WO2014115816A1 - Micro-organismes comportant une voie de fixation du dioxyde de carbone qui a été introduite dans ceux-ci - Google Patents

Micro-organismes comportant une voie de fixation du dioxyde de carbone qui a été introduite dans ceux-ci Download PDF

Info

Publication number
WO2014115816A1
WO2014115816A1 PCT/JP2014/051403 JP2014051403W WO2014115816A1 WO 2014115816 A1 WO2014115816 A1 WO 2014115816A1 JP 2014051403 W JP2014051403 W JP 2014051403W WO 2014115816 A1 WO2014115816 A1 WO 2014115816A1
Authority
WO
WIPO (PCT)
Prior art keywords
acid
coa
microorganism
enzyme
enzymatic reaction
Prior art date
Application number
PCT/JP2014/051403
Other languages
English (en)
Japanese (ja)
Inventor
亮太 藤井
松本　佳子
友則 秀崎
Original Assignee
三井化学株式会社
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 三井化学株式会社 filed Critical 三井化学株式会社
Publication of WO2014115816A1 publication Critical patent/WO2014115816A1/fr

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/24—Preparation of oxygen-containing organic compounds containing a carbonyl group
    • C12P7/26—Ketones
    • C12P7/28—Acetone-containing products
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/14—Glutamic acid; Glutamine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C12P7/44—Polycarboxylic acids
    • C12P7/50—Polycarboxylic acids having keto groups, e.g. 2-ketoglutaric acid

Definitions

  • the present invention relates to a microorganism into which a carbon dioxide fixation pathway is introduced, and a substance production method using the microorganism.
  • Acetyl CoA is one of the most important intermediates in the metabolic pathway of microorganisms.
  • Various metabolites are produced via acetyl CoA.
  • substances produced via acetyl CoA include, for example, amino acids such as L-glutamic acid, L-glutamine, L-proline, L-arginine, L-leucine, L-isoleucine; acetic acid, propionic acid, butyric acid , Organic acids such as caproic acid, citric acid, 3-hydroxybutyric acid, 3-hydroxyisobutyric acid, 3-aminoisobutyric acid, 2-hydroxyisobutyric acid, methacrylic acid, poly-3-hydroxybutyric acid; isopropyl alcohol, ethanol, butanol, etc. Alcohols; acetone; polyglutamic acid; and the like are known.
  • 2-Oxoglutaric acid ( ⁇ -ketoglutaric acid) is also an extremely important intermediate in the metabolic pathway of microorganisms.
  • Various substances such as L-glutamic acid, L-glutamine, and L-arginine are converted from 2-oxoglutaric acid ( ⁇ -ketoglutaric acid).
  • 2-Oxoglutaric acid is a metabolite on the TCA cycle (tricarboxylic acid cycle), and is produced from sugar via acetyl CoA.
  • acetyl CoA is produced using a sugar such as glucose as a carbon source.
  • Sugar is converted into pyruvate via metabolic pathways called glycolytic pathways such as the Emden-Meyerhof pathway, Entner-Doudoroff pathway, and pentose-phosphate pathway. It is converted into acetyl CoA by the action of lyase or the like.
  • carbon dioxide (CO 2 ) and formic acid are produced as by-products, not all of the carbon derived from the sugar is fixed as acetyl CoA.
  • CO 2 is fixed and used as a carbon source in the body of microorganisms
  • a Calvin Benson circuit a reductive TCA circuit, a Wood-Ljungdahl pathway, a 3-hydroxypropionic acid circuit, and a 4-hydroxybutyric acid circuit.
  • the Calvin Benson circuit is a CO 2 fixation circuit consisting of about 12 kinds of enzymes present in plants and photosynthetic bacteria.
  • CO 2 is fixed by ribulose-1,5-bisphosphate carboxylase (RubisCO). Glyceraldehyde 3-phosphate is produced.
  • the reductive TCA circuit is a circuit found in anaerobic bacteria and microaerobic bacteria including green sulfur bacteria. It consists of 11 kinds of enzymes, and is a CO 2 -fixing enzyme (acetyl CoA carboxylase and 2 -Oxoglutarate synthase), and produces pyruvic acid from CO 2 by reaction in the reverse direction of the normal TCA cycle.
