WO2014147087A1 - Influenza nucleoprotein vaccines - Google Patents

Influenza nucleoprotein vaccines Download PDF

Info

Publication number
WO2014147087A1
WO2014147087A1 PCT/EP2014/055438 EP2014055438W WO2014147087A1 WO 2014147087 A1 WO2014147087 A1 WO 2014147087A1 EP 2014055438 W EP2014055438 W EP 2014055438W WO 2014147087 A1 WO2014147087 A1 WO 2014147087A1
Authority
WO
WIPO (PCT)
Prior art keywords
influenza
antigen
fusion protein
seq
imx313
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2014/055438
Other languages
English (en)
French (fr)
Inventor
Judith DEL CAMPO ASCARATEIL
Fergal Hill
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Imaxio SA
Original Assignee
Imaxio SA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to KR1020157029403A priority Critical patent/KR102379951B1/ko
Priority to JP2016503642A priority patent/JP2016520534A/ja
Priority to AU2014234363A priority patent/AU2014234363B2/en
Priority to BR112015023738A priority patent/BR112015023738B8/pt
Priority to EP14710594.4A priority patent/EP2976357B1/en
Priority to RU2015140603A priority patent/RU2662667C2/ru
Priority to CN201480013364.1A priority patent/CN105143251B/zh
Priority to MX2015013304A priority patent/MX363149B/es
Application filed by Imaxio SA filed Critical Imaxio SA
Priority to CA2901888A priority patent/CA2901888C/en
Publication of WO2014147087A1 publication Critical patent/WO2014147087A1/en
Priority to US14/570,155 priority patent/US9243047B2/en
Anticipated expiration legal-status Critical
Priority to US14/975,918 priority patent/US9963490B2/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • A61K39/145Orthomyxoviridae, e.g. influenza virus
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A61K47/646Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent the entire peptide or protein drug conjugate elicits an immune response, e.g. conjugate vaccines
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • A61P31/16Antivirals for RNA viruses for influenza or rhinoviruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/04Immunostimulants
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C07K14/08RNA viruses
    • C07K14/11Orthomyxoviridae, e.g. influenza virus
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C07K14/08RNA viruses
    • C07K14/15Retroviridae, e.g. bovine leukaemia virus, feline leukaemia virus human T-cell leukaemia-lymphoma virus
    • C07K14/155Lentiviridae, e.g. human immunodeficiency virus [HIV], visna-maedi virus or equine infectious anaemia virus
    • C07K14/16HIV-1 ; HIV-2
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/44Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from protozoa
    • C07K14/445Plasmodium
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525Virus
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/53DNA (RNA) vaccination
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/70Fusion polypeptide containing domain for protein-protein interaction
    • C07K2319/735Fusion polypeptide containing domain for protein-protein interaction containing a domain for self-assembly, e.g. a viral coat protein (includes phage display)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011Details
    • C12N2760/16011Orthomyxoviridae
    • C12N2760/16034Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011Details
    • C12N2760/16011Orthomyxoviridae
    • C12N2760/16111Influenzavirus A, i.e. influenza A virus
    • C12N2760/16134Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein

