WO2015016768A1 - Gènes de casbène synthase de jatropha curcas - Google Patents

Gènes de casbène synthase de jatropha curcas Download PDF

Info

Publication number
WO2015016768A1
WO2015016768A1 PCT/SG2013/000315 SG2013000315W WO2015016768A1 WO 2015016768 A1 WO2015016768 A1 WO 2015016768A1 SG 2013000315 W SG2013000315 W SG 2013000315W WO 2015016768 A1 WO2015016768 A1 WO 2015016768A1
Authority
WO
WIPO (PCT)
Prior art keywords
plant
nucleic acid
protein
seq
jatropha
Prior art date
Application number
PCT/SG2013/000315
Other languages
English (en)
Inventor
Chunhong Li
Ailing NG
Yan Hong
Original Assignee
Temasek Life Sciences Laboratory Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Temasek Life Sciences Laboratory Limited filed Critical Temasek Life Sciences Laboratory Limited
Priority to PCT/SG2013/000315 priority Critical patent/WO2015016768A1/fr
Publication of WO2015016768A1 publication Critical patent/WO2015016768A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)

Definitions

  • the present invention relates to the field of plant molecular biology, more particularly Jatropha curcas casbene synthase genes whose encoded proteins are involved in phorbol ester biosynthesis.
  • the present invention also relates to methods of down regulating casbene synthase expression in Jatropha and other plants.
  • the present invention further relates to methods for decreasing the amount of phorbol esters in the seeds of Jatropha and other plants.
  • Jatropha curcas is a common hardy shrub found in many tropical and subtropical regions. Its oilseeds contain up to 40% (Ginwal et al., 2006) of oil that are suitable for converting into either biodiesel or biojet fuel. It belongs to the family Euphorbiaceae, which includes many economically importance species like cassava (Manihot esculenta), castor bean (Ricinus communis) and rubber tree (Hevea brasiliensis). Jatropha is gaining popularity as a biofuel feedstock plant due to its non-edible seed oil, drought tolerance and adaptability to almost any type of soil, including those in arid and marginal land that are not suitable for crops (Heller, 1996).
  • Jatropha oil It was projected that as much as 25.6 million tons of Jatropha oil could be produced yearly by 2015 (GEXSI, 2008).
  • the seed contains kernel and shell with an average ratio of 62.2:37.7.
  • the kernel has high crude protein (22-28%) and oil contents (54-58%) (Devappa et al., 2010).
  • Production of Jatropha oil can also produce large amount of seed cake.
  • the defatted Jatropha kernel meal (JKM) obtained after solvent extraction of kernels (free of shells) contains protein ranging from 57.3 to 63.8%, higher than those in commercial soybean meal (46.5%) (Makkar et al., 1998). If seed cake can be used for livestock feeding, commercial value of Jatropha plantation will be greatly increased and its commercial viability will be more attractive.
  • Curcins belong to the ribosome inactivating proteins (RJPs) group. It shows cell-free protein synthesis inhibition, but not under in vivo conditions. Also, it is heat labile and easily degraded in soil (Devappa et al., 2010).
  • PEs are tetracyclic tigliane diterpenoids that are present mostly in Jatropha seeds.
  • Six different PEs have been characterized from Jatropha (Haas et al., 2002; Devappa et al., 2010). PEs have been found to be widely distributed in the families of Euphorbiaceae and Thymelaeceae (Haas et al., 2002).
  • PEs are amphiphillic molecules present in both oil and seedcake (up to 8 mg g in oil and 3 mg g in defatted kernel meal) and are heat stable.
  • PEs are epidermal cell irritating and cancer promoting (NTH, 2007), Jatropha seed cake cannot be used directly as an animal feed without detoxification. Currently, they are often used as an organic fertilizer and an increase of Jatropha seed yield between 13 to 120% was reported after returning Jatropha seedcake to Jatropha plantation. Not only do PEs reduce commercial values of Jatropha seed meal, they also cause some safety and environment concerns. Ingestion or skin application of PEs results in a burning sensation and pain in the mouth and stomach, watery or bloody diarrhea. Eye exposure results in conjunctivitis (also called pink eye) (NJH, 2007). Human safety concerns are mosdy on accidental exposure or occupational exposure of operators involved in seed harvest and seed/oil processing.
  • PEs are heat stable, there are also concerns on their possible ecotoxicity to other plants and animals when seed meals are used as fertilizers, or when seeds remain in soil for a prolonged period of time, with possible PEs leaching into soil and being carried to water bodies (Devappa et al., 2010).
  • Casbene a diterpenoid compound with a single ring structure and 20 carbons, has been speculated as a possible precursor to PE biosynthesis in Euphorbiaceae. It is synthesized from geranyl geranyl diphosphate (GGPP) by the enzymatic activity of a casbene synthase. Casbene synthases have been isolated from a number of plant species of the Euphorbiaceae family (Kirby et al., 2010). Theoretically, diterpene products found in Euphorbiaceae could be synthesized from casbene. However, their biosynthetic mechanism and direct functional evidence are lacking.
  • the present invention relates to the field of plant molecular biology, more particularly Jatropha curcas casbene synthase genes whose encoded proteins are involved in phorbol ester biosynthesis.
  • the present invention also relates to methods of down regulating casbene synthase expression in Jatropha and other plants.
  • the present invention further relates to methods for decreasing the amount of phorbol esters in the seeds of Jatropha and other plants.
  • the present invention provides an isolated nucleic acid encoding a Jatropha casbene synthase comprising the amino acid sequence set forth in SEQ ID NO:2.
  • the nucleic acid comprises the nucleotide sequence set forth in SEQ ID NO:l.
  • the nucleic acid comprises the nucleotide sequence set forth as nucleotides 73-1875 of SEQ ID NO:l.
  • the nucleic acid comprises the nucleotide sequence set forth as nucleotides 73-1878 of SEQ ID NO:l.
  • the nucleic acid further comprises a plant operable promoter operably linked to the nucleic acid.
  • the promoter is a seed specific promoter.
  • the seed specific promoter is a Jatropha seed specific promoter.
  • the present invention provides an isolated nucleic acid encoding a Jatropha casbene synthase comprising the amino acid sequence set forth in SEQ ID NO:4.
  • the nucleic acid comprises the nucleotide sequence set forth in SEQ H> NO:3.
