WO2015018860A1 - Neue peptide mit spezifität für die lunge - Google Patents

Neue peptide mit spezifität für die lunge Download PDF

Info

Publication number
WO2015018860A1
WO2015018860A1 PCT/EP2014/066892 EP2014066892W WO2015018860A1 WO 2015018860 A1 WO2015018860 A1 WO 2015018860A1 EP 2014066892 W EP2014066892 W EP 2014066892W WO 2015018860 A1 WO2015018860 A1 WO 2015018860A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
seq
lung
capsid
peptide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2014/066892
Other languages
German (de)
English (en)
French (fr)
Inventor
Martin Trepel
Jakob KOERBELIN
Stefan MICHELFELDER
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Universitatsklinikum Hamburg Eppendorf
Original Assignee
Universitatsklinikum Hamburg Eppendorf
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Universitatsklinikum Hamburg Eppendorf filed Critical Universitatsklinikum Hamburg Eppendorf
Priority to US14/911,197 priority Critical patent/US10688151B2/en
Priority to EP19153543.4A priority patent/EP3536794A3/de
Priority to EP14753039.8A priority patent/EP3030664A1/de
Priority to JP2016532677A priority patent/JP6560212B2/ja
Publication of WO2015018860A1 publication Critical patent/WO2015018860A1/de
Anticipated expiration legal-status Critical
Priority to US16/907,562 priority patent/US20210187062A1/en
Priority to US18/162,833 priority patent/US20230181683A1/en
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/162Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from virus
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/12Antihypertensives
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/33Fusion polypeptide fusions for targeting to specific cell types, e.g. tissue specific targeting, targeting of a bacterial subspecies
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14122New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14133Use of viral protein as therapeutic agent other than vaccine, e.g. apoptosis inducing or anti-inflammatory
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14171Demonstrated in vivo effect
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2799/00Uses of viruses
    • C12N2799/02Uses of viruses as vector
    • C12N2799/021Uses of viruses as vector for the expression of a heterologous nucleic acid
    • C12N2799/025Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from a parvovirus
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2810/00Vectors comprising a targeting moiety
    • C12N2810/40Vectors comprising a peptide as targeting moiety, e.g. a synthetic peptide, from undefined source

