WO2014178653A1 - 지방세포 분화 과정에서 인간 작은 류신 지퍼 단백질의 용도 - Google Patents
지방세포 분화 과정에서 인간 작은 류신 지퍼 단백질의 용도 Download PDFInfo
- Publication number
- WO2014178653A1 WO2014178653A1 PCT/KR2014/003864 KR2014003864W WO2014178653A1 WO 2014178653 A1 WO2014178653 A1 WO 2014178653A1 KR 2014003864 W KR2014003864 W KR 2014003864W WO 2014178653 A1 WO2014178653 A1 WO 2014178653A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- slzip
- pparγ2
- protein
- human small
- cells
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/04—Anorexiants; Antiobesity agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0634—Cells from the blood or the immune system
- C12N5/0636—T lymphocytes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
- C12N5/0653—Adipocytes; Adipose tissue
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/502—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2121/00—Preparations for use in therapy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/998—Proteins not provided for elsewhere
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
- C12N2506/13—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells
- C12N2506/1346—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells from mesenchymal stem cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
- C12N2506/13—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells
- C12N2506/1346—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells from mesenchymal stem cells
- C12N2506/1353—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells from mesenchymal stem cells from bone marrow mesenchymal stem cells (BM-MSC)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
- G01N2500/10—Screening for compounds of potential therapeutic value involving cells
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/04—Endocrine or metabolic disorders
- G01N2800/042—Disorders of carbohydrate metabolism, e.g. diabetes, glucose metabolism
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/04—Endocrine or metabolic disorders
- G01N2800/044—Hyperlipemia or hypolipemia, e.g. dyslipidaemia, obesity
Definitions
- the present invention relates to the use of human small leucine zipper protein in adipocyte differentiation during differentiation of mesenchymal stem cells.
- mesenchymal stem cells have been used in various clinical trials, but for medical treatment, problems such as control of differentiation of mesenchymal stem cells have to be solved.
- Adipocytes and osteoblasts are differentiated from mesenchymal stem cells, and this differentiation is regulated from transcription factors.
- mesenchymal stem cells the balance of differentiation of osteoblasts and adipocytes is very important for recovery, regeneration and homeostasis. The failure of this mesenchymal stem cell differentiation balance causes problems such as degenerative arthritis and osteoporosis.
- PPAR ⁇ 2 is expressed upon differentiation from mesenchymal stem cells to adipocytes and is involved in the regulation of adipocyte-related gene expression. Runx2 is also expressed during osteoblast differentiation and is involved in osteoblast-related gene expression. Therefore, it is very important to understand the regulation mechanism of transcription factor in adipocyte and osteoblast differentiation.
- PPAR ⁇ belongs to the transcription factor PPAR family and includes PPAR ⁇ , PPAR ⁇ , and PPAR ⁇ .
- PPAR ⁇ is a major regulator of lipogenesis, lipid biosynthesis, inflammation, and glucose metabolism, and is produced in two variants, PPAR ⁇ 1 and PPAR ⁇ 2 through alternative splicing.
- PPAR ⁇ 2 contains 30 additional amino acids at the N-terminus than PPAR ⁇ 1, and is mainly expressed in macrophages and adipocytes, and partially expressed in bone marrow stromal cells.
- PPAR ⁇ 1 is expressed in various tissues such as muscle, adipose tissue, and bone.
- PPAR ⁇ binds to the peroxisome proliferator-activated response element (PPRE) DNA sequence and forms a heterologous complex with RXR. These factors are found in the CD36 promoter involved in ap2 and cholesterol transport, which are involved in lipid storage. PPAR ⁇ and RXR heterocomplexes bind to inhibitory complements such as HDAC, NCoR, and SMRT in the absence of ligand, and helpers such as P160 / SRC, PBP, PGC-1, CBP, etc. Is replaced by. Many transcription factors and ligands are involved in the regulation and expression of PPAR ⁇ .
- PPRE peroxisome proliferator-activated response element
- C / EBP directly binds to the PPAR ⁇ promoter to promote transcription
- TZD a synthetic reagent such as prostaglandin J2, rosiglitazone, and pioglitazone, which is a natural PPAR ⁇ ligand, also increases PPAR ⁇ transcriptional activity.
- RB and cyclin D1 inhibit the transcriptional activity of PPAR ⁇ .
- LZIP is a member of the bZIP family and belongs to the CREB / ATF gene family.
- LZIP has a basic DNA-binding domain and a leucine zipper domain, and binds to a cAMP-responsive element (CRE) and an AP-1 element.
- CRE cAMP-responsive element
- Human LZIP has been shown to be an HCF-1 binding protein and promotes cell proliferation and cellular transformation.
- N-terminal 92 amino acids are strong transcriptional domains and contain two LxxLL-transcription helper binding motifs.
- LZIP consists of five members: CREB3 (LZIP, Luman), CREB3L1 (OASIS), CREB3L2 (BBF2H7), CREB3L3 (CREB-H), and CREB3L4 (AIbZIP).
- LZIP CREB3
- Luman Luman
- CREB3L1 OASIS
- BBF2H7 CREB3L2
- CREB3L3 CREB3L3
- AIbZIP CREB3L4
- LZIP an isoform of LZIP
- sLZIP inhibits the transcriptional activity of the glucocorticoid receptor by activating HDACs without being involved in LKN-1 dependent cell migration.
- the present inventors completed the present invention by studying the regulation mechanism of sLZIP that regulates the transcriptional activities of PPAR ⁇ and Runx2 in relation to the differentiation of osteoblasts and adipocytes in mesenchymal stem cells.
- An object of the present invention is to identify the role of human small leucine-zipper protein (called 'sLZIP') in the differentiation of mesenchymal stem cells into adipocytes. To provide.
- 'sLZIP' human small leucine-zipper protein
- Still another object of the present invention is to provide a screening use of the sLZIP for the prevention or treatment of diabetes or obesity.
- the present invention provides a composition for inhibiting differentiation of mesenchymal stem cells into adipocytes, including human small leucine-zipper protein as a differentiation regulator.
- the present invention also provides a composition for preventing or treating diabetes comprising human small leucine zipper protein.
- the present invention also provides the use of human small leucine zipper proteins for the preparation of a composition for preventing or treating diabetes.
- the present invention also provides a method for treating diabetes in an animal comprising administering to a subject a composition for preventing or treating diabetes comprising a pharmaceutically effective amount of a human small leucine zipper protein.
- the present invention also provides a composition for preventing or treating obesity comprising a human small leucine zipper protein.
- the present invention also provides the use of a human small leucine zipper protein for the preparation of a composition for preventing or treating obesity.
- the present invention also provides a method for treating obesity in an animal comprising administering to a subject a composition for preventing or treating obesity comprising a pharmaceutically effective amount of a human small leucine zipper protein.
- the present invention also provides a method for screening a medicament for preventing or treating diabetes, comprising contacting a gene of a human small leucine zipper protein with a candidate outside the body and determining whether the candidate promotes or inhibits the expression of the gene. to provide.
- the present invention also provides a method for screening a medicament for preventing or treating diabetes, comprising contacting a human small leucine zipper protein with a candidate outside the body, and determining whether the candidate enhances or inhibits the function or activity of the protein. to provide.
- the present invention also provides a method for screening a medicament for preventing or treating obesity, comprising contacting a gene of a human small leucine zipper protein with a candidate outside the body, and determining whether the candidate promotes or inhibits expression of the gene. to provide.
- the present invention also provides a method for screening a medicament for preventing or treating obesity, comprising contacting a human small leucine zipper protein with a candidate outside the body, and determining whether the candidate enhances or inhibits the function or activity of the protein. to provide.
- human small leucine zipper protein binds to PPAR ⁇ 2 and induces complex formation of HDAC3 and PPAR ⁇ 2, thereby acting as an inhibitor of PPAR ⁇ 2, negatively inhibiting the transcriptional activity of PPAR ⁇ 2 and inhibiting differentiation into adipocytes. It provides a regulator that controls the differentiation balance of adipocytes and osteoblasts in mesenchymal stem cells.
- sLZIP can be used for therapeutic purposes such as diabetes or obesity, or as a marker for the development of new therapeutic drugs.
- Figure 1 shows the effect on the transcriptional activity of PPAR ⁇ of sLZIP according to the present invention
- a to C is a ligand of PPAR ⁇ 2 rosiglitazone (RZD) (A), pioglitazone (PZD) (B) and troglitazone (TZD) (C )
- RZD rosiglitazone
- PZD pioglitazone
- TZD troglitazone
- D is the result of measuring the transcriptional activity of PPAR ⁇ 2 by si-sLZIP
- E is the differentiation of mesenchymal stem cells overexpressing sLZIP The result of measuring the transcriptional activity of PPAR ⁇ 2.
- Figure 2 is a result of investigating the binding capacity of PPAR ⁇ of sLZIP according to the present invention, A and B in 293T cells transfected with GST-sLZIP and Myc-PPAR ⁇ 2 (A) and GST-PPAR ⁇ 2 and Flag-sLZIP (B)
- the result of investigating the binding capacity of sLZIP and PPAR ⁇ 2 is the result of immunoblotting to measure the binding of His-sLZIP and PPAR ⁇ 2 using anti-PPAR ⁇ 2 and anti-His antibody
- D is GFP expressed in C3H10T1 / 2 cells Nuclear localization of -PPAR ⁇ 2 and Flag-sLZIP.
- Figure 3 shows the gene map and binding site analysis of sLZIP and PPAR ⁇ 2 according to the present invention, A is sLZIP, B is PPAR ⁇ 2.
- Figure 4 shows the results of the role of HDAC3 in the inhibition of the transcriptional activity of PPAR ⁇ 2 by sLZIP according to the present invention
- A is the effect of the transcriptional activity of PPAR ⁇ 2 after treatment with HDSA inhibitor TSA
- B is the HDAC si-RNA PPAR ⁇ 2 transcriptional activity was inhibited after expression
- C was the effect of PPAR ⁇ 2 transcriptional activity on HDAC3 overexpression
- D was measured in the nucleus position of HDAC3 and sLZIP
- E was HDAC3 according to GST pull-down analysis. This shows the combination of and sLZIP.
- FIG. 5 shows the result of inhibition of PPAR ⁇ 2 induction of PPAR ⁇ 2 by sLZIP according to the present invention
- A shows the binding of PPAR ⁇ 2 ligand dependent sLZIP and PPAR ⁇ 2
- B shows the binding effect of sLZIP and PPAR ⁇ 2 according to the treatment of PPAR ⁇ 2 ligand according to time zones.
- C represents the binding effect of HDAC3 and sLZIP, which are inhibitors of PPAR ⁇ 2 under PPAR ⁇ 2 ligand
- D represents the binding effect of sLZIP, PPAR ⁇ 2 and HDAC3 complexes
- E the binding effect of sLZIP, PPAR ⁇ 2 and HDAC3 complexes according to NCoR1 treatment
- F The sLZIP deletion mutant was used to show the relationship between the regulatory mechanism of sLZIP and ligand-dependent binding to PPAR ⁇ 2.
- A is the effect of sLZIP when binding between PPAR ⁇ 2 and HDAC3
- B is ubiquitination result of HDAC3 by sLZIP
- C is sLZIP The effect on PPAR ⁇ 2 helper is shown.
- A is the result of analyzing the FABP4 enhancer sequence by the TES and AliBaba2
- B is various in the FABP4 enhancer region
- C and D are super shift analysis and cold competition assay confirming specific DNA binding ability of CREB element and sLZIP in FABP4 enhancer region
- E is FABP4 enhancer-luciferase construct PPAR ⁇ 2 transcriptional activity test results using the F, ChIP results.
- Figure 8 shows the effect of sLZIP according to the invention in the process of adipocyte formation
- a and B show the effect of sLZIP on adipocyte formation in vivo
- E shows the effect of sLZIP on adipocyte differentiation in pluripotent mesenchymal progenitor cells.
- Figure 9 shows the effect of sLZIP according to the present invention when adipocyte differentiation in vivo, A and B in the fat precursor cells (A) and mouse embryo fibroblasts (B) isolated from epididymal adipose tissue of sLZIP TG mice Differentiated adipocytes are shown, C and D show the results of measuring mRNA expression level of PPAR ⁇ 2 target gene using RT-PCR (C) and real time PCR (D).
- FIG. 10 is a schematic diagram showing the differentiation control effect of sLZIP according to the present invention of mesenchymal stem cells.
- the present invention relates to a composition for inhibiting differentiation of mesenchymal stem cells into adipocytes comprising human small leucine zipper proteins as differentiation regulators.
- sLZIP binds to PPAR ⁇ 2 and induces complex formation of HDAC3 and PPAR ⁇ 2, thereby acting as an inhibitor of PPAR ⁇ 2, which negatively inhibits the transcriptional activity of PPAR ⁇ 2 and differentiates into adipocytes.
- the present invention was completed by confirming that adipocyte differentiation of sLZIP transgenic mice was suppressed in experiments using sLZIP transgenic mice.
- sLZIP is an isoform of LZIP, which consists of 354 amino acids without transmembrane domains, and activates HDACs without involving LKN-1 dependent cell migration, thereby activating the transcriptional activity of the Glucocorticoid receptor. It is a protein that inhibits.
- sLZIP is a differentiation regulator of mesenchymal stem cells that controls the differentiation balance of adipocytes and osteoblasts.
- sLZIP inhibits PPAR ⁇ 2 transcriptional activity in a concentration dependent manner. Inhibition of the transcriptional activity of PPAR ⁇ 2 occurred by sLZIP binding directly to PPAR ⁇ 2. The binding of sLZIP and PPAR ⁇ 2 occurs in the nucleus.
- various sLZIP deletion mutants such as N-terminal deletion mutants (1-228), C-terminal deletion mutants (229-354) and CC-terminal deletions Mutants (297-354) were generated and analyzed for PPAR binding domains.
- PPAR ⁇ 2 The transcriptional activity of PPAR ⁇ is regulated by helpers and inhibitors, and in the resting state PPAR ⁇ 2 is known to bind inhibitory complexes such as HDAC3, SMRT and NCoR, so the effect of sLZIP on the transcriptional activity of PPAR ⁇ 2 by HDACs was investigated.
- sLZIP inhibited the transcriptional activity of PPAR ⁇ 2
- sLZIP did not reduce the PPAR ⁇ 2 transcriptional activity in cells treated with HDACs inhibitors. Inhibition of this PPAR ⁇ 2 transcriptional activity was limited to HDAC3 in class 1 HDACs.
- sLZIP binds to HDAC3, which indicates that sLZIP binds to HDAC3 and negatively regulates the transcriptional activity of PPAR ⁇ 2.
- Inhibitor complement complexes are replaced by helper upon binding of nuclear receptors and ligands.
- sLZIP binds to PPAR ⁇ 2 in the absence of ligand, but in a time-dependent manner in the presence of ligand. It was isolated from PPAR ⁇ 2.
- LZIP contains an N-terminal active domain (1-220) and has been reported to be involved in the transcriptional activity of cAMP-responsive elements (CREs) -containing reporter genes, and sLZIP, an isoform of LZIP, binds to PPAR ⁇ 2.
- CREs cAMP-responsive elements
- sLZIP enhances binding between PPAR ⁇ 2 and HDAC3 in the presence of ligand, but PPAR ⁇ 2 binds to inhibitors such as HDAC3 in the absence of ligand, and the addition of PPAR ⁇ 2 ligand results in the separation of the PPAR ⁇ -inhibitory complement complex resulting in ubiquitin / proteosomes. Induce degradation by the pathway.
- SLZIP also inhibited HDAC3 ubiquitination upon ligand treatment.
- sLZIP inhibited the supplementation of the helper PGC-1 ⁇ for PPAR ⁇ 2.
- sLZIP binds to PPAR ⁇ 2 to regulate the transcriptional activity of PPAR ⁇ 2 and enhances the formation of inhibitory complement complexes.
- analysis of the FABP4 promoter region revealed that sLZIP directly bound to the CREB region in the FABP4 enhancer region. It appears that sLZIP binds directly to the CREB element in the FABP4 enhancer, leading to an enhancement of the inhibitory complement complex of PPAR ⁇ 2.
- PPAR ⁇ 2 is a major regulator of adipocyte formation and is highly expressed during adipocyte differentiation and regulates the expression of genes involved in adipocyte formation. Therefore, the effect of sLZIP on adipocyte formation in vivo was investigated. As a result, PPAR ⁇ 2 transcriptional activity in adipocytes of sLZIP TG mice was decreased in adipocytes of sLZIP TG mice compared to wild type (WT) mice. Testing of homologous mouse LZIP affects transcriptional activity and expression of PPAR ⁇ 2 during adipocyte formation. Mouse LZIP also reduced PPAR ⁇ 2 transcriptional activity compared to control. Interestingly, mouse LZIP expression decreased during adipocyte differentiation.
- SLZIP also inhibited adipocyte differentiation from pluripotent mesenchymal progenitor cells to adipocyte differentiation.
- differentiation of primary adipocytes and mouse embryonic fibroblasts (MEFs) isolated from sLZIP TG mice was also inhibited in comparison with wild-type mice.
- expression of FABP4 and other PPAR ⁇ 2 target genes such as C / EBPa and LPL was also down-regulated.
- sLZIP functions as a negative regulator of adipocyte differentiation in vitro and in vivo by inhibiting PPAR ⁇ 2 transcriptional activity.
- composition for inhibiting differentiation of the present invention may include sLZIP as a natural or recombinant sLZIP, or sLZIP having a physiological activity substantially equivalent thereto.
- Proteins having substantially equivalent physiological activity include native / recombinant sLZIP and its functional equivalents and functional derivatives.
- the “functional equivalent” refers to an amino acid sequence variant in which some or all of the amino acids of the native protein are substituted, or a portion of the amino acid is deleted or added, and has substantially the same physiological activity as the native sLZIP.
- sLZIP a protein that has been modified to increase or decrease the physicochemical properties of the sLZIP and has substantially the same physiological activity as the native sLZIP.
- the sLZIP of the present invention is a protein of mammalian, preferably human origin, for example GenBank accession no. It refers to a protein having a sequence known as FJ263669 and the like. More specifically, it may be represented by the amino acid sequence described in SEQ ID NO: 1.