  • the nucleic acid comprises the nucleotide sequence set forth as nucleotides 3-1265 of SEQ ID NO:3.
  • the nucleic acid comprises the nucleotide sequence set forth as nucleotides 3-1268 of SEQ JD NO:3.
  • the nucleic acid further comprises a plant operable promoter operably linked to the nucleic acid.
  • the promoter is a seed specific promoter.
  • the seed specific promoter is a Jatropha seed specific promoter.
  • the present invention provides a construct or vector comprising an isolated nucleic acid as described herein.
  • the construct or vector is an expression construct or vector.
  • the construct or vector further comprises a selectable marker.
  • the construct or vector comprises a Cre-lox recombination marker free system.
  • the present invention provides a transgenic plant comprising a nucleic acid, nucleic acid construct or vector described herein.
  • the transgenic plant a plant of the families of Euphorbiaceae and Thymelaeceae.
  • the plant is a Jatropha plant.
  • the plant is a Jatropha curcas plant.
  • the plant is a Croton tiglium plant.
  • the present invention provides for the down regulation of a Jatropha casbene synthase gene or a homolog thereof.
  • the down regulation of a Jatropha synthase gene or a homolog thereof involves using RNA interference (RNAi), including microRNA and hairpin RNA.
  • RNAi RNA interference
  • a nucleic acid construct is provided that comprises a nucleic acid that when expressed produces an RNAi molecule that suppresses or down regulates expression of the casbene synthase gene.
  • the RNAi molecule is an ihpRNA.
  • a nucleic acid construct is provided which down regulates the casbene synthase JcCASA163 gene or a homolog thereof.
  • a nucleic acid construct which down regulates the casbene synthase JcCASD168 gene or a homolog thereof.
  • a nucleic acid construct is provided which down regulates both the casbene synthase JcCASA163 gene or a homolog thereof and the casbene synthase JcCASD168 gene or a homolog thereof.
  • the nucleic acid construct further comprises a plant operable promoter operably linked to the nucleic acid.
  • the promoter is a seed specific promoter.
  • the seed specific promoter is a Jatropha seed promoter.
  • the present invention also provides a vector comprising an isolated nucleic acid or a nucleic acid construct as described herein.
  • the vector is an expression vector.
  • the vector further comprises a selectable marker.
  • the vector comprises a Cre-lox recombination marker free system.
  • the present invention further provides a transgenic or infected plant comprising a nucleic acid or vector described herein.
  • the transgenic or infected plant is a plant of the families of Euphorbiaceae and Thymelaeceae.
  • the plant is a Jatropha plant.
  • the plant is a Jatropha curcas plant.
  • the plant is a Croton tiglium plant
  • the present invention provides methods of decreasing the amount of phorbol esters in plant seeds.
  • the plant seeds are seeds of a plant of the families of Euphorbiaceae and Thymelaeceae.
  • the plant seeds are Jatropha seeds.
  • the plant seeds are Jatropha curcas seeds.
  • the plant seeds are Croton tiglium seeds.
  • a method involves modulating the level of activity of one or more enzymes involved in a phorbol ester biosynthesis in the host plant cell or plant.
  • the enzyme is a casbene synthase.
  • the enzymes are two casbene synthases.
  • the casbene synthase is JcCASA163 or a homolog thereof. In another embodiment, the casbene synthase is JcCASD168 or a homolog thereof. In a further embodiment, the casbene synthases are JcCASA163 or a homolog thereof and JcCASD168 or a homolog thereof. In another embodiment, the casbene synthase is a casbene synthase of a plant of the families of Euphorbiaceae and Thymelaeceae.
  • the level of activity can be reduced by reducing expression of the enzyme. In one embodiment, the modulation of the level of activity of an enzyme is a reduction in the activity of the enzyme. The level of activity of an enzyme can be reduced by using RNAi techniques described herein in which the enzyme is the target for the RNAi. BRIEF DESCRIPTION OF THE FIGURES
  • Figure 1 shows the nucleotide sequence of JcCASA163 cDNA (SEQ ID NO:l) and its encoded amino acid sequence (SEQ ID NO:2). Numbers of the nucleotide sequence are indicated on the left margin. Vertical lines in the sequence show the position of introns. The start (ATG) and the stop (TGA) codon are shadowed. The arrow indicates the putative cleavage site of the chloroplast transit peptide between C52 and A53. The dashed boxes indicate highly aspartate-rich motifs.
  • FIG. 2 shows expression profiles of JcCASD168, JcCASA163 and LEA1 (late embryogenesis abundant 1) in different tissues and seed growth stage in reference to the house keeping gene GADPH.
  • 1 Young leave; 2: Inflorescence; 3: Inner skin; 4: seed 25 days post anthesis (DPA); 5: seed 35DPA; 6: seed 45DPA; 7: seed 52 DPA; 8: seed 62 DPA; 9: seed 80 DPA.
  • Figures 3A and 3B show GG-MS detection of in vitro diterpenoid product produced by recombinant JcCasA163.
  • JcCASA163 enzyme was expressed in E. coli, purified and incubated with GGPP. Products were collected by hexane extraction and analyzed by GC-MS.
  • Fig. 3A GC-MS trace using SIM mode of the hexane extracted product generated.
  • Fig. 3B Full scan mass spectra of casbene synthesized
  • Figures 4A and 4B show constructs for seed specific down regulation of JcCASA163 and JcCASD168 genes.
  • Fig. 4A proLEAl::dsR366, with a 570 bp fragment of JcCASA163 used as the trigger sequence.
  • Fig. 4B proLEAl ::dsSET12, with 306 bp from JcCASA163 and 290 bp from JcCASD168 fusion fragment used as the trigger sequence.
  • PLeal seed-specific Leal promoter; HPT, hygromycin resistance marker gene.
  • Figure 5 shows genomic Southern blot hybridization to check transgene copy number in TO plants. Genomic DNAs from TO transgenic plants were digested with restriction enzymes (1: HindHI; 2: EcoRI; 3: Xbal) before hybridization to isotope labelled hpt probe.
  • FIG. 6 shows reduction of PE content in Tl transgenic seeds.
  • Tl transgenic seeds from four transgenic lines were analyzed for their PE content.
  • CK seeds from a non-related transgenic line.
  • Figure 7 shows inhibition of transcription for the casbene synthase genes in Tl transgenic seeds. Transcript level of the two casbene synthase genes was evaluated in Tl transgenic seeds. CK, seeds from a non-related transgenic line. DETAILED DESCRIPTION OF THE INVENTION
  • the present invention relates to the field of plant molecular biology, more particularly Jatropha curcas casbene synthase genes whose encoded proteins are involved in phorbol ester biosynthesis.