Definitions

  • the invention relates to a peptide, polypeptide or protein which specifically binds to cells of the lung endothelium.
  • the peptide, polypeptide or protein may be part of a viral capsid and used to selectively direct a recombinant viral vector to pulmonary endothelial tissue after systemic administration to a subject and to provide there for tissue specific expression of one or more transgenes.
  • the invention thus also relates to a recombinant viral vector, preferably an AAV vector, which comprises a capsid which contains the peptide, polypeptide or protein according to the invention, as well as at least one transgene packed in the capsid.
  • the viral vector is particularly useful for the therapeutic treatment of pulmonary dysfunction or lung disease.
  • the invention further relates to cells and pharmaceutical compositions comprising the viral vector of the invention.
  • Pulmonary hypertension is a severe chronic lung disease that, if untreated, regularly causes death.
  • the term encompasses diseases of various causes characterized by a structural change in the pulmonary vasculature, which raises blood pressure in the pulmonary arterial system to more than 25 mm Hg [1]. In the case of affected patients this usually leads to a stress-dependent respiratory distress and a general reduction in performance.
  • vessels narrow, resulting in transformation (remodeling) and thickening of all three layers of the vessel walls, ie, intima, media, and adventitia [2]. This often leads to dysphonia, global respiratory insufficiency, and right-sided heart failure. the congestive syndromes as well as long-term heart failure.
  • Pulmonary arterial hypertension is a particularly severe form of pulmonary hypertension in which the average survival from diagnosis, which is often very late due to the initial weak symptoms, is only about three years [3].
  • Adeno-associated viruses are promising candidates for use in clinical practice, as they are considered relatively safe.
  • AAV vectors are capable of infiltrating a transgene into a tissue and stably and efficiently expressing it there. At the same time, these vectors have no known pathogenicity mechanisms [10].
  • AAV vectors of serotype 2 AAV2
  • the transgenes may be present in various forms in the transfected cell, e.g. as episomal, single- or double-stranded DNA. Also concatameric forms of DNA were detected in transduced cells.
  • the genome of AAV2 is formed by a linear, single-stranded DNA molecule of about 4700 nucleotides in length and includes inverted terminal repeats (ITRs) at both ends.
  • the genome also includes two large open reading frames called replication region (rep) and capsid region (cap).
  • the replication region encodes proteins required in virus replication.
  • the capsid region on the other hand, encodes the structural proteins VP1, VP2, and VP3, which make up the icosahedral capsid of the virus.
  • wild-type AAV vectors such as the AAV2 vectors described, do not have sufficient specificity for a particular tissue but infect a wide variety of cell types.
  • Reference [1.3] describes a method that allows screening for capsids of AAV2 with modified tropism in randomized peptide libraries. From these libraries, it is possible to isolate vectors which specifically transduce a desired cell type in vitro. However, it has surprisingly been found that the capsids selected in this way are often unsuitable for use in vivo since they lack the necessary specificity in the animal model [14].
  • the present invention provides viral vectors for targeted gene transfer into the lung.
  • the viral vectors of the invention express on their capsid surface a hitherto unknown amino acid sequence, which is specifically recognized in vivo by receptors on the endothelial tissue of the lung.
  • the viral vectors of the present invention specifically transduce its lung tissue.
  • the viral vectors of the invention also allow a strong and long-lasting expression of a transgene in the endothelial cells of the lung with only a minor immune response and are therefore particularly suitable for the gene therapy treatment of certain pulmonary disorders and / or lung diseases. After transfection, the AAV vectors elicit only a minor immune response in the host and are thus particularly suitable for gene therapy.
  • various lung-specific sequences were identified by selection in a randomized AAV2-heptamer-peptide library. Based on the identified peptide sequence ESGHGYF (SEQ ID NO: 2), the recombinant viral vector rAAV2-ESGHGYF was prepared in which the peptide sequence ESGHGYF is expressed as a partial sequence of the capsid protein VP1. Subsequently, the vector rAAV2-ESGHGYF was administered intravenously to mice, whereby a clear specificity of the vector for lung endothelial tissue could be observed both in vitro and in vivo. The specificity could be demonstrated by staining with CD31 as described in the present examples.
  • the present invention therefore provides various lung-specific peptide sequences which are particularly suitable for use in therapeutic agents, e.g. direct viral vectors into the lungs of a subject to be treated.
  • the present invention relates to a peptide, polypeptide or protein that specifically binds to endothelial cells of the lung, wherein the peptide, polypeptide or protein comprises the amino acid sequence of SEQ ID NO: 1.
  • the peptide, polypeptide or protein comprises the amino acid sequence of SEQ ID NO: 2 or a variant thereof which differs from the amino acid sequence of SEQ ID NO: 2 by modification of at least one of the two N-terminal amino acids.
  • the peptide, polypeptide or protein according to the invention preferably binds to endothelial cells of the lung, in particular of the human lung.
  • the invention relates to a peptide, polypeptide or protein that specifically binds to endothelial cells of the lung, wherein the peptide, polypeptide or protein comprises the amino acid sequence of SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: 5 ,
  • the term "peptide” refers to a linkage of 2-10 amino acids linked together by a peptidic linkage.
  • polypeptide refers to a linkage of 11-100 amino acids linked by a peptidic linkage. Polypeptides with more than 100 amino acids are referred to herein as "protein".
  • the lung-specific peptide sequence according to the invention of SEQ ID NO: 1 or SEQ ID NO: 2 or the variant of SEQ ID NO: 2 is part of a capsid protein of a virus. This means that the lung-specific sequence is present as part of a capsid protein of the virus.
  • a corresponding nucleotide sequence coding for the lung-specific peptide is cloned into the region of the virus genome which codes for a capsid protein of the virus. If the lung-specific sequence is expressed as part of a capsid protein, it can often be presented on the surface of the viral vector.
  • the capsid protein is one derived from an adeno-associated virus (AAV).
  • AAV may be any of the serotypes described in the prior art, the capsid protein preferably being derived from an AAV of one of serotypes 2, 4, 6, 8 and 9.
  • a capsid protein of serotype 2 AAV is particularly preferred.
  • the AAV wild-type capsid is composed of the capsid proteins VP1, VP2 and VP3, which are overlapped by the cap region. All three proteins have an identical C-terminal region.
  • the capsid of AAV comprises about 60 copies of the proteins VP1, VP2 and VP3, expressed in the ratio 1: 1: 8. If a nucleotide sequence coding for one of the lung-specific peptides described herein is cloned C-terminal into the reading frame of VP1 (ie, the region that is identical for all three proteins), one can expect that theoretically 60 of the specific peptides will be deleted can be found on the capsid surface.
  • the gene coding for the lung-specific peptide is cloned nucleotide sequence in the cap region at the 3 'end of the genome.
  • the lung-specific peptide coding sequence can be cloned into the genomic sequence of one of the capsid proteins VP1, VP2 or VP3.
  • the capsid proteins of AAV2 are exemplified in SEQ ID NO: 6 (VP1), SEQ ID NO: 7 (VP2), and SEQ ID NO: 8 (VP3).
  • the sequence coding for the lung-specific peptide is cloned into the reading frame of a VP1 gene, preferably into the VP1 gene of AAV2 shown in SEQ ID NO: 6. It should be noted that the insertion of the cloned sequence results in no change of the reading frame and no premature termination of the translation. The person skilled in the necessary methods will be readily apparent.
  • amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2 or its variant may be e.g. immediately after one of the following amino acids of the VPI protein, in particular the protein of SEQ ID NO: 6, connect: 550, 551, 552, 553, 554, 555, 556, 557, 558, 559, 560, 561, 562, 563 564 565 566 567 568 569 570 571 572 573 574 575 576 578 579 580 581 582 583 584 585 586 587 588 , 589, 590, 591, 592, 593, 594, 595, 596, 597, 598, 599 or 600.
  • amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2 or its variant (or alternatively, the peptide sequences of SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: 5) follow the amino acid 588 of the VPI protein of SEQ ID NO: 6, as shown in the examples. It is possible that between the arginine residue in position 588 and the first amino acid of SEQ ID NO: 1 or SEQ ID NO: 2 or the variant of SEQ ID NO: 2 one or more, and in particular up to 5 (ie 1, 2, 3, 4 or 5) are amino acids, which are due to the cloning. Likewise, behind the last amino acid of SEQ ID NO: 1 or SEQ ID NO: 2 or the variant of SEQ ID NO: 2 may be one or more, in particular up to 5 (i.e., 1, 2, 3, 4 or 5) amino acids.