Definitions

  • influenza vaccines A need exists for improved influenza vaccines.
  • Current vaccine strategies against influenza focus on generating robust antibody (humoral) responses against hemagglutinins. Because of the high degree of antigenic drift among circulating influenza strains over the course of a year, vaccine strains must be reformulated specifically for each influenza season. Although annual (or seasonal) influenza vaccines are successful to varying degrees in different age categories, more effective protection is clearly needed particularly for the young and the elderly. Furthermore, there is a major, permanent risk that reassortant viruses will evolve which have acquired very different HA (hemagglutinin) genes in a process known as "antigenic shift". This would create a public health emergency, as current influenza vaccines rely essentially on the HA antigen.
  • Influenza is an enveloped, single-stranded, negative-sense RNA virus in the Orthomyxoviridae family of viruses, divided into 3 major types: A, B, and C.
  • Influenza A viruses infect a wide variety of animals, including humans, birds, pigs, horses, bats and many others, although the tropism of any particular influenza virus is generally highly adapted to a particular host.
  • Influenza B viruses infect a smaller number of species, namely humans and seals, but are still a substantial cause of annual influenza epidemics. Most human influenza infections are caused by influenza A or B; influenza C viruses, which infect humans and pigs, rarely account for serious human infections or epidemics (Lamb).
  • HA hemagglutinin
  • the current inactivated influenza virus vaccines induce antibodies that protect against closely related virus strains.
  • licensed vaccines mainly induce strain-specific neutralizing antibodies against hemagglutinin (HA), the main antigenic determinant on the surface of the virus, which is highly immunogenic, and can prevent disease caused by infection with a matching virus strain.
  • HA has substantial antigenic variation which excludes its use alone in a vaccine designed to provide broad protection. For this reason, alternative vaccine strategies that generate protective responses directed against less variable targets are of great interest.
  • NP antigen is immunogenic in humans following natural infections, but the cytotoxic T lymphocytes that are induced have a short life-span (McMichael a, McMichael b).
  • McMichael a the cytotoxic T lymphocytes that are induced have a short life-span
  • Cellular immunity against NP is valuable, as it is directed against different variants of NP epitopes, and NP-targeting DNA vaccines have induced cross -protective immunity in animals (Schotsaert).
  • NP antigen has long been recognized as a highly conserved antigen: even the most divergent influenza A strains share 90% identity in the NP proteins they encode (Gorman, Xu). Antigenic changes to NP are rare and only occur to a minor extent (Stanekova).
  • nucleoprotein as an antigen in vaccines
  • influenza nucleoprotein as an antigen was described in the 1980s (Wraith).
  • Cellular immune responses in mice against NP are capable of inducing immunity, and notably of producing cross-protection against divergent type A viruses. It was shown that immunization of mice with NP purified from a H3N2 virus could provide substantial protection (75%) from a lethal heterologous (H1 N1 ) challenge, but it did not prevent infection.
  • DNA vaccines using the NP gene have been known for twenty years: they were used in the first "proof of concept" experiments for DNA vaccination itself (Ulmer).
  • NP from a viral vector was first demonstrated in the 1980s (Yewdell 1985), and immunization with this vector was associated with an improved generation of cytotoxic T lymphocytes against diverse influenza A, but not B, strains, in comparison with DNA vaccines.
  • NP protein is primarily located in the nucleus, reducing the immunogenicity of such DNA vaccines (Stanekova).
  • Improved cellular immune responses against NP can be obtained by forcing the secretion of NP, for example by fusing a tPA signal peptide to the NP gene (Luo), by formulation of the DNA (Greenland, Sullivan) and by the use of electroporation (Laddy) to improve DNA delivery.
  • the major technical problem in preparing influenza vaccines with the NP antigen is inducing strong and durable cellular immune responses.
  • the 'cellular immune response' is an immune response that does not involve antibodies but rather involves the activation of antigen-specific T- lymphocytes, and especially cytotoxic T lymphocytes, and the release of various cytokines in response to an antigen.
  • CD4 cells or helper T cells provide protection against different pathogens by secreting cytokines that activate the immune response.
  • Cytotoxic T cells CD8 cause death by apoptosis of pathogens without using cytokines.
  • Vaccines that provide protection by eliciting a strong cytotoxic T cell response may be useful when T cell epitopes are derived from the highly conserved NP protein (Epstein; Roy).
  • Cellular immune responses mediated by T lymphocytes, mainly function by recognizing influenza virus-infected cells, by inhibiting viral replication and by accelerating virus clearance.
  • the specific T cells involved in conferring immunity include both CD4+ and CD8+ T cells, and often exert their functions through the action of secreted cytokines and cytolytic activity, respectively.
  • Influenza NP-specific CD8+ CTL in particular could play important roles in heterosubtypic protective immunity against a lethal influenza virus challenge in mice (Gschoesser), including clearance of the influenza virus from the upper respiratory mucosal surfaces (Mbawuike), promoting survival and recovery after challenge (Epstein).
  • An optimal NP-based vaccine would improve both CD4 and CD8 cellular responses.
  • This patent application provides methods for improving cellular immune responses to influenza virus nucleoproteins.
  • the present invention is related to a method for increasing the immunogenicity, and particularly the cellular immunogenicity, of the NP antigens from Influenza viruses, by fusing at least one variant of the NP antigen from Influenza strains A, B or C to a variant of the chicken C4bp oligomerization domain as carrier protein.
  • the present invention is in particular related to a fusion protein, comprising at least one monomeric variant of the NP antigen from Influenza strain A, B or C, and a carrier protein IMX313 having the sequence as shown in SEQ ID NO: 1 , such as described in the patent application WO2007/062819.
  • the present invention is in particular related to a fusion protein, comprising the monomeric variant of the NP antigen from Influenza strain A presenting the E339A and R416A point mutations as shown in SEQ ID NO: 2, and a variant of IMX313 carrier protein having a C-terminal substitution of at least one positively charged peptide having the sequence ZXBBBBZ wherein (i) Z is any amino acid or is absent, (ii) X is any amino acid and (iii) B is an arginine (R) or a lysine (K), as shown in SEQ ID NO: 3, such as described in the patent application PCT/EP2013/076289 filed on December 1 1 th 2013.
  • a preferred variant of IMX313 carrier protein does not induce antibodies which cross-react with protamine.
  • the present invention is in particular related to a fusion protein, comprising a monomeric variant of the NP antigen, and a modified carrier protein IMX313T or IMX313P, as shown respectively in SEQ ID NO: 4 and SEQ ID NO: 5.
  • the present invention is also related to an immunogenic composition
  • an immunogenic composition comprising a DNA sequence in a plasmid or a viral vector, further comprising a signal peptide, such as tPA, as shown in SEQ ID NO: 6.
  • the present invention is also related to a recombinant DNA sequence coding for said fusion proteins.
  • the present invention is also related to an immunogenic composition
  • an immunogenic composition comprising a DNA sequence encoded by a plasmid or a viral vector, or a fusion protein, further comprising vaccine adjuvants or nucleic acid ligands for intracellular TLRs, as described in the patent application PCT/EP2013/076289 filed on December 1 1 th 2013.
  • the present invention is also related to a DNA plasmid, a viral vector, a fusion or an immunogenic composition, for its use as a vaccine or an immunotherapy as a method of prevention or treatment of the influenza.
  • the present invention is not limited to particularly exemplified methods and may, of course, vary.
  • the present invention is related to fusion proteins comprising at least one nu- cleoprotein antigen from Influenza, and is not limited to a specific influenza nucleopro- tein.
  • Influenza viruses are of three types, A, B and C. This classification was initially serological: antisera to the influenza virus A nucleoprotein cross-react with the nucleoprotein of other A class viruses, but not with those of B class or C class viruses. Influenza A viruses are further classified into subtypes, based on the serological cross- reaction of their hemagglutinin (H) and neuraminidase (N) glycoproteins.
  • H hemagglutinin
  • N neuraminidase glycoproteins
  • Influenza nucleoproteins are meant the nucleoproteins of all three types (A, B and C) of the Influenza viruses.
  • a “carrier protein” designates generally a protein to which antigens are conjugated or fused and thereby rendered more immunogenic.
  • the term is used specifically in the meaning of a protein carrying an antigen.