  • the present invention also relates to methods of down regulating casbene synthase expression in Jatropha and other plants.
  • the present invention further relates to methods for decreasing the amount of phorbol esters in the seeds of Jatropha and other plants.
  • JcCASA163 and JcCASD168 Jatropha casbene synthase homologues with high degree of amino acid sequence similarity to casbene synthases in castor bean and other plants were isolated and characterized.
  • the encoded protein of JcCASA163 was firstly proven to be an active diterpene synthase that converts GGPP to macrocyclic compound casbene in vitro.
  • transgene mediated RNAi silencing platform was used to down regulate the casbene synthase genes in a seed specific manner by using a seed specific promoter. Seeds of transgenic plants were found with reduced transcript level of the targeted gene together with reduced PE levels.
  • allele refers to any of one or more alternative forms of a gene locus, all of which alleles relate to a trait or characteristic. In a diploid cell or organism, the two alleles of a given gene occupy corresponding loci on a pair of homologous chromosomes.
  • RNAi refers to a compound, which is capable of down-regulating or reducing the expression of a gene or the activity of the product of such gene to an extent sufficient to achieve a desired biological or physiological effect.
  • dsRNA or "RNAi molecule,” as used herein, refers to one or more of a dsRNA, siRNA, shRNA, ihpRNA, synthetic shRNA, miRNA.
  • downstream regulated refers to genes inhibited by the subject RNAi method, refers to a dirninishment in the level of expression of a gene(s) in the presence of one or more RNAi constructs) when compared to the level in the absence of such RNAi constructs).
  • the term “down regulated” is used herein to indicate that the target gene expression is lowered by 1-100%. For example, the expression may be reduced by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%.
  • expression refers to transcription of the gene and, as appropriate, translation of the resulting mRNA transcript to a protein.
  • expression of a protein coding sequence results from transcription and translation of the coding sequence.
  • gene refers to a nucleic acid sequence that encompasses a 5' promoter region associated with the expression of the gene product, any intron and exon regions and 3' or 5' untranslated regions associated with the expression of the gene product.
  • gene silencing refers to the suppression of gene expression, e.g., transgene, heterologous gene and/or endogenous gene expression. Gene silencing may be mediated through processes that affect transcription and/or through processes that affect post- transcriptional mechanisms. Gene silencing may be allele-specific wherein specific silencing of one allele of a gene occurs.
  • genetictype refers to the genetic constitution of a cell or organism.
  • heterologous or exogenous when used with reference to portions of a nucleic acid indicates that the nucleic acid comprises two or more subsequences that are not found in the same relationship to each other in nature.
  • the nucleic acid is typically recombinantly produced, having two or more sequences from unrelated genes arranged to make a new functional nucleic acid, e.g., a promoter from one source and a coding region from another source.
  • a heterologous or exogenous protein indicates that the protein comprises two or more subsequences that are not found in the same relationship to each other in nature (e.g., a fusion protein).
  • homolog refers to a gene related to a second gene by descent from a common ancestral DNA sequence.
  • the term, homolog may apply to the relationship between genes separated by the event of speciation (ortholog) or to the relationship between genes separated by the event of genetic duplication (paralog).
  • homolog is used generically to refer to all species.
  • inverted repeat refers to a nucleic acid sequence comprising a sense and an antisense element positioned so that they are able to form a double stranded RNA when the repeat is transcribed.
  • the inverted repeat may optionally include a linker or a heterologous sequence between the two elements of the repeat.
  • the elements of the inverted repeat have a length sufficient to form a double stranded RNA.
  • phenotype refers to the detectable characteristics of a cell or organism, which characteristics are the manifestation of gene expression.
  • nucleic acid and “nucleic acid molecule” are used interchangeably herein to refer to a polymer of nucleotides which may be a natural or synthetic linear and sequential array of nucleotides and/or nucleosides, including deoxyribonucleic acid, ribonucleic acid, and derivatives thereof. It includes chromosomal DNA, self-replicating plasmids, infectious polymers of DNA or RNA and DNA or RNA that performs a primarily structural role. Unless otherwise indicated, nucleic acids or polynucleotide are written left to right in 5' to 3' orientation, Nucleotides are referred to by their commonly accepted single-letter codes. Numeric ranges are inclusive of the numbers defining the range.
  • polypeptide polypeptide
  • peptide protein
  • amino acid polymers in which one or more amino acid residue is an artificial chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers.
  • Amino acids may be referred to by their commonly known three-letter or one-letter symbols. Amino acid sequences are written left to right in amino to carboxy orientation, respectively. Numeric ranges are inclusive of the numbers defining the range.
  • the term “reduced PE content” or “seeds having reduced PE content” refers to seeds of transgenic plants that have 1-100% reduction in PE content when compared to seeds of non-transgenic plants.
  • the amount of PE content may be reduced by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%.
  • the present invention provides an isolated nucleic acid encoding a Jatropha casbene synthase comprising the amino acid sequence set forth in SEQ ID NO:2.
  • the nucleic acid comprises the nucleotide sequence set forth in SEQ ID NO:l.
  • the nucleic acid comprises the nucleotide sequence set forth as nucleotides 73-1875 of SEQ ID NO:l.
  • the nucleic acid comprises the nucleotide sequence set forth as nucleotides 73-1878 of SEQ ID NO:l.
  • the nucleic acid further comprises a plant operable promoter operably linked to the nucleic acid.
  • the promoter is a seed specific promoter.
  • the seed specific promoter is a Jatropha seed specific promoter.