- sLZIP used in the present invention is GenBank accession no. It may be prepared by genetic engineering methods known to those skilled in the art from FJ263669 and the like.
- the native sLZIP is similar to that of the natural type in terms of protein activity and solubility in mammalian cells than in E. coli or insect cells when the protein is produced by genetic recombination methods.
- the recombinant sLZIP can be separated using a conventional column chromatography method.
- the degree of purification of the protein can be confirmed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).
- composition for inhibiting differentiation of the present invention may be added as a differentiation regulating factor in mesenchymal stem cell culture in vitro .
- natural or recombinant sLZIP may be added to control the number of osteoblasts through quantitative changes thereof.
- composition for inhibiting differentiation of the present invention may further include a known differentiation inducing factor for inducing differentiation of mesenchymal stem cells in addition to the sLZIP.
- a known differentiation inducing factor for inducing differentiation of mesenchymal stem cells in addition to the sLZIP.
- ciliary neurotrophic factor CNTF
- BMPs bone morphogenetic proteins
- TGF ⁇ transforming growth factor
- GGF2 neuregulin-1
- GGF2 glial growth factor-2
- the present invention also relates to a composition for preventing or treating bone diseases comprising human small leucine zipper protein.
- the present invention also relates to a composition for preventing or treating diabetes comprising human small leucine zipper protein.
- the present invention also provides the use of human small leucine zipper proteins for the preparation of a composition for preventing or treating diabetes.
- the present invention also relates to a composition for preventing or treating obesity comprising a human small leucine zipper protein.
- the present invention also provides the use of a human small leucine zipper protein for the preparation of a composition for preventing or treating obesity.
- the sLZIP inhibits the differentiation of mesenchymal stem cells into adipocytes, it can be used as a preventive or therapeutic agent for diabetes and obesity.
- the sLZIP used in the composition for preventing or treating diabetes or obesity of the present invention is a protein derived from a mammal, preferably a human, for example, GenBank accession no. It refers to a protein having a sequence known as FJ263669 and the like. More specifically, it may be represented by the amino acid sequence described in SEQ ID NO: 1.
- the sLZIP may be included in the form of a natural or recombinant protein, or in the form of a transformed stem cell overexpressing sLZIP.
- the transformed stem cells overexpressing the native or recombinant sLZIP may be prepared by introducing a vector expressing the native or recombinant sLZIP into the stem cells through known methods.
- the present invention also provides a method of treating diabetes in an animal comprising administering to a subject a composition for preventing or treating diabetes comprising a pharmaceutically effective amount of sLZIP.
- the present invention also provides a method of treating obesity in an animal comprising administering to a subject a composition for preventing or treating obesity comprising a pharmaceutically effective amount of sLZIP.
- the individual who can administer the pharmaceutical composition for preventing or treating diabetes or obesity includes all animals.
- it may be an animal except a human such as a dog, a cat, and a mouse.
- composition of the present invention may further comprise a pharmaceutically acceptable carrier.
- Such pharmaceutically acceptable carriers include carriers and vehicles commonly used in the pharmaceutical arts, and in particular, ion exchange resins, alumina, aluminum stearate, lecithin, serum proteins (eg, human serum albumin), buffer materials (eg, Various phosphates, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids), water, salts or electrolytes (e.g., protamine sulfate, disodium hydrogen phosphate, hydrogen carbonate, sodium chloride and zinc salts) Silica, magnesium trisilicate, polyvinylpyrrolidone, cellulosic substrates, polyethylene glycols, sodium carboxymethylcellulose, polyarylates, waxes, polyethylene glycols or wool, and the like.
- the pharmaceutical composition of the present invention may further include a lubricant, a humectant, an emulsifier, a suspending agent, a preservative, and the like, in addition to the above components.
- the composition according to the invention may be prepared in an aqueous solution for parenteral administration, preferably a buffered solution such as Hanks' solution, Ringer's solution or physically buffered saline. Can be used.
- Aqueous injection suspensions can add a substrate that can increase the viscosity of the suspension, such as sodium carboxymethylcellulose, sorbitol or dextran.
- compositions of the present invention can be administered systemically or topically and can be formulated in suitable formulations by known techniques for such administration.
- oral administration it can be administered by mixing with an inert diluent or an edible carrier, sealed in hard or soft gelatin capsules, or pressed into tablets.
- the active compounds can be mixed with excipients and used in the form of intake tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers and the like.
- sLZIP is well soluble in saline or buffer, it is stored in a freeze-dried state, and then formulated in solution immediately before administration to saline or buffer in an effective amount of sLZIP in a form suitable for intravenous, subcutaneous, intramuscular, intraperitoneal, or transdermal administration. It can also be administered.
- An effective amount of the active ingredient of the pharmaceutical composition of the present invention means an amount required to achieve the effect of preventing, inhibiting or alleviating the disease.
- the type of disease, the severity of the disease, the type and amount of the active and other ingredients contained in the composition, the type of formulation and the age, weight, general health, sex and diet, sex and diet, time of administration, route of administration and composition of the patient can be adjusted according to various factors including the rate of secretion, the duration of treatment, and the drug used concurrently.
- the sLZIP of the present invention may be administered at a dose of 0.1 ng / kg to 10 g / kg in adults when administered once or several times a day.
- the present invention also provides a method for screening a medicament for preventing or treating diabetes, comprising contacting a gene of a human small leucine zipper protein with a candidate outside the body, and determining whether the candidate promotes or inhibits the expression of the gene. It is about.
- the present invention also provides a method for screening a medicament for preventing or treating diabetes, comprising contacting a human small leucine zipper protein with a candidate outside the body, and determining whether the candidate enhances or inhibits the function or activity of the protein. to provide.
- the present invention also provides a method for screening a medicament for preventing or treating obesity, comprising contacting a gene of a human small leucine zipper protein with a candidate outside the body, and determining whether the candidate promotes or inhibits expression of the gene. It is about.
- the present invention also provides a method for screening a medicament for preventing or treating obesity, comprising contacting a human small leucine zipper protein with a candidate outside the body, and determining whether the candidate enhances or inhibits the function or activity of the protein. to provide.
- a candidate substance to be analyzed may be contacted with a diabetic or mast cell including the gene or protein first.
- the candidate substance is assumed to have a potential as a medicament for promoting or inhibiting the function or activity of the sLZIP protein or a substance that promotes or inhibits the transcription and translation of the mRNA and the protein in the sLZIP gene sequence according to a conventional selection method, or Random nucleic acids, proteins, peptides, other extracts or natural products, compounds, and the like.
- the expression level of the gene, the amount of the protein or the activity of the protein can be measured in the cells treated with the candidate, and as a result of the increase, the expression amount of the gene, the amount of the protein or the activity of the protein is increased or decreased.
- the candidate substance may be determined as a substance capable of preventing or treating diabetes or obesity.
- the method of measuring the expression amount of the gene, the amount of the protein or the activity of the protein in the above may be carried out through a variety of methods known in the art, for example, but not limited to reverse transcriptase polymerase chain reaction (reverse transcriptase-polymerase chain reaction, real time-polymerase chain reaction, western blot, northern blot, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radioimmunodiffusion (radioimmunodiffusion) And immunoprecipitation assays.
- reverse transcriptase polymerase chain reaction reverse transcriptase-polymerase chain reaction, real time-polymerase chain reaction, western blot, northern blot, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radioimmunodiffusion (radioimmunodiffusion)
- immunoprecipitation assays for example, but not limited to reverse transcriptase polymerase
- Candidates exhibiting activity that enhances gene expression or enhances protein function obtained through the screening method of the present invention may be candidates for the treatment of diabetes or obesity.
- Such candidates for the treatment of diabetes or obesity will act as leading compounds in the development of drugs for the treatment of diabetes or obesity, so that the leading substances can promote or inhibit the function of the sLZIP gene or the protein expressed therefrom.
- new therapeutic agents for diabetes or obesity can be developed.
- Dulbecco's modified Eagle's medium was purchased from GIBCO technologies, Inc (Gaithersburg) and fetal bovine serum was purchased from HyClone Laboratory (Logan, UT).
- Anti-PPAR ⁇ 2, anti-HDAC1, 2, 3, 4, 6, 8 and 9, anti- ⁇ -actin and anti-GST antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, Calif.).
- Anti-mouse and anti-rabbit peroxidase bound secondary antibodies were purchased from Pierce (Madison, WI).
- IBMX Insulin and methylisobutylxanthine
- MSCs Human primary mesenchymal stem cells
- C3H10T1 / 2, 293T and MEF cells were cultured in DMEM with 10% FBS inactivated by heat and penicillin (100 U / mL) / streptomycin (100 ⁇ g / mL).
- Primary adipocytes were isolated from epididymal fat pads of sLZIP transgenic mice by collagenase cleavage, and 3T3-L1 cells were 10% bovine serum and penicillin (100 U / mL) / streptomycin. (100 ⁇ g / mL) was maintained in the added DMEM.
- C3H10T1 / 2 and 3T3-L1 cells, primary adipocytes, and MEF cells were grown to confluence, followed by 10% FBS, 5 ⁇ g / mL insulin, 1 ⁇ M of dexamethasone And medium was changed to DMEM containing 0.5 mM IBMX.
- C3H10T1 / 2 and 293T cells were plated in 12-well culture dishes at a density of 2 ⁇ 10 5 cells / well. After incubation for 24 hours, cells were transfected with 0.2 ⁇ g of reporter gene and 0.1-0.5 ⁇ g of experimental plasmid using Lipofectamine 2000 or Genefectine according to the manufacturer's instructions. After 24 hours, cells were cultured in serum-free DMEM with or without 10 nM rosiglitazone. siRNAs were made using the sLZIP and HDAC target sequences (Table 1). For RNA interference experiments, cells were transfected with mixed RNA and appropriate siRNAs using Lipofectamine 2000 according to the manufacturer's instructions. Human MSC and C3H10T / 1/2 cells were infected with adenoviral or empty vectors containing cDNA for human sLZIP. After 2 hours the infection medium was changed to fresh medium.
- RNA samples were directly lysed in the culture dish by adding TRIzol reagent (Invitrogen, Carlsbad, Calif.) According to the manufacturer's instructions.
- CDNA was synthesized from 2 ⁇ g of total RNA using Accupower RT PreMix (BioNeer, Daejeon, Korea). The reaction was carried out at 42 ° C. for 60 minutes and at 94 ° C. for 5 minutes.
- PCR amplification was performed using the Hipi PCR Mix Kit (ELPIS) using the oligomers listed in Table 2.
- GAPDH was amplified as an internal control.
- PCR products were electrophoresed on 1-2% (w / v) agarose gel containing 0.5 ⁇ g / mL ethidium bromide and the size of the PCR product was measured in comparison to the 1 kb DNA ladder marker (Invitrogen). .
- the intensity of each band amplified by RT-PCR was analyzed using a MultiImage TM Light Cabinet (version 5.5, Alpha Innotech Corp., San Leandro, Calif.).
- Cells were obtained and washed twice with cold PBS.
- Cell extracts were prepared using RIPA buffer (10 mM HEPES, 10 mM NaCl, 0.1 mM EDTA, 0.1 mM EGTA, 1% NP-40, 0.5 mM PMSF, 0.1 mM DTT, 0.1 mM Na 3 VO 4 , and protease inhibitors). .
- the suspension was centrifuged at 16,000 x g for 20 minutes at 4 ° C. Supernatants were combined and mixed with sample buffer. Protein samples were separated on SDS-PAGE (8-15%) and transferred to nitrocellulose membranes. Membranes and appropriate antibodies were incubated at 4 ° C. for overnight.
- Luciferase assays were performed using a luciferase assay system (Promega Corporation, Madison, Wis.). Luciferase activity was recorded on Luminometer 20/20 n (Turner BioSystems, Sunnyvale, CA) according to the manufacturer's instructions. Luciferase activity was normalized to ⁇ -galactosidase activity. For ⁇ -galactosidase analysis, CMV- ⁇ -galactosidase was transfected with the luciferase reporter gene. All data are presented as mean ⁇ standard deviation in at least 3 independent experiments.
- the 5'-terminus of the oligonucleotide was labeled with [ ⁇ - 32 P] ATP (Perkin Elmer, Waltham, Mass.) Using T4 polynucleotide kinase (Promega, Madison, Wis.). Unbound nucleotides were removed via tubes in a Bio-Gel P-6 spin column (Bio-Rad, Inc., Hercules, CA) as described in the manufacturer's instructions. His-sLZIP protein was added to 5 ⁇ binding buffer [10 ⁇ GRAB, 20 mM DTT, Poly (deoxyinosinic-deoxycytidylic), Sigma, St.
- radiolabeled probes were pre-incubated for 20 minutes at room temperature, then each reaction mixture was loaded into wells of 4% unmodified polyacrylamide gel and electrophoresed at 180 V in 0.5 ⁇ TBE buffer for 45 minutes.
- the binding reaction was incubated for 30 minutes with a 100-fold molar excess of unlabeled CREB binding oligonucleotides prior to the addition of radiolabeled oligonucleotides.
- anti-His antibodies were added to the reaction mixture for an additional 30 minutes on ice.
- the probes used for EMSA are listed in Table 4.
- C3H10T1 / 2 cells grown in 100-mm culture dishes were infected with adenovirus HA-sLZIP. After infection, cells were maintained in growth medium until they reached 100% confluence and replaced with differentiation medium. Cells were washed with 1 ⁇ PBS and treated with 1% formaldehyde for 10 minutes in medium at room temperature followed by addition of glycine for 5 minutes at a final concentration of 0.125M. Cells were strapped with PBS and centrifuged at 1000 ⁇ g for 5 minutes at 4 ° C. ChIP analysis was performed by precipitation with the DNA-protein complex using anti-HA antibody and anti-rabbit IgG as internal control. The enhancer region of FABP4 containing one functional CREs was amplified from the prepared DNA.
- 293T cells were obtained and washed with cold PBS. Cells were resuspended in IP Lysis buffer [25 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1 mM EDTA, 1% NP-40 and 5% glycerol, and protease inhibitors. The suspension was centrifuged at 16,000 x g for 20 minutes at 4 ° C. Supernatants were collected and incubated with 0.5 ⁇ g of the appropriate antibody and 25 ⁇ l of Protein A / G-Agarose or GST Sepharose 4B beads at 4 ° C. for 24 hours.
- IP Lysis buffer 25 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1 mM EDTA, 1% NP-40 and 5% glycerol, and protease inhibitors. The suspension was centrifuged at 16,000 x g for 20 minutes at 4 ° C. Supernatants were collected and incubated
- Protein complexes were washed five times by centrifuging for 1 min at 1,000 x g with cold IP Lysis buffer. The final pellet was resuspended in 50 ⁇ l SDS-sample buffer containing 5% ⁇ -mercaptoethanol and boiled at 100 ° C. for 10 minutes. Protein samples were separated on SDS-PAGE (8-10%) and transferred to nitrocellulose membranes. Proteins precipitated together were detected by Western blotting using specific antibodies.
- C3H10T1 / 2 cells were transiently transfected together with Flag-sLZIP, GFP-PPAR ⁇ 2 or GFP-sLZIP, and HDAC3 was cultured on cover slips. After 24 hours, cells were fixed for 10 minutes with 4% paraformaldehyde and infiltrated with 0.2% Triton-X 100 for 5 minutes. Cells were incubated with 1% BSA for 1 hour and then incubated with anti-Flag and anti-HDAC3 antibodies for 4 days at 4 ° C. After washing with PBS, cells were incubated with Texas Red bound antibody for 2 hours. Cover slides were washed with PBS, mounted and tested using an LSM 510 META confocal microscope (Carl Zeiss, Jena, Germany).
- sLZIP was cloned into the pET-28a (+) vector. His-sLZIP protein was expressed in Escherichia coli BL21 cells using the T7 isopropyl- ⁇ -D-thiogalactopyranoside (IPTG) -derived system. IPTG-induced cells were disrupted upon sonication and cell lysates were cleared by centrifugation. His-sLZIP protein was placed in a nickel-nitrilotriacetic acid bead column (Bio-Rad, Richmond, CA).
- sLZIP transgenic mice To produce human sLZIP transgenic (TG) mice, the sLZIP gene was cloned into the pCMV-flag expression vector. sLZIP TG mice were produced by Macrogen, Inc. (Seoul, Korea). Transgenic founders were mated with wild type C57BL / 6 mice to produce the F1 heterozygote. F1-F4 generations were genetically screened for transgenes at 2 weeks of age. The following two primers were used to amplify genomic DNA to identify wild type and TG mice: 5'- GGA CGA TGA TGA CAA GGA CT-3 'and 5'- GTC AGA GGA GTA CAT GCT GCT-3'.
- Nuclear receptor PPAR ⁇ is an important positive regulator of adipocyte differentiation in MSCs and a negative regulator in osteoblast development.
- sLZIP is known to be involved in many types of nuclear receptor transcriptional activity such as GR, estrogen receptor (ER) and androgen receptor (AR).
- ER estrogen receptor
- AR androgen receptor
- human sLZIP contains two essential and sufficient LxxLL motifs to bind nuclear receptors.
- sLZIP sLZIP-induced transcriptional activity of PPAR ⁇ 2
- 293T cells were treated with PPAR ⁇ 2 (0.5 ⁇ g), ⁇ -galactosidase (0.1 ⁇ g), FABP4-Luc reporter gene (0.2 ⁇ g) and sLZIP (0.1-) by content.
- 0.5 ⁇ g) was temporarily transfected together.
- cells were stimulated with or without 10 nM rosiglitazone (RZD) (FIG. 1A), pioglitazone (PZD) (FIG. 1B), and troglitazone (TZD) (FIG. 1C).
- sLZIP inhibited the transcriptional activity of PPAR ⁇ 2 in a concentration dependent manner.
- Transcriptional activity of PPAR ⁇ 2 was down-regulated by sLZIP depending on the presence or absence of various PPAR ⁇ 2 ligands as compared to the control.
- siRNA si-sLZIP
- si-sLZIP si-sLZIP
- C3H10T1 / 2 cells stably expressing the FABP4 reporter gene were infected with sLZIP expressing adenovirus and then differentiated into adipocytes. As shown in FIG. 2, the transcriptional activity of PPAR ⁇ 2 was decreased by sLZIP in adipocytes.