  • amino acid R588 in VP1 corresponds to position R451 of VP2 (SEQ ID NO: 7) or position R386 of VP3 (SEQ ID NO: 8).
  • SEQ ID NO: 9 exemplifies the sequence of the VPI protein of AVV2 after introduction of the peptide sequence of SEQ ID NO: 2. Due to the cloning, the capsid protein has two additional amino acids present in the native sequence of the VP1 protein of AVV2 does not occur. Thus, the peptide sequence of SEQ ID NO: 2 is flanked N-terminally by a glycine at position 589 and C-terminal by an alanine at position 597. In addition, the asparagine at position 587 of the native sequence is exchanged for a glutamine.
  • the present invention thus also relates to a capsid protein comprising or consisting of:
  • the invention is directed to a viral capsid comprising a peptide, polypeptide or protein which specifically binds to cells of the lung and the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2 or a variant as described above of SEQ ID NO: 2 (or alternatively the peptide sequences of SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: 5).
  • the present invention also provides a nucleic acid encoding a peptide, polypeptide or protein as described above.
  • a nucleic acid suitable for A capsid protein encoding a peptide, polypeptide or protein of the invention as described above is also provided.
  • the nucleic acid coding for the capsid protein preferably comprises the nucleotide sequence of SEQ ID NO: 10 or a nucleotide sequence derived therefrom with at least 80% sequence identity.
  • a plasmid comprising such a nucleic acid is also provided.
  • the invention relates to a recombinant, i. a viral vector produced by genetic engineering which comprises a capsid and at least one transgene packed therein, wherein the capsid comprises at least one capsid protein having the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2 or of a variant of SEQ ID NO: 2, which differs from the amino acid sequence of SEQ ID NO: 2 by modification of at least one of the two N-terminal amino acid.
  • the capsid protein may also comprise the amino acid sequence of SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: 5.
  • the recombinant viral vector may be a recombinant AAV vector, e.g. such serotype 2, 4, 6, 8, and 9 serotype 2 AAV vectors are particularly preferred.
  • AAV serotypes differ essentially in their natural tropism. For example, wild-type AAV2 binds more strongly to alveolar cells than to lung epithelial cells, whereas AAV5, AAV6, and AAV9 are capable of greater transduction of respiratory epithelial cells.
  • AAV5 AAV6, and AAV9 are capable of greater transduction of respiratory epithelial cells.
  • AAV9 AAV9 are capable of greater transduction of respiratory epithelial cells.
  • a transgene is a gene which has been introduced into the genome of the vector by means of genetic engineering.
  • the transgene (or transgenes) may be DNA or RNA.
  • it is single-stranded DNA (ssDNA). or double-stranded DNA (dsDNA), such as genomic DNA or cDNA.
  • ssDNA single-stranded DNA
  • dsDNA double-stranded DNA
  • the transgene to be transported by the recombinant viral vector of the present invention is a human gene.
  • Suitable transgenes are, for example, therapeutic genes intended to replace a dysfunctional gene in the patient. It may also be a gene that is not or only insufficiently expressed in the corresponding target tissue.
  • the transgene expressed by the viral vector of the invention is a gene encoding a nitric oxide synthase (NOS) or the bone morphogenic protein receptor 2 (BMPR2).
  • NOS can be an endothelial NOS (eNOS) or an inducible NOS (iNOS).
  • eNOS endothelial NOS
  • iNOS inducible NOS
  • the genes encoding eNOS and iNOS can be used in the treatment of pulmonary dysfunction or lung disease, particularly pulmonary or pulmonary arterial hypertension, in a subject.
  • the transgene encodes a radioprotective protein, such as a radioprotective enzyme.
  • a radioprotective protein such as a radioprotective enzyme.
  • the lung is a therapeutically particularly relevant place of tumor growth but at the same time a particularly radiation-sensitive organ, which is why primary tumors often only limited and diffuse tumor growth there can not be treated radiotherapeutically.
  • the lung-specific vectors of the present invention the healthy tissue surrounding the malignant tissue can be protected by targeted expression of radioprotective proteins.
  • the transgene that is introduced into healthy lung tissue is a manganese superoxide dismutase (MnSOD) that catalyzes the conversion of superoxide anions, one of the key factors of radiation-induced toxicity, to hydrogen peroxide.
  • MnSOD manganese superoxide dismutase
  • Another embodiment proposed here is the kinase domain of the Ataxia telangiectasia mutant (ATM) gene, which contributes to the repair of radiation-induced DNA damage.
  • both genes are introduced into the patient to be treated by means of the vectors described herein.
  • the transgene encodes human alpha-1-antitrypsin.
  • the lack of sufficient amounts of alpha-1-antitrypsin is the cause of Laurell-Eriksson syndrome, a hereditary substance disorder that can lead to emphysema or cirrhosis of the liver.
  • Alpha-1-antitrypsin is required for the regulation of the activity of proteases in serum. The lack of this inhibitor leads to an increased proteolysis in the serum and thereby to the mentioned, serious sequelae.
  • the viral vectors of the present invention are particularly suitable for use in a method for the therapeutic treatment of diseases of the lung.
  • Diseases of the lung according to the invention include in particular all types of vascular diseases of the lung, such as pulmonary hypertension, but also lung tumors, alpha-1-antitrypsin deficiency (A1AD), and others.
  • lung tumors suitable for treatment with the vectors of the invention include small cell lung carcinoma (SCLC), squamous cell carcinoma Adenocarcinoma and large cell lung cancer.
  • the viral vectors of the present invention are used for the therapeutic treatment of pulmonary or pulmonary arterial hypertension.
  • the transgene encodes an antitumor agent, e.g. a tumor suppressor protein, or an immunomodulator, e.g. a cytokine (e.g., Interleukin 1 to 4, gamma interferon, p53) that is to be selectively transported to the patient's lung tissue.
  • an antitumor agent e.g. a tumor suppressor protein
  • an immunomodulator e.g. a cytokine (e.g., Interleukin 1 to 4, gamma interferon, p53) that is to be selectively transported to the patient's lung tissue.
  • cytokine e.g., Interleukin 1 to 4, gamma interferon, p53
  • the vectors may also be used to deliver antisense RNA, ribozymes, or the like into the endothelial tissue of the lung.
  • the vectors according to the invention may also comprise transgenes which code for secretory proteins which are to enter the bloodstream systemically. Such secretory proteins can be efficiently secreted into the bloodstream through the lung capillary bed, which is part of the cardiovascular system.
  • the term "subject" refers to any human or animal organism that can be infected by AAV vectors.
  • the subject to be treated is a mammal, e.g. around a human, a primate, a mouse or a rat.
  • the subject to be treated is a human.
  • the vector After transfection into the subject, the vector provides for site-specific expression of the transgene in the cells of the lung endothelium.
  • the transgene may be present in the viral vector in the form of an expression cassette which, in addition to the sequence of the transgene to be expressed, comprises further elements required for expression, such as a suitable promoter which controls the expression of the transgene after infection of the corresponding cells.
  • suitable promoters include, in addition to the AAV promoters, eg the cytomegalovirus (CMV) promoter, the chimeric cken-beta-actin / cytomegalovirus hybrid promoter (CAG), an endothelial cell-specific promoter, such as the VE-catherin promoter, as well as steroid promoters and metallothionein promoters.
  • the transgene according to the invention comprises a lung endothelium-specific promoter which is connected in functional connection with the transgene to be expressed.
  • a lung endothelium-specific promoter is a promoter whose activity in pulmonary endothelial cells is at least 2-fold, 5-fold, 10-fold, 20-fold, 50-fold, or 100-fold higher than in a cell that does not Lung endothelial cell is.
  • this promoter is a human promoter.
  • the expression cassette may also contain an enhancer element to increase the expression level of the exogenous protein to be expressed.
  • the expression cassette may comprise polyadenylation sequences such as the SV40 polyadenylation sequences or the bovine growth hormone polyadenylation sequences.
  • the viral vectors of the invention may comprise, preferably as part of one of their capsid proteins, the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: 5.
  • variants of the amino acid sequence of SEQ ID NO: 2 may be used, which differ from the amino acid sequence of SEQ ID NO: 2 by modification of at least one of the two N-terminal amino acid.