  • the function of the protein is to increase the immunogenicity of said antigen to which it is conjugated or fused.
  • a "variant of NP” designates all the proteins having a sequence with at least 90% of identity of the wild type version of influenza nucleoproteins from Influenza strains A, B and C.
  • a "variant of the chicken C4bp oligomerization domain” is a variant of the C4bp domain of the SEQ ID NO: 1 described in the patent applications WO2007/062819, and PCT/EP2013/076289 filed on December 11 th , 2013, both references being incorporated herein by reference, particularly a fragment of at least 48 contiguous amino acids and /or having at least 70% amino acid sequence identity of said SEQ ID NO: 1 described in the patent applications WO2007/062819.
  • Protamine consists of a group of heterogenous peptides with an average molecular weight of 4500 Daltons, obtained from fish. Approximately 67% of the amino acid composition of protamine is arginine. It has long been used to formulate insulin (in Neutral Protamine Hagedorn), or to neutralize heparin.
  • fusion protein designates a recombinant protein, non-naturally existing, comprising two domains from different origins that have been fused. More precisely, in the invention, the fusion protein comprises an influenza nucleoprotein antigen fused to a carrier domain variant of the chicken C4bp oligomerization domain, particularly 'IMX313T' or 'IMX313P'. Fusion has the advantage of creating a homogenous product. More formally, the "conjugation" can be described as genetic: the DNA encoding the pro-immunogenic carrier protein is spliced to the DNA encoding the antigen. The antigen can be fused to the N- or C- terminal of the carrier protein.
  • the invention is related to an immunogenic composition, comprising at least one variant of an Influenza nucleoprotein antigen and a variant of a C4bp oligomerization domain, and eliciting a increased cellular immune response against the Influenza nucleoprotein antigen.
  • the nucleoprotein fused to the carrier protein variant of the chicken C4bp oligomerization domain can be a nucleoprotein from any type (A, B or C) of the Influenza viruses.
  • the nucleoprotein antigen can be fused to the N- or C-terminal of the carrier protein, particularly IMX313T or IMX313P.
  • At least one nucleoprotein is fused to one carrier protein, particularly IMX313T or IMX313P; however, two or more nucleoproteins, identical or different, can be fused to the same carrier protein.
  • the nucleoprotein antigen fused to the variant of the chicken C4bp oligomerization domain is a monomeric antigen.
  • monomeric antigens as described in the patent application WO 2005/014654, provided that monomerization does not diminish their immunogenicity.
  • monomeric forms of naturally oligomeric proteins have diminished immunogenicity (Fiers).
  • the man skilled in the art knows different point mutations that can be introduced into the protein sequence of the NP antigen, to induce its monomerisation.
  • the NP antigen presents at least one of the two following point mutations: E339A and R416A.
  • the NP antigen is from the Influenza strain A.
  • the NP antigen comprises both point mutations E339A and R416A, and is therefore monomeric.
  • the NP antigen presents the polypeptide sequence as shown in SEQ ID NO: 2.
  • variants of this domain presenting a C-terminal substitution of at least one positively charged peptide having the sequence ZXBBBBZ wherein (i) Z is any amino acid or is absent, (ii) X is any amino acid and (iii) B is an arginine (R) or a lysine (K), as shown in SEQ ID NO: 3, which enables an improved immune response to an antigen when fused to said antigen, such as described in the patent application PCT/EP2013/076289 filed on December 11 th 2013.
  • IMX313 carrier protein does not induce antibodies which cross-react with protamine.
  • Particular improved variants called IMX313T and IMX313P, have been recently described in the patent application PCT/EP2013/076289 filed on December 11 th , 2013. Their peptide sequences are the following:
  • the fusion protein comprises a NP antigen which comprises a signal peptide.
  • NP protein is primarily located in the nucleus, which could potentially reduce the immunogenicity of such DNA vaccines. Therefore, enabling the secretion of NP antigen, by adding a signal peptide, is desirable.
  • said signal peptide is the tPA (tissue plasminogen activator) secretory signal peptide as described in (Luo).
  • the NP antigen is monomeric and comprises a signal peptide.
  • the NP antigen comprises both mutations E339A and R416A, and the signal peptide tPA.
  • the fusion protein comprising IMX313T and the monomeric NP antigen comprising a signal peptide induces, when injected as a DNA vaccine in mice, a stronger Th1 response (lgG2a) than Th2 response (Fig.13).
  • Th1 responses are preferable to Th2 responses.
  • methods for improving preferentially Th1 responses to an antigen are not known in the art.
  • the invention is also related to a fusion protein comprising any carrier protein comprising a coiled-coil domain, and at least one nucleoprotein (NP) antigen from Influenza.
  • NP nucleoprotein
  • said nucleoprotein antigen is monomeric.
  • the present invention is also related to a nucleic acid encoding for a fusion protein such as described above, and in particular:
  • coding for a fusion protein comprising a NP antigen comprising a signal peptide and IMX313T or IMX313P;
  • - coding for a fusion protein comprising a monomeric NP antigen comprising a signal peptide and IMX313T or IMX313P.
  • said nucleic acid codes for a fusion protein comprising a monomeric NP antigen from Influenza A.
  • said nucleic acid codes for a fusion protein which does not induce antibodies cross-reacting with protamine.
  • said nucleic acids present the sequences as shown in SEQ ID NO: 6 and SEQ ID NO: 7.
  • the present invention is also related to a vector comprising the nucleic acid presented above, and genetic elements such as promoters and enhancers to ensure the expression of the DNA cassette in host cells.
  • the present invention is also related to an immunogenic composition comprising:
  • nucleic acid ligands for intracellular TLRs for intracellular TLRs, and/or any other vaccine adjuvants.
  • TLRs Toll-Like Receptors
  • PAMPs pathogen associated molecular patterns
  • TLRs represent a set of immune pattern recognition receptors able to alert the immune system immediately after infection by a pathogen. They play an important role as pivotal components between innate and adaptive immunity and are able to scent out many pathogens ranging from viruses to parasites.
  • TLRs 1 , 2, 4, 5 and 6 are principally expressed on the cell surface, where they recognize mostly bacterial products, while TLRs 3, 7, 8 and 9 are localized in intracellular compartments and recognize mostly viral products and nucleic acids.
  • Intracellular Toll-Like Receptors are principally expressed on the cell surface, where they recognize mostly bacterial products, while TLRs 3, 7, 8 and 9 are localized in intracellular compartments and recognize mostly viral products and nucleic acids.
  • TLRs Toll-like receptors
  • TLRs Toll- Like Receptors
  • TLR3, TLR7, TLR8, TLR9 and TLR13 Blasius and references therein.
  • TLR3 is expressed on a variety of epithelial cells including airway, uterine, corneal, vaginal, cervical, biliary and intestinal epithelial cells, and these cells appear to express TLR3 on their cell surfaces (Akira).
  • TLR3 receptor The importance of limiting signaling through these receptors, and notably the TLR3 receptor, is dose-dependent. Binding nucleic acid ligands tightly to the antigen is thus essential, to prevent their binding to TLRs in the absence of the antigen. Tightly bound intracellular TLR ligands are therefore highly preferred over formulations in which binding is less tight. Therefore, the man skilled in the art is looking for antigenic compositions able to bind efficiently TLR ligands, so that they are not separated from the antigen before the antigen arrives in the cells where it will trigger an immune response, with the goal of diminishing the potential adverse effects mediated by the binding of the ligands to TLR receptors elsewhere.
  • poly l:C being a duplex of a polynucleotide of polyinosinic acid hybridized to polycytidylic acid, an analogue of double-stranded RNA.
  • the chain length was twenty nucleotides for each strand.
  • TLR7 an oligonucleotide, called ssRNA40, with the sequence 5' GsCsCsCsG- sUsCsUsGsUsUsGsUsGsUsGsAsCsUsC 3' where "s" represents a phosphothioate linkage (SEQ ID NO: 8);
  • TLR9 an oligonucleotide called ODN1826 with the sequence: 5' tccatgac- gttcctgacgtt 3' (SEQ ID NO: 9).
  • the immunogenic composition comprises:
  • the invention is also related to a fusion protein such as described above, for its use as a vaccine for the prevention and treatment of influenza disease.
  • Said influenza vaccine can be used for multiple applications:
  • the invention is also related to a nucleic acid such as described above, for its use as a DNA vaccine for the prevention of influenza disease.
  • the invention is also related to a vector such as described above, for its use as a viral vaccine for the prevention of influenza disease.
  • the invention is also related to an immunogenic composition such as described above for its use as a vaccine for the prevention of influenza disease.