  • the present invention provides an isolated nucleic acid encoding a Jatropha casbene synthase comprising the amino acid sequence set forth in SEQ ID NO:4.
  • the nucleic acid comprises the nucleotide sequence set forth in SEQ ID NO:3.
  • the nucleic acid comprises the nucleotide sequence set forth as nucleotides 3-1265 of SEQ ID NO:3.
  • the nucleic acid comprises the nucleotide sequence set forth as nucleotides 3-1268 of SEQ JD NO:3.
  • the nucleic acid further comprises a plant operable promoter operably linked to the nucleic acid.
  • the promoter is a seed specific promoter.
  • the seed specific promoter is a Jatropha seed specific promoter.
  • the present invention provides a construct or vector comprising an isolated nucleic acid as described herein.
  • the construct or vector is an expression construct or vector.
  • the construct or vector further comprises a selectable marker.
  • the construct or vector comprises a Cre-lox recombination marker free system.
  • the present invention provides a transgenic plant comprising a nucleic acid, nucleic acid construct or vector described herein.
  • the transgenic plant a plant of the families of Euphorbiaceae and Thymelaeceae.
  • the plant is a Jatropha plant.
  • the plant is a Jatropha curcas plant.
  • the plant is a Croton tiglium plant.
  • the present invention provides for the down regulation of a Jatropha casbene synthase gene or a homolog thereof.
  • the down regulation of a Jatropha synthase gene or a homolog thereof involves using RNA interference (RNAi), including microRNA and hairpin RNA.
  • RNAi RNA interference
  • a nucleic acid construct is provided that comprises a nucleic acid that when expressed produces an RNAi molecule that suppresses or down regulates expression of the casbene synthase gene.
  • the RNAi molecule is an ihpRNA.
  • a nucleic acid construct is provided which down regulates the casbene synthase JcCASA163 gene or a homolog thereof.
  • a nucleic acid construct which down regulates the casbene synthase JcCASD168 gene or a homolog thereof.
  • a nucleic acid construct is provided which down regulates both the casbene synthase JcCASA163 gene or a homolog thereof and the casbene synthase JcCASD168 gene or a homolog thereof.
  • the nucleic acid construct further comprises a plant operable promoter operably linked to the nucleic acid.
  • the promoter is a seed specific promoter.
  • the seed specific promoter is a Jatropha seed promoter.
  • the present invention also provides a vector comprising an isolated nucleic acid or nucleic acid construct as described herein.
  • the vector is an expression vector.
  • the vector further comprises a selectable marker.
  • the vector comprises a Cre-lox recombination marker free system.
  • the present invention further provides a transgenic or infected plant comprising a nucleic acid, nucleic acid construct or vector described herein.
  • the transgenic or infected plant is a plant of the families of Euphorbiaceae and Thymelaeceae.
  • the plant is a Jatropha plant.
  • the plant is a Jatropha curcas plant.
  • the plant is a Croton tigli m plant.
  • the nucleic acid is selected to inhibit expression of the native gene or to silence the native gene within a plant's tissues to achieve a desired phenotype.
  • expression of the native gene is inhibited.
  • Such inhibition might be accomplished, for example, with transformation of a plant cell to comprise a promoter linked to an antisense nucleotide sequence, hairpin, RNA interfering molecule, double stranded RNA microRNA or other nucleic acid molecule, such that tissue-preferred expression of the molecule interferes with translation of the mRNA of the native DNA sequence or otherwise inhibits expression of the native DNA sequence in plant cells.
  • RNAi techniques or microRNA techniques see, e.g., U.S. Patent Nos.
  • RNAi molecules or microRNA molecules can be prepared by the skilled artisan using techniques well known in the art, including techniques for the selection and testing of RNAi molecules and microRNA molecules that are useful for down regulating a Jatropha casbene synthase gene or a casbene synthase gene of other plants. See, for example, Wesley et al. (2001), Mysara et al. (2011), Yan et al. (2012) and ww2.bioprerdsi.org. It has typically been found that dsRNA of 300-700 bp are particularly suited for inducing RNAi in plants.
  • hairpin RNAs containing an intron for example, a construct comprising an RNA encoding sequence in a sense direction operably linked to an intron operably linked to an RNA encoding sequence in an antisense direction or vice versa which is capable of forming an intron-hairpin RNA (ihpRNA), is suitable for inducing RNAi in plants.
  • ihpRNA intron-hairpin RNA
  • Any suitable ihpRNA or other dsRNA can be used to down regulate Jatropha casbene synthase genes as shown herein.
  • a nucleic acid construct can be prepared that includes a nucleic that is transcribed into an RNA that can anneal to itself, e.g., a double stranded RNA having a stem- loop structure.
  • one strand of the stem portion of a double stranded RNA comprises a sequence that is similar or identical to the sense coding sequence, or a fragment thereof, of a casbene synthase as described herein, and that is from about 10 nucleotides to about 2,500 nucleotides in length.
  • the length of the sequence that is similar or identical to the sense coding sequence can be from 10 nucleotides to 1000 nucleotides, from 15 nucleotides to 600 nucleotides, from 20 nucleotides to 500 nucleotides, or from 25 nucleotides to 100 nucleotides, or any length within the 10 nucleotides to 2,500 nucleotides.
  • the other strand of the stem portion of a double stranded RNA comprises a sequence that is similar or identical to the antisense strand, or a fragment thereof, of the coding sequence of the polypeptide of interest, and can have a length that is shorter, the same as, or longer than the corresponding length of the sense sequence.
  • one strand of the stem portion of a double stranded RNA comprises a sequence that is similar or identical to the 3' or 5' untranslated region, or a fragment thereof, of the mRNA encoding the casbene synthase
  • the other strand of the stem portion of the double stranded RNA comprises a sequence that is similar or identical to the sequence that is complementary to the 3' or 5' untranslated region, respectively, or a fragment thereof, of the mRNA encoding the casbene synthase.
  • one strand of the stem portion of a double stranded RNA comprises a sequence that is similar or identical to the sequence of an intron or a fragment thereof in the pre-mRNA encoding the casbene synthase