  • the modification may be an exchange, deletion or insertion of amino acids as long as the variant retains the ability to mediate, as part of the capsid, the specific binding of the vector to receptor structures of endothelial cells of the lung.
  • the invention thus also extends to variants of the sequence of SEQ ID NO: 2 in which one of the two N-terminal amino acids of SEQ ID NO: 2 has been altered.
  • variants which are included in the scope of the invention, therefore have one Sequence identity of more than 85% to the amino acid sequence shown in SEQ ID NO: 2, when the sequences are compared with the programs GAP or BESTFIT.
  • GAP or BESTFIT programs for determining amino acid sequence identity are well known in the art.
  • the variant of the sequence of SEQ ID NO: 2 may be based on substitution of one or both N-terminal amino acids, i. one or both N-terminal amino acids can be exchanged for another amino acid.
  • the substitution by which the variants differ from the amino acid sequence shown in SEQ ID NO: 2 is a conservative substitution, i. a substitution of an amino acid by an amino acid of similar polarity, which confers similar functional properties to the peptide.
  • the exchanged amino acid is from the same group of amino acids as the replacing amino acids.
  • one hydrophobic moiety may be replaced by another hydrophobic moiety or one polar moiety may be replaced by another polar moiety.
  • Non-polar amino acids such as e.g. Glycine, valine, alanine, isoleucine, leucine, methionine, proline, phenylalanine, and tryptophan.
  • uncharged polar amino acids include serine, threonine, glutamine, asparagine, tyrosine, and cysteine.
  • charged polar (acidic) amino acids include histidine, arginine and lysine.
  • charged polar (basic) amino acids include aspartic acid and glutamic acid.
  • variants of the amino acid sequence shown in SEQ ID NO: 2 those amino acid sequences in which an amino acid in the region of the two N-terminal amino acids of SEQ ID NO: 2 has been inserted are also valid. Such insertions may, in principle, occur as long as the resulting variant retains its ability to bind specifically to endothelial cells of the lung. Furthermore, in the present case, such proteins also apply as variants of the amino acid sequence shown in SEQ ID NO: 2, in which one of the two N-terminal amino acids of SEQ ID NO: 2 is missing. The prerequisite is again that the corresponding deleted variant binds specifically to endothelial cells of the lung.
  • lung endothelium-specific variants of the amino acid sequence shown in SEQ ID NO: 2 that are structurally modified at one or both N-terminal amino acids, such as by introducing a modified amino acid.
  • these modified amino acids can be amino acids which have been modified by biotinylation, phosphorylation, glycosylation, acetylation, branching and / or cyclization.
  • Viral vectors whose capsid comprise one of the peptide sequences according to the invention or a variant thereof as defined above bind specifically to endothelial cells of the lung.
  • "specific" binding of the vectors of the invention means that after systemic administration the vectors accumulate predominantly on or in the endothelial cells of the lung. This means that more than 50% of the originally administered vector genomes accumulate in the endothelial cells or in the region of the endothelial cells of the lung, while less than 50% accumulate in or in the region of other cells or tissues (such as in the spleen or the spleen) Empty).
  • more than 60%, 70%, 80%, 90%, 95%, or even more than 99% of the originally administered vector genome accumulate in or around endothelial cells of the lung.
  • a specific binding of the vectors can also be determined via the expression of the transgene.
  • more than 50% of the total expression of the transgene is in or around endothelial cells of the lung, while less than 50% of the expression is in or in the region of other tissues can be observed.
  • more than 60%, 70%, 80%, 90%, 95%, or even more than 99% of the total measured expression of the transgene occurs in or in the region of the endothelial cells of the lung.
  • vectors whose capsids contain variants of the amino acid sequence shown in SEQ ID NO: 2 have at least about 50% of the binding activity of a corresponding viral vector whose capsid has the amino acid sequence shown in SEQ ID NO: 2. Even more preferred is that the variants have about 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% of the binding activity of a corresponding viral vector whose capsid is as described in SEQ ID NO: 2 has shown amino acid sequence.
  • the binding activity of the vectors can be measured by in vitro assays, as described in the present examples.
  • the binding activity of the vectors according to the invention is preferably at least 2-fold, 5-fold, 10-fold, 20-fold, 50-fold, 75-fold for endothelial cells of the lung , 100x, 150x, 200x, 250x, 500x, 600x, 700x, 800x, 900x, 1000x, 2000x, 5000x, or 10,000-fold higher than the binding activity for a control cell other than a pulmonary endothelial cell, eg a spleen or liver cell).
  • the invention also relates to a cell comprising a peptide, polypeptide or protein according to the invention, a coding for it Nucleic acid, a plasmid comprising such a nucleic acid, or containing a recombinant AAV vector as described above. It is preferably a human cell or cell line.
  • a cell has been e.g. obtained by a Biop- sieclar from a human subject and then transfected with the viral vector in an ex vivo method.
  • the cell may then be reimplanted or otherwise re-injected into the subject, e.g. by transplantation or infusion.
  • the likelihood of rejection of transplanted cells is less if the subject from whom the cell was derived is genetically similar to the subject to whom the cell is administered.
  • the subject to whom the transfected cells are delivered is the same subject from which the cells were previously obtained.
  • the cell is preferably a human lung cell, especially a human lung endothelial cell.
  • the cell to be transfected may also contain a stem cell, e.g. an adult human stem cell.
  • the cells to be transfected are autologous cells which have been treated with the viral vector according to the invention, e.g. the described recombinant AAV2 vector, was transfected ex vivo.
  • the cells are preferably used in a method of treating pulmonary dysfunction or lung disease in a subject.
  • the invention relates to a method for producing an AAV vector using a plasmid encoding a capsid protein having the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2 or a variant thereof includes.
  • the vector may also comprise the amino acid sequence of SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: 5.
  • the basic method of producing recombinant AAV vectors which are one to be expressed Transgene is well described in the art [28].
  • HEK 293-T cells are transfected with three plasmids.
  • a first plasmid contains the cap and rep regions of the AAV genome, but lacks the naturally occurring inverted repeats (ITRs).
  • the cap region of this plasmid contains a gene which codes for at least one modified capsid protein, ie a gene which comprises the peptide sequence according to the invention.
  • a second plasmid comprises a transgene expression cassette flanked by the corresponding ITRs representing the packaging signal. The expression cassette is therefore packaged in the course of assembly of the virus particles in the capsid.
  • the third plasmid is an adenoviral helper plasmid encoding the helper proteins E1A, ElB, E2A, E4-orf6, VA required for AAV replication in the HEK 293 T cells.
  • the vectors of the invention may be purified, for example, by gel filtration techniques, e.g. using a Sepharose matrix, desalted and purified by subsequent filtration. Other purification procedures may further comprise cesium chloride or iodixanol gradient ultracentrifugation. Purification reduces potentially deleterious affects in the subject to which the adeno-associated viral vectors are administered.
  • the administered virus is essentially free of wild-type and replication-competent virus. The purity of the virus can be checked by suitable methods, such as PCR amplification.
  • the invention provides in a further aspect a pharmaceutical composition
  • a pharmaceutical composition comprising a viral vector of the present invention, in particular an AAV vector.
  • the viral vector is doing in a therapeutic effective amount administered to the patient, ie, in an amount sufficient to substantially enhance at least one symptom of the pulmonary dysfunction or lung disease being treated, or to inhibit the progression of the disease.
  • Symptoms that are regularly associated with lung disease include cough, fever, chest pain, hoarseness, and difficulty breathing.
  • a therapeutically effective amount of the vector of the invention causes a positive change in one of said symptoms, ie, a change that approximates the phenotype of the subject concerned to the phenotype of a healthy subject who is not suffering from a lung disease.
  • administration of the viral vector is in an amount that results in complete or substantially complete cure of pulmonary impairment or lung disease.