  • the invention is also related to a method for increasing the cellular immune response to the nucleoprotein antigen of influenza, comprising the fusion of this antigen to a carrier protein IMX313T or IMX313P having the sequences as shown in SEQ ID NO: 4 and SEQ ID NO: 5.
  • a carrier protein IMX313T or IMX313P having the sequences as shown in SEQ ID NO: 4 and SEQ ID NO: 5.
  • the fusion protein or the nucleic acid or the vector or the immunogenic composition such as described previously is used in immunotherapy of influenza disease.
  • Figure 1 map of the parental plasmid pcDNA3 NP - This plasmid and its derivatives, constructed as described in the Examples, were used for DNA vaccination.
  • Figure 2 Comparison of total T cells secreting IFN- ⁇ in response to immunization with plasmids encoding NP, or NP fused to IMX313.
  • Figure 3 Comparison of CD8 and CD4 T cells secreting IFN- ⁇ in response to immunization with a plasmid encoding NP or a plasmid encoding NP fused to IMX313.
  • Figure 4 Comparison of IgG antibody responses to recombinant NP induced by DNA plasmids encoding either NP or NP fused to IMX313
  • Figure 5 Comparison of IgG antibody subclass responses to recombinant NP induced by DNA plasmids encoding either NP or NP fused to IMX313.
  • Figure 6 Comparison of total T cell responses to plasmids encoding NP, monomeric NP (NPm), monomeric NP fused to IMX313 (NPm-IMX31 3) and monomeric NP fused to IMX313T (NPm-IMX313T).
  • Figure 7 Comparison of CD8+ and CD4+ T cell responses to plasmids encoding NP, monomeric NP (NPm), monomeric NP fused to IMX313 (NPm-IMX313) and monomeric NP fused to IMX313T (NPm-IMX313T).
  • Figure 8 Comparison of IgG antibody responses, measured by ELISA using recombinant NP, to plasmids encoding NP, monomeric NP (NPm), monomeric NP fused to IMX313 (NPm-IMX313) and monomeric NP fused to IMX313T (NPm-IMX313T).
  • Figure 9 Comparison of IgG antibody subclass responses, measured using recombinant NP, to plasmids encoding NP, monomeric NP (NPm), monomeric NP fused to IMX313 (NPm-IMX313) and monomeric NP fused to IMX313T (NPm-IMX313T).
  • FIG. 10 Influence of the secretion, by the tPA signal peptide, on the various NP fusion proteins.
  • Total T cells were measured by IFNy ELISpots comparing NP, secreted NP (tPA-NP), secreted monomeric NP (tPA-NPm), secreted NP fused to IMX313 (tPA-NP- IMX313), secreted monomeric NP fused to IMX313 (tPA-NPm-IMX313), and secreted monomeric NP fused to IMX313T (tPA-NPm-IMX313T).
  • Figure 1 1 Influence of the secretion, by the tPA signal peptide, on the CD8+ and CD4+ responses to various NP fusion proteins, measured by IFNy ELISpots comparing: NP, secreted NP (tPA-NP), secreted monomeric NP (tPA-NPm), secreted NP fused to IMX313 (tPA-NP-IMX313), secreted monomeric NP fused to IMX313 (tPA-NPm-IMX313), and secreted monomeric NP fused to IMX313T (tPA-NPm-IMX313T).
  • tPA-NP secreted NP
  • tPA-NPm secreted monomeric NP
  • tPA-NPm-IMX31313 secreted monomeric NP fused to IMX313
  • tPA-NPm-IMX313T secreted monomeric NP fused to IMX313T
  • Figure 12 Influence of the secretion, by the tPA signal peptide, on the IgG responses to various NP fusion proteins, measured by ELISAs comparing: NP, secreted NP (tPA-NP), secreted monomeric NP (tPA-NPm), secreted NP fused to IMX313 (tPA-NP-IMX313), secreted monomeric NP fused to IMX31 3 (tPA-NPm-IMX31 3), and secreted monomeric NP fused to IMX313T (tPA-NPm-IMX313T).
  • tPA-NP secreted NP
  • tPA-NPm secreted monomeric NP
  • tPA-NP-IMX313 secreted monomeric NP fused to IMX31 3
  • tPA-NPm-IMX313T secreted monomeric NP fused to IMX313T
  • Figure 13 Influence of the secretion, by the tPA signal peptide, on the IgG subclass responses to various NP fusion proteins, measured by ELISAs comparing: NP, secreted NP (tPA-NP), secreted monomeric NP (tPA-NPm), secreted NP fused to IMX313 (tPA-NP- IMX313), secreted monomeric NP fused to IMX313 (tPA-NPm-IMX313), and secreted monomeric NP fused to IMX313T (tPA-NPm-IMX313T).
  • Figure 14 Fusion of nucleoprotein to IMX313T increases the immunogenicity of NP to the same extent as the formulation of NP in the oil-in-water adjuvant AddaVax (Invivogen); and the use of AddaVax with the NPm-IMX313T fusion protein shows a synergistic effect.
  • Figure 15 Analysis of the results shown in Figure 14 after separation of CD4 and CD8 cells. The synergistic effect of AddaVax with the NPm-IMX313T protein is seen both in CD4 responses and the CD8 responses.
  • Figure 16 IgG responses to nucleoprotein. Fusion of nucleoprotein to IMX313T, in the absence of the adjuvant AddaVax, showed no significant change in IgG titres compared to NP. But in the presence of AddaVax, the fusion protein is significantly more immunogenic than the nucleoprotein.
  • Figure 17 Comparison of IgG antibody subclass responses, measured using recombinant NP, following immunization with NP or NPm-IMX313T, with or without AddaVax.
  • NP with or without Addavax
  • NPm-IMX313T with or without AddaVax
  • Figure 18 SDS-PAGE analysis of the recombinant proteins used for immunisations.
  • Lane 1 molecular weight markers (New England Biolabs); lane 2: recombinant NP (Imgenex); lane 3: purified NP; lane 4: purified NPm-IMX313T.
  • Figure 19 SDS-PAGE analysis of the recombinant NPm-IMX313P proteins.
  • Lane 1 purified NP;
  • lane 2 purified NPm-IMX313T;
  • lane 3 purified NPm-IMX313P;
  • lane 4 molecular weight markers (New England Biolabs).
  • FIG. 20 IgG responses to Protamine or to IMX313P, after immunization of mice with IMX313P protein. This shows that, although the mice produce IgG antibodies to IMX313P (and some cross-react with IMX313), no antibodies which cross-react with protamine were found.
  • the parent plasmid pcDNA3-NP as shown in Figure 1 , was modified as described in the Examples below.
  • the plasmids plMX494 and plMX497 are described in the patent application PCT/EP2013/076289 filed on December 11 th , 2013.
  • the IMX313 coding sequence was amplified from the plasmid plMX494 using the oligonucleotide primers IMX1289 (5' caatgcagaggagtacgacaatggatccaagaagcaaggtgatgctgatg 3' - SEQ ID NO: 10) and IMX1290 (5' GTAGAAACAAGGGTATTTTTCTTtattactccttgctcagtccttgc 3' - SEQ ID NO: 11 ) and inserted into the plasmid pcDNA3-NP as described by Geiser.
  • IMX1289 caatgcagaggagtacgacaatggatccaagaagcaaggtgatgctgatg 3' - SEQ ID NO: 10
  • IMX1290 5' GTAGAAACAAGGGTATTTTTCTTtattactccttgctcagtccttgc 3' - SEQ ID NO
  • the tPA signal peptide was amplified from the vector pSG2-85A (Spencer) using the oligonucleotides IMX1305 (5' cactgagtgacatcaaaatcatgGATGCAATGAAGAGAGGGC 3' - SEQ ID NO: 12) and IMX1306 (5' cgtaagaccgtttggtgccttggctagctcttctgaatcgggcatggatttcc 3' - SEQ ID NO: 13) and inserted in-frame with the N-terminus of the NP coding sequence in a number of plasmids as described by Geiser.
  • IMX1305 5' cactgagtgacatcaaaatcatgGATGCAATGAAGAGAGGGC 3' - SEQ ID NO: 12
  • IMX1306 5' cgtaagaccgtttggtgccttggctagct
  • oligonucleotide primers IMX1287 (5' ccattctgccgcatttgCagatctaagag 3' - SEQ ID NO: 14) and IMX1288 (5' CAAAAGGGAGATTTGCCTGTACTGAGAAC 3' - SEQ ID NO: 15) were used to amplify an internal fragment of the NP gene, and the resulting PCR product was inserted into NP-encoding plasmids as described by Geiser. Because both oligonucleotides were imperfectly matched to the NP gene, the insertion of the PCR product generated two point mutations.
  • the IMX1287 primer created the mutation E339A (GAA to GCA), whereas the IMX1288 primer created the mutation R416A in the NP gene (AGA to GCA).
  • the IMX313T coding sequence was amplified from the plasmid plMX497 using the oligonucleotide primers IMX1289 (SEQ ID NO: 10) and IMX051 (5' GTAGAAACAAGGGTATTTTTCTTtattaggagcgacggcgacgc 3' - SEQ ID NO: 16) and inserted into the various pcDNA3-NP-derived plasmids as described by Geiser.
  • mice Groups of five female BALB/C mice were immunized intramuscularly twice, 14 days apart, with various plasmid DNAs, using 20 ⁇ g of each plasmid per injection. Immune responses were measured on day 28, to determine the influence of various modifications: +/- IMX313 or IMX313T; +/- the tPA signal peptide; +/- the monomerizing mutations.
  • Antigen-specific T-cell responses were measured by ELISPOTs, using splenocytes, on day 28.
  • Purified spleen CD4+, CD8+ and Total T cells isolated from the immunized mice were co-cultured with NP A Influenza peptide (amino acids 366-374) purchased from Eurogentec.
  • ELISPOT Assays Flat-bottomed, 96-well nitrocellulose plates (Millititer; Millipore) were coated with IFN- ⁇ mAb ( ⁇ g/ml; MABTECH, Sweden) and incubated overnight at 4°C. After washing with PBS, plates were blocked with 10% fetal bovine serum for one hour at 37° C. 2x10 6 cells per well were stimulated with relevant peptides at a final concentration of 2 ⁇ g/ml (NP A Influenza peptide) on I PVH-membranes coated with 15 ⁇ g/ml anti-human I FN- ⁇ and incubated for 20 hours.
  • mice typically respond to influenza vaccines with a Th2-type immune response, which is associated with the stimulation of lgG1 antibodies.
  • Th2-type immune response the major antibody isotype present in the sera of mice that survive viral infections.
  • lgG2a the major antibody isotype present in the sera of mice that survive viral infections.
  • Th1 -type immune responses Huber. Stimulation of lgG2a antibodies has been associated with increased efficacy of influenza vaccination.
  • antigens were diluted to a concentration of 5 mg/ml in 0.1 M sodium carbonate/bicarbonate (pH 9.6) and were then used to coat the wells of MaxiSorb plates (Nunc-lmmulon, Denmark). Twofold serial dilutions of the test sera were added to the wells, and following washing, bound antibodies were detected with anti-mouse IgG, or anti-mouse lgG1 or anti-mouse lgG2a (Sigma) conjugated to horseradish peroxidase. Absorbance at 490 nm was determined after o-phenylenediamine (Sigma) and H 2 0 2 were added; the reactions were stopped with 1 M sulphuric acid.