- PPAR ⁇ 2 was translated in vitro by the TNT translation system (Promega) and His-sLZIP protein was expressed in BL21 cells using the IPTG-inducing system. Purified His-sLZIP protein was subjected to His pull-down assay. Proteins bound to beads were analyzed by SDS-PAGE and immunoblotted using anti-PPAR ⁇ 2, anti-His antibodies (FIG. 2C). GFP-PPAR ⁇ 2 and Flag-sLZIP constructs were expressed in C3H10T1 / 2 cells and analyzed under fluorescence microscopy using mouse anti-Flag and Texas red coupled anti-mouse antibodies. Nuclei were stained with DAPI (FIG. 2D).
- 293T cells were transfected with Flag-full length PPAR ⁇ 2, full length PPAR ⁇ 2, N-terminal deletion mutant PPAR ⁇ 2 (1-310), C-terminal deletion mutant PPAR ⁇ 2 (139-505) and GST-sLZIP. Cell lysates were obtained and GST pull-down assays were performed. Protein complexes were analyzed on SDS-PAGE and subjected to immunoblotting using anti-GST and anti-Flag antibodies (FIG. 3B).
- the C and CC domains of wild-type sLZIP and sLZIP bind PPAR ⁇ 2, but the sLZIP N domain does not bind PPAR ⁇ 2. It can be seen that the CC-terminal domain of sLZIP containing a proline-rich region is important for binding to PPAR ⁇ 2.
- PPAR ⁇ 2 Transcriptional activity of PPAR ⁇ is regulated by helpers and inhibitors.
- PPAR ⁇ 2 in the resting state is thought to bind to inhibitory complement complexes such as HDAC3, SMRT and NCoR.
- the inhibitor complement complex is replaced with helpers such as p300 / CBP, p160, and PGC-1, leading to the initiation of transcription of the target gene.
- helpers such as p300 / CBP, p160, and PGC-1
- 293T cells were transiently transfected with PPAR ⁇ 2 (0.5 ⁇ g), ⁇ -galactosidase (0.1 ⁇ g), FABP4-Luc reporter gene (0.2 ⁇ g) and sLZIP (0.1 ⁇ g). After transfection, cells were stimulated with or without 10 nM RZD and 10 nM TSA (FIG. 4A). Promoter activity was measured according to the luciferase assay. In 293T cells, the FABP4-Luc reporter gene, sLZIP, PPAR, ⁇ -galactosidase, and 100 nM si-RNAs for the control, and HDAC1, 2, 3 and 8 were expressed.
- FIG. 4B After transfection, cells were stimulated with or without 10 nM RZD and promoter activity was measured (FIG. 4B). 293T cells were transiently transfected with FABP4-Luc reporter gene, PPAR ⁇ 2, ⁇ -galactosidase, HDAC3 (0.5 ⁇ g) and sLZIP (0.1 ⁇ g). After transfection, cells were stimulated with or without 10 nM RZD and luciferase assay was performed (FIG. 4C). Luciferase activity was normalized to ⁇ -galactosidase activity and expressed as relative intensity (fold change). All experiments were performed in three replicates, and the bar in the graph represents the mean ⁇ standard deviation.
- GFP-sLZIP expression constructs were expressed in C3H10T1 / 2 cells and analyzed under fluorescence microscopy using rabbit anti-HDAC3 antibodies and Texas red-bound anti-rabbit antibodies. Nuclei were stained with DAPI (FIG. 4D). 293T cells were transfected together with GST-HDAC3 and Flag-sLZIP. Cell lysates were pulled down using glutathione 4B beads. Protein complexes were analyzed on SDS-PAGE and immunoblotted using anti-GST and anti-Flag antibodies (FIG. 4E). *, P ⁇ 0.05; **, P ⁇ 0.01
- siRNAs for HDAC1, 2, and 8 are not involved in PARL2 regulation mediated by sLZIP.
- knockdown of HDAC3 dramatically improved the sLZIP-mediated PPAR ⁇ 2 transcriptional activity.
- sLZIP was located in the nucleus with HDAC3 (FIG. 4D).
- Inhibitor complement complexes are replaced by helpers upon ligand binding to the nuclear receptor. Therefore, the binding between sLZIP and PPAR ⁇ 2 by ligand treatment was investigated.
- 293T cells were transfected with GST-PPAR ⁇ 2 and Flag-sLZIP and treated with 10 nM RZD for 24 hours or not.
- Cell lysates were obtained and subjected to GST pull-down assay (FIG. 5A) and immunoprecipitation (FIG. 5B) using glutathione 4B beads. Protein complexes were analyzed on SDS-PAGE and immunoblotted using anti-GST and anti-Flag antibodies.
- GST-PPAR ⁇ 2 and Flag-sLZIP were expressed in 293T cells, and cells were treated with 10 nM RZD at each time interval. Cell lysates were analyzed for GST pull-down (FIG. 5C).
- 293T cells were transfected with GST-HDAC3 and Flag-sLZIP and treated with 10 nM RZD for 24 hours or not.
- Cell lysates were analyzed for GST pull-down (FIG. 5D).
- Flag-sLZIP was expressed in 293T cells, and cells were treated with 10 nM RZD for 24 hours.
- Cell lysates were subjected to immunoprecipitation assays using anti-NCoR1 antibodies. Protein complexes were analyzed by SDS-PAGE and immunoblotted using anti-NCoR1 and anti-Flag antibodies (FIG. 5E).
- 293T cells were transiently transfected together with PPAR ⁇ 2 (0.5 ⁇ g), ⁇ -galactosidase (0.1 ⁇ g), FABP4-Luc reporter gene (0.2 ⁇ g) and various deletion mutants of sLZIP (0.1 ⁇ g). After transfection, cells were stimulated with or without 10 nM RZD (FIG. 5F). Luciferase activity was normalized to ⁇ -galactosidase activity and expressed as relative activity (fold change). All experiments were performed in three replicates and expressed as mean ⁇ standard deviation. *, P ⁇ 0.05; **, P ⁇ 0.01
- PPAR ⁇ 2 was isolated from sLZIP upon ligand treatment, as shown in FIG. 5B.
- sLZIP was isolated from PPAR ⁇ 2 when treated with RZD and still inhibited PPAR ⁇ 2 transcriptional activity (FIG. 5F).
- PPAR ⁇ 2 transcriptional activity was inhibited by deletion mutants (1-220) of sLZIP that did not bind PPAR ⁇ 2 (FIG. 5F).
- LZIP contains N-terminal active domains (1-220) and is reported to be involved in the transcriptional activity of cAMP-responsive elements (CREs) -containing reporter genes.
- CREs cAMP-responsive elements
- GST-HDAC3, GST-PPAR ⁇ 2, Myc-PPAR ⁇ 2, Flag-sLZIP and Ha-UB were expressed in 293T cells and 10 nM RZD were treated with cells for 24 hours.
- Cell lysates were subjected to GST pull-down assay (FIG. 6B).
- GST-PPAR ⁇ 2 and Flag-sLZIP were expressed in 293T cells and treated with 10 nM RZD for 24 hours.
- Cell lysates were subjected to GST pull-down assay and protein complexes were analyzed by SDS-PAGE followed by immunoblotting using anti-PGC1 ⁇ , anti-GST and anti-Flag antibodies (FIG. 6C).
- GST pull-down assay showed that sLZIP enhanced binding between PPAR ⁇ 2 and HDAC3 upon ligand treatment.
- PPAR ⁇ 2 binds to inhibitors such as HDAC3 when the ligand is not treated, and separation of the PPAR ⁇ -inhibitory complement complex occurs by addition of the PPAR ⁇ 2 ligand, rosiglitazone, leading to degradation by the ubiquitin / proteosome pathway.
- sLZIP inhibited HDAC3 ubiquitination upon ligand treatment (FIG. 6B).
- FABP4 promoter region was analyzed using Transcription Element Search System (TESS) and AliBaba2, a program that predicts the binding site of transcription factors.
- TESS Transcription Element Search System
- PPAR ⁇ 2 has been reported to bind 518-bp enhancers in adipocyte P2 (FABP4) gene, which includes two PPAR ⁇ 2 binding elements, ARE6 and ARE7. Therefore, we tried to find the expected sLZIP binding site in the FABP4 enhancer region.
- 7A depicts potential sLZIP binding sites in the FABP4 enhancer region.
- the DNA binding capacity of sLZIP with various elements in the FABP4 enhancer region was tested.
- recombinant His-sLZIP fusion proteins (3 ⁇ g) were incubated with ⁇ - 32 P-labeled oligonucleotide probes containing expected CREB binding elements (FIG. 7B).
- ⁇ - 32 P-labeled oligonucleotide probes were incubated with increasing amounts of His-sLZIP purified.
- Competition assays were performed using a 100-fold excess of unlabeled CREB oligonucleotide probe and His antibody was added to the reaction mixture for an additional 40 minutes on ice (FIG. 7C).
- His-sLZIP protein was subjected to EMSA using wild type and CREB mutant (TG AT GTCA? TG GG GTCA) probes (FIG. 7D).
- EMSA TG AT GTCA? TG GG GTCA
- PPAR ⁇ 2 0.5 ⁇ g
- ⁇ -galactosidase 0.1 ⁇ g
- FABP4 enhancer-luciferase reporter gene 0.2 ⁇ g
- sLZIP mutants by content (0.1-0.5 ⁇ g) Sean.
- cells were stimulated with 10 nM RZD (FIG. 7F). Luciferase activity was normalized to ⁇ -galactosidase activity and expressed as relative activity (fold change).
- ChIP analysis was performed using an antibody specific for HA-sLZIP followed by PCR. PCR was performed on input chromatin or immunoprecipitated chromatin to serve as a control for the variables.
- sLZIP reduced the transcriptional activity of PPAR ⁇ 2 in a concentration dependent manner.
- ChIP sLZIP processed RZD or both gathered in CREB element in FABP4 enhancer
- sLZIP binds directly to the CREB element in the FABP4 enhancer, leading to an enhancement of the inhibitory complement complex of PPAR ⁇ 2.
- Adipocyte differentiation is a well-regulated process.
- PPAR ⁇ 2 is a major regulator of adipocyte formation and is highly expressed during adipocyte differentiation and regulates the expression of genes involved in adipocyte formation.
- the effect of sLZIP on adipocyte formation in vivo was investigated. To this end, the sLZIP gene was cloned into the pCMV-flag expression vector to produce human sLZIP transgenic mice.
- sLZIP TG mice were produced by Macrogen, Inc (Seoul, Korea) (FIG. 8A).
- Adipose progenitor cells were isolated from epididymal adipose tissue of sLZIP TG mice.
- Adipose progenitor cells were transfected with FABP4 promoter reporter gene (0.2 ⁇ g) and PPAR ⁇ 2 (0.5 ⁇ g) containing PPAR binding elements and treated with or without 10 nM RZD. Promoter activity was determined according to the luciferase assay (FIG. 8B). 293T cells were transiently transfected together with PPAR ⁇ 2 (0.5 ⁇ g), ⁇ -galactosidase (0.1 ⁇ g), FABP4 enhancer-luciferase reporter gene (0.2 ⁇ g) and mouse LZIP (0.5 ⁇ g). After transfection, cells were stimulated with 10 nM RZD (FIG. 8C).
- Luciferase activity was normalized to ⁇ -galactosidase activity and expressed as relative activity (fold change). All experiments were performed in three replicates, and the bar in the graph represents the mean ⁇ standard deviation.
- C3H10T1 / 2 and 3T3-L1 cells were changed to differentiation medium containing 10% FBS, 5 ⁇ g / mL insulin, 1 ⁇ M dexamethasone, and 0.5 mM IBMX.
- Total RNA was extracted from the cells, and mRNA expression levels of mouse LZIP were measured using RT-PCR analysis. GAPDH was used as an internal control. The experiment was performed in three replicates (FIG. 8D).
- FIG. 9A Oil-red O staining was performed on C3H10T1 / 2 and 3T3-L1 (FIG. 9A).
- Adipose progenitor cells were isolated from epididymal adipose tissue of sLZIP TG mice (FIG. 9B).
- Adipose progenitor cells isolated from epididymal adipose tissue of sLZIP TG mice were differentiated into adipocytes.
- Total RNA was isolated from the cells and mRNA expression levels of mouse LZIP were measured using RT-PCR (FIG. 9C) and real time PCR (FIG. 9D).
- mouse LZIP As a result of testing whether homologous mouse LZIP affects transcriptional activity and expression of PPAR ⁇ 2 during adipocyte formation, mouse LZIP also reduced PPAR ⁇ 2 transcriptional activity compared to the control group (FIG. 8C). Interestingly, mouse LZIP expression decreased during adipocyte differentiation (FIG. 8D).
- sLZIP functions as a negative regulator of adipocyte differentiation in vitro and in vivo by inhibiting PPAR ⁇ 2 transcriptional activity.
- the present invention can be used as a therapeutic agent for diabetes or obesity.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hematology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Cell Biology (AREA)
- General Engineering & Computer Science (AREA)
- Urology & Nephrology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Pathology (AREA)
- Rheumatology (AREA)
- Tropical Medicine & Parasitology (AREA)
- General Physics & Mathematics (AREA)
- Toxicology (AREA)
- Food Science & Technology (AREA)
- Epidemiology (AREA)
- Gastroenterology & Hepatology (AREA)
- Biophysics (AREA)
- Diabetes (AREA)
- Child & Adolescent Psychology (AREA)
Abstract
본 발명은 지방세포 분화 과정에서 인간 작은 류신 지퍼 단백질의 용도에 관한 것으로, 보다 상세하게는 sLZIP이 PPARγ2와 결합하여 HDAC3와 PPARγ2의 복합체 형성을 유도함으로써 PPARγ2의 억제보체로 작용하여 PPARγ2의 전사활성을 부정적으로 저해하고 지방세포로의 분화를 억제하여 당뇨병, 비만 등의 치료 및 치료제 신약 개발을 위한 표지자로 사용될 수 있다.
Description
본 발명은 중간엽 줄기세포의 분화 시 지방세포 분화 과정에서 인간 작은 류신 지퍼 단백질의 용도에 관한 것이다.
세포 치료는 환자의 부족한 의료 요구를 충족할 수 있는 유망한 접근 방식이다. 최근 중간엽 줄기세포가 다양한 임상 실험에 이용되고 있지만 의학적 치료를 위해서는 중간엽 줄기세포의 분화 조절과 같은 문제점을 해결해야 한다.
지방세포와 조골세포는 중간엽 줄기세포로부터 분화되며, 이러한 분화는 전사인자로부터 조절된다. 중간엽 줄기세포에서 조골세포와 지방세포의 분화 균형은 회복, 재생, 항상성 유지에 매우 중요하다. 이러한 중간엽 줄기세포 분화조절 균형의 실패는 퇴행성 관절염, 골다공증과 같은 문제를 일으킨다. PPARγ2는 중간엽 줄기세포에서 지방세포로 분화 시 발현되고 지방세포관련 유전자 발현조절에 관여한다. 또한 Runx2는 조골세포 분화 시 발현되며 조골세포 관련 유전자 발현에 관여한다. 따라서 지방세포와 조골세포 분화에서 전사인자의 조절 메커니즘 이해는 매우 중요하다.
PPARγ는 전사인자 PPAR 패밀리에 속하며, PPARα, PPARγ, PPARδ를 포함하고 있다. PPARγ는 지방생성, 지질 생합성, 염증, 포도당 대사에 주요 조절자이며, 얼터너티브 스플라이싱(alternative splicing)을 통해 PPARγ1, PPARγ2 두 가지 변이체로 생성된다. PPARγ2는 PPARγ1 보다 N-말단에 30개의 아미노산이 추가로 포함되어 있고, 주로 대식세포와 지방세포에 발현되며, 골수 기질세포에도 일부 발현된다. PPARγ1은 근육, 지방조직, 뼈 등 다양한 조직에서 발현된다. PPARγ는 peroxisome proliferator-activated response element(PPRE) DNA 서열에 결합하고 RXR과 이형 복합체를 형성한다. 이러한 요소는 지질 저장에 관련된 ap2와 콜레스테롤 수송에 관여하는 CD36 프로모터에 발견된다. PPARγ과 RXR 이형복합체는 리간드가 없을 시 HDAC과 NCoR, SMRT와 같은 억제보체와 결합하고 있으며, 리간드 결합 시 배좌 변화(conformational change)를 통해 P160/SRC, PBP, PGC-1, CBP 등과 같은 도움인자로 대체된다. 많은 전사인자와 리간드들이 PPARγ의 발현과 기능에 조절에 관여한다. C/EBP는 PPARγ 프로모터에 직접적으로 결합하여 전사를 촉진하고, 천연 PPARγ 리간드인 프로스타글란딘 J2(Prostaglandin J2)와 로시글리타존(rosiglitazone), 피오글리타존(pioglitazone)과 같은 합성시약인 TZD 역시 PPARγ 전사활성을 증가시킨다. 음성조절자로서 RB와 사이클린 D1은 PPARγ의 전사활성을 억제한다.
LZIP은 bZIP 패밀리의 구성원으로서 CREB/ATF 유전자 패밀리에 속한다. LZIP은 기본 DNA-결합 도메인(basic DNA-binding domain)과 류신지퍼 도메인을 가지고 있고, cAMP-responsive element(CRE)와 AP-1 element에 결합한다. 인간 LZIP은 HCF-1 결합 단백질로 밝혀졌으며, 세포 증식과 세포성 형질전환을 촉진한다. N-말단 92개의 아미노산은 강력한 전사활성 도메인이고 2개의 LxxLL-전사 도움인자 결합 모티프를 포함하고 있다. LZIP은 CREB3(LZIP, Luman), CREB3L1 (OASIS), CREB3L2(BBF2H7), CREB3L3(CREB-H), CREB3L4(AIbZIP) 5개의 구성원으로 되어있으며, 이들은 상동성을 가지고 있으나 전사인자의 기능은 다르다. 보고된 LZIP의 기능은 CCR1에 결합하여 Lkn-1 의존성 세포이동을 조절하고, CCR2 프로모터에 결합하며 CCR2의 발현을 조절하며, 단핵구의 이동을 증가시킨다.