  • the Wood-Ljungdahl pathway is a pathway found in anaerobic microorganisms such as acetic acid producing bacteria and consists of nine enzymes. Formate dehydrogenase, CO dehydrogenase, etc. reduce formic acid on CO 2 or coenzyme, and finally acetyl Convert to CoA.
  • the 3-hydroxypropionic acid circuit is a circuit found in chloroflexus bacteria and the like, and is composed of 13 enzymes. CO 2 is immobilized by the action of acetyl CoA (propionyl CoA) carboxylase, and acetylated via malonyl CoA or the like. Produce CoA.
  • the 4-hydroxybutyric acid cycle is a pathway existing in archaea and the like, which fixes CO 2 by the reaction of pyruvate synthase, acetyl CoA (propionyl CoA) carboxylase, and phosphoenolpyruvate carboxylase, and produces 4-hydroxybutyryl CoA, etc. To produce acetyl-CoA.
  • 2011/099006 proposes a circuit for fixing CO 2 via a carbonic acid fixing reaction on acetyl CoA or a reduction reaction of malonyl CoA.
  • German Offenlegungsschrift 102007059248 proposes acetyl CoA production by a route similar to the 4-hydroxybutyric acid cycle.
  • the known carbonic acid fixation pathway is not necessarily efficient from the viewpoint of fixing useful CO 2 and producing useful compounds derived from acetyl-CoA.
  • the Calvin Benson circuit is well known as the natural carbon fixation pathway, but RubisCO, which is responsible for carbon fixation, has a slow reaction rate and side reactions such as oxidative degradation. No (Journal of Bioscience and Bioengineering, 2002; 94 (6): 497-505).
  • the Wood-Ljungdahl route, the route disclosed in WO2009 / 094485, the route disclosed in WO2010 / 071697, and the route disclosed in WO2009 / 046929 are CO 2 including a path for reducing 2 to CO or formic acid, thus strong enzyme reduction reaction catalyzing often do not act only in a reducing environment, the reduction reaction on difficult under normal conditions In addition, it is not easy to introduce the enzyme other than absolutely anaerobic microorganisms. In the reductive TCA circuit, the reduction reaction by pyruvate synthase and the reduction reaction by 2-oxoglutarate synthase require a strong reducing power using ferredoxin as an electron acceptor, and the progress of the reaction is not easy.
  • the 4-hydroxybutyric acid cycle, the 3-hydroxypropionic acid cycle, the route described in WO 2009/046929, and the route described in WO 2011/099006 are succinyl CoA reduction or malonyl CoA.
  • the reduction reaction of carboxylic acid or its (thio) ester is used, such as reduction, such a reaction is generally difficult as an enzyme reaction, and it is desirable to avoid it as much as possible as a fermentation route.
  • the 4-hydroxybutyric acid cycle goes through a dehydration reaction such as the dehydration of 4-hydroxybutyryl CoA or the dehydration of 3-hydroxypropionic acid. There is a problem of competing with.
  • the 4-hydroxybutyric acid cycle, the 3-hydroxypropionic acid cycle, and the reductive TCA cycle convert maltyl-CoA synthase and pyruvate synthase into acetyl-CoA produced in the circuit to another substance. Therefore, it is not necessarily efficient from the viewpoint of production of acetyl CoA.
  • the carbonic acid fixation pathway reported so far often passes through an intermediate having an aldehyde group that is relatively highly toxic to living organisms, such as malonic acid semialdehyde. No route has been reported so far that satisfies the above conditions 1) to 3) but does not pass through a substance having a concern about toxicity such as an intermediate having an aldehyde group.
  • the purpose is to increase the production amount of 2-oxoglutaric acid, from the viewpoint of production of 2-oxoglutaric acid, not only the efficiency of production of acetyl CoA but also from acetyl CoA to 2-oxoglutaric acid It is preferable to increase the efficiency as much as possible with respect to the route.
  • the yield of acetyl CoA increases, the yield of substances derived from acetyl CoA (for example, glutamic acid, isopropyl alcohol, etc.) also increases (International Publication No. 2012/069247). Therefore, the effect of the CO 2 fixation pathway can be evaluated by the amount of the substance derived from acetyl CoA.
  • the present invention was made under the above situation.
  • An object of the first invention is to provide a microorganism useful for efficiently producing acetyl CoA using carbon dioxide.
  • an object of the first invention is to provide a method for producing acetyl-CoA and a useful metabolite derived from acetyl-CoA using the microorganism.