  • IMX31 3 immunized mice showed significantly higher I FNy responses compared with those of the NP immunized mice and confirmed the ability of IMX31 3 to increase T cell responses.
  • Figure 2 shows that fusing the parental NP antigen gene to the IMX31 3 gene improves T cell responses to NP, even when the fusion protein is expressed in the cytosol.
  • Figure 3 shows that fusing the NP antigen gene to the IMX313 gene improves both CD4+ and CD8+ responses to the NP antigen.
  • NP-specific IgG Ab responses were measured in sera.
  • NP control mice and mice given NP-IMX313 showed moderate NP-specific IgG Abs (Fig. 4), which were higher in the group immunized with NP-IMX313.
  • Figure 4 shows that fusing the NP gene to the IMX313 gene improves IgG antibody responses to the NP antigen.
  • Sera were also examined for the presence of NP-specific lgG1 and lgG2a antibodies (representative of Th2 and Th1 types of response in Balb/C mice, respectively).
  • NP-specific lgG1 and lgG2a antibody isotypes were detected in the sera of the NP-IMX313 immunized mice; however serum samples from mice given NP alone showed only low levels of lgG1 and lgG2a Ab (Fig. 5).
  • Figure 5 shows the subclass distributions of the antibodies induced against the NP antigen. Fusion to the IMX313 gene improved the lgG2A response more than the lgG1 response, converting a Th2-biased response against NP to a Th1 -biased response against NP-IMX313.
  • Figure 6 shows that monomerisation of NP (NPm) improves its immunogenicity slightly (although the improvement is not statistically significant: NS); that NPm immunogenicity is further improved by fusion to the IMX313 gene; and finally that fusing the monomeric NP to the IMX313T gene further enhances NP immunogenicity. Surprisingly, monomerisation of NP does not decrease its immunogenicity.
  • Figure 7 shows that, on analysis of the CD4+ and CD8+ responses, the same rank ordering as in Figure 6 is seen: monomerisation of NP improves NP's immunogenicity slightly but not significantly (NS); NP's immunogenicity is further improved by fusion to the IMX313 gene, but that the largest improvement in NP immunogenicity is obtained by fusing the monomeric NP to the IMX313T gene.
  • Figure 8 shows that the same rank ordering is seen for B cell responses as was seen for T cell responses (both CD4+ and CD8+) in Figures 6 and 7.
  • Total IgG responses against NP were higher with IMX313T than with IMX313.
  • Figure 9 shows the subclass distributions of the antibodies induced by the monomeric NP antigen.
  • fusion to the IMX313 gene augmented the lgG2A responses more than the lgG1 responses, converting a Th2-biased response against NP (0.8) to a Th1 - biased response against NP-IMX313 (1.51 ).
  • Expression of lgG2a antibodies in the influenza vaccines is correlated with clearance of virus and increased protection against lethal influenza challenge. Increased induction of both antibody isotypes as measured by ELISA was a better correlate for vaccine efficacy than neutralization alone (Huber).
  • NP DNA vaccine constructs containing the tissue plasminogen activator (tPA) secretory signal sequence was made: tPA-NP, tPA-NPm, tPA-NPm-IMX313, and tPA-NPm- IMX313T.
  • tPA-NP tissue plasminogen activator
  • mice immunized with tPA containing constructs showed significantly higher IFNy responses compared with those of the NP immunized mice and confirmed the ability of IMX313T and the monomerizing mutations to increase T cell responses.
  • Figure 10 shows that forcing the secretion of the NP antigen improved its immunogenicity (NP versus tPA-NP), whether it was monomeric or not (tPA-NP versus tPA-NPm).
  • fusion to IMX313 showed that use of a monomeric version of NP was more immunogenic than use of the unmodified antigen (tPA-NP-IMX313 versus tPA-NPm- IMX313).
  • substitution of IMX313 by IMX313T further improved the immunogenicity of NP (tPA-NPm-IMX313 versus tPA-NPm-IMX313T).
  • Figure 11 shows the CD8+ and CD4+ responses to the different secreted versions of NP.
  • mice immunized with NP alone had no or very low levels of anti-NP IgG antibody in their sera (Fig.12)
  • Mice immunized with tPA-NP-IMX313, tPA- NPm-IMX313 or tPA-NPm-IMX313T showed high levels of systemic NP- specific IgG antibody responses; once again, the tPA-NPm-IMX313T immunized mice had significantly higher (p ⁇ 0.001 ) IgG antibody responses compared to all the other groups of immunized mice.
  • FIG. 13 shows the subclass analysis of the B cell responses to NP, and illustrates that the initial Th2 bias with NP alone is reversed by IMX313 and by IMX313T.
  • Th1 response LgG2a
  • a pET22-derived plasmid expressing the wild-type H1 N1 NP protein of strain A/WSN/33 (Tarus 2012b) with a C-terminal 6-His-tag was expressed in the bacterial strain C43R.
  • This strain was made by transforming C43(DE3) with the rare codon expressing plasmid pRARE2 (Novagen). Expression was induced with IPTG in TB (terrific broth) medium.
  • the overexpressed protein was purified initially as described by Ye and by Tarus for the clarification and ion-exchange steps, but in a final step the fusion protein was purified by affinity on Heparin Sepharose, and by gel filtration (Hi Prep 26/60 Sephacryl S-300) as described in the patent application PCT/EP2013/076289 filed on December 11 th , 2013.
  • the plasmid expressing NP was modified in two steps.
  • the monomerizing mutations were introduced as in Example 3, using the oligonucleotide primers IMX1287 (5' ccattctgccgcatttgCagatctaagag 3' - SEQ ID NO: 1 ) and IMX1288 (5' CAAAAG G G AG ATTTG CCTGTACTG AG AAC 3' - SEQ ID NO: 15).
  • the 6-His-tag was replaced by the IMX313T coding sequence, using the same oligonucleotide primers as in Example 4: IMX1289 (SEQ ID NO: 10) and IMX051 (5' GTAGAAACAAGGGTATTTTTCTTtattaggagcgacggcgacgc 3' - SEQ ID NO: 16).
  • IMX1289 SEQ ID NO: 10
  • IMX051 5' GTAGAAACAAGGGTATTTTTCTTtattaggagcgacggcgacgcgc 3' - SEQ ID NO: 16.
  • the PCR product was then inserted in place of the 6-His-tag as described by Geiser.
  • the NPm-IMX313T fusion protein was expressed in the same manner and strain as the NP protein, and purified using the same chromatographic steps.
  • mice Immunisations of mice were then performed to compare the immunogenicity of NPm- IMX31 3T, with or without formulation with the AddaVax adjuvant (Invivogen).
  • NP protein with or without formulation with the AddaVax adjuvant, was used as a control.
  • mice 4 groups of (five) female BALB/c mice were immunized subcutaneously twice, with a 14 day interval, using 2( g of each protein per injection.
  • the induction of antigen-specific T-cell responses were measured by ELISPOTs, using splenocytes, on day 28.
  • Purified spleen CD4+, CD8+ and Total T cells isolated from the immunized mice were co-cultured with NP protein or Influenza A NP (366-374) peptide. Pre-immune and day 28 antibody responses were measured by ELISAs with NP as antigen.
  • Example 9 - IMX313T is not degraded by proteases on passage through secretion pathways
  • the plasmid expressing NPm-IMX313T was modified by substituting the IMX313P gene in place of the IMX313T gene, by exchanging a restriction fragment (Pml l-Hind III) from a plasmid encoding IMX313P in place of the corresponding fragment in the plasmid encoding the NPM-IMX313T protein. Then the fusion protein was expressed and purified as in Example 7. Figure 19 shows the purified protein; the principal band is the monomer, but oligomeric forms are also visible (on the overloaded gel) above the principal band.
  • Example 1 1 - Production of hyperimmune antisera to IMX313P
  • a group of five female BALB/C mice were immunized intramuscularly six times, at 14 day intervals, with the IMX313P protein using 50 ⁇ g per injection.
  • Sera were tested for IgG antibodies by using a modified ELISA method.
  • Protamine sulfate Grade X (Sigma), IMX313 or IMX313P were used to coat the wells of the microplate to capture antibodies.
  • the detection antibodies were goat-anti-mouse IgG-HRP (Sigma), which was reacted with hydrogen peroxide to produce the absorbance readings at 405 nm.
  • Antrobus RD Lillie PJ, Berthoud TK, Spencer AJ, McLaren JE, Ladell K, Lambe T, Milicic A, Price DA, Hill AV, Gilbert SC. (2012) A T cell-inducing influenza vaccine for the elderly: safety and immunogenicity of MVA-NP+M1 in adults aged over 50 years. PLoS One. 7:e48322.
  • C4-binding protein acts as an adjuvant, and the fusion protein comprised of the 19-kilodalton merozoite surface protein 1 fused with the murine C4bp domain protects mice against malaria.
  • C4bp C4-binding protein
  • Influenza A virus nucleoprotein is a major target antigen for cross-reactive anti-influenza A virus cytotoxic T lymphocytes. Proc Natl Acad Sci U S A. 82: 1785-1789.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Virology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Pulmonology (AREA)
  • Toxicology (AREA)
  • Epidemiology (AREA)
  • Microbiology (AREA)
  • Communicable Diseases (AREA)
  • Mycology (AREA)
  • Wood Science & Technology (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • AIDS & HIV (AREA)
  • Hematology (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)
PCT/EP2014/055438 2013-03-18 2014-03-18 Influenza nucleoprotein vaccines Ceased WO2014147087A1 (en)