최근 LZIP의 이소 폼인 small LZIP을 발견했으며, 막관통(transmembrane) 도메인부분이 없는 354 아미노산으로 구성된다. sLZIP은 LKN-1 의존성 세포 이동에 관여하지 않고 HDACs을 활성화함으로써, 글루코코티코이드 수용체(Glucocorticoid receptor)의 전사활성을 억제한다.
이에 본 발명자들은 PPARγ와 Runx2의 전사활성을 조절하는 sLZIP의 조절 메커니즘을 중간엽 줄기세포에서 조골세포와 지방세포의 분화의 관련하여 연구함으로써 본 발명을 완성하였다.
본 발명의 목적은 중간엽 줄기세포의 지방세포로의 분화에서 인간 작은 류신 지퍼 단백질(human small leucine-zipper protein, 약어로 'sLZIP'라 함)의 역할을 규명함으로써 줄기세포의 분화 조절자로서의 용도를 제공하는 것이다.
본 발명의 다른 목적은 상기 sLZIP의 당뇨병 또는 비만 예방 또는 치료적 용도를 제공하는 것이다.
본 발명의 또 다른 목적은 상기 sLZIP의 당뇨병 또는 비만의 예방 또는 치료적 의약의 스크리닝 용도를 제공하는 것이다.
상기 목적을 달성하기 위하여, 본 발명은 분화 조절제로, 인간 작은 류신 지퍼 단백질(human small leucine-zipper protein)을 포함하는 중간엽 줄기세포에서 지방세포로의 분화 억제용 조성물을 제공한다.
본 발명은 또한 인간 작은 류신 지퍼 단백질을 포함하는 당뇨병 예방 또는 치료용 조성물을 제공한다.
또한, 본 발명은 당뇨병 예방 또는 치료용 조성물의 제조를 위한 인간 작은 류신 지퍼 단백질의 용도를 제공한다.
또한, 본 발명은 약제학적 유효량의 인간 작은 류신 지퍼 단백질을 포함하는 당뇨병 예방 또는 치료용 조성물을 개체에 투여하는 단계를 포함하는 동물의 당뇨병 치료 방법을 제공한다.
본 발명은 또한 인간 작은 류신 지퍼 단백질을 포함하는 비만 예방 또는 치료용 조성물을 제공한다.
또한, 본 발명은 비만 예방 또는 치료용 조성물의 제조를 위한 인간 작은 류신 지퍼 단백질의 용도를 제공한다.
또한, 본 발명은 약제학적 유효량의 인간 작은 류신 지퍼 단백질을 포함하는 비만 예방 또는 치료용 조성물을 개체에 투여하는 단계를 포함하는 동물의 비만 치료 방법을 제공한다.
본 발명은 또한 인간 작은 류신 지퍼 단백질의 유전자를 후보물질과 인체 외에서 접촉시키고, 상기 후보물질이 상기 유전자의 발현을 촉진하는지 또는 억제하는지를 판단하는 것을 포함하는 당뇨병의 예방 또는 치료용 의약의 스크리닝 방법을 제공한다.
본 발명은 또한 인간 작은 류신 지퍼 단백질을 후보물질과 인체 외에서 접촉시키고, 상기 후보물질이 상기 단백질의 기능 또는 활성을 증진하는지 또는 억제하는지를 판단하는 것을 포함하는 당뇨병의 예방 또는 치료용 의약의 스크리닝 방법을 제공한다.
본 발명은 또한 인간 작은 류신 지퍼 단백질의 유전자를 후보물질과 인체 외에서 접촉시키고, 상기 후보물질이 상기 유전자의 발현을 촉진하는지 또는 억제하는지를 판단하는 것을 포함하는 비만의 예방 또는 치료용 의약의 스크리닝 방법을 제공한다.
본 발명은 또한 인간 작은 류신 지퍼 단백질을 후보물질과 인체 외에서 접촉시키고, 상기 후보물질이 상기 단백질의 기능 또는 활성을 증진하는지 또는 억제하는지를 판단하는 것을 포함하는 비만의 예방 또는 치료용 의약의 스크리닝 방법을 제공한다.
본 발명에 따르면, 인간 작은 류신 지퍼 단백질(sLZIP)은 PPARγ2와 결합하여 HDAC3와 PPARγ2의 복합체 형성을 유도함으로써 PPARγ2의 억제보체로 작용하여 PPARγ2의 전사활성을 부정적으로 저해하고 지방세포로의 분화를 억제함으로써 중간엽 줄기세포에서 지방세포와 조골세포의 분화 균형을 조절하는 조절자임을 제공한다.
따라서, sLZIP를 당뇨병 또는 비만 등의 치료적 용도로 사용하거나, 치료제 신약 개발을 위한 표지자로 이용될 수 있다.
도 1은 본 발명에 따른 sLZIP의 PPARγ의 전사활성에 대한 효과를 나타낸 것으로, A내지 C는 PPARγ2의 리간드인 로시글리타존(RZD)(A), 피오글리타존(PZD)(B) 및 트로글리타존(TZD)(C) 처리 시 sLZIP에 의한 PPARγ2의 전사활성을 측정한 결과이고, (D)는 si-sLZIP에 의한 PPARγ2의 전사활성을 측정한 결과이며, (E)는 sLZIP를 과발현하는 중간엽 줄기세포의 분화 시 PPARγ2의 전사활성을 측정한 결과이다.
도 2는 본 발명에 따른 sLZIP의 PPARγ의 결합능을 조사한 결과로, A 및 B는 GST-sLZIP 및 Myc-PPARγ2(A)와 GST-PPARγ2 및 Flag-sLZIP(B)로 트랜스펙션 된 293T 세포에서 sLZIP과 PPARγ2의 결합능을 조사한 결과이고, C는 항-PPARγ2와 항-His 항체를 사용하여 His-sLZIP와 PPARγ2의 결합 여부를 측정한 면역 블랏팅 결과이며, D는 C3H10T1/2 세포에서 발현된 GFP-PPARγ2 및 Flag-sLZIP의 핵 내 위치 측정 결과이다.
도 3은 본 발명에 따른 sLZIP 및 PPARγ2의 유전자 지도와 결합 부위 분석 결과로 A는 sLZIP를, B는 PPARγ2를 나타낸 것이다.
도 4는 본 발명에 따른 sLZIP에 의한 PPARγ2의 전사활성 억제에서 HDAC3의 역할 규명결과를 나타낸 것으로, A는 HDAC의 저해제인 TSA를 처리한 후 PPARγ2의 전사활성 효과를, B는 HDAC si-RNA를 통해 발현을 억제한 후 PPARγ2의 전사활성 효과를, C는 HDAC3 과발현 시 PPARγ2의 전사활성 효과를, D는 HDAC3와 sLZIP의 핵 내 위치를 측정한 결과를, E는 GST 풀-다운 분석에 따른 HDAC3와 sLZIP의 결합을 보여주는 결과이다.
도 5는 본 발명에 따른 sLZIP에 의한 PPARγ2의 억제보체 유도 결과를 나타낸 것으로, A는 PPARγ2 리간드 의존적 sLZIP과 PPARγ2의 결합을 보여주며, B는 시간대별 PPARγ2 리간드 처리에 따른 sLZIP과 PPARγ2의 결합 효과를, C는 PPARγ2 리간드 하에서 PPARγ2의 억제자인 HDAC3와 sLZIP의 결합 효과를, D는 sLZIP와 PPARγ2 및 HDAC3 복합체의 결합 효과를, E는 NCoR1 처리에 따른 sLZIP와 PPARγ2 및 HDAC3 복합체의 결합 효과를, F는 sLZIP 결실 돌연변이체를 이용하여 PPARγ2와의 리간드 의존적 결합에 대한 sLZIP의 조절 메카니즘과 관련성 조사 결과를 나타낸 것이다.
도 6은 PPARγ2 및 HDAC3 간의 결합 시 본 발명에 따른 sLZIP의 효과를 조사한 결과로, A는 PPARγ2 및 HDAC3 간의 결합 시 sLZIP의 효과를, B는 sLZIP에 의한 HDAC3의 유비퀴틴화 결과를, C는 sLZIP의 PPARγ2 도움인자에 대한 효과를 나타낸 것이다.
도 7은 FABP4 인핸서 영역에서 본 발명에 따른 sLZIP의 결합 부위를 검색한 결과로, A는 전사 요소 검색 시스템(TESS) 및 AliBaba2에 의한 FABP4 인핸서 서열을 분석한 결과이고, B는 FABP4 인핸서 영역에서 다양한 요소와 sLZIP의 DNA 결합능을 시험한 EMSA 결과이며, C 및 D는 FABP4 인핸서 영역에서 CREB 요소와 sLZIP의 특이 DNA 결합능을 확인한 슈퍼 시프트 분석 및 콜드 경쟁 분석 결과이며, E는 FABP4 인핸서-루시퍼라아제 구조물을 사용한 PPARγ2 전사활성 시험 결과이고, F는 ChIP 결과를 나타낸 것이다.
도 8은 지방세포 형성 과정에서 본 발명에 따른 sLZIP의 효과를 나타낸 것으로, A 및 B는 생체 내에서 지방세포 형성에 대한 sLZIP의 효과를, C 및 D는 상동의 마우스 LZIP의 지방세포 형성에서 전사활성과 PPARγ2 발현에 대한 효과를, E는 다능성 중간엽 전구세포에서 지방세포 분화에서 sLZIP의 효과를 나타낸다.
도 9는 생체 내에서 지방세포 분화 시 본 발명에 따른 sLZIP의 효과를 나타낸 것으로, A 및 B는 sLZIP TG 마우스의 부고환 지방조직에서 분리한 지방전구세포(A)와 마우스 배아 섬유아세포(B)에서 분화된 지방세포를 보여주며, C 및 D는 PPARγ2 표적 유전자의 mRNA 발현 수준을 RT-PCR(C) 및 실시간 PCR(D)을 사용하여 측정한 결과를 나타낸다.
도 10은 중간엽 줄기세포의 본 발명에 따른 sLZIP의 분화 조절 효과를 도시하는 모식도이다.
이하, 본 발명의 구성을 구체적으로 설명한다.
본 발명은 분화 조절제로, 인간 작은 류신 지퍼 단백질을 포함하는 중간엽 줄기세포에서 지방세포로의 분화 억제용 조성물에 관한 것이다.
본 발명자들은 중간엽 줄기세포에서 지방세포로 분화하는 과정에서 sLZIP이 PPARγ2와 결합하여 HDAC3와 PPARγ2의 복합체 형성을 유도함으로써 PPARγ2의 억제보체로 작용하여 PPARγ2의 전사활성을 부정적으로 저해하고 지방세포로의 분화를 억제하며, sLZIP 형질전환 마우스를 이용한 실험에서 sLZIP 형질전환 마우스의 지방세포 분화가 억제됨을 확인함으로써 본 발명을 완성하였다.
일반적으로, sLZIP는 LZIP의 이소 폼으로 막관통(transmembrane) 도메인부분이 없는 354 아미노산으로 구성되며, LKN-1 의존성 세포 이동에 관여하지 않고 HDACs을 활성화함으로써, 글루코코티코이드 수용체(Glucocorticoid receptor)의 전사활성을 억제하는 단백질이다.
상기 결과로부터, 본 발명은 sLZIP가 지방세포와 조골세포의 분화 균형을 조절하는 중간엽 줄기세포의 분화 조절자임을 최초로 제시하는 것이다.
본 발명의 일 구체예에 따르면, sLZIP는 농도 의존적인 방식으로 PPARγ2 전사활성을 억제한다. PPARγ2의 전사활성의 억제는 sLZIP가 PPARγ2와 직접적으로 결합함으로써 일어났다. sLZIP와 PPARγ2의 결합은 핵 내에서 이루어진다. PPARγ2와 결합하는데 필요한 sLZIP의 도메인을 조사하기 위해, 다양한 sLZIP 결실 돌연변이체들, 예컨대, N-말단 결실 돌연변이체(1-228), C-말단 결실 돌연변이체(229-354) 및 CC-말단 결실 돌연변이체(297-354)을 만들어 PPAR 결합 도메인을 분석한 결과, 야생형 sLZIP 및 sLZIP의 C 및 CC 도메인은 PPARγ2와 결합하나, sLZIP N 도메인은 PPARγ2와 결합하지 않았다. 이는 프롤린이 풍부한 영역을 포함하는 sLZIP의 CC-말단 도메인이 PPARγ2와의 결합에 중요함을 알 수 있다. 또한, sLZIP과 결합하는데 필요한 PPARγ2의 도메인을 시험한 결과, PPARγ2의 리간드 결합 도메인(AF-2)이 sLZIP과 결합하는데 필수적이었다. 상기 결과는 PPARγ2가 sLZIP과 결합하나, sLZIP의 LxxLL 모티프는 결합능에 필수적인 것은 아님을 입증한 것이다.
PPARγ의 전사활성은 도움인자와 억제보체에 의해 조절되고, 휴지기 상태에서 PPARγ2는 억제보체 복합체, 예컨대, HDAC3, SMRT 및 NCoR과 결합하는 것으로 알려져 있으므로, HDACs에 의한 PPARγ2의 전사활성에 대한 sLZIP의 효과를 조사하였다. 그 결과, HDACs 억제제가 없는 상태에서, sLZIP는 PPARγ2의 전사활성을 억제하나, HDACs 억제제가 처리된 세포에서는 sLZIP가 PPARγ2의 전사활성을 감소하지 않았다. 이러한 PPARγ2의 전사활성의 억제는 클래스 1 HDACs 중 HDAC3에만 한정된 것이었다. 또한, sLZIP는 HDAC3와 결합하였는바 sLZIP가 HDAC3와 결합하여 PPARγ2의 전사활성을 부정적으로 조절함을 알 수 있었다. 억제보체 복합체는 핵 수용체와 리간드 결합 시 도움인자에 의해 대체되므로 PPARγ2 리간드 처리에 의한 sLZIP 및 PPARγ2 간의 결합을 조사한 결과, sLZIP는 리간드가 없을 때는 PPARγ2와 결합하나, 리간드가 있는 경우에는 시간 의존적 방식으로 PPARγ2로부터 분리되었다. 다음으로, PPARγ2의 억제보체 복합체와의 결합에 대한 sLZIP의 효과를 조사한 결과, sLZIP는 PPARγ2 리간드가 없는 경우 PPARγ2 억제보체 복합체에서 HDAC3와 결합하였다. 또한, LZIP는 N-말단 활성 도메인(1-220)을 포함하고, cAMP-반응 요소(CREs)-함유 리포터 유전자의 전사활성에 관여하는 것으로 보고되어 있고, 상기 LZIP의 이소 폼인 sLZIP는 PPARγ2와 결합하고, 아마도 FABP4 프로모터 영역에 결합하여 그것의 전사활성을 조절하는 것으로 보여 이러한 조절 메카니즘을 이해하기 위해 PPARγ2 및 HDAC3 간의 결합 시 sLZIP의 효과를 조사하였다. 그 결과, sLZIP는 리간드가 있는 경우 PPARγ2 및 HDAC3 간의 결합을 향상시키나, PPARγ2는 리간드가 없는 경우 HDAC3 같은 억제보체와 결합하고, PPARγ2 리간드 첨가로 PPARγ-억제보체 복합체의 분리가 일어나 유비퀴틴/프로테오좀 경로에 의한 분해를 유도한다. 또한, sLZIP는 리간드 처리 시 HDAC3 유비퀴틴화를 억제하였다. 더욱이, sLZIP는 PPARγ2에 대한 도움인자 PGC-1α의 보충을 억제하였다. 즉, sLZIP이 PPARγ2와 결합하여 PPARγ2의 전사활성을 조절하고, 억제보체 복합체 형성을 향상시킴을 알 수 있다. FABP4 프로모터에서 sLZIP의 DNA-결합능의 조절 메카니즘을 이해하기 위해, FABP4 프로모터 영역을 분석한 결과 FABP4 인핸서 영역에서 sLZIP는 직접적으로 CREB 영역에 농도 의존적 방식으로 결합하였다. 이는 sLZIP가 FABP4 인핸서에서 CREB 요소에 직접적으로 결합하여 PPARγ2의 억제보체 복합체의 향상을 유도하는 것으로 보인다.
PPARγ2는 지방세포 형성 과정의 주요 조절자로 지방세포 분화 동안 높게 발현되며, 지방세포 형성에 관여하는 유전자들의 발현을 조절한다. 따라서, 생체 내에서 지방세포 형성에 대한 sLZIP의 효과를 조사하였다. 그 결과, sLZIP TG 마우스의 지방세포에서 PPARγ2 전사활성은 야생형(WT) 마우스 대비 sLZIP TG 마우스의 지방세포에서 감소하였다. 상동의 마우스 LZIP가 지방세포 형성 동안 전사활성과 PPARγ2의 발현에 영향을 주는지 시험한 결과, 마우스 LZIP 또한 대조군에 비해 PPARγ2 전사활성을 감소시켰다. 흥미롭게도, 마우스 LZIP 발현은 지방세포 분화 동안 감소하였다. 다능성 중간엽 전구세포에서 지방세포로의 분화에서도 sLZIP는 지방세포 분화를 억제하였다. 또한, 생체 내에서 지방세포 분화에서도 sLZIP TG 마우스에서 분리한 원발성 지방전구세포 및 마우스 배아 섬유아세포(MEFs)의 분화는 야생형 마우스 대비 억제되었다. 또한, FABP4 및 다른 PPARγ2 표적 유전자, 예컨대 C/EBPα 및 LPL의 발현 역시 하향-조절되었다.
상기 결과로부터 sLZIP가 PPARγ2 전사활성을 억제하여 시험관 내 및 생체 내에서 지방세포 분화 시 부정적인 조절자로 기능을 수행함을 알 수 있다.
본 발명의 분화 억제용 조성물은 sLZIP를 천연형 또는 재조합 sLZIP, 또는 이들과 실질적으로 동등한 생리 활성을 갖는 sLZIP를 포함할 수 있다. 상기 실질적으로 동등한 생리 활성을 갖는 단백질에는 천연형/재조합 sLZIP과 그 기능적 동등물(functional equivalent) 및 기능적 유도체(functional derivative)가 포함된다.