  • the first invention for solving the above-mentioned problems is as follows.
  • At least one enzyme reaction selected from the group consisting of (a) and (b) below, and the enzyme reactions (c), (d), (e), (f) and (g) below, The following (h) enzyme reaction, the following (i), (j), (k) and (n) enzyme reaction, and the following (i), (j), (l), (m) and (n)
  • a microorganism having a pathway comprising: (a) an enzyme reaction from phosphoenolpyruvate to oxaloacetate, (b) an enzyme reaction from pyruvate to oxaloacetate, (at least one selected from the group consisting of: c) Enzymatic reaction from oxaloacetic acid to malic acid, (d) Enzymatic reaction from malic acid to malyl-CoA, (e) Enzymatic reaction from malyl-CoA to glyoxylic acid and acetyl-CoA, (f) From
  • [A2] The microorganism according to [A1], wherein (d), (e), and (f) are a given enzyme reaction.
  • [A3] A microorganism having none of the following (o), (p), (q), (r) and (s) is added to the following (o), (p), (q) and (r) Without giving any, or giving one or more of the following (o), (p), (q) and (r), the ability to produce acetyl CoA was enhanced without exerting its function, [ A1] or the microorganism according to [A2]: (o) a carbonic acid fixation circuit having an enzymatic reaction from malonyl CoA to malonic acid semialdehyde or 3-hydroxypropionic acid, (p) from acetyl CoA and CO 2 to pyruvic acid A carbonic acid fixation circuit having an enzymatic reaction, (q) a carbonic acid fixation circuit having an enzymatic reaction from crotonyl CoA and CO 2 to
  • [A5] The microorganism according to any one of [A1] to [A4] obtained by adding malate thiokinase, malyl-CoA lyase, and glycine transaminase
  • [A6] The microorganism according to any one of [A1] to [A5], which is a microorganism belonging to or a coryneform bacterium.
  • the microorganism according to one.
  • [A8] A method for producing isopropyl alcohol, comprising producing isopropyl alcohol from a carbon source material using the microorganism according to any one of [A1] to [A7].
  • [A9] A method for producing acetone, comprising producing acetone from a carbon source material using the microorganism according to any one of [A1] to [A7].
  • [A10] A method for producing glutamic acid comprising producing glutamic acid from a carbon source material using the microorganism according to any one of [A1] to [A7].
  • An acetyl-CoA production method comprising: [A12] The acetyl CoA according to [A11], further comprising a supply step of supplying at least one selected from the group consisting of carbonate ions, hydrogen carbonate ions, carbon dioxide gas, and a reducing agent to a medium used for culture. Production method. [A13] The acetyl-CoA production method according to [A11] or [A12], further including a gas supply step of collecting a gas containing carbon dioxide generated by the culture and supplying the gas to a medium used for the culture.
  • [A14] A culturing step in which the microorganism according to any one of [A1] to [A7] and a carbon source material are brought into contact with each other, and acetyl CoA obtained by the contact as an intermediate
  • a method for producing a metabolite having acetyl-CoA as an intermediate the method comprising a recovery step of recovering the metabolite.
  • the acetyl CoA according to [A14] further comprising a supply step of supplying at least one selected from the group consisting of carbonate ions, hydrogen carbonate ions, carbon dioxide gas, and a reducing agent to a medium used for culture.
  • the intermediate comprising the acetyl CoA according to [A14] or [A15], further comprising a gas supply step of recovering a gas containing carbon dioxide generated by the culture and supplying the gas to a medium used for the culture.
  • Metabolite production method [A17]
  • the metabolite having acetyl CoA as an intermediate according to any one of [A14] to [A16], wherein the metabolite having acetyl CoA as an intermediate is isopropyl alcohol, acetone, or glutamic acid. Production method.
  • the enzyme reaction of (t) is catalyzed by at least one selected from the group consisting of pyruvate kinase and pyruvate carboxylase, phosphoenolpyruvate carboxylase, and phosphoenolpyruvate carboxykinase,
  • the enzymatic reaction of (u) is catalyzed by malate dehydrogenase
  • the enzymatic reaction of (v) is catalyzed by malate thiokinase
  • the enzymatic reaction of (w) is catalyzed by malyl-CoA lyase
  • the enzyme reaction of (y) is catalyzed by 4-hydroxy-2-oxoglutarate dehydratase
  • the enzyme reaction of (z) is The microorganism according to [B1], which is catalyzed by 4-oxoglutaconic acid reduct
  • [B5] A culture step of culturing the microorganism according to any one of [B1] to [B4] by contacting with the carbon source material, and a recovery step of recovering a target product obtained by the contact And a method for producing 2-oxoglutarate.