Priority Applications (11)

Application Number Priority Date Filing Date Title
CN201480013364.1A CN105143251B (zh) 2013-03-18 2014-03-18 流感核蛋白疫苗
AU2014234363A AU2014234363B2 (en) 2013-03-18 2014-03-18 Influenza nucleoprotein vaccines
BR112015023738A BR112015023738B8 (pt) 2013-03-18 2014-03-18 Vacinas de nucleoproteina influenza
EP14710594.4A EP2976357B1 (en) 2013-03-18 2014-03-18 Influenza nucleoprotein vaccines
RU2015140603A RU2662667C2 (ru) 2013-03-18 2014-03-18 Вакцины на основе нуклеопротеина вируса гриппа
KR1020157029403A KR102379951B1 (ko) 2013-03-18 2014-03-18 인플루엔자 핵단백질 백신
JP2016503642A JP2016520534A (ja) 2013-03-18 2014-03-18 インフルエンザ核タンパク質ワクチン
MX2015013304A MX363149B (es) 2013-03-18 2014-03-18 Vacunas de nucleoproteina de la influenza.
CA2901888A CA2901888C (en) 2013-03-18 2014-03-18 Influenza nucleoprotein vaccines
US14/570,155 US9243047B2 (en) 2013-03-18 2014-12-15 Influenza nucleoprotein vaccines
US14/975,918 US9963490B2 (en) 2013-03-18 2015-12-21 Influenza nucleoprotein vaccines