  • the pharmaceutical composition will accordingly contain a therapeutically effective dose of the vector according to the invention.
  • a therapeutically effective dose will usually not be toxic to the subject undergoing the treatment.
  • the exact amount of viral vector that must be administered to achieve a therapeutic effect depends on several parameters. Factors relevant to the amount of viral vector to be administered include, for example, the mode of administration of the viral vector, the type and severity of the lung disease, the history of the disease of the patient to be treated, and the age, weight, size and health of the patient to be treated. Furthermore, the expression level of the transgene needed to achieve a therapeutic effect, the immune response of the patient, as well as the stability of the gene product for the amount to be administered are also relevant. A therapeutically effective amount of the viral vector may be readily obtained by one skilled in the art Be determined based on the general knowledge and the present disclosure.
  • the viral vector is preferably administered in an amount corresponding to a virus dose in the range of 1.0 x 10 10 to 1.0 x 10 14 vg / kg (viral genomes per kg of body weight), with a range of 1.0 x 10 11 to 1.0 x 10 13 vg / kg is more preferable, and a range of 5.0 x 10 11 to 5.0 x 10 12 vg / kg is more preferable, and a range of 1.0 x 10 12 to 5 , 0x10 12 is even more preferred.
  • a virus dose of about 2.5 x 10 12 vg / kg is most preferred.
  • the amount of viral vector to be administered, eg, the AAV2 vector of the present invention can be adjusted depending on the level of expression of the one or more transgenes.
  • the viral vector of the present invention may be formulated for various modes of administration, for example for oral administration as a capsule, liquid or the like.
  • the viral vector is administered parenterally, preferably by intravenous injection or intravenous infusion.
  • administration may be by intravenous infusion, eg, within 60 minutes, within 30 minutes, or within 15 minutes.
  • the viral vector is locally administered by injection during surgery on the lung.
  • Compositions suitable for administration by injection and / or infusion typically include solutions and dispersions as well as powders from which appropriate solutions and dispersions can be made. Such compositions will contain the viral vector and at least one suitable pharmaceutically acceptable carrier.
  • Suitable pharmaceutically acceptable carriers for intravenous administration include bacteriostatic water, Ringer's solution, physiological saline, phosphate buffered saline (PBS) and Cremophor EL TM.
  • Sterile cogeneration Compositions for injection and / or infusion can be prepared by introducing the viral vector in the required amount in a suitable carrier and then filter sterilizing it by means of a filter.
  • Compositions for administration by injection or infusion should remain stable for a prolonged period after their preparation under storage conditions.
  • the compositions may contain a preservative for this purpose. Suitable preservatives include chlorobutanol, phenol, ascorbic acid and thiomersal.
  • the preparation of corresponding administration forms and suitable auxiliaries are described, for example, in “Remington: The Science and Practice of Pharmacy", Lippincott Williams &Wilkins; 21st edition (2005).
  • the invention relates to a method for the therapeutic treatment of pulmonary disorder or lung disease, comprising administering to a subject a viral vector of the invention, preferably an AAV vector as described above.
  • the vector comprises a capsid which comprises at least one capsid protein which contains the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2 or a variant of SEQ ID NO: 2 described above.
  • the vector may also comprise the amino acid sequence of SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: 5.
  • the viral vector further comprises a transgene, eg, a therapeutic gene useful for the treatment of pulmonary dysfunction or lung disease.
  • the vector After administration to the subject to be treated, preferably by systemic administration such as intravenous injection or infusion, the vector provides for the specific expression of the gene in the endothelial cells of the lung.
  • FIG. 1 shows the in vivo selection method of the AAV peptide library used in the context of the invention.
  • FIG. 2 shows the sequences of the lung-specific peptides identified by means of the selection method. After the fourth round of selection, a total of four different sequences could be identified.
  • Figure 3 shows the measurement of the expression of luciferase 14 days after systemic administration of recombinant AAV vectors in mouse organ lysates.
  • A AAV2 wild-type vector (upper panel) and the insertion control AAV2-CVGSPCG (middle panel) induce predominantly cardiac expression.
  • AAV2-ESGHYGF (lower panel) induces strong and lung-specific expression of luciferase.
  • B Comparison of the expression levels of the vectors AAV2-wild type, AAV2-CVGSPCG and AAV2-ESGHYGF in heart (upper panel), liver (middle panel) and lung (lower panel).
  • FIG. 5 shows the distribution of recombinant AAV vectors after systemic administration of 5 ⁇ 10 10 gp / mouse by means of quantitative real-time PCR.
  • A Distribution of AAV2-ESGHYGF 4 hours after vector administration in seven different organs.
  • B Distribution of genomes by the AAV2 wild-type (upper panel), the control vector AAV2-CVGSPCG (middle panel) and AAV2-ESGHYGF (lower panel). Control vector and wild type accumulate in the reticulo-endothelial system of the liver and spleen. AAV2-ESGHYGF accumulates exclusively in the lungs.
  • a random display peptide library was prepared and selected over four rounds.
  • a random X 7 -AAV peptide library with a theoretical diversity of 1 ⁇ 10 8 individual clones was prepared using a two-step protocol as described previously [26-27].
  • a degenerate oligonucleotide encoding seven randomly located amino acids at nucleotide position 3967 in the AAV genome, corresponding to amino acid position R588 in VP1 was prepared.
  • the oligonucleotide had the sequence: 5'-CAGTCGGCCAGAGAGGC (NNK) 7 GCCCAGGCGGCTGACGAG-3 '(SEQ ID NO: 11).
  • the second strand was isolated using a sequenase (Amersham, Freiburg, Germany) and the primer of the sequence 5'-CTCGTCAGCCGCCTGG-3 '(SEQ ID NO: 12).
  • the double-stranded insert was cut with BglI, purified with the QIAquick Nucleotide Removal Kit (Qiagen, Hilden, Germany), and ligated into the Sfil-digested library plasmid pMT187-0-3 [26].
  • the diversity of the plasmid library was determined by the number of clones growing from a representative aliquot of transformed, electrocompetent DH5a bacteria on agar containing 150 mg / ml ampicillin.
  • Library plasmids were harvested and purified using Qiagen's Plasmid Preparation Kit.
  • the AAV library genomes were packaged into chimeric wild-type and library AAV capsids (AAV-TransferShuttle) by incubating 2x10 8 293 T cells in 10 cell culture dishes (15 cm) with the plasmid pVP3cm (containing the wild-type Cap gene modified codon usage without the terminal inverted repeats) [27], the library plasmid and the pXX6 helper plasmid [28] were transfected, the ratio between the plasmids being 1: 1: 2.
  • the resulting AAV library transfer shuttle was used to infect 2x10 8 293 T cells in cell culture dishes (15 cm) at an MOI of 0.5 replicative units per cell.
  • Cells were superinfected with Ad5 (provided by the Laboratoire des Therapie Genique, France) at an MOI of 5 plaque-forming units (pfu / cell).
  • Ad5 provided by the Laboratoire des Therapie Genique, France
  • the final AAV display library was harvested from the supernatants after 48 hours. The supernatants were concentrated using VivaSpin columns (Viva Science, Hannover, Germany) and purified by iodixanol density gradient ultracentrifugation as previously described [29] and by real-time PCR using the cap-specific primers
  • the random oligonucleotides contained in AAV particles of the library and enriched in the tissue of interest were prepared by nested PCR using primers 5'-ATGGCAAGCCACAAGGACGATG-3 '(SEQ ID NO: 15) and 5'-CGTGGAGTACTGTGTGATGAAG - 3 '(SEQ ID NO: 16) for the first PCR and the primers 5' - GGTTCTCATCTTGGGAAGCAAG - 3 '(SEQ ID NO: 17) and 5 1 -TGATGAGAATCTGTGGAGGAG - 3' (SEQ ID NO: 18) for the second PCR amplified.
  • the PCR amplified oligonucleotides were used to prepare secondary library for three more rounds of selection.
  • the secondary libraries were generated like the primary libraries (see above) but without the additional step of making transfer shuttles.
  • the secondary plasmid library was used to transfect 2x10 8 293 T cells into cell culture dishes (15 cm) at a ratio of 25 library plasmids per cell using the transfection agent Polyfect (Qiagen). After each round of selection, several clones were sequenced. The selection method used is shown in FIG.
  • the clones enriched in Example 1 were prepared as recombinant AAV vectors and analyzed for their transduction profile.
  • Recombinant AAV vectors were generated by triple transfection of HEK293T cells. The cells were grown at 37 ° C, 5% C0 2 in Dulbecco's modified Eagle medium (Invitrogen, Carlsbad, USA) supplemented with 1% penicillin / streptomycin and 10% fetal calf serum. Plasmid DNA was transfected with the transfection agent Polyfect (Qiagen, Hilden, Germany) into 293T cells. Four days after transfection, the cells were harvested, lysed and the vectors were purified by iodixanol density gradient ultracentrifugation as previously described [29].