상기 "기능적 동등물"에는 천연형 단백질의 아미노산 중 일부 또는 전부가 치환되거나, 아미노산의 일부가 결실 또는 부가된 아미노산 서열 변형체로서 천연형 sLZIP과 실질적으로 동등한 생리활성을 갖는 것을 말한다.
"기능적 유도체"는 상기 sLZIP의 물리 화학적 성질을 증가 또는 감소시키기 위한 변형을 가한 단백질로서 천연형 sLZIP과 실질적으로 동등한 생리 활성을 갖는 것을 의미한다.
본 발명의 sLZIP는 포유동물, 바람직하게는 사람에서 기원하는 단백질이며, 예컨대, 사람 유래의 GenBank accession no. FJ263669 등으로 공지된 서열을 가진 단백질을 말한다. 보다 구체적으로, SEQ ID NO: 1에 기재된 아미노산 서열로 표시되는 것일 수 있다.
일 구체예에 따르면, 본 발명에 사용된 sLZIP는 GenBank accession no. FJ263669 등으로부터 당업자에 공지된 유전공학적 방법으로 제조할 수 있다.
천연형의 sLZIP는 유전자 재조합 방법에 의하여 단백질을 제조하는 경우 대장균이나 곤충 세포를 이용하는 것보다 포유동물 세포를 이용하는 경우가 단백질의 활성도나 용해성 측면에서 천연형의 것과 유사할 것으로 여겨진다.
상기 재조합 sLZIP는 통상의 컬럼 크로마토그래피 방법 등을 이용하여 분리할 수 있다. 또한 단백질의 정제 정도는 소듐 도데실 술페이트-폴리아크릴아마이드 젤 전기영동(SDS-PAGE) 등으로 확인할 수 있다.
본 발명의 분화 억제용 조성물은 시험관내(in vitro)에서 중간엽 줄기세포 배양 시 분화 조절 인자로 첨가될 수 있다. 예컨대, 중간엽 줄기세포의 분화 유도 배양 시 천연형 또는 재조합 sLZIP를 부가하여 이들의 양적 변화를 통해 조골세포의 수를 조절할 수 있다.
본 발명의 분화 억제용 조성물은 상기 sLZIP 외에 중간엽 줄기세포의 분화를 유도하는 공지의 분화 유도 인자를 더 포함할 수 있다. 예컨대, ciliary neurotrophic factor(CNTF), bone morphogenetic proteins(BMPs), transforming growth factor(TGFα) 또는 neuregulin-1 (Nrg1)/glial growth factor-2(GGF2) 등을 사용할 수 있다.
본 발명은 또한 인간 작은 류신 지퍼 단백질을 포함하는 골 질환 예방 또는 치료용본 발명은 또한 인간 작은 류신 지퍼 단백질을 포함하는 당뇨병 예방 또는 치료용 조성물에 관한 것이다.
또한, 본 발명은 당뇨병 예방 또는 치료용 조성물의 제조를 위한 인간 작은 류신 지퍼 단백질의 용도를 제공한다.
본 발명은 또한 인간 작은 류신 지퍼 단백질을 포함하는 비만 예방 또는 치료용 조성물에 관한 것이다.
또한, 본 발명은 비만 예방 또는 치료용 조성물의 제조를 위한 인간 작은 류신 지퍼 단백질의 용도를 제공한다.
상기 sLZIP는 중간엽 줄기세포에서 지방세포로의 분화를 억제하므로 당뇨병, 비만의 예방 또는 치료제로 사용할 수 있다.
본 발명의 당뇨병 또는 비만 예방 또는 치료용 조성물에 사용되는 sLZIP는 포유동물, 바람직하게는 사람에서 기원하는 단백질이며, 예컨대, 사람 유래의 GenBank accession no. FJ263669 등으로 공지된 서열을 가진 단백질을 말한다. 보다 구체적으로, SEQ ID NO: 1에 기재된 아미노산 서열로 표시되는 것일 수 있다.
상기 sLZIP는 천연형 또는 재조합 단백질 형태, 또는 sLZIP를 과발현하는 형질전환 줄기세포 형태로 포함될 수 있다.
상기 천연형 또는 재조합 sLZIP를 과발현하는 형질전환 줄기세포는 공지의 방법을 통해 천연형 또는 재조합 sLZIP를 발현하는 벡터를 줄기세포에 도입하여 제조된 것일 수 있다.
본 발명은 또한 약제학적 유효량의 sLZIP를 포함하는 당뇨병 예방 또는 치료용 조성물을 개체에 투여하는 단계를 포함하는 동물의 당뇨병의 치료 방법을 제공한다.
또한 본 발명은 약제학적 유효량의 sLZIP를 포함하는 비만 예방 또는 치료용 조성물을 개체에 투여하는 단계를 포함하는 동물의 비만의 치료 방법을 제공한다.
상기 당뇨병 또는 비만의 치료 방법에 사용되는 약제학적 조성물 및 투여 방법은 상기에서 설명하였으므로, 이 둘 사이에 공통된 내용은 본 명세서의 과도한 복잡성을 피하기 위하여, 그 기재를 생략한다.
한편, 상기 당뇨병 또는 비만의 예방 또는 치료용 약제학적 조성물을 투여할 수 있는 개체는 모든 동물을 포함한다. 예를 들어, 개, 고양이, 생쥐와 같은 인간을 제외한 동물일 수 있다.
또한, 본 발명의 약제학적 조성물은 약제학적으로 허용 가능한 담체를 더 포함할 수 있다.
상기 약제학적으로 허용 가능한 담체는 의약 분야에서 통상 사용되는 담체 및 비히클을 포함하며, 구체적으로 이온 교환 수지, 알루미나, 알루미늄 스테아레이트, 레시틴, 혈청 단백질(예, 사람 혈청 알부민), 완충 물질(예, 각종 인산염, 글리신, 소르브산, 칼륨 소르베이트, 포화 식물성 지방산의 부분적인 글리세라이드 혼합물), 물, 염 또는 전해질(예, 프로타민 설페이트, 인산수소이나트륨, 인산수소캄륨, 염화나트륨 및 아연 염), 교질성 실리카, 마그네슘 트리실리케이트, 폴리비닐피롤리돈, 셀룰로즈계 기질, 폴리에틸렌 글리콜, 나트륨 카르복시메틸셀룰로즈, 폴리아릴레이트, 왁스, 폴리에틸렌 글리콜 또는 양모지 등을 포함하나 이에 제한되지 않는다.
또한, 본 발명의 약제학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 유화제, 현탁제, 또는 보존제 등을 추가로 포함할 수 있다.
한 양태로서, 본 발명에 따른 조성물은 비경구 투여를 위한 수용성 용액으로 제조할 수 있으며, 바람직하게는 한스 용액(Hank's solution), 링거 용액(Ringer's solution) 또는 물리적으로 완충된 염수와 같은 완충 용액을 사용할 수 있다. 수용성 주입(injection) 현탁액은 소듐 카르복시메틸셀룰로오스, 솔비톨 또는 덱스트란과 같이 현탁액의 점도를 증가시킬 수 있는 기질을 첨가할 수 있다.
본 발명의 약제학적 조성물은 전신계 또는 국소적으로 투여될 수 있으며, 이러한 투여를 위해 공지의 기술로 적합한 제형으로 제제화될 수 있다. 예를 들어, 경구 투여 시에는 불활성 희석제 또는 식용 담체와 혼합하거나, 경질 또는 연질 젤라틴 캡슐에 밀봉되거나 또는 정제로 압형하여 투여할 수 있다. 경구 투여용의 경우, 활성 화합물은 부형제와 혼합되어 섭취형 정제, 협측 정제, 트로키, 캡슐, 엘릭시르, 서스펜션, 시럽, 웨이퍼 등의 형태로 사용될 수 있다.
주사용, 비경구 투여용 등의 각종 제형은 당해 기술 분야 공지된 기법 또는 통용되는 기법에 따라 제조할 수 있다. sLZIP는 식염수 또는 완충액에 잘 용해되므로 냉동 건조 상태로 보관한 후, 유효량의 sLZIP을 정맥내 주입, 피하 주입, 근육 주입, 복강 주입, 경피 투여 등에 적합한 형태로 식염수 또는 완충액에 투여 직전에 용액으로 제제화하여 투여할 수도 있다.
본 발명의 약제학적 조성물의 유효성분의 유효량은 질환의 예방, 억제 또는 경감 효과를 이루는데 요구되는 양을 의미한다.
따라서, 질환의 종류, 질환의 중증도, 조성물에 함유된 유효 성분 및 다른 성분의 종류 및 함량, 제형의 종류 및 환자의 연령, 체중, 일반 건강 상태, 성별 및 식이, 투여 시간, 투여 경로 및 조성물의 분비율, 치료 기간, 동시 사용되는 약물을 비롯한 다양한 인자에 따라 조절될 수 있다. 이에 제한되는 것은 아니나, 예컨대, 본 발명의 sLZIP는 1일 1회 내지 수회 투여 시, 성인의 경우 0.1ng/kg 내지 10g/kg의 용량으로 투여할 수 있다.
본 발명은 또한 인간 작은 류신 지퍼 단백질의 유전자를 후보물질과 인체 외에서 접촉시키고, 상기 후보물질이 상기 유전자의 발현을 촉진하는지 또는 억제하는지를 판단하는 것을 포함하는 당뇨병의 예방 또는 치료용 의약의 스크리닝 방법에 관한 것이다.
본 발명은 또한 인간 작은 류신 지퍼 단백질을 후보물질과 인체 외에서 접촉시키고, 상기 후보물질이 상기 단백질의 기능 또는 활성을 증진하는지 또는 억제하는지를 판단하는 것을 포함하는 당뇨병의 예방 또는 치료용 의약의 스크리닝 방법을 제공한다.
본 발명은 또한 인간 작은 류신 지퍼 단백질의 유전자를 후보물질과 인체 외에서 접촉시키고, 상기 후보물질이 상기 유전자의 발현을 촉진하는지 또는 억제하는지를 판단하는 것을 포함하는 비만의 예방 또는 치료용 의약의 스크리닝 방법에 관한 것이다.
본 발명은 또한 인간 작은 류신 지퍼 단백질을 후보물질과 인체 외에서 접촉시키고, 상기 후보물질이 상기 단백질의 기능 또는 활성을 증진하는지 또는 억제하는지를 판단하는 것을 포함하는 비만의 예방 또는 치료용 의약의 스크리닝 방법을 제공한다.
본 발명의 스크리닝 방법에 따르면, 먼저 상기 유전자 또는 단백질을 포함하는 당뇨병 또는 비만세포에 분석하고자 하는 후보물질을 접촉시킬 수 있다.
상기 후보물질은 통상적인 선정방식에 따라 sLZIP 유전자 염기서열에서 mRNA, 단백질로의 전사, 번역을 촉진하거나 억제하는 물질 또는 sLZIP 단백질의 기능 또는 활성을 증진하거나 억제하는 의약으로서의 가능성을 지닌 것으로 추정되거나 또는 무작위적으로 선정된 개별적인 핵산, 단백질, 펩타이드, 기타 추출물 또는 천연물, 화합물 등이 될 수 있다.
이후, 후보물질이 처리된 세포에서 상기 유전자의 발현양, 단백질의 양 또는 단백질의 활성을 측정할 수 있으며, 측정 결과, 상기 유전자의 발현양, 단백질의 양 또는 단백질의 활성이 증가 또는 감소되는 것이 측정되면 상기 후보물질은 당뇨병 또는 비만을 예방 또는 치료할 수 있는 물질로 판단할 수 있다.
상기에서 유전자의 발현양, 단백질의 양 또는 단백질의 활성을 측정하는 방법은 당업계에 공지된 다양한 방법을 통해 수행될 수 있는데, 예를 들면, 이에 제한되지는 않으나, 역전사 중합효소 연쇄반응(reverse transcriptase-polymerase chain reaction), 실시간 중합효소 연쇄반응(real time-polymerase chain reaction), 웨스턴 블럿, 노던 블럿, ELISA(enzyme linked immunosorbent assay), 방사선면역분석(RIA: radioimmunoassay), 방사 면역 확산법(radioimmunodiffusion) 및 면역침전분석법(immunoprecipitation assay) 등을 이용하여 수행할 수 있다.
본 발명의 스크리닝 방법을 통해 얻은, 유전자 발현을 증진시키거나 단백질의 기능을 증진시키는 활성을 나타내는 후보물질이 당뇨병 또는 비만 치료제 후보물질이 될 수 있다.
이와 같은 당뇨병 또는 비만 치료제 후보물질은 이후의 당뇨병 또는 비만 치료제 개발과정에서 선도물질(leading compound)로서 작용하게 되며, 선도물질이 sLZIP 유전자 또는 그로부터 발현되는 단백질의 기능을 촉진 또는 억제효과를 나타낼 수 있도록 그 구조를 변형시키고 최적화함으로써, 새로운 당뇨병 또는 비만 치료제를 개발할 수 있다.
이하, 본 발명을 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.
<제조예>
Dulbecco's modified Eagle's medium(DMEM)는 GIBCO technologies, Inc(Gaithersburg)에서 구입하였고, 우태아혈청은 HyClone Laboratory(Logan, UT)에서 구입하였다. 항-PPARγ2, 항-HDAC1, 2, 3, 4, 6, 8 및 9, 항-β-액틴 및 항-GST 항체는 Santa Cruz Biotechnology(Santa Cruz, CA)에서 구입하였다. 항-마우스 및 항-토끼 페록시다아제 결합된 2차 항체는 Pierce(Madison, WI)에서 구입하였다. 인슐린 및 메틸이소부틸크산틴(methylisobutylxanthine, IBMX)은 Sigma(St. Louis, MO)에서 구입하였다.
(세포배양 및 분화)
사람의 원발성 중간엽 줄기세포(MSCs), C3H10T1/2, 293T 및 MEF 세포는 열로 불활성화시킨 10% FBS와 페니실린(100U/mL)/스트렙토마이신(100㎍/mL)이 첨가된 DMEM에서 배양하였다. 원발성 지방세포(Primary adipocytes)는 콜라게나아제 절단에 의해 sLZIP 형질전환 마우스의 부고환 지방조직(epididymal fat pads)에서 분리되었고, 3T3-L1 세포는 10% 소혈청 및 페니실린(100U/mL)/스트렙토마이신(100㎍/mL)이 첨가된 DMEM에서 유지시켰다.
모든 세포 타입들은 CO2%를 포함하는 습식 배양기에서 37℃ 온도 조건에서 배양하였다. 지방세포 분화를 유도하기 위해, C3H10T1/2 및 3T3-L1 세포, 원발성 지방전구세포, 및 MEF 세포를 컨플루언스까지 키우고 나서, 10% FBS, 5㎍/mL의 인슐린, 1μM의 덱사메타손(dexamethasone) 및 0.5mM IBMX를 포함하는 DMEM으로 배지를 바꿔주었다.
(일시적 발현 및 바이러스 감염)
C3H10T1/2 및 293T 세포를 2×105 세포/웰의 밀도로 12-웰 배양 접시에 플레이팅하였다. 24시간 동안 인큐베이션한 후, 제조업체의 설명서에 따라 리포펙타민 2000 또는 진펙틴(Genefectine)을 이용하여 0.2㎍의 리포터 유전자와 0.1~0.5㎍의 실험용 플라스미드로 세포를 트렌스펙션 시켰다. 24시간 후, 10nM 로시글리타존(rosiglitazone)이 있거나 없이 무혈청 DMEM에서 세포를 배양하였다. sLZIP 및 HDAC 표적 서열을 이용하여 siRNAs를 만들었다(표 1). RNA 간섭 실험을 위해, 제조업체의 설명서에 따라 리포펙타민 2000을 이용하여 뒤섞인 대조군 RNA 및 적당한 siRNAs로 세포를 트랜스펙션 시켰다. 사람 MSC 및 C3H10T/1/2 세포는 사람 sLZIP에 대한 cDNA를 포함하는 아데노바이러스 벡터 또는 빈 벡터로 감염시켰다. 2시간 후 감염 배지를 신선 배지로 바꿔주었다.
표 1
| siRNA 서열(+dTdT) | ||
| Forward | reverse | |
| 대조군 | CCUACGCCACCAAUUUGGU(SEQ ID NO:3) | ACGAAAUUGGUGGCGUAGG(SEQ ID NO:4) |
| sLZIP | GGACCCAGAUGACUCCACAGCAUAU(SEQ ID NO:5) | AUAUGCUGUGGAGUCAUCUGGGUCC(SEQ ID NO:6) |
| HDAC1 | CGACUGUUUGAGAACCUUA(SEQ ID NO:7) | UAAGGUUCUCAAACAGUCGCU(SEQ ID NO:8) |
| HDAC2 | GGUCAAUAAGACCAGAUAA(SEQ ID NO:9) | UUAUCUGGUCUUAUUGACCG(SEQ ID NO:10) |
| HDAC3 | GCCGGUUAUCAACCAGGUA(SEQ ID NO:11) | UACCUGGUUGAUAACCGGC(SEQ ID NO:12) |
| HDAC8 | CAUUCAGGAUGGCAUACAA(SEQ ID NO:13) | UUGUAUGCCAUCCUGAAUGGG(SEQ ID NO:14) |
(반-정량적 RT-PCR 및 실시간 PCR)
제조업체의 설명서에 따라 TRIzol 시약(Invitrogen, Carlsbad, CA)을 부가하여 배양 접시에서 세포를 직접적으로 용해시켰다. Accupower RT PreMix(BioNeer, Daejeon, Korea)를 사용하여 2㎍의 총 RNA로부터 cDNA를 합성하였다. 반응은 42℃에서 60분 동안 그리고 94℃에서 5분간 시행하였다. PCR 증폭은 표 2에 나열된 올리고머를 이용하여 Hipi PCR Mix Kit(ELPIS)를 사용하여 수행하였다. 내부 대조군으로서 GAPDH를 증폭하였다. PCR 산물은 0.5㎍/mL 에티디움 브로마이드를 포함하는 1-2% (w/v) 아가로오스 젤에서 전기영동을 하고, 1 kb DNA 래더 마커(Invitrogen)와 비교하여 PCR 산물의 크기를 측정하였다. RT-PCR에 따라 증폭된 각 밴드의 강도는 MultiImageTM Light Cabinet(version 5.5, Alpha Innotech Corp., San Leandro, CA)를 사용하여 분석하였다.
