes in the thermoacidophilic archaeon S ulfolobus solfataricus in response to the carbon source L‐fucose versus D‐glucose
Han et al. Fermentative production and direct extraction of (−)-α-bisabolol in metabolically engineered Escherichia coli
US9322023B2 (en) Constructs and methods for the assembly of biological pathways
EP2432877B1 (fr) Procédé de production de (+)-zizaène
Nguyen et al. Unlocking the biosynthesis of sesquiterpenoids from methane via the methylerythritol phosphate pathway in methanotrophic bacteria, using α-humulene as a model compound
JP2014501495A (ja) ３−ヒドロキシアルカン酸の組合わせ酵素変換によるアルケンの製造
JP2013504312A (ja) アセトンとアセチル−ｃｏａから酵素によって３−ヒドロキシ−３−メチル酪酸を製造する方法
AU2019242553A1 (en) Biosynthesis of olivetolic acid
US20150118725A1 (en) Method for the enzymatic production of isoprenol using mevalonate as a substrate
JP2021522852A (ja) 組み換え酵母、構築方法、並びに、その組み換え酵母を用いたチロソール及び誘導体の製造方法
ul Hassan et al. Engineered Saccharomyces cerevisiae for the de novo synthesis of the aroma compound longifolene
Rodríguez-Concepción et al. Isoprenoid biosynthesis in prokaryotic organisms
Lee et al. Cloning and characterization of the dxs gene, encoding 1-deoxy-d-xylulose 5-phosphate synthase from Agrobacterium tumefaciens, and its overexpression in Agrobacterium tumefaciens
Zhang et al. Development of isopentenyl phosphate kinases and their application in terpenoid biosynthesis
WO2015030681A1 (fr) Système multi-biocatalytique de synthèse in vitro pour la synthèse d'isoprénoïdes et de précurseurs d'isoprénoïdes
KR101958113B1 (ko) (-)-α-비사볼올 생산 미생물 및 상기 미생물을 이용한 (-)-α-비사볼올 생산 방법
Zhan et al. The glyoxylate-serine pathway enables conversion of Saccharomyces cerevisiae to a synthetic methylotroph
Kudoh et al. Exploration of the 1-deoxy-d-xylulose 5-phosphate synthases suitable for the creation of a robust isoprenoid biosynthesis system
Pérez-Gil et al. Cloning and functional characterization of an enzyme from Helicobacter pylori that catalyzes two steps of the methylerythritol phosphate pathway for isoprenoid biosynthesis
Lai et al. Reconstruction of the archaeal isoprenoid ether lipid biosynthesis pathway in Escherichia coli through digeranylgeranylglyceryl phosphate
Liu et al. Joint antisense RNA strategies for regulating isoprene production in Escherichia coli
US9714436B2 (en) Recombinant microorganism and method for producing a substance using the same

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14840884

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 14840884

Country of ref document: EP

Kind code of ref document: A1