  • was used as adenoviral helper plasmid [28], the luciferase gene pUF2-CMV-luc [27] or the GFP gene pTR-CMV-GFP [30], as well as a plasmid coding for the AAV capsid of interest coded used. Plasmids encoding the AAV capsid mutants previously selected from the AAV library and wild-type controls were modified pXX2-187 [31] and pXX2, respectively [28]. For alanine scanning, oligonucleotide inserts were also prepared which code for modified variants of the peptide ESGHGYF. The inserts were processed into library inserts as described (see above). For the quantification of the recombinant vectors, the genomic titers were determined by quantitative real-time PCR using the. CMV-specific primers 5'-GGCGGAGTTGTTACGACAT-3 '(SEQ ID NO: 19) and
  • the peptides were introduced into the capsid of a recombinant vector comprising a luciferase reporter gene. Mutant capsid vectors and control vectors were injected into mice.
  • Luciferase expression was analyzed using a Xenogen IVIS200 Imaging System (Caliper Lifescience, Hopkinton, USA) with the Living Image 4.0 software (Caliper) after intraperitoneal injection of 200 ⁇ l Luciferin substrate (150 mg / kg, Xenogen) per mouse , Representative in vivo bioluminescence maps of transgene expression were taken at different positions (ventral, dorsal, lateral) when the luminescence in relative light units (photons / sec / cm 2 ) reached the highest intensity. Subsequently, the animals were sacrificed, the organs of interest were rapidly removed, and maps of the expression of the transgene in individual organs were immediately taken.
  • the organs were then frozen in liquid nitrogen and stored at -80 ° C. Three-dimensional reconstructions of the in vivo luminescence images were obtained using the DLIT option of the Living Image 4.0 software and measuring the emitted light in five different wavelengths of 560-640 nm for three minutes each.
  • reporter lysis buffer RLB, Promega, Madison, USA.
  • the determination of the luciferase reporter gene activity was carried out in a luminometer (Mitras LB9 40, Berthold Technologies, Bad Wildbad, Germany) at 10-second intervals after addition of 100 ⁇ luciferase assay reagent (LAR, Promega ), between the Measurements each 2 seconds delay existed. The values were normalized with respect to the total protein level in each sample using the Roti Nanoquant Protein Assay (Roth, Düsseldorf, Germany).
  • a randomly selected control clone of the non-selected library resulted in poor gene expression that occurred predominantly in the heart and some abdominal sites but not in the lungs.
  • Wild-type AAV2 caused weak gene expression in the heart, liver and skeletal muscle, but not in the lung.
  • a three-dimensional reconstruction of the bioluminescence images confirmed the lung-specific expression.
  • the peptide ADGVMWL (SEQ ID NO: 3), which was also enriched during in vivo selection, also led to lung-specific expression of the transgene, but was weaker than the peptide ESGHGYF.
  • vectors carrying the lung-specific ESGHGYF capsid resulted in strong and specific gene expression in the lung (4, 10x10 5 RLU / mg protein, see Figure 3A, lower panel).
  • the lung-specific ESGHGYF vectors showed only an expression in the region of the background signal (about 1 ⁇ 10 3 RLU / mg protein) .
  • expression of the transgene in the lung was more than 200-fold higher than the expression mediated by wild-type AAV2 or by the CVGSPCG control vectors (see Figure 3B).
  • the lung-specific expression of the transgene mediated by the ESGHGYF vectors also remained organ-specific over a long period of time.
  • expression of the transgene was measured over a period of 164 days. The radiation emitted in the area of the lung was recorded quantitatively. Throughout the period, transgene expression was stable at a high level and restricted to the lung. The lowest expression in the lung was measured on day 7, a peak was reached on day 42 and the radiation decreased only slowly until the last measurement on day 164 ( Figure 4).
  • Example 4 Alanine scanning with the peptide ESGHGYF To study the importance of the individual amino acids in the peptide ESGH-GYF with respect to lung specificity, alanine scanning was performed.
  • the DNA was quantified using a spectrophotometer (Nanodrop ND-2000C, Peqlab). Analysis of the AAV vector DNA in the tissues was performed by quantitative real-time PCR using the CMV-specific primers described above, using 40 ng of template normalized with respect to total DNA. Results: The quantification of the vector genome by real-time PCR revealed a lung-specific homing of ESGHGYF. The amount of vector genome that could be detected in the lung (3.8x10 5 ⁇ 1, 9xl0 5 vg / 100ng total DNA) was about 6-100 fold higher than the amount of vector genome detected in another organ (Fig 5A).
  • the vector distribution of wild-type AAV2 was measured 14 days after intravenous administration of 5 ⁇ 10 gp / mouse, ie at the time at which the expression of the transgene was determined (see above).
  • the genomes provided by wild-type AAV2 vectors could be obtained mainly from the liver and spleen, and the genomes of vectors containing the control peptide were also obtained mainly from the spleen.
  • the amount of vector genomes detected in the spleen was relatively equal for all capsid variants tested (4x10 3 vp / 100 ng total DNA), suggesting a nonspecific uptake mechanism for the particles in the reticulo-endothelial System that is independent of the delivery and expression of the transgene.
  • the distribution data of genomes provided by vectors having the lung-specific peptide ESGHGYF closely resemble the expression data of the transgene, whereby a highly specific accumulation in the lung can be observed.
  • the amount of lung-detected vectors that displayed the peptide ESGHGYF was about 250-fold higher than in other organs and up to 500-fold higher than in lungs injected with a wild-type vector or a control capsid vector (Fig. 5B).
  • the same distribution levels between the organs were detected 28 days after vector administration.
  • the direct comparison of the quantities of detected genomes between the three vector capsid variants is shown in Figure 5C for the three tissues in which relevant amounts of vector DNA are detected. could be.
  • An immunohistochemistry was performed to control, at 14 days after intravenous administration of the rAAV-GFP vector comprising the peptide ESGHGYF or the wild-type AAV capsid, the expression of the transgene at the cellular level in the lung and in a control Visualize organ.
  • the lungs of the animals were fixed ex situ with 4% (w / v) paraformaldehyde via the trachea under hydrostatic pressure of a 20 cm water column for 20 minutes followed by 24 hours immersion in the same fixative.
  • the lung tissues were embedded in paraffin. Sections of a thickness of 2 ⁇ were removed from wax, rehydrated and used for immunohistochemistry.
  • Immunohistochemistry was performed with polyclonal antibodies against GFP (A-11122, Invitrogen) or CD31 (AB28364, Abcam, Cambridge, USA). The activity of endogenous peroxidase was inactivated with 1% H2O2 in methanol for 30 minutes. Before staining with CD31, the sections were heated in citrate buffer (pH 6.0) at 100 ° C for 20 minutes. After washing in PBS, the sections were incubated for 30 minutes with PBS, 10% goat serum (Vector Lab, Burlingame, USA) and 2% milk powder (Roth). Primary antibodies were allowed to bind for 1 hour at 37 ° C.
  • mice injected with rAAV-ESGHGYF were incubated for 30 minutes with a secondary, biotinylated goat anti-rabbit antibody (Vector Lab). Bound antibodies were visualized using the VECTASTAIN Elite ABC Kit (Vector Lab) and 3,3'-diaminobenzidine (DAB, Sigma-Aldrich, St. Louis, USA). Selected sections were counterstained with Hemalum. Results: In lungs of mice injected with rAAV-ESGHGYF, microscopic examination revealed intense staining of the endothelial cells throughout the pulmonary microvasculature and to a slightly lesser extent in the large pulmonary vessels (data not shown). In contrast, pulmonary tissue from mice injected with wildtype AAV2 vector did not stain.
  • the liver was analyzed as a control organ (a tissue known to frequently show high expression of a transgene following injection of wild-type AAV2 vector.). patocytes were observed after administration of wild-type RAAV2 vector but no staining after administration of the rAAV2-ESGHGYF vector The endothelial lineage of the transduced pulmonary cells was confirmed by CD31 staining, with the pattern obtained by GFP staining in serial sections of the lung of mice injected with rAAV2-ESGHGYF (data not shown).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Virology (AREA)
  • Medicinal Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Epidemiology (AREA)
  • Plant Pathology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Cardiology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Pulmonology (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
PCT/EP2014/066892 2013-08-09 2014-08-06 Neue peptide mit spezifität für die lunge Ceased WO2015018860A1 (de)