실시간 PCR은 SYBR 그린 마스터 믹스(Roche, Mannheim, Germany)를 사용하여 LightCycler 480에서 수행하였다. β-액틴은 내부 대조군으로 사용하였다. β-액틴에 대한 표적 유전자 발현 수준 비율은 CT 방법을 사용하여 계산하였고, 상기 CT 값은 형광 신호가 표적의 고정된 한계 비율에 도달하는 PCR 사이클의 횟수로 정의한다. 각 실험은 실험마다 3회 기술적 반복으로 3반복 실험을 수행하였다.
표 2
| 반-정량적 RT-PCR용 프라이머 서열 | ||
| Forward | reverse | |
| sLZIP | AGCAGCAGCATGTACTCCTCT(SEQ ID NO:15) | CTAGCCTGAGTATCTGTCCT(SEQ ID NO:16) |
| GAPDH | CCATCACCATCTTCCAGGAG(SEQ ID NO:17) | CCAGGAAATCATGTGCAATC(SEQ ID NO:18) |
| FABP4 | GTG GGA ACC TGG AAG CTT GTC(SEQ ID NO:19) | CTT CAC CTT CCT GTC GTC TGC(SEQ ID NO:20) |
| mLZIP | ATGGATCCTGGTGGTCAG(SEQ ID NO:21) | CT AAC CTG AAT ACC TGC C(SEQ ID NO:22) |
| PPARγ2 | AT GGG TGA AAC TCT GGG AGA(SEQ ID NO:23) | CT AAT ACA AGT CCT TGT AGA(SEQ ID NO:24) |
| TG micegenotype | GGACGATGATGACAAGGACT(SEQ ID NO:25) | GTCAGAGGAGTACATGCTGCT(SEQ ID NO:26) |
표 3
| 실시간 RT-PCR용 프라이머 서열 | ||
| Forward | reverse | |
| FABP4 | CATCAGCGTAAATGGGGATT(SEQ ID NO:27) | TCGACTTTCCATCCCACTTC(SEQ ID NO:28) |
| C/EBPα | TGGACAAGAACAGCAACGAG(SEQ ID NO:29) | TCACTGGTCAACTCCAGCAC(SEQ ID NO:30) |
| LPL | GGGCTCTGCCTGAGTTGTAG(SEQ ID NO:31) | CCATCCTCAGTCCCAGAAAA(SEQ ID NO:32) |
| Sox9 | CTGAAGGGCTACGACTGGAC(SEQ ID NO:33) | TACTGGTCTGCCAGCTTCCT(SEQ ID NO:34) |
| Col2A1 | GCCAAGACCTGAAACTCTGC(SEQ ID NO:35) | GCCATAGCTGAAGTGGAAGC(SEQ ID NO:36) |
| OSCAR | CACACACACCTGGCACCTAC(SEQ ID NO:37) | GAGACCATCAAAGGCAGAGC(SEQ ID NO:38) |
| CTSK | CCAGTGGGAGCTATGGAAGA(SEQ ID NO:39) | AAGTGGTTCATGGCCAGTTC(SEQ ID NO:40) |
| TARP | TCCTGGCTCAAAAAGCAGTT(SEQ ID NO:41) | ACATAGCCCACACCGTTCTC(SEQ ID NO:42) |
| TG mice sLZIP | TCGATTCCAGGCTTATGGAG(SEQ ID NO:43) | AGTCGCTCGGTACCTCAGAA(SEQ ID NO:44) |
| hGAPDH | GACAAGCTTCCCGTTCTCAG(SEQ ID NO:45) | GAGTCAACGGATTTGGTCGT(SEQ ID NO:46) |
| mGAPDH | ACCCAGAAGACTGTGGATGG(SEQ ID NO:47) | CACATTGGGGGTAGGAACAC(SEQ ID NO:48) |
(웨스턴 블랏 분석)
세포를 수득하고, 차가운 PBS로 2회 세척하였다. RIPA 버퍼(10mM HEPES, 10mM NaCl, 0.1mM EDTA, 0.1mM EGTA, 1% NP-40, 0.5mM PMSF, 0.1mM DTT, 0.1mM Na3VO4, 및 프로테아제 억제제)을 사용하여 세포 추출물을 준비하였다. 현탁액은 4℃에서 16,000×g, 20분간 원심분리 하였다. 상등액을 모아 샘플 버퍼와 혼합하였다. 단백질 샘플은 SDS-PAGE(8-15%)에서 분리하고, 니트로셀룰로오스 멤브레인으로 옮겼다. 멤브레인과 적당한 항체를 4℃에서 오버나이트 동안 인큐베이션 하였다. 그 후 각 면역 블랏은 서양고추냉이의 페록시다아제 표지된 2차 항체에서 인큐베이션 하였다. 면역 표지된 단백질은 ECL 분석(Amersham)을 사용하여 관찰하였고, X-선 필름을 사용하여 ECL 반응을 현상하였다. 상기 블랏을 벗긴 후 항-β-액틴을 다시 반응시켜 내부 대조군으로 사용하였다.
(루시퍼라아제 리포터 유전자 활성 분석)
적절히 트랜스펙션 된 세포를 차가운 PBS로 2회 세척하고, 리포터 라이시스 버퍼(Promega)를 사용하여 배양 접시에서 용해시켰다. 루시퍼라아제 분석은 루시퍼라아제 분석 시스템(Promega Corporation, Madison, WI)을 사용하여 수행하였다. 루시퍼라아제 활성은 제조업체의 설명서에 따라 Luminometer 20/20n(Turner BioSystems, Sunnyvale, CA)에서 기록하였다. 루시퍼라아제 활성은 β-갈락토시다아제 활성으로 표준화하였다. β-갈락토시다아제 분석을 위해, CMV-β-갈락토시다아제를 루시퍼라아제 리포터 유전자와 함께 트랜스펙션 시켰다. 모든 데이터는 적어도 3회 독립 실험에서 평균±표준편차로 나타내었다.
(전기영동상 변화 분석, EMSA)
T4 폴리뉴클레오티드 키나아제(Promega, Madison, WI)를 사용하여 올리고뉴클레오티드의 5'-말단을 [γ-32P]ATP(Perkin Elmer, Waltham, MA)로 표지하였다. 결합되지 않은 뉴클레오티드는 제조업체의 설명서에 기재된 대로 Bio-Gel P-6 스핀 컬럼(Bio-Rad, Inc., Hercules, CA)에서 관을 통해 제거하였다. His-sLZIP 단백질을 5×바인딩 버퍼[10×GRAB, 20mM DTT, Poly(deoxyinosinic-deoxycytidylic), Sigma, St. Louis]와 방사성 표지된 프로브에서 실온에서 20분간 미리 인큐베이션 하고 나서, 각 반응 혼합물을 4% 비변성 폴리아크릴아마이드 젤의 웰에 로딩하고 0.5×TBE 버퍼에서 180 V로 45분간 전기영동 하였다. 경쟁 실험을 위해, 결합 반응은 방사성 표지된 올리고뉴클레오티드의 첨가 전에 표지되지 않은 CREB 결합 올리고뉴클레오티드의 100배 몰 과량과 함께 30분간 인큐베이션하였다. 슈퍼 시프트 분석을 위해, 항-His 항체를 얼음 위에서 추가 30분 동안 반응 혼합물에 부가하였다. EMSA에 사용된 프로브는 표 4에 나열하였다.
표 4
| EMSA 프로브 서열 | ||
| #1 C/EBPβ | GAATTCCAGCAGGAATCAGG(SEQ ID NO:49) | CCTGATTCCTGCTGGAATTC(SEQ ID NO:50) |
| #2 CREB/AP-1 | GAAGGGATTGATGTCAGCAGGA(SEQ ID NO:51) | TCCTGCTGACATCAATCCCTTC(SEQ ID NO:52) |
| #3 AP-1 | GCAGGAGTCACCACCCAGAG(SEQ ID NO:53) | CTCTGGGTGGTGACTCCTGC(SEQ ID NO:54) |
| #4 C/EBPβ | ATGGAGTTCCCAGATGCCTG(SEQ ID NO:55) | CAGGCATCTGGGAACTCCAT(SEQ ID NO:56) |
| #5 AP-1 | GTGGAAGTGTCACAGCCCAA(SEQ ID NO:57) | TTGGGCTGTGACACTTCCAC(SEQ ID NO:58) |
| #6 C/EBPβ | TCTCTCTCTTGCTAAACCTCC(SEQ ID NO:59) | GGAGGTTTAGCAAGAGAGAGA(SEQ ID NO:60) |
| #7 C/EBPβ | GGTTTCATTTCTGAATCATCTACT(SEQ ID NO:61) | AGTAGATGATTCAGAAATGAAAC(SEQ ID NO:62) |
| CREBMutant | GAAGGGATTGGGGTCAGCAGG A(SEQ ID NO:63) | TCCTGCTGACCCCAATCCCTTC(SEQ ID NO:64) |
(크로마틴 면역침전 분석)
100-mm 배양 접시에서 키운 C3H10T1/2 세포를 아데노바이러스 HA-sLZIP으로 감염시켰다. 감염 후, 세포는 100% 컨플루언스에 도달할 때까지 생장 배지에 유지시키고, 분화 배지로 바꿔주었다. 1×PBS로 세포를 세척하고, 실온에서 배지에 10분 동안 1% 포름알데히드를 처리한 후 0.125M의 최종 농도로 글리신을 5분 동안 부가하였다. PBS로 세포를 스트랩하고, 4℃에서 1000×g로 5분간 원심분리 하였다. ChIP 분석은 항-HA 항체와 내부 대조군으로 항-토끼 IgG를 사용하여 DNA-단백질 복합체와 함께 침전시켜 수행하였다. 상기 준비된 DNA로부터 한 기능적 CREs를 포함하는 FABP4의 인핸서 영역을 증폭하였다.
(공-면역침전 분석)
293T 세포를 수득하고, 차가운 PBS로 세척하였다. IP 라이시스 버퍼[25mM Tris-HCl(pH 7.4), 150mM NaCl, 1mM EDTA, 1% NP-40 및 5% 글리세롤, 및 프로테아제 억제제]에서 세포를 재현탁하였다. 현탁액을 4℃에서 16,000×g으로 20분간 원심분리 하였다. 상등액을 수집하고, 0.5㎍의 적당한 항체 및 25㎕의 단백질 A/G-아가로오스 또는 GST Sepharose 4B 비드와 4℃에서 24시간 동안 인큐베이션 하였다. 단백질 복합체는 차가운 IP 라이시스 버퍼로 1,000×g로 1분간 원심분리 하여 5회 세척하였다. 최종 펠렛은 5% β-머캅토에탄올을 포함하는 50㎕의 SDS-샘플 버퍼로 재현탁하고, 100℃에서 10분간 끓였다. 단백질 샘플을 SDS-PAGE(8-10%)에서 분리하고, 니트로셀룰로오스 멤브레인으로 옮겼다. 함께 침전된 단백질은 특이 항체를 사용하여 웨스턴 블랏팅에 따라 검출하였다.
(형광 현미경 분석)
C3H10T1/2 세포는 Flag-sLZIP, GFP-PPARγ2 또는 GFP-sLZIP으로 일시적으로 함께 트랜스펙션 시키고, HDAC3는 커버 슬립에서 배양하였다. 24시간 후, 4% 파라포름알데히드로 10분간 세포를 고정하고, 0.2% Triton-X 100로 5분간 침투시켰다. 세포는 1% BSA와 1시간 동안 인큐베이션 하고 나서, 항-Flag 및 항-HDAC3 항체들과 4℃에서 오버나이트 동안 인큐베이션 하였다. PBS로 세척한 후, 세포를 텍사스 레드가 결합된 항체와 2시간 동안 인큐베이션 하였다. PBS로 커버 슬라이드를 세척하고, 장착하고, LSM 510 META 공초점 현미경(Carl Zeiss, Jena, Germany)를 사용하여 시험하였다.
(His-sLZIP 단백질의 정제)
sLZIP는 pET-28a(+) 벡터에 클로닝하였다. His-sLZIP 단백질은 T7 isopropyl-β-D-thiogalactopyranoside(IPTG)-유도 시스템을 사용하여 대장균(Escherichia coli BL21) 세포에서 발현하였다. IPTG-유도된 세포는 초음파 처리에 따라 파쇄하고, 세포 용해물은 원심분리 하여 맑게 하였다. His-sLZIP 단백질을 니켈-니트릴로트리아세트산 비드 컬럼(Bio-Rad, Richmond, CA)에 넣었다. 다량의 라이시스 버퍼와 10mM 이미다졸로 상기 컬럼을 세척하고 나서, Ni-NTA 용출 버퍼(Bio-Rad Laboratories, Hercules, CA)에서 용출하였다. His-sLZIP 단백질을 포함하는 분획을 10% 글리세롤에 대해 투석시키고, -80℃에서 저장하였다. 단백질 정제는 10% SDS-PAGE/쿠마시 블루 염색에 따라 평가하였고, 보통 >98%의 순도를 나타내었다.
(sLZIP 형질전환 마우스 생산)
사람의 sLZIP 형질전환(TG) 마우스를 생산하기 위해, sLZIP 유전자를 pCMV-flag 발현 벡터에 클로닝하였다. sLZIP TG 마우스는 Macrogen, Inc(Seoul, Korea)에서 생산하였다. 형질전환 창시자(Transgenic founders)를 야생형 C57BL/6 마우스와 교미시켜 F1 이형접합체(heterozygote)를 생산하였다. F1-F4 세대는 2주령째에 트랜스유전자에 대해 유전학적으로 스크리닝 하였다. 하기 2개의 프라이머는 야생형과 TG 마우스를 동정하기 위한 게놈 DNA를 증폭하는데 사용하였다: 5'- GGA CGA TGA TGA CAA GGA CT -3' 및 5'- GTC AGA GGA GTA CAT GCT GCT -3'.
(통계 분석)
데이터는 평균±표준편차로 나타내었다. 통계 평가는 one-way ANOVA를 사용하여 시행하였다. 데이터는 p<0.05일 때 통계적으로 유의한 것으로 간주하였다. 모든 통계 분석은 컴퓨터 프로그램 Prism(GraphPad Software, La Jolla, CA)에 따라 수행하였다.
<실시예 1> sLZIP의 PPARγ 전사활성에 대한 효과
핵 수용체 PPARγ는 MSCs에서 지방세포 분화의 중요한 양성 조절자로, 조골세포 발생에서는 음성 조절자로 작용한다. 선행 연구에서, sLZIP는 많은 종류의 핵 수용체 전사활성, 예컨대, GR, 에스트로겐 수용체(ER) 및 안드로겐 수용체(AR)에 관련되어 있는 것으로 알려져 있다. 또한, 사람의 sLZIP는 핵 수용체들과 결합하기 위한 필수적이고 충분한 2개의 LxxLL 모티프를 포함한다. 따라서, 본 발명자들은 sLZIP 및 PPARγ2 간의 관계에 초점을 맞추었다.
PPARγ2의 전사활성에 대한 sLZIP의 효과를 조사하기 위해, 293T 세포를 PPARγ2(0.5㎍), β-갈락토시다아제(0.1㎍), FABP4-Luc 리포터 유전자(0.2㎍) 및 함량 별 sLZIP(0.1-0.5㎍)으로 일시적으로 함께 트랜스펙션 시켰다. 트랜스펙션 후, 10nM의 로시글리타존(RZD)(도 1A), 피오글리타존(PZD)(도 1B), 및 트로글리타존(TZD)(도 1C)이 있거나 없는 상태에서 세포를 자극하였다. 트랜스펙션 24시간 후, 세포에 리간드 처리하거나 그렇지 않고, 루시퍼라아제 상대 활성을 분석하였다. 또한, 293T 세포를 함량별로 si-sLZIP(50 및 100nM)로 일시적으로 트랜스펙션 하고, 세포에 RZD(도 1D)를 처리하거나 그렇지 않았다. FABP4-Luc 안정한 C3H10T1/2 세포를 sLZIP 발현 아데노바이러스로 감염시킨 후 4일 동안 지방세포로 분화시켰다(도 1E). 루시퍼라아제 활성은 β-갈락토시다아제 활성에 대해 표준화하였고, 상대 활성(배수 변화)으로 표시하였다. 모든 실험은 3반복으로 수행하였고, 그래프 내 막대 표시는 평균±표준편차를 나타낸다. *, P<0.05; **, P<0.01
도 1A 내지 C에 나타난 바와 같이, sLZIP는 농도 의존적인 방식으로 PPARγ2의 전사활성을 억제하였다. PPARγ2의 전사활성은 대조군과 비교하여 다양한 PPARγ2 리간드 유무에 따라 sLZIP에 의해 하향-조절되었다.
PPARγ2의 전사활성에 대한 sLZIP의 효과를 확인하기 위해, sLZIP에 대한 siRNA(si-sLZIP)를 사용하여 sLZIP 발현을 넉다운 시킨 결과, si-sLZIP에 의한 sLZIP 발현 억제는 PPARγ2의 전사활성을 향상시켰다(도 1D).
또한, 세포 내 PPARγ2의 전사활성이 sLZIP에 의해 조절되는지를 조사하기 위해, FABP4 리포터 유전자를 안정하게 발현하는 C3H10T1/2 세포를 sLZIP 발현 아데노바이러스로 감염시키고 나서, 지방세포로 분화시킨 결과, 도 1E에 나타난 바와 같이, PPARγ2의 전사활성은 지방세포에서 sLZIP에 의해 감소하였다.