  • the other strand of the stem portion comprises a sequence that is similar or identical to the sequence that is complementary to the sequence of the intron or fragment thereof in the pre-mRNA.
  • the loop portion of a double stranded RNA can be from 3 nucleotides to 5,000 nucleotides, e.g., from 3 nucleotides to 2500 nucleotides, from 15 nucleotides to 1,000 nucleotides, from 20 nucleotides to 500 nucleotides, or from 25 nucleotides to 200 nucleotides, or any length within the 3 nucleotides to 5,000 nucleotides.
  • the loop portion of the RNA can include an intron or a fragment thereof.
  • a double stranded RNA can have zero, one, two, three, four, five, six, seven, eight, nine, tea or more stem-loop structures.
  • RNAi RNAi-derived RNAi
  • a variation of the target region is one in which the target region is shifted 5' of a disclosed or designed target region of a casbene synthase gene described herein or homolog thereof.
  • a variation of the target region is one in which the target region is shifted 3' of a disclosed or designed target region of a casbene synthase gene described herein or homolog thereof.
  • the variation of the target region is a variation in the target regions of two or more casbene synthase genes that are used to prepare an RNAi molecule.
  • the variation of a target region can be sequence variations for more effective down regulation of casbene synthase genes or homologs thereof.
  • Other constructs that can be prepared include those which use other plant operable introns.
  • the RNAi constructs targeting casbene synthase genes or homologs thereof can also be combined with RNAi constructs targeting other genes involved in downstream steps of phorbol ester biosynthesis.
  • the construct typically includes regulatory regions operatively linked to the 5' side of the nucleic acid described herein (such as a nucleic acid encoding a Jatropha synthase protein or a nucleic acid encoding an RNAi molecule to down regulate a Jatropha synthase gene) and/or to the 3' side of the nucleic acid.
  • a cassette containing all of these elements is also referred to herein as an expression cassette.
  • the expression cassettes may additionally contain 5' leader sequences in the expression cassette construct.
  • the regulatory regions i.e., promoters, transcriptional regulatory regions, and translational termination regions
  • the polynucleotide encoding a signal anchor may be native/analogous to the host cell or to each other.
  • the promoters and tissue-specific promoters are particularly useful for preparing constructs for the transformation of Jatropha.
  • the regulatory regions and/or the polynucleotide encoding a signal anchor may be heterologous to the host cell or to each other. See, U.S. Patent No. 7,205,453 and U.S. Patent Application Publication Nos. 2006/0218670, 200670248616 and 20090100536, and the references cited therein.
  • the expression cassettes may additionally contain 5' leader sequences in the expression cassette construct. Such leader sequences can act to enhance translation. Translation leaders are known in the art and include those described in International Publication No. WO 2008/094127 and the references cited therein.
  • a number of promoters can be used in the practice of the invention.
  • the promoters can be selected based on the desired outcome. That is, the nucleic acids can be combined with constitutive, tissue-preferred, or other promoters for expression in the host cell of interest.
  • constitutive promoters include, for example, the core promoter of the Rsyn7 (WO 99/48338 and U.S. Pat. No.
  • promoters include inducible promoters, particularly from a pathogen-inducible promoter.
  • Such promoters include those from pathogenesis-related proteins (PR proteins), which are induced following infection by a pathogen; e.g., PR proteins, SAR proteins, beta- 1,3- glucanase, chitinase, etc.
  • PR proteins pathogenesis-related proteins
  • Other promoters include those that are expressed locally at or near the site of pathogen infection.
  • the promoter may be a wound-inducible promoter.
  • chemical-regulated promoters can be used to modulate the expression of a gene in a plant through the application of an exogenous chemical regulator.
  • the promoter may be a chemical-inducible promoter, where application of the chemical induces gene expression, or a chemical-repressible promoter, where application of the chemical represses gene expression.
  • tissue-preferred promoters can be utilized to target enhanced expression of a polynucleotide of interest within a particular plant tissue. Each of these promoters are described in U.S. Pat. Nos. 6,506,962, 6,575,814, 6,972,349 and 7,301,069 and in U.S. Patent Application Publication Nos. 2007/0061917 and 2007/0143880. Any promoter that is active in the seed endosperm and/or kernel skin can be used. Such promoters include endogenous promoters and exogenous promoters.
  • Jatropha seed promoters are well known to the skilled artisan and include, but are not limited to the oleosin promoter (Popluechai et al., 2011), curcin 1 promoter (U.S. Patent Application Publication No. 20120073018), LEA1 promoter (Hundertmark and Hincha, 2008), beta-globulin (Sunilkumar et al., 2006) and modifying enzymes, such as P450, and the like.
  • Any other recourse seed specific promoter can be used, for example soybean 7S storage gene promoter (Qu et al., 2012), 2S storage protein promoter, cotton Gh-sp promoter (Song et al., 2000), cotton a-globulin B promoter (Sunilkumar et al., 2006), and the like.
  • the expression cassette may additionally comprise a selectable marker gene for the selection of transformed cells.
  • Selectable marker genes are utilized for the selection of transformed cells or tissues.
  • the plant selectable marker gene will encode antibiotic resistance, with suitable genes including at least one set of genes coding for resistance to the antibiotic spectinomycin, the streptomycin phosphotransferase (spt) gene coding for streptomycin resistance, the neomycin phosphotransferase (nptH) gene encoding kanamycin or geneticin resistance, the hygromycin phosphotransferase (hpt or aphiv) gene encoding resistance to hygromycin, acetolactate synthase (als) genes.
  • the plant selectable marker gene will encode herbicide resistance such as resistance to the sulfonylurea-type herbicides, glufosinate, glyphosate, ammonium, bromoxynil, imidazolinones, and 2,4- dichlorophenoxyacetate (2,4-D), including genes coding for resistance to herbicides which act to inhibit the action of glutamine synthase such as phosphinothricin or basta (e.g., the bar gene). See generally, International Publication No. WO 02/36782, U.S. Patent No. 7,205,453 and U.S. Patent Application Publication Nos.