Priority Applications (6)

Application Number Priority Date Filing Date Title
US14/911,197 US10688151B2 (en) 2013-08-09 2014-08-06 Peptides having specificity for the lungs
EP19153543.4A EP3536794A3 (de) 2013-08-09 2014-08-06 Peptide mit spezifität für die lunge
EP14753039.8A EP3030664A1 (de) 2013-08-09 2014-08-06 Neue peptide mit spezifität für die lunge
JP2016532677A JP6560212B2 (ja) 2013-08-09 2014-08-06 肺に対する特異性を有する新たなペプチド
US16/907,562 US20210187062A1 (en) 2013-08-09 2020-06-22 Peptides having specificity for the lungs
US18/162,833 US20230181683A1 (en) 2013-08-09 2023-02-01 Peptides having specificity for the lungs

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DEDE102013215817.3 2013-08-09
DE102013215817.3A DE102013215817A1 (de) 2013-08-09 2013-08-09 Neue peptide mit spezifität für die lunge

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US14/911,197 A-371-Of-International US10688151B2 (en) 2013-08-09 2014-08-06 Peptides having specificity for the lungs
US16/907,562 Division US20210187062A1 (en) 2013-08-09 2020-06-22 Peptides having specificity for the lungs

Publications (1)

Publication Number Publication Date
WO2015018860A1 true WO2015018860A1 (de) 2015-02-12

Family

ID=51383708

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2014/066892 Ceased WO2015018860A1 (de) 2013-08-09 2014-08-06 Neue peptide mit spezifität für die lunge

Country Status (5)

Country Link
US (3) US10688151B2 (https=)
EP (2) EP3536794A3 (https=)
JP (2) JP6560212B2 (https=)
DE (1) DE102013215817A1 (https=)
WO (1) WO2015018860A1 (https=)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018035451A1 (en) 2016-08-19 2018-02-22 Calimmune, Inc. Methods and compositions for treating conditions using recombinant self-complementary adeno-associated virus
WO2020221911A1 (en) 2019-05-02 2020-11-05 Boehringer Ingelheim International Gmbh Viral vectors and nucleic acids for use in the treatment of pf-ild and ipf
WO2021233849A1 (en) 2020-05-17 2021-11-25 Boehringer Ingelheim International Gmbh Viral vectors and nucleic acids for regulated gene therapy
WO2022096612A2 (en) 2020-11-04 2022-05-12 Boehringer Ingelheim International Gmbh Viral vectors and nucleic acids for use in the treatment of ild, pf-ild and ipf
WO2022096563A1 (en) 2020-11-04 2022-05-12 Boehringer Ingelheim International Gmbh Viral vectors and nucleic acids for use in the treatment of ild, pf-ild and ipf
WO2022136655A1 (en) 2020-12-23 2022-06-30 Boehringer Ingelheim International Gmbh Viral capsid proteins with specificity to heart tissue cells
US11958886B2 (en) 2016-12-07 2024-04-16 University Of Florida Research Foundation, Incorporated IL-1RA cDNAs
US11981914B2 (en) 2019-03-21 2024-05-14 Ginkgo Bioworks, Inc. Recombinant adeno-associated virus vectors