<실시예 2> sLZIP 및 PPARγ2의 결합능 조사
PPARγ2의 전사활성이 sLZIP와의 결합에 의해 조절되는지를 조사하기 위해, sLZIP와 PPARγ2의 결합을 시험하였다. 이를 위해, GST-sLZIP 및 Myc-PPARγ2를 293T 세포에 트랜스펙션 시켰다. 세포 용해물을 수득하고, 글루타티온 4B 비드를 사용하여 GST 풀-다운 분석을 수행하였다. 단백질 복합체는 SDS-PAGE로 분석하고 나서 특정 항체(도 2A)를 사용하여 면역 블랏팅을 수행하였다. 293T세포를 GST-PPARγ2 및 Flag-sLZIP로 트랜스펙션 시키고, GST-풀 다운 분석에 따라 확인하였다(도 2B). PPARγ2는 TNT 번역 시스템(Promega)에 의해 시험관 내에서 번역되었고, His-sLZIP 단백질은 IPTG-유도 시스템을 사용하여 BL21 세포에서 발현되었다. 정제된 His-sLZIP 단백질은 His 풀-다운 분석을 실시하였다. 비드에 결합된 단백질은 SDS-PAGE에서 분석하고 나서 항- PPARγ2, 항-His 항체를 사용하여 면역 블랏팅 하였다(도 2C). GFP-PPARγ2 및 Flag-sLZIP 구조물은 C3H10T1/2 세포에서 발현되었고, 마우스 항-Flag 및 텍사스 레드 결합된 항-마우스 항체를 사용하여 형광 현미경에서 분석하였다. 핵은 DAPI로 염색하였다(도 2D).
도 2A에 나타난 바와 같이, sLZIP는 PPARγ2와 결합하였다.
상기 결합을 확인하기 위하여 GST-PPARγ2와 Flag-sLZIP를 293T 세포에 트랜스펙션 시키고, GST 풀-다운 분석을 수행한 결과 PPARγ2는 sLZIP과 결합하였다(도 2B).
sLZIP가 직접적으로 PPARγ2와 결합하는지를 시험한 결과, 도 2C에 나타난 바와 같이, PPARγ2는 직접적으로 sLZIP에 결합하였다.
또한, sLZIP와 PPARγ2 간의 결합을 특성 규명하기 위해, sLZIP와 PPARγ2의 세포 내 위치를 시험하였다. sLZIP는 PPARγ2와 함께 핵에 위치하였다(도 2D).
상기 결과로부터 sLZIP가 PPARγ2와의 직접 결합을 통해 PPARγ2의 전사활성을 부정적으로 조절함을 알 수 있었다.
많은 핵 수용체들의 활성화는 도움인자들의 보충에 달려있다. 따라서, PPARγ2와 결합하는데 필요한 sLZIP의 도메인을 조사하였다. 이를 위해, GST-전장 sLZIP (1-354), N-말단 결실 돌연변이체 sLZIP(1-228), C-말단 결실 돌연변이체 sLZIP(229-354), CC-말단 결실 돌연변이체 sLZIP(297-354) 및 PPARγ2를 293T 세포에 트랜스펙션 시켰다. 세포 용해물을 수득하고, 글루타티온 4B 비드를 사용하여 GST 풀-다운 분석을 수행하였다. 단백질 복합체는 SDS-PAGE에서 분석하고 나서, 특정 항체를 사용하여 면역 블랏팅을 하였다(도 3A). 293T 세포를 Flag-전장 PPARγ2, 전장 PPARγ2, N-말단 결실 돌연변이체 PPARγ2(1-310), C-말단 결실 돌연변이체 PPARγ2(139-505) 및 GST-sLZIP으로 트랜스펙션 시켰다. 세포 용해물을 수득하고, GST 풀-다운 분석을 수행하였다. 단백질 복합체는 SDS-PAGE에서 분석하고 나서, 항-GST 및 항-Flag 항체를 사용하여 면역 블랏팅을 하였다(도 3B).
도 3A에 나타난 바와 같이, 야생형 sLZIP 및 sLZIP의 C 및 CC 도메인은 PPARγ2와 결합하나, sLZIP N 도메인은 PPARγ2와 결합하지 않았다. 이는 프롤린이 풍부한 영역을 포함하는 sLZIP의 CC-말단 도메인이 PPARγ2와의 결합에 중요함을 알 수 있다.
또한, sLZIP과 결합하는데 필요한 PPARγ2의 도메인을 시험한 결과, 도 3B에 나타난 바와 같이, PPARγ2의 리간드 결합 도메인(AF-2)이 sLZIP과 결합하는데 필수적이었다.
즉, PPARγ2가 sLZIP과 결합하나, sLZIP의 LxxLL 모티프는 결합능에 필수적인 것은 아님을 입증한 것이다.
<실시예 3> sLZIP에 의한 PPARγ2 전사활성 억제에서 HDAC3의 역할 규명
PPARγ의 전사활성은 도움인자와 억제보체에 의해 조절된다. 일반적으로, 휴지기 상태에서 PPARγ2는 억제보체 복합체, 예컨대, HDAC3, SMRT 및 NCoR과 결합하는 것으로 생각된다. 그러나, 리간드에 의한 활성화 시 억제보체 복합체는 도움인자, 예컨대, p300/CBP, p160, 및 PGC-1으로 대체되어, 표적 유전자의 전사 개시를 이끈다. 선행 연구에서 sLZIP는 HDACs를 모집 및 활성화하여 GR 전사활성을 감소시킴을 보여준바 있다. HDAC3는 또한 모든 클래스 1 HDACs 중에서 LZIP와 특이적으로 결합한다. 따라서, HDACs에 의한 PPARγ2 전사활성에 대한 sLZIP의 효과를 이해하기 위해, HDACs 억제제인 트리코스테인 A(trichostain A, TSA)를 사용하여 HDACs가 sLZIP에 의한 PPARγ2 전사활성 억제에 관여하는 지를 시험하였다.
이를 위해, 293T 세포를 PPARγ2(0.5㎍), β-갈락토시다아제(0.1㎍), FABP4-Luc 리포터 유전자(0.2㎍) 및 sLZIP(0.1㎍)으로 함께 일시적으로 트랜스펙션 시켰다. 트랜스펙션 후, 10nM의 RZD 및 10nM의 TSA 유무 하에서 세포를 자극하였다(도 4A). 프로모터 활성은 루시퍼라아제 분석에 따라 측정하였다. 293T 세포에서 FABP4-Luc 리포터 유전자, sLZIP, PPAR, β-갈락토시다아제, 및 대조군에 대한 100nM의 si-RNAs, 및 HDAC1, 2, 3 및 8를 발현시켰다. 트랜스펙션 후 10nM의 RZD 유무 하에서 세포를 자극하였고, 프로모터 활성을 측정하였다(도 4B). 293T 세포를 FABP4-Luc 리포터 유전자, PPARγ2, β-갈락토시다아제, HDAC3(0.5㎍) 및 sLZIP(0.1㎍)로 함께 순간적으로 트랜스펙션 시켰다. 트랜스펙션 후 10nM의 RZD 유무 하에서 세포를 자극하였고, 루시퍼라아제 분석을 수행하였다(도 4C). 루시퍼라아제 활성은 β-갈락토시다아제 활성에 대해 표준화 하였고, 상대 강도(배수 변화)로 표시하였다. 모든 실험은 3반복으로 수행하였고, 그래프 내 막대 표시는 평균±표준편차를 나타낸다. GFP-sLZIP 발현 구조물을 C3H10T1/2 세포에서 발현시키고, 토끼 항-HDAC3 항체 및 텍사스 레드-결합된 항-토끼 항체를 사용하여 형광 현미경에서 분석하였다. 핵은 DAPI로 염색하였다(도 4D). 293T 세포를 GST-HDAC3 및 Flag-sLZIP로 함께 트랜스펙션 시켰다. 세포 용해물을 글루타티온 4B 비드를 사용하여 풀-다운시켰다. 단백질 복합체는 SDS-PAGE에서 분석하고, 항-GST 및 항-Flag 항체를 사용하여 면역 블랏팅 하였다(도 4E). *, P<0.05; **, P<0.01
도 4A에 나타난 바와 같이, TSA가 없는 상태에서, sLZIP는 PPARγ2 전사활성을 억제하나, TSA가 처리된 세포에서 sLZIP는 PPARγ2 전사활성을 감소하지 않았다.
다음으로, sLZIP가 매개하는 PPARγ2 전사활성의 억제가 클래스 1 HDACs 중 HDAC3에만 한정된 것인지를 조사한 결과, 도 4B에 나타난 바와 같이, HDAC1, 2 및 8에 대한 siRNA는 sLZIP가 매개하는 PPARγ2 조절에 관여하지 않았다. 그러나, HDAC3의 넉다운 결과 sLZIP가 매개하는 PPARγ2 전사활성을 극적으로 향상시켰다.
이 결과를 확인하기 위해, sLZIP 및 HDAC3 발현 구조물로 세포를 트랜스펙션 시킨 결과 sLZIP가 매개하는 PPARγ2 전사활성의 억제는 sLZIP 및 HDAC3 둘 다를 트랜스펙션 하여 상당히 하향-조절되었다(도 4C).
다음으로, sLZIP 및 HDAC3의 세포 내 위치를 시험한 결과, sLZIP는 HDAC3과 함께 핵에 위치하였다(도 4D).
HDAC3는 LZIP과 특이적으로 결합한다고 보고되어 있기 때문에, sLZIP 및 HDAC3 간의 결합을 시험한 결과, sLZIP는 HDAC3와 결합하였다(도 4E).
즉, sLZIP가 HDAC3와 결합하여 PPARγ2 전사활성을 부정적으로 조절함을 알 수 있다.
<실시예 4> sLZIP의 PPARγ2와 억제보체의 복합체 형성에 대한 효과
억제보체 복합체는 핵 수용체와 리간드 결합 시 도움인자에 의해 대체된다. 따라서, 리간드 처리에 의한 sLZIP 및 PPARγ2 간의 결합을 조사하였다.
이를 위해, 293T 세포를 GST-PPARγ2 및 Flag-sLZIP로 트랜스펙션 시키고, 10nM RZD를 24시간 동안 처리하거나 그렇지 않았다. 세포 용해물을 수득하고, 글루타티온 4B 비드를 사용하여 GST 풀-다운 분석(도 5A)과 면역침전(도 5B)을 실시하였다. 단백질 복합체는 SDS-PAGE에서 분석하고, 항-GST 및 항-Flag 항체를 사용하여 면역 블랏팅하였다. GST- PPARγ2 및 Flag-sLZIP를 293T 세포에서 발현시키고, 시간대 별로 세포에 10nM RZD를 처리하였다. 세포 용해물은 GST 풀-다운 분석하였다(도 5C). 293T 세포를 GST-HDAC3 및 Flag-sLZIP으로 트랜스펙션 시키고, 10nM RZD로 24시간 동안 처리하거나 그렇지 않았다. 세포 용해물은 GST 풀-다운 분석하였다(도 5D). Flag-sLZIP를 293T 세포에 발현시키고, 세포에 10nM RZD를 24시간 처리하였다. 세포 용해물에 대해 항-NCoR1 항체를 사용하여 면역 침전 분석을 실시하였다. 단백질 복합체는 SDS-PAGE에서 분석한 후 항-NCoR1 및 항-Flag 항체를 사용하여 면역 블랏팅하였다(도 5E). 293T 세포는 PPARγ2(0.5㎍), β-갈락토시다아제(0.1㎍), FABP4-Luc 리포터 유전자(0.2㎍) 및 sLZIP의 다양한 결실 돌연변이체(0.1㎍)로 함께 일시적으로 트랜스펙션 시켰다. 트랜스펙션 후, 10nM의 RZD를 처리하거나 그렇지 않고 세포를 자극하였다(도 5F). 루시퍼라아제 활성은 β-갈락토시다아제 활성에 대해 표준화하였고, 상대 활성(배수 변화)으로 표현하였다. 모든 실험은 3반복으로 수행하였고, 평균±표준편차로 나타내었다. *, P<0.05; **, P<0.01
GST 풀-다운 실험 결과, sLZIP는 리간드로 자극하지 않는 경우 PPARγ2와 결합하였다(도 5A). 그러나, 리간드 처리 시 sLZIP는 PPARγ2로부터 분리되었다.
면역 침전 분석을 사용하여 Flag-sLZIP 및 GST-PPARγ2를 발현하는 세포에서 sLZIP 및 PPARγ2 간의 결합을 시험한 결과, 도 5B에 나타난 바와 같이, 리간드 처리 시 PPARγ2는 sLZIP에서 분리되었다.
리간드 의존적인 분리를 확인하기 위해, RZD에 대한 반응에서 sLZIP 및 PPARγ2 간의 결합의 시간 의존성을 시험한 결과, sLZIP는 시간 의존적인 방식으로 PPARγ2에서 분리되었다(도 5C).
다음으로, PPARγ2의 억제보체 복합체와의 결합에 대한 sLZIP의 효과를 시험한 결과, sLZIP는 RZD를 처리하지 않는 경우 PPARγ2 억제보체 복합체에서 HDAC3와 결합하였다(도 5D). 비록 RZD 처리로 PPARγ2가 sLZIP에서 분리하나 HDAC3는 sLZIP에 결합된 채로 남아있었다(도 5D). 그러나, NCoR1은 RZD 처리 시 sLZIP에서 약간 분리되었다(도 5E).
또한, PPARγ2와의 리간드-의존적 결합에서 sLZIP의 조절 메카니즘과 PPARγ2 전사활성 조절에서 그것의 관련성을 조사한 결과, sLZIP는 RZD를 처리한 경우 PPARγ2에서 분리되었고, 여전히 PPARγ2 전사활성을 억제하였다(도 5F). PPARγ2 전사활성은 PPARγ2와 결합하지 않는 sLZIP의 결실 돌연변이체(1-220)에 의해 억제되었다(도 5F).
LZIP는 N-말단 활성 도메인(1-220)을 포함하고, cAMP-반응 요소(CREs)-함유 리포터 유전자의 전사활성에 관여하는 것으로 보고되어 있다. 즉, sLZIP가 PPARγ2와 결합하고, 아마도 FABP4 프로모터 영역에 결합하여 그것의 전사활성을 조절하는 것으로 보인다.
따라서, FABP4 프로모터 영역에 결합함에 따른 PPARγ2 전사활성에서 sLZIP의 조절 메카니즘을 이해하기 위해 PPARγ2 및 HDAC3 간의 결합 시 sLZIP의 효과를 조사하였다. 이를 위해, 293T 세포를 GST-HDAC3, Myc-PPARγ2 및 Flag-sLZIP로 트랜스펙션 시키고, 10nM RZD를 24시간 동안 처리하거나 그렇지 않았다. 세포 용해물은 글루타티온 4B 비드를 사용하여 GST 풀-다운 분석을 실시하고, 단백질 복합체는 SDS-PAGE에서 분석한 후 항-GST, 항-Myc 및 항-Flag 항체를 사용하여 면역 블랏팅하였다(도 6A). GST-HDAC3, GST-PPARγ2, Myc-PPARγ2, Flag-sLZIP 및 Ha-UB를 293T 세포에서 발현시키고, 10nM RZD를 세포에 24시간 동안 처리하였다. 세포 용해물은 GST 풀-다운 분석을 실시하였다(도 6B). GST-PPARγ2 및 Flag-sLZIP를 293T 세포에서 발현시키고, 10nM RZD를 24시간 동안 처리하였다. 세포 용해물은 GST 풀-다운 분석을 실시하고, 단백질 복합체는 SDS-PAGE에서 분석한 후 항-PGC1α, 항-GST 및 항-Flag 항체를 사용하여 면역 블랏팅 하였다(도 6C).
도 6A에 나타난 바와 같이, GST 풀-다운 분석 결과 sLZIP는 리간드 처리 시 PPARγ2 및 HDAC3 간의 결합을 향상시켰다.
PPARγ2는 리간드를 처리하지 않는 경우 HDAC3 같은 억제보체와 결합하고, PPARγ2 리간드, 로시글리타존의 첨가로 PPARγ-억제보체 복합체의 분리가 일어나 유비퀴틴/프로테오좀 경로에 의한 분해를 유도한다. sLZIP가 HDAC3 유비퀴틴화에 관여하는 지를 측정한 결과, sLZIP는 리간드 처리 시 HDAC3 유비퀴틴화를 억제하였다(도 6B).
또한, sLZIP는 PPARγ2에 대해 도움인자 PGC-1α의 보충을 억제하였다(도 6C).
상기 결과로부터 sLZIP이 PPARγ2와 결합하여 PPARγ2 전사활성을 조절하고, 억제보체 복합체 형성을 향상시킴을 알 수 있다.
<실시예 5> sLZIP는 FABP4 인핸서 영역의 결합 부위 분석
FABP4 프로모터에서 sLZIP의 DNA-결합능의 조절 메카니즘을 이해하기 위해, 전사 요소 검색 시스템(Transcription Element Search System, TESS)과 전사 인자들의 결합 부위를 예측하는 프로그램인 AliBaba2를 사용하여 FABP4 프로모터 영역을 분석하였다. PPARγ2는 2개의 PPARγ2 결합 요소, ARE6 및 ARE7을 포함하는 지방세포 P2(FABP4) 유전자에서 518-bp 인핸서와 결합한다고 보고되어 있다. 따라서, FABP4 인핸서 영역에서 예상 sLZIP 결합 부위를 찾고자 하였다. 도 7A에 FABP4 인핸서 영역에서 잠재적 sLZIP 결합 부위를 도시하였다.