  • the expression cassette may additionally comprise a Cre-lox recombination marker free system, such as described by Zuo et al. (2001). Such a system is useful for producing selection marker free transgenic plants, including transgenic Jatropha plants.
  • the various DNA fragments may be manipulated, so as to provide for the DNA sequences in the proper orientation and, as appropriate, in the proper reading frame.
  • adapters or linkers may be employed to join the DNA fragments or other manipulations may be involved to provide for convenient restriction sites, removal of superfluous DNA, removal of restriction sites, or the like.
  • in vitro mutagenesis, primer repair, restriction, annealing, resubstitutions, e.g. transitions and transversions may be involved.
  • plant cell is intended to encompass any cell derived from a plant including undifferentiated tissues such as callus and suspension cultures, as well as plant seeds, pollen or plant embryos.
  • Plant tissues suitable for transformation include leaf tissues, root tissues, meristems, protoplasts, hypocotyls, cotyledons, scutellum, shoot apex, root, immature embryo, pollen, and anther.
  • Transformation means the directed modification of the genome of a cell by the external application of recombinant DNA from another cell of different genotype, leading to its uptake and integration into the subject cell's genome. In this manner, genetically modified plants, plant cells, plant tissue, seed, and the like can be obtained.
  • DNA or nucleic acid constructs described herein can be used to transform any plant
  • the plant is a plant of the families of Euphorbiaceae and Thymelaeceae.
  • the plant is a Jatropha plant.
  • the plant is a Jatropha curcas plant
  • the plant is a Croton tiglium plant
  • the constructs may be introduced into the genome of the desired plant host by a variety of conventional techniques. Techniques for transforming a wide variety of higher plant species are well known and described in the technical and scientific literature. Transformation protocols may vary depending on the type of plant or plant cell, i.e., monocot or dicot, targeted for transformation, as is well known to the skilled artisan.
  • the DNA construct may be introduced directly into the genomic DNA of the plant cell using techniques such as electroporation and microinjection of plant cell protoplasts, or the DNA constructs can be introduced directly to plant tissue using ballistic methods, such as DNA particle bombardment.
  • the DNA constructs may be combined with suitable T-DNA flanking regions and introduced into a conventional Agrobacterium twnef ciens host vector.
  • the virulence functions of the Agrobacterium tumefaciens host will direct the insertion of the construct and adjacent marker into the plant cell DNA when the cell is infected by the bacteria.
  • any method, which provides for effective transformation/transfection may be employed. See, for example, U.S. Patent Nos.
  • Transformed plant cells which are derived by any of the above transformation techniques can be cultured to regenerate a whole plant which possesses the transformed genotype and thus the desired phenotype, e.g., a transgenic plant.
  • a "transgenic planf ' is a plant into which foreign DNA has been introduced.
  • a "transgenic plant” encompasses all descendants, hybrids, and crosses thereof, whether reproduced sexually or asexually, and which continue to harbor the foreign DNA.
  • Regeneration techniques rely on manipulation of certain phytohormones in a tissue culture growth medium, typically relying on a biocide and/or herbicide marker which has been introduced together with the desired nucleotide sequences. See for example, International Publication No.
  • the foregoing methods for transformation are typically used for producing a transgenic variety in which the expression cassette is stably incorporated. After the expression cassette is stably incorporated in transgenic plants, it can be transferred to other plants by sexual crossing. In one embodiment, the transgenic variety could then be crossed, with another (non- transformed or transformed) variety, in order to produce a new transgenic variety. Alternatively, a genetic trait which has been engineered into a particular Jatropha line using the foregoing transformation techniques could be moved into another line using traditional backcrossing techniques that are well known in the plant breeding arts.
  • a backcrossing approach could be used to move an engineered trait from a public, non-elite variety into an elite variety, or from a variety containing a foreign gene in its genome into a variety or varieties which do not contain that gene.
  • crossing can refer to a simple X by Y cross, or the process of backcrossing, depending on the context Any of a number of standard breeding techniques can be used, depending upon the species to be crossed.
  • transgenic plants of this type are produced, the plants themselves can be cultivated in accordance with conventional procedures.
  • Transgenic seeds can, of course, be recovered from the transgenic plants. These seeds can then be planted in the soil and cultivated using conventional procedures to produce transgenic plants.
  • the cultivated transgenic plants will express the DNA of interest in a tissue-preferred or tissue-specific manner as described herein.
  • the present invention provides methods of decreasing the amount of phorbol esters in plant seeds.
  • the plant seeds are seeds of a plant of the families of Euphorbiaceae and Thymelaeceae.
  • the plant seeds are Jatropha seeds.
  • the plant seeds are Jatropha curcas seeds.
  • the plant seeds are Croton tiglium seeds.
  • a method involves modulating the level of activity of one or more enzymes involved in a phorbol ester biosynthesis in the host plant cell or plant.
  • the enzyme is a casbene synthase.
  • the enzymes are two casbene synthases.
  • the casbene synthase is JcCASA163 or a homolog thereof. In another embodiment, the synthase is JcCASD168 or a homolog thereof. In a further embodiment, the casbene synthases are JcCASA163 or a homolog thereof and JcCASD168 or a homolog thereof. In another embodiment, the casbene synthase is a casbene synthase of a plant of the families of Euphorbiaceae and Thymelaeceae. The level of activity can be reduced by reducing expression of the enzyme. In one embodiment, the modulation of the level of activity of an enzyme is a reduction in the activity of the enzyme.