  • the method according to [B5] further includes a supplying step of supplying at least one selected from the group consisting of carbonate ions, hydrogen carbonate ions, carbon dioxide gas, and a reducing agent to a medium used for culture. Oxoglutaric acid production method.
  • a microorganism useful for efficiently producing acetyl CoA using carbon dioxide is provided.
  • the manufacturing method of the useful metabolite derived from acetyl-CoA and acetyl-CoA is provided using the said microorganisms.
  • a microorganism useful for efficiently producing 2-oxoglutaric acid using carbon dioxide According to the second invention, there is provided a production method for producing 2-oxoglutaric acid or glutamic acid using the microorganism.
  • FIG. 4 is a route diagram for explaining an outline of a route for producing 2-oxoglutaric acid according to the second invention.
  • a microorganism having a carbon dioxide fixation pathway via glycine includes at least one enzyme reaction selected from the group consisting of (a) and (b) below, and (c) and (d) below: , (E), (f) and (g), the following (h) enzymatic reaction, the following (i), (j), (k) and (n) enzymatic reactions, and the following (i) , (J), (l), (m) and at least one selected from the group consisting of (n) enzyme reactions, and a microorganism having a pathway (hereinafter also referred to as “acetyl-CoA-producing microorganism”). It is.
  • A Enzymatic reaction from phosphoenolpyruvate to oxaloacetate.
  • B Enzymatic reaction from pyruvate to oxaloacetate.
  • C Enzymatic reaction from oxaloacetic acid to malic acid.
  • D Enzymatic reaction from malic acid to malyl CoA.
  • E Enzymatic reaction from malyl CoA to glyoxylic acid and acetyl CoA.
  • F Enzymatic reaction from glyoxylic acid to glycine.
  • G Enzymatic reaction from glycine to serine.
  • H Enzymatic reaction from serine to pyruvate.
  • I Enzymatic reaction from serine to 3-hydroxypyruvic acid.
  • (J) Enzymatic reaction from 3-hydroxypyruvic acid to glyceric acid.
  • (K) Enzymatic reaction from glyceric acid to 2-phosphoglyceric acid.
  • (L) Enzymatic reaction from glyceric acid to 3-phosphoglyceric acid.
  • (M) Enzymatic reaction from 3-phosphoglycerate to 2-phosphoglycerate.
  • (N) Enzymatic reaction from 2-phosphoglycerate to phosphoenolpyruvate.
  • Acetyl CoA producing microorganism according to the first invention by having a path including a given enzyme reaction can efficiently immobilize CO 2 and CO 2 that is supplied from the outside occurs in the glucose metabolism. Moreover, the acetyl-CoA producing microorganism according to the first invention can efficiently convert CO 2 into acetyl-CoA.
  • Metabolites such as isopropyl alcohol, ethanol, acetone, citric acid, itaconic acid, acetic acid, butyric acid
  • the microorganism having the 2-oxoglutarate production pathway (hereinafter sometimes referred to as “2-oxoglutarate-producing microorganism”) according to the second invention is the following (t), (u), (v), ( w), (x), (y) and (z) are microorganisms having a pathway including the enzyme reaction.
  • U Enzymatic reaction from oxaloacetic acid to malic acid.
  • V Enzymatic reaction from malic acid to malyl-CoA.
  • W Enzymatic reaction from malyl CoA to glyoxylic acid and acetyl CoA.
  • Z Enzymatic reaction from 4-oxoglutaconic acid to 2-oxoglutaric acid.
  • 2-oxoglutarate producing microorganism according to the second invention by having a path including a given enzyme reaction can efficiently immobilize CO 2 and CO 2 that is supplied from the outside occurs in the glucose metabolism.
  • the 2-oxoglutarate-producing microorganism according to the second invention can efficiently produce 2-oxoglutarate and glutamate.
  • the method for producing 2-oxoglutarate according to the second invention is provided using the microorganism for producing 2-oxoglutarate according to the second invention.