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004083441A2 (en) * 2003-03-19 2004-09-30 Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts Random peptide library displayed on aav vectors

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7427396B2 (en) * 2004-06-03 2008-09-23 Genzyme Corporation AAV vectors for gene delivery to the lung
EP2425000B1 (en) 2009-04-30 2019-02-20 The Trustees Of The University Of Pennsylvania Compositions for targeting conducting airway cells comprising adeno-associated virus constructs
DE102014207498A1 (de) 2014-04-17 2015-10-22 Universitätsklinikum Hamburg-Eppendorf Viraler Vektor für den zielgerichteten Gentransfer in Gehirn und Rückenmark

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004083441A2 (en) * 2003-03-19 2004-09-30 Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts Random peptide library displayed on aav vectors

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE UniProt [online] 13 September 2005 (2005-09-13), "RecName: Full=Sugar fermentation stimulation protein homolog;", XP002731555, retrieved from EBI accession no. UNIPROT:Q47W67 Database accession no. Q47W67 *
STEFAN MICHELFELDER ET AL: "Peptide Ligands Incorporated into the Threefold Spike Capsid Domain to Re-Direct Gene Transduction of AAV8 and AAV9 In Vivo", PLOS ONE, vol. 6, no. 8, 5 August 2011 (2011-08-05), pages e23101, XP055147101, DOI: 10.1371/journal.pone.0023101 *
STEFAN MICHELFELDER ET AL: "Successful Expansion but Not Complete Restriction of Tropism of Adeno-Associated Virus by In Vivo Biopanning of Random Virus Display Peptide Libraries", PLOS ONE, vol. 4, no. 4, 9 April 2009 (2009-04-09), pages e5122, XP055147203, DOI: 10.1371/journal.pone.0005122 *
Y YING ET AL: "Heart-targeted adeno-associated viral vectors selected by in vivo biopanning of a random viral display peptide library", GENE THERAPY, vol. 17, no. 8, 15 April 2010 (2010-04-15), pages 980 - 990, XP055147105, ISSN: 0969-7128, DOI: 10.1038/gt.2010.44 *

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018035451A1 (en) 2016-08-19 2018-02-22 Calimmune, Inc. Methods and compositions for treating conditions using recombinant self-complementary adeno-associated virus
US11207382B2 (en) 2016-08-19 2021-12-28 University Of Florida Research Foundation, Incorporated Compositions for treating conditions using recombinant self-complementary adeno-associated virus
US11958886B2 (en) 2016-12-07 2024-04-16 University Of Florida Research Foundation, Incorporated IL-1RA cDNAs
US11981914B2 (en) 2019-03-21 2024-05-14 Ginkgo Bioworks, Inc. Recombinant adeno-associated virus vectors
WO2020221911A1 (en) 2019-05-02 2020-11-05 Boehringer Ingelheim International Gmbh Viral vectors and nucleic acids for use in the treatment of pf-ild and ipf
WO2021233849A1 (en) 2020-05-17 2021-11-25 Boehringer Ingelheim International Gmbh Viral vectors and nucleic acids for regulated gene therapy
WO2022096612A2 (en) 2020-11-04 2022-05-12 Boehringer Ingelheim International Gmbh Viral vectors and nucleic acids for use in the treatment of ild, pf-ild and ipf
WO2022096092A1 (en) 2020-11-04 2022-05-12 Boehringer Ingelheim International Gmbh Viral vectors and nucleic acids for use in the treatment of ild, pf-ild and ipf
WO2022096563A1 (en) 2020-11-04 2022-05-12 Boehringer Ingelheim International Gmbh Viral vectors and nucleic acids for use in the treatment of ild, pf-ild and ipf
WO2022136655A1 (en) 2020-12-23 2022-06-30 Boehringer Ingelheim International Gmbh Viral capsid proteins with specificity to heart tissue cells

Also Published As

Publication number Publication date
EP3030664A1 (de) 2016-06-15
JP2019214579A (ja) 2019-12-19
US20230181683A1 (en) 2023-06-15
JP6560212B2 (ja) 2019-08-14
JP6768895B2 (ja) 2020-10-14
DE102013215817A1 (de) 2015-02-12
EP3536794A3 (de) 2019-11-20
JP2016527298A (ja) 2016-09-08
EP3536794A2 (de) 2019-09-11
US10688151B2 (en) 2020-06-23
US20160175389A1 (en) 2016-06-23
US20210187062A1 (en) 2021-06-24

Similar Documents

Publication Publication Date Title
EP3132043B1 (de) Viraler vektor für den zielgerichteten gentransfer in gehirn und rückenmark
WO2015018860A1 (de) Neue peptide mit spezifität für die lunge
JP2024020346A (ja) 筋疾患の治療のための改変aavカプシドポリペプチド
DE69735364T2 (de) Modulatoren für die regenerierung von gewebe
DE69535340T2 (de) Rekombinantes Adeno-assoziiertes Virus
DE60129229T2 (de) Adeno-assoziierte virus-vermittelte übertragung von angiogenesefaktoren
KR101835490B1 (ko) 신경변성 질환에 대한 유전자 요법
DE60037189T2 (de) Rekombinante, natrium-jodid symporter-kodierende adenoviren
KR20210158859A (ko) Ube3a 유전자 및 발현 카세트 및 이들의 용도
US20240325570A1 (en) Treating diseases and improving nucleic acid delivery
CN114516901B (zh) 一种神经系统高亲和性的aav载体及其应用
KR20240005950A (ko) 벡터 시스템
EP4516805A1 (en) Viral vector for fibroblast transfection
EP4705490A1 (en) Capsids and methods of targeting nuerons
HK40030612A (en) Viral vector for the targeted transfer of genes in the brain and spinal cord
HK40014345A (en) Peptides having specificity for the lungs
Nishiuchi Design of Tissue-specific Regulatory Cassettes for High-level rAAV-mediated Expression in Skeletal and Cardiac Muscle

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14753039

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2016532677

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 14911197

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: 2014753039

Country of ref document: EP