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP13305320.7 2013-03-18
EP13305320 2013-03-18

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US14/570,155 Continuation US9243047B2 (en) 2013-03-18 2014-12-15 Influenza nucleoprotein vaccines

Publications (1)

Publication Number Publication Date
WO2014147087A1 true WO2014147087A1 (en) 2014-09-25

Family

ID=48044708

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2014/055438 Ceased WO2014147087A1 (en) 2013-03-18 2014-03-18 Influenza nucleoprotein vaccines

Country Status (11)

Country Link
US (2) US9243047B2 (enExample)
EP (1) EP2976357B1 (enExample)
JP (1) JP2016520534A (enExample)
KR (1) KR102379951B1 (enExample)
CN (2) CN113307881A (enExample)
AU (1) AU2014234363B2 (enExample)
BR (1) BR112015023738B8 (enExample)
CA (1) CA2901888C (enExample)
MX (1) MX363149B (enExample)
RU (1) RU2662667C2 (enExample)
WO (1) WO2014147087A1 (enExample)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2931896B1 (en) * 2012-12-11 2019-01-16 Osivax SAS Modified coiled coil type proteins having improved properties
WO2023025864A1 (en) 2021-08-24 2023-03-02 Osivax Immunogenic compositions and their use
WO2023117742A1 (en) 2021-12-22 2023-06-29 Osivax Vaccine compositions and their use
WO2023180394A1 (en) 2022-03-22 2023-09-28 Osivax Mrna vaccine compositions and their use

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3941519A4 (en) * 2019-03-21 2023-01-18 Georgia State University Research Foundation, Inc. VIRUS-LIKE PARTICLES AND THEIR USES
CN115779079A (zh) * 2022-10-01 2023-03-14 中国人民解放军军事科学院军事医学研究院 一种可增强与佐剂协同免疫效力的电荷调控型抗原蛋白
CN117659138B (zh) * 2023-12-25 2025-04-08 华中农业大学 一种流感病毒np蛋白突变体及其应用

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005014654A2 (en) * 2003-08-12 2005-02-17 Avidis Sa Product comprising a c4bp core protein and a monomeric antigen, and its use
WO2007062819A2 (en) * 2005-11-30 2007-06-07 Imaxio Multimeric complexes of antigens and an adjuvant
WO2011045612A1 (en) * 2009-10-16 2011-04-21 Isis Innovation Limited Mycobacterial vaccines