FABP4 인핸서 영역에서 다양한 요소와 sLZIP의 DNA 결합능을 시험하였다. 이를 위해, 재조합 His-sLZIP 융합 단백질(3㎍)을 예상 CREB 결합 요소를 포함하는 γ-32P-표지된 올리고뉴클레오티드 프로브와 인큐베이션 하였다(도 7B). γ-32P-표지된 올리고뉴클레오티드 프로브를 정제한 His-sLZIP의 양을 증가시키면서 인큐베이션 하였다. 경쟁 분석은 100배 과량의 표지하지 않은 CREB 올리고뉴클레오티드 프로브를 사용하여 수행하였고, 얼음 위에서 추가로 40분 동안 반응 혼합물에 His 항체를 부가하였다(도 7C). His-sLZIP 단백질은 야생형 및 CREB 돌연변이(TGATGTCA?TGGGGTCA) 프로브를 사용하여 EMSA를 실시하였다(도 7D). 293T 세포를 PPARγ2(0.5㎍), β-갈락토시다아제(0.1㎍), FABP4 인핸서-루시퍼라아제 리포터 유전자(0.2㎍) 및 함량별 sLZIP 돌연변이체(0.1-0.5㎍)으로 함께 순간적으로 트랜스펙션 시켰다. 트랜스펙션 후, 10nM RZD로 세포를 자극하였다(도 7F). 루시퍼라아제 활성은 β-갈락토시다아제 활성으로 표준화하였고, 상대 활성(배수 변화)으로 표시하였다. 모든 실험은 3반복으로 수행하였고, 그래프 내 막대 표시는 평균±표준편차를 나타낸다. ChIP 분석은 HA-sLZIP에 특이적인 항체를 사용하여 수행하였고, 이어 PCR을 실시하였다. 인풋 크로마틴 또는 면역침전된 크로마틴에 대해 PCR을 실시하여 변수에 대한 대조군으로 사용하였다.
도 7B에 나타난 바와 같이, sLZIP는 직접적으로 CREB 영역에 결합하였다.
FABP4 인핸서 영역에서 CREB 요소와 sLZIP의 특이 DNA 결합능을 확인하기 위해, 100배 과량의 표지하지 않은 CREB 프로브를 사용한 슈퍼 시프트 분석(supershift assay)과 His-항체를 사용한 콜드 경쟁 분석(cold competition assay)을 수행한 결과, sLZIP의 DNA 결합능은 농도 의존적으로 증가하였다(도 7C). 그러나, sLZIP는 경쟁자 하에서 CREB 요소와 결합하지 않았고, sLZIP는 His 항체 처리 시 슈퍼 시프트 되었다(도 7C). sLZIP는 CREB 돌연변이 프로브(TGATGTCA→TGGGGTCA)와 결합하지 않았다(도 7D).
EMSA 결과를 확증하기 위해, FABP4 인핸서-루시퍼라아제 구조물을 사용하여 PPARγ2의 전사활성을 시험한 결과, 도 7E에 나타난 바와 같이, sLZIP는 농도 의존적 방식으로 PPARγ2의 전사활성을 감소시켰다. ChIP를 수행한 결과, sLZIP는 RZD를 처리하거나 그렇지 않은 경우 모두 FABP4 인핸서에서 CREB 요소에 모였다(도 7F).
요약하면, sLZIP가 FABP4 인핸서에서 CREB 요소에 직접적으로 결합하여 PPARγ2의 억제보체 복합체의 향상을 유도한다.
<실시예 6> 지방세포 형성 과정에서 sLZIP의 효과
지방세포 분화는 잘 조절된 과정으로 PPARγ2는 지방세포 형성 과정의 주요 조절자로, 지방세포 분화 동안 높게 발현되며, 지방세포 형성에 관여하는 유전자들의 발현을 조절한다. 생체 내에서 지방세포 형성에 대한 sLZIP의 효과를 조사하였다. 이를 위해, 사람 sLZIP 형질전환 마우스를 생산하기 위해 sLZIP 유전자를 pCMV-flag 발현 벡터에 클로닝 하였다. sLZIP TG 마우스는 Macrogen, Inc(Seoul, Korea)에서 생산하였다(도 8A). 지방전구세포는 sLZIP TG 마우스의 부고환 지방조직에서 분리하였다. 지방전구세포를 PPAR 결합 요소를 포함하는 FABP4 프로모터 리포터 유전자(0.2㎍) 및 PPARγ2(0.5㎍)으로 트랜스펙션 시키고, 10 nM RZD를 처리하거나 그렇지 않았다. 프로모터 활성은 루시퍼라아제 분석에 따라 측정하였다(도 8B). 293T 세포를 PPARγ2(0.5㎍), β-갈락토시다아제(0.1㎍), FABP4 인핸서-루시퍼라아제 리포터 유전자(0.2 ㎍) 및 마우스 LZIP(0.5㎍)으로 일시적으로 함께 트랜스펙션 시켰다. 트랜스펙션 후, 10nM RZD으로 세포를 자극하였다(도 8C). 루시퍼라아제 활성은 β-갈락토시다아제 활성으로 표준화 하였고, 상대 활성(배수 변화)으로 표시하였다. 모든 실험은 3반복으로 수행하였고, 그래프 내 막대 표시는 평균±표준편차를 나타낸다. C3H10T1/2 및 3T3-L1 세포는 10% FBS, 5㎍/mL 인슐린, 1μM 덱사메타손, 및 0.5mM IBMX를 포함하는 분화 배지로 바꿔주었다. 세포에서 총 RNA를 추출하였고, 마우스 LZIP의 mRNA 발현 수준은 RT-PCR 분석을 사용하여 측정하였다. GAPDH는 내부 대조군으로 사용하였다. 실험은 3반복으로 수행하였다(도 8D). 오일-레드 O 염색은 C3H10T1/2 및 3T3-L1에서 수행하였고(도 9A) 지방전구세포는 sLZIP TG 마우스의 부고환 지방조직에서 분리하였다(도 9B). sLZIP TG 마우스의 부고환 지방조직에서 분리한 지방전구세포는 지방세포로 분화시켰다. 세포에서 총 RNA를 분리하고, 마우스 LZIP의 mRNA 발현 수준은 RT-PCR(도 9C) 및 실시간 PCR(도 9D)을 사용하여 측정하였다.
sLZIP TG 마우스의 지방세포에서 PPARγ2전사활성을 시험한 결과, PPARγ2 전사활성은 야생형 마우스 대비 sLZIP TG 마우스의 지방세포에서 감소하였다(도 8B).
상동의 마우스 LZIP가 지방세포 형성 동안 전사활성과 PPARγ2의 발현에 영향을 주는지 시험한 결과, 마우스 LZIP 또한 대조군에 비해 PPARγ2 전사활성을 감소시켰다(도 8C). 흥미롭게도, 마우스 LZIP 발현은 지방세포 분화 동안 감소하였다(도 8D).
루시퍼라아제 분석 결과를 확증하기 위해, 다능성 중간엽 전구세포에서 지방세포 분화 시 sLZIP의 효과를 시험한 결과, 오일 레드 O 염색에서, sLZIP는 지방세포 분화를 억제하였다(도 8E).
시험관 내 결과를 확증하기 위해, 생체 내에서 지방세포 분화 시 sLZIP의 효과를 시험한 결과, 도 9A 및 B에 나타난 바와 같이, sLZIP TG 마우스에서 분리한 원발성 지방전구세포 및 마우스 배아 섬유아세포(MEFs)의 분화는 야생형 마우스 대비 억제되었다. 상기 결과와 일치하게도, FABP4 및 다른 PPARγ2 표적 유전자, 예컨대 C/EBPα 및 LPL의 발현 역시 하향-조절되었다(도 9C 및 D).
결론적으로, 도 10과 같이, sLZIP는 PPARγ2 전사활성을 억제하여 시험관 내 및 생체 내에서 지방세포 분화 시 부정적인 조절자로 기능을 수행한다.
본 발명은 당뇨병 또는 비만 등의 치료제로 사용할 수 있다.
Claims (12)
- 분화 조절제로, 인간 작은 류신 지퍼 단백질(human small leucine-zipper protein)을 포함하는 중간엽 줄기세포에서 지방세포로의 분화 억제용 조성물.
- 제1항에 있어서,인간 작은 류신 지퍼 단백질은 SEQ ID NO: 1에 기재된 아미노산 서열로 표시되는 중간엽 줄기세포에서 지방세포로의 분화 억제용 조성물.
- 인간 작은 류신 지퍼 단백질(human small leucine-zipper protein)을 포함하는 당뇨병 예방 또는 치료용 조성물.
- 제3항에 있어서,인간 작은 류신 지퍼 단백질은 SEQ ID NO: 1에 기재된 아미노산 서열로 표시되는 당뇨병 예방 또는 치료용 조성물.
- 제3항에 있어서,인간 작은 류신 지퍼 단백질은 천연 또는 재조합 단백질 형태, 또는 인간 작은 류신 지퍼 단백질을 과발현하는 형질전환 줄기세포 형태로 포함되는 당뇨병 예방 또는 치료용 조성물.
- 인간 작은 류신 지퍼 단백질(human small leucine-zipper protein)의 저해제를 포함하는 비만 예방 또는 치료용 조성물.
- 제6항에 있어서,인간 작은 류신 지퍼 단백질은 SEQ ID NO: 1에 기재된 아미노산 서열로 표시되는 비만 예방 또는 치료용 조성물.
- 제6항에 있어서,인간 작은 류신 지퍼 단백질은 천연 또는 재조합 단백질 형태, 또는 인간 작은 류신 지퍼 단백질을 과발현하는 형질전환 줄기세포 형태로 포함되는 비만 예방 또는 치료용 조성물.
- 인간 작은 류신 지퍼 단백질(human small leucine-zipper protein)의 유전자를 후보물질과 인체 외에서 접촉시키고,상기 후보물질이 상기 유전자의 발현을 촉진하는지 또는 억제하는지를 판단하는 것을 포함하는 당뇨병의 예방 또는 치료용 의약의 스크리닝 방법.
- 인간 작은 류신 지퍼 단백질(human small leucine-zipper protein)을 후보물질과 인체 외에서 접촉시키고,상기 후보물질이 상기 단백질의 기능 또는 활성을 증진하는지 또는 억제하는지를 판단하는 것을 포함하는 당뇨병의 예방 또는 치료용 의약의 스크리닝 방법.
- 인간 작은 류신 지퍼 단백질(human small leucine-zipper protein)의 유전자를 후보물질과 인체 외에서 접촉시키고,상기 후보물질이 상기 유전자의 발현을 촉진하는지 또는 억제하는지를 판단하는 것을 포함하는 비만의 예방 또는 치료용 의약의 스크리닝 방법.
- 인간 작은 류신 지퍼 단백질(human small leucine-zipper protein)을 후보물질과 인체 외에서 접촉시키고,상기 후보물질이 상기 단백질의 기능 또는 활성을 증진하는지 또는 억제하는지를 판단하는 것을 포함하는 비만의 예방 또는 치료용 의약의 스크리닝 방법.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US14/888,343 US9775879B2 (en) | 2013-04-30 | 2014-04-30 | Use of human small leucine zipper protein in adipocyte differentiation procedure |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR10-2013-0048133 | 2013-04-30 | ||
| KR1020130048133A KR101535337B1 (ko) | 2013-04-30 | 2013-04-30 | 지방세포 분화 과정에서 인간 작은 류신 지퍼 단백질의 용도 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2014178653A1 true WO2014178653A1 (ko) | 2014-11-06 |
Family
ID=51843703
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2014/003864 Ceased WO2014178653A1 (ko) | 2013-04-30 | 2014-04-30 | 지방세포 분화 과정에서 인간 작은 류신 지퍼 단백질의 용도 |
Country Status (3)
| Country | Link |
|---|---|
| US (2) | US9775879B2 (ko) |
| KR (1) | KR101535337B1 (ko) |
| WO (1) | WO2014178653A1 (ko) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3623466A4 (en) * | 2017-05-12 | 2020-08-12 | FUJIFILM Corporation | PROCESS FOR THE PRODUCTION OF MESENCHYMATIC STEM CELLS AND RELATED APPLICATION |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR101535336B1 (ko) * | 2013-04-30 | 2015-07-09 | 고려대학교 산학협력단 | 골 형성 과정에서 인간 작은 류신 지퍼 단백질의 용도 |
| WO2018062233A1 (ja) * | 2016-09-27 | 2018-04-05 | 協和発酵キリン株式会社 | カチオン性脂質としての化合物 |
| KR101906333B1 (ko) | 2016-12-07 | 2018-10-11 | 고려대학교 산학협력단 | 지방간의 진단 또는 치료를 위한 류신 지퍼 단백질의 용도 |
| KR102678213B1 (ko) * | 2020-07-28 | 2024-07-01 | 고려대학교 산학협력단 | 간 섬유증의 진단을 위한 인간 작은 류신 단백질의 용도 |
| CN116426469B (zh) * | 2023-06-07 | 2023-09-08 | 北京大学口腔医学院 | LAP2α在间充质干细胞成脂向分化中的应用 |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20110044545A (ko) * | 2009-10-23 | 2011-04-29 | 고려대학교 산학협력단 | 신규한 인간 류신 지퍼 단백질 아형 및 이의 용도 |
-
2013
- 2013-04-30 KR KR1020130048133A patent/KR101535337B1/ko active Active
-
2014
- 2014-04-30 WO PCT/KR2014/003864 patent/WO2014178653A1/ko not_active Ceased
- 2014-04-30 US US14/888,343 patent/US9775879B2/en active Active
-
2017
- 2017-08-31 US US15/692,789 patent/US10058586B2/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20110044545A (ko) * | 2009-10-23 | 2011-04-29 | 고려대학교 산학협력단 | 신규한 인간 류신 지퍼 단백질 아형 및 이의 용도 |
Non-Patent Citations (5)
| Title |
|---|
| DATABASE NCBI 3 November 2009 (2009-11-03), accession no. CN32251.1 * |
| KANG ET AL.: "A novel isoform of human LZIP negatively regulates the transactivation of the glucocorticoid receptor", MOLECULAR ENDOCRINOLOGY, vol. 23, no. 11, 2009, pages 1746 - 1757 * |
| KIM, JAE U ET AL.: "Study on metabolic diseases and adipocyte differentiation", BIOCHEMISTRY NEWS, vol. 30, no. 4, 2010, pages 1 - 10 * |
| SHI ET AL.: "A glucocorticoid-induced leucine-zipper protein, GILZ, inhibits adipogenesis of mesenchymal cells", EMBO REPORTS, vol. 4, no. 4, 2003, pages 374 - 380 * |
| YEH ET AL.: "Cascade regulation of terminal adipocyte differentiation by three members of the C/EBP family of leucine zipper proteins", GENES & DEVELOPMENT, vol. 9, no. 2, 1995, pages 168 - 181 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3623466A4 (en) * | 2017-05-12 | 2020-08-12 | FUJIFILM Corporation | PROCESS FOR THE PRODUCTION OF MESENCHYMATIC STEM CELLS AND RELATED APPLICATION |
| US11649274B2 (en) | 2017-05-12 | 2023-05-16 | FUJTFITM Corporation | Method for producing mesenchymal stem cell and application of same |
Also Published As
| Publication number | Publication date |
|---|---|
| KR20140129617A (ko) | 2014-11-07 |
| US20180092962A1 (en) | 2018-04-05 |
| KR101535337B1 (ko) | 2015-07-09 |
| US20160074471A1 (en) | 2016-03-17 |
| US10058586B2 (en) | 2018-08-28 |
| US9775879B2 (en) | 2017-10-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Batchvarova et al. | Inhibition of adipogenesis by the stress‐induced protein CHOP (Gadd153). | |
| Don et al. | The expanding family of CREB/CREM transcription factors that are involved with spermatogenesis | |
| WO2014178653A1 (ko) | 지방세포 분화 과정에서 인간 작은 류신 지퍼 단백질의 용도 | |
| Yamada et al. | Basic helix-loop-helix transcription factors, BHLHB2 and BHLHB3; their gene expressions are regulated by multiple extracellular stimuli | |
| WO2017142367A1 (ko) | 중간엽 줄기세포 또는 xcl1을 포함하는 근육질환의 예방 또는 치료용 약학적 조성물 | |
| US7378246B2 (en) | Methods and compositions for regulating adipogenesis | |
| Jung et al. | Augmentation of PPARγ-TAZ interaction contributes to the anti-adipogenic activity of KR62980 | |
| WO2023140664A1 (ko) | 리포칼린 2 또는 이의 수용체의 발현 억제제를 유효성분으로 함유하는 비알코올성지방간염에 의해 유도된 간섬유화 예방 또는 치료용 약학 조성물 | |
| WO2014178649A1 (ko) | 골 형성 과정에서 인간 작은 류신 지퍼 단백질의 용도 | |
| WO2017023047A1 (ko) | 아리피프라졸을 유효성분으로 함유하는 염증성 질환 또는 암 예방 또는 치료용 조성물 | |
| WO2022045668A1 (ko) | 우유 엑소좀을 포함하는 갈색지방화 유도용 조성물 | |
| WO2020091463A1 (ko) | 분리된 미토콘드리아를 포함하는 건병증 예방 또는 치료용 약학 조성물 | |
| WO2010021516A9 (ko) | 뇌 손상 치료를 위한 리포칼린 2의 신규한 용도 | |
| WO2013176503A1 (ko) | 타우 단백질 매개 신경 퇴행성 질환 치료제 | |
| KR20110044545A (ko) | 신규한 인간 류신 지퍼 단백질 아형 및 이의 용도 | |
| WO2010032976A2 (ko) | 심부전 예방 또는 치료용 조성물 | |
| WO2019245269A1 (ko) | Flt3 억제제를 유효성분으로 포함하는 만성 골수성 백혈병 약물 내성 억제용 조성물 | |
| WO2019235876A1 (ko) | C-src의 발현 또는 활성 억제제를 포함하는 시누클레인병증의 예방 또는 치료용 약학 조성물 | |
| WO2017052340A1 (ko) | 운동유사효과 유도용 약학 조성물 | |
| WO2017023002A1 (ko) | 비알콜성 지방간 조절인자 14-3-3 단백질 | |
| CN116462666B (zh) | 细胞保护性化合物及其用途 | |
| WO2015111971A1 (ko) | Gpr119 리간드를 유효성분으로 포함하는 비알콜성 지방간 질환의 예방 또는 치료용 약학적 조성물 | |
| Zhang et al. | Two-pore channel 2 is a key regulator of adipocyte differentiation via the cAMP signaling pathway with calpain as downstream effector | |
| WO2016159695A1 (ko) | Ssu72를 유효성분으로 포함하는 자가면역질환의 예방 또는 치료용 조성물 | |
| WO2025053613A1 (ko) | Ilk 저해제를 포함하는 말초신경종양 예방 또는 치료용 약학 조성물 및 이의 용도 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 14791311 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 14888343 Country of ref document: US |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 14791311 Country of ref document: EP Kind code of ref document: A1 |