  • the level of activity of an enzyme can be reduced by using RNAi techniques described herein in which the enzyme is the target for the RNAi.
  • two casbene synthase gene JcCASA163 and JcCASD16S homologs were isolated from Jatropha genome.
  • JcCASA163 and JcCASD16S casbene synthase gene
  • a seed specific promoter driving an RNAi construct targeting function domains of either JcCASA163 gene or both genes effectively reduced transcript level of these genes in seed together with reduction of PE level.
  • RNA Interference RNA Interference
  • RNAi The Nuts & Bolts ofsiRNA Technology, DNA Press, 2003; Gott, RNA Interference, Editing, and Modification: Methods and Protocols (Methods in Molecular Biology), Human Press, Totowa, NJ, 2004; Sohail, Gene Silencing by RNA Interference: Technology and Application, CRC, 2004.
  • Jatropha casbene synthase genes were obtained through blastX (Altschul et al., 1997) search against a Temasek Life Sciences Laboratory (TLL) in-house whole genome sequence database of Jatropha.
  • the gene named as JcCASA163 showed 75% nucleic acid similarity to the casbene synthase gene first identified in Ricinus communis (Mau and West, 1994; Kirby et al., 2010).
  • Predicted cDNAs were amplified from a cDNA library and sequenced to verify the presence of JcCASA163 and JcCASD168 gene transcripts.
  • JcCASA163 gene encoding a complete open reading frame was obtained after extension by 511ACE-PCR and 3'RACE-PCR.
  • Another distinct homologue to the castor casbene synthase gene (71% similarity) was identified from a cDNA library (Gu et al., 2012) and named JcCASDI68.
  • JcCASA163 cDNA open reading frame (1803 bp) (SEQ ID NO:l) encodes a protein of 601 amino acids (SEQ ID NO:2) with predicted Mr of 69 KDa. This predicted size is consistent with those for many other plant terpene cyclases reported so far (Dueber et al., 1978; Vogeli et al., 1990; Banthorpe et al., 1992; Savage et al., 1994).
  • the encoded protein contained highly conserved elements of terpene synthases, including the RxR motif which is thought to be involved in the complexation of diphosphate group after the ionization of the substrate (Starks et al., 1997). Most importantly, the encoded protein also has the aspartate-rich region DDxxD (SEQ ID NO:5) and the NSE/DTE motif. These two conserved amino acid regions are crucial for the metal cofactor binding of terpene synthases. The two highly aspartate-rich motifs are present in all members of the IDS (isoprenyl diphosphate synthase) family which are important in substrate binding (Jennings et al., 1991).
  • RNAs were extracted with a modified CTAB method. RNAs were incubated with DNase I (Fermentas) to get DNA-free RNA. 1 ⁇ g RNA was used in a 20 ⁇ reverse transcription mixture for first-strand cDNA synthesis with iSCRIPT Reverse Transcription Supermix (BIO-RAD). After reaction, cDNA was 5-fold diluted and 1 ⁇ was added to a 30- ⁇ 1 PCR mixture. Gene specific primers were used to amplify the JcCASA163, JcCASD168 and LEA as follows:
  • JcCASA163-F TCTGCGGTTAAGTCATTCCCTAATTTCGC (SEQ ID NO:6) and JcCASA163-R: CCTCCAGCTTGATTGAGTTTGGGGTA (SEQ ID NO:7);
  • JcCASD168-F TAGCCGCACAATCGAGTCCTCATCTT (SEQ ID NO:8) and JcCASD168-R: CCTGTTTCATCAAAAAGATTCAACACAGCC (SEQ ID NO:9);
  • LEAl-F TCACCGCTTGAGTTTTGAGAAGAAG (SEQ ID NO: 10) and LEA1-R: GCAATTATATAAAACGAAGGCAACTTCTC (SEQ ID NO:l 1).
  • PCR program hot start of 94° C for 5 min, 30 cycles of denaturation (94° C, 20 sec), annealing (58° C, 20 sec) and elongation (72° C, 30 sec), and a final extension step at 72° C for 5 min.
  • the PCR products (8 ⁇ ) for each sample were then separated by electrophoresis in 1.2% agarose gel containing ethidium bromide.
  • GADPH Glyceraldehyde 3-phosphate dehydrogenase gene GADPH was also analyzed.
  • RNA blot analysis revealed a single band of close to 2kb which is consistent with the size of the longest cDNA (data not shown).
  • JcCASA163 is ubiquitously expressed with higher level of transcription during the late stages of seed development. JcCASD168 is more seed specific with no transcript detected in leaf. LEA1 is seed development specific with high level of expression.
  • the JcCASA163 protein was expressed in E. coli and the purified protein was incubated with potential substrates geranyl diphosphate (GPP), farnesyl diphosphate (FPP) and geranylgeranyl diphosphate (GGDP) in the presence of various co-substrates MgCl 2+ or MnCl 2+ . In this manner, the enzymatic activity to convert the substrates into terpene reaction products was tested.
  • GPP geranyl diphosphate
  • FPP farnesyl diphosphate
  • GGDP geranylgeranyl diphosphate
  • a protein of 100 kDa was detected by 12% SDS-PAGE in protein extracts from IPTG induced cultures of E. coli strain BL21(DE3) /pGEX6P-l-JcCASA163. This size is consistent with the predicted protein size for JcCASA163 plus 30 kDa of the GST tag.
  • the recombinant protein was purified by a single affinity chromatography procedure followed by the elution from GST-binding affinity resin. Dialyzed, purified proteins were incubated with each of the three acyclic terpenoid substrates.
  • JLEA1 late embryogenesis abundant gene
  • the upstream fragment of LEA1 promoter approximately 2.45 kb (SEQ ID NO: 14) was inserted into the Xbal/BamHI sites of pCAMBIA1300.
  • a nos terminal fragment (SEQ ID NO:15) from pBI121 was cloned into
  • the hygromycin-resistant regenerated shoots of about 2.5 cm were rooted, acclimatized and maintained in biosafety level 2 GM green house in pots (diameter 30 cm) at Temasek Life Sciences Laboratory, Singapore. Plant management, such as fertilization, agrochemical application, watering and artificial fertilization, was carried out according to standard practices. TO plants were allowed to flower and set fruit to yield Tl seeds. Genomic Southern blot hybridization was used to check copy number of transgene. Results for four transgenic lines are shown in Figure 5, which have either one or two copies of the transgene. Individual seeds were analyzed for either transcription level of the targeted genes or PE content (Bu et al., 2012).
  • Tl seeds had PEs content reduced (Figure 6) in comparison with seeds harvested from a non-related transgenic plant grown under the same conditions. Similarly, Tl seeds analyzed also had their transcript levels of JcCASA163 and JcCASD168 reduced ( Figure 7). It is noted that in JcCASA163 single gene knock down transgenic plants, JcCASD168 transcription was little affected. In double knockdown transgenic plants, both genes were down regulated.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Nutrition Science (AREA)
  • Virology (AREA)
  • Medicinal Chemistry (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