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
IL108915A0 (en) * 1993-03-18 1994-06-24 Merck & Co Inc Polynucleotide vaccine against influenza virus
WO1999012036A1 (en) * 1997-09-04 1999-03-11 Stanford University Reversible immobilization of arginine-tagged moieties on a silicate surface
WO2004016283A2 (en) * 2002-08-14 2004-02-26 Avidis Sa Heteropolymeric compound comprising a scaffold, an adjuvant and an antigen, and its use
EP2060586A1 (en) * 2007-11-14 2009-05-20 PharmaSurgics in Sweden AB New synthetic arginine substituted peptides and their use
BR112015013387B8 (pt) * 2012-12-11 2023-01-10 Osivax Sas Proteínas tipo coiled-coil modificadas possuindo propriedades melhoradas

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005014654A2 (en) * 2003-08-12 2005-02-17 Avidis Sa Product comprising a c4bp core protein and a monomeric antigen, and its use
WO2007062819A2 (en) * 2005-11-30 2007-06-07 Imaxio Multimeric complexes of antigens and an adjuvant
WO2011045612A1 (en) * 2009-10-16 2011-04-21 Isis Innovation Limited Mycobacterial vaccines

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
KACPRZAK MAGDALENA M ET AL: "Inhibition of furin by polyarginine-containing peptides - Nanomolar inhibition by NONA-D-arginine", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 279, no. 35, 27 August 2004 (2004-08-27), pages 36788 - 36794, XP002698956, ISSN: 0021-9258 *
KIBLER KAREN V ET AL: "Polyarginine inhibits gp160 processing by furin and suppresses productive human immunodeficiency virus type 1 infection", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 279, no. 47, 19 November 2004 (2004-11-19), pages 49055 - 49063, XP002698955, ISSN: 0021-9258 *
OGUN SOLABOMI A ET AL: "The oligomerization domain of C4-binding protein (C4bp) acts as an adjuvant, and the fusion protein comprised of the 19-kilodalton merozoite surface protein 1 fused with the murine C4bp domain protects mice against malaria", INFECTION AND IMMUNITY, AMERICAN SOCIETY FOR MACROBIOLOGY, USA, vol. 76, no. 8, 1 August 2008 (2008-08-01), pages 3817 - 3823, XP009106276, ISSN: 0019-9567, DOI: 10.1128/IAI.01369-07 *
SMITH J C ET AL: "Chemical synthesis and cloning of a poly(arginine)-coding gene fragment designed to aid polypeptide purification", GENE, ELSEVIER, AMSTERDAM, NL, vol. 32, no. 3, 1 December 1984 (1984-12-01), pages 321 - 327, XP025682441, ISSN: 0378-1119, [retrieved on 19841201], DOI: 10.1016/0378-1119(84)90007-6 *
SPENCER ALEXANDRA J ET AL: "Fusion of the Mycobacterium tuberculosis Antigen 85A to an Oligomerization Domain Enhances Its Immunogenicity in Both Mice and Non-Human Primates", PLOS ONE, vol. 7, no. 3, March 2012 (2012-03-01), XP002698954 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2931896B1 (en) * 2012-12-11 2019-01-16 Osivax SAS Modified coiled coil type proteins having improved properties
WO2023025864A1 (en) 2021-08-24 2023-03-02 Osivax Immunogenic compositions and their use
WO2023117742A1 (en) 2021-12-22 2023-06-29 Osivax Vaccine compositions and their use
WO2023180394A1 (en) 2022-03-22 2023-09-28 Osivax Mrna vaccine compositions and their use

Also Published As

Publication number Publication date
KR20150131292A (ko) 2015-11-24
MX363149B (es) 2019-03-11
CN105143251B (zh) 2021-05-11
BR112015023738B8 (pt) 2023-02-14
BR112015023738A2 (pt) 2017-11-21
US9243047B2 (en) 2016-01-26
CA2901888A1 (en) 2014-09-25
EP2976357B1 (en) 2018-10-17
AU2014234363A1 (en) 2015-09-03
CA2901888C (en) 2023-06-20
RU2662667C2 (ru) 2018-07-26
RU2015140603A (ru) 2017-04-21
US9963490B2 (en) 2018-05-08
US20150098958A1 (en) 2015-04-09
EP2976357A1 (en) 2016-01-27
KR102379951B1 (ko) 2022-03-31
US20160215032A1 (en) 2016-07-28
MX2015013304A (es) 2015-12-15
JP2016520534A (ja) 2016-07-14
CN105143251A (zh) 2015-12-09
CN113307881A (zh) 2021-08-27
BR112015023738B1 (pt) 2023-01-10
AU2014234363B2 (en) 2018-02-15

Similar Documents

Publication Publication Date Title
JP7250878B2 (ja) 新規多価ナノ粒子に基づくワクチン
US9963490B2 (en) Influenza nucleoprotein vaccines
EP3166963B1 (en) Influenza virus vaccines and uses thereof
JP7655849B2 (ja) ヘマグルチニン(ha)タンパク質内の非ドミナントエピトープに対する免疫応答を誘起するためのベクター
CN104066446B (zh) 流感病毒疫苗及其用途
CN105452270B (zh) 流行性感冒病毒疫苗及其用途
AU2025201644B2 (en) Chimeric influenza vaccines
Deng et al. Protein nanoparticle vaccine based on flagellin carrier fused to influenza conserved epitopes confers full protection against influenza A virus challenge
CN106559986A (zh) 多价流感病毒样颗粒(vlp)及其作为疫苗的用途
US9896484B2 (en) Influenza virus recombinant proteins
Baranowska et al. Targeting of nucleoprotein to chemokine receptors by DNA vaccination results in increased CD8+-mediated cross protection against influenza
CN117693359A (zh) 作为免疫原的广泛反应性病毒抗原、其组合物和使用方法
WO2025179103A1 (en) Pentavalent and octavalent influenza virus immunogens, compositions and methods of use thereof
HK1236966A1 (en) Influenza virus vaccines and uses thereof
HK1236966B (en) Influenza virus vaccines and uses thereof

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 201480013364.1

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14710594

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2901888

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2014234363

Country of ref document: AU

Date of ref document: 20140318

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2014710594

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2016503642

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: MX/A/2015/013304

Country of ref document: MX

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 20157029403

Country of ref document: KR

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2015140603

Country of ref document: RU

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112015023738

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112015023738

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20150915