La présente invention concerne le domaine de la biologie moléculaire des plantes, et plus particulièrement les gènes de casbène synthase de Jatropha curcas dont les protéines codées sont impliquées dans la biosynthèse d'ester de phorbol. La présente invention concerne également des procédés permettant de diminuer les effets de l'expression de la casbène synthase chez Jatropha et chez d'autres plantes. La présente invention concerne en outre des procédés permettant de réduire la quantité d'esters de phorbol dans les graines de Jatropha et d'autres plantes.
PCT/SG2013/000315 2013-07-29 2013-07-29 Gènes de casbène synthase de jatropha curcas WO2015016768A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/SG2013/000315 WO2015016768A1 (fr) 2013-07-29 2013-07-29 Gènes de casbène synthase de jatropha curcas

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/SG2013/000315 WO2015016768A1 (fr) 2013-07-29 2013-07-29 Gènes de casbène synthase de jatropha curcas

Publications (1)

Publication Number Publication Date
WO2015016768A1 true WO2015016768A1 (fr) 2015-02-05

Family

ID=52432165

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/SG2013/000315 WO2015016768A1 (fr) 2013-07-29 2013-07-29 Gènes de casbène synthase de jatropha curcas

Country Status (1)

Country Link
WO (1) WO2015016768A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018034356A1 (fr) * 2016-08-16 2018-02-22 国立研究開発法人産業技術総合研究所 Peptide cible de tumeur maligne

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK 1 July 2011 (2011-07-01), accession no. AJ53216 *
DATABASE GENBANK 25 July 2012 (2012-07-25), accession no. AM34474 *
DATABASE GENBANK 25 July 2012 (2012-07-25), accession no. B687998 *
HAAS, W. ET AL.: "Novel 12-deoxy-16-hydroxyphorbol diesters isolated from the seed oil of Jatropha curcas", JOURNAL OF NATURAL PRODUCTS, vol. 65, 2002, pages 1434 - 1440 *
KING, A.J. ET AL.: "Potential of Jatropha curcas as a source of renewable oil and animal feed", JOURNAL OF EXPERIMENTAL BOTANY, vol. 60, no. 10, pages PAGES 289 PAGE 2903 *
KIRBY, J. ET AL.: "Cloning of casbene and neocembrene synthases from Euphorbiaceae plants and expression in Saccharomyces cerevisiae", PHYTOCHEMISTRY, vol. 71, 2010, pages 1466 - 1473 *
MATTHEW, L.: "RNAi for plant functional genomics", COMPARATIVE AND FUNCTIONAL GENOMICS, vol. 5, 2004, pages 240 - 244 *
NAKANO, Y. ET AL.: "Characterization of the casbene synthase homolog from Jatropha (Jatropha curcas L.", PLANT BIOTECHNOLOGY, vol. 29, 2012, pages 185 - 189 *

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018034356A1 (fr) * 2016-08-16 2018-02-22 国立研究開発法人産業技術総合研究所 Peptide cible de tumeur maligne
CN109563128A (zh) * 2016-08-16 2019-04-02 国立研究开发法人产业技术总合研究所 恶性肿瘤靶向肽
US10695396B2 (en) 2016-08-16 2020-06-30 National Institute Of Advanced Industrial Science And Technology Malignant tumor target peptide
AU2017311927B2 (en) * 2016-08-16 2021-06-03 National Institute Of Advanced Industrial Science And Technology Malignant tumor target peptide
RU2770197C2 (ru) * 2016-08-16 2022-04-14 Нэшнл Инститьют Оф Эдванст Индастриал Сайенс Энд Текнолоджи Пептид злокачественной опухоли, являющийся мишенью
CN109563128B (zh) * 2016-08-16 2023-02-28 国立研究开发法人产业技术总合研究所 恶性肿瘤靶向肽
IL264845B1 (en) * 2016-08-16 2023-05-01 Aist Peptides targeting malignant tumors, conjugates and preparations containing them and their uses
IL264845B2 (en) * 2016-08-16 2023-09-01 Aist Peptides targeting malignant tumors, conjugates and preparations containing them and their uses

Similar Documents

Publication Publication Date Title
CN107207573A (zh) 超敏aba受体
CN105037521B (zh) 一种与植物抗逆性相关蛋白TaWrky48及其编码基因与应用
US10913954B2 (en) Abiotic stress tolerant plants and methods
US11111497B2 (en) Transgenic plants with engineered redox sensitive modulation of photosynthetic antenna complex pigments and methods for making the same
WO2016064347A1 (fr) Terpènes synthases obtenues à partir d'ylang-ylang (cananga odorata var. fruticosa)
Li et al. Engineering low phorbol ester Jatropha curcas seed by intercepting casbene biosynthesis
US8557585B2 (en) Fusion polynucleotide for biosynthesis of beta-carotene using bicistronic gene expression and method for producing beta-carotene using the same
Darqui et al. Peculiarities of the transformation of Asteraceae family species: the cases of sunflower and lettuce
Kempe et al. The production of male-sterile wheat plants through split barnase expression is promoted by the insertion of introns and flexible peptide linkers
CN106397556B (zh) 植物抗旱相关蛋白ZmNAC111及其编码基因与应用
US20150141714A1 (en) Engineering plants with rate limiting farnesene metabolic genes
Kong et al. Comparative proteomics analysis of OsNAS1 transgenic Brassica napus under salt stress
EP2334798A2 (fr) Plante transgenique contenant du decarboxylase de glutamate (gad) ayant une architecture modifiee
US20200370063A1 (en) Genetically engineered land plants that express lcid/e protein and optionally a ccp1 mitochondrial transporter protein and/or pyruvate carboxylase
BR112021004034A2 (pt) plantas terrestres geneticamente modificadas que expressam uma proteína de rendimento de sementes aumentado e/ou um rna de rendimento de sementes aumentado
WO2015016768A1 (fr) Gènes de casbène synthase de jatropha curcas
CN106279386A (zh) 一种水稻穗顶部生长发育相关蛋白及其编码基因与应用
WO2018234191A1 (fr) Résistance accrue à la sécheresse dans des plantes
Abdel-Ghany et al. Engineering of plants for the production of commercially important products: approaches and accomplishments
CN106834313B (zh) 人工优化合成的Pat#基因与重组载体以及改变作物抗性的方法
US20180327770A1 (en) Guayule with increased rubber production and yield
CN113773374B (zh) 转录因子ZmbZIPa6及其编码基因与应用
US7655837B2 (en) Glutathione-S-transferase gene from Proposis juliflora confers abiotic stress tolerance in plants
Weiguo et al. Applicatios of Genetic Engineering in Mulberry
Do Genetic Engineering of Sorghum and Switchgrass for Improved Biofuel Production

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13890284

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13890284

Country of ref document: EP

Kind code of ref document: A1