  • 2-Oxoglutaric acid is converted to glutamic acid by a transfer reaction of an amino group. Therefore, the method for producing glutamic acid according to the second invention, using the 2-oxoglutarate-producing microorganism according to the second invention, in the same manner as the glutamic acid fermentation pathway described in “Fermentation Handbook” (Kyoritsu Shuppan) etc. Is provided.
  • circuit refers to a path that starts from an arbitrary substance on a path, is converted to another substance via the path, and is finally converted to the same substance as the start.
  • path refers to a series of reactions by an enzymatic reaction and / or a spontaneous chemical reaction in a fermenter.
  • the path may be a circuit or may not be a circuit. Therefore, the carbonic acid fixing path (carbon dioxide fixing path) includes a carbonic acid fixing circuit (carbon dioxide fixing circuit).
  • carbon dioxide (CO 2) fixed in the present invention, refers to the conversion of CO 2 and / or CO 2 that is supplied from the outside occurs in the glucose metabolism to organic compounds. CO 2 may be HCO 3 — .
  • carbon dioxide (CO 2 ) fixation is sometimes referred to as “carbonic acid fixation”.
  • the “enzyme” in the present invention includes “factor” which does not exhibit enzyme activity by itself unless otherwise specified.
  • “Inactivation” of enzyme activity in the present invention refers to a state in which the enzyme activity measured by any existing measurement system is 1/10 or less when the enzyme activity in the microorganism before inactivation is defined as 100.
  • “reduction” of enzyme activity refers to a state in which when a gene encoding an enzyme is treated by genetic recombination technology, the enzyme activity is significantly lower than the state before the treatment. Point to.
  • the term “enhancement” of enzyme activity in the present invention broadly means that the enzyme activity in a microorganism before the enhancement increases after the enhancement.
  • the method of strengthening is not particularly limited as long as the activity of the enzyme possessed by the microorganism is increased, by strengthening by introducing the enzyme gene into the cell from outside the cell, or by enhancing the expression of the enzyme gene in the cell. Strengthening and combinations thereof may be mentioned.
  • the introduction of an enzyme gene from outside the cell into the cell can be carried out by using a gene recombination technique to encode a gene encoding an enzyme that is more active than the host's original enzyme.
  • the enhancement by enhancing the expression of the enzyme gene in the cell includes introducing a nucleotide sequence that enhances the expression of the enzyme gene into the cell from outside the host; the host possesses it in the genome Enhancing the expression of the enzyme gene by enhancing the promoter activity of the enzyme gene; Enhancing the expression of the enzyme gene by replacing the promoter of the enzyme gene held in the genome with another promoter; and these Can be mentioned.
  • “giving” enzyme activity broadly means that an enzyme gene is introduced into the cell from outside the cell to give the target enzyme activity to a microorganism that cannot find the target enzyme activity.
  • the method of providing is not particularly limited as long as the target enzyme activity is given to the microorganism, and can be performed by a gene recombination technique. Specific examples include transformation with a plasmid carrying the enzyme gene; introduction of the enzyme gene into the genome; and combinations thereof.
  • the introduced enzyme gene may be homologous or heterologous to the host cell.
  • “Granting” an enzyme activity related to a circuit or pathway of substance metabolism means that the circuit or pathway of substance metabolism is functionally constructed as a result of imparting the enzyme activity, and the method of granting depending on the host Can be selected.
  • does not perform its function even if a carbonic acid fixation circuit is imparted means that an enzyme gene is introduced from the outside into a microorganism that does not find the target enzyme activity, It indicates that the carbon fixation circuit is not functioning. That "no carbonate fixing circuit is functioning" is test using labeled CO 2, the label from CO 2 in material derived from metabolites thereof or metabolites in the circuit is not detected, or circuit in It can be indirectly grasped by, for example, no increase in the sugar yield of the substance derived from the metabolite.
  • the promoter used for “enhancement” or “giving” of enzyme activity is not particularly limited as long as it can express a gene, and a constitutive promoter or an inducible promoter can be used.
  • KEGG Knowles Genes and Genomes, http://www.genome.jp/kegg/
  • NCBI National Center for biotechnology information, ⁇ ⁇ ⁇ http://www.ncbi.nlm.nih.gov/gene/).
  • KEGG Knowles Genes and Genomes
  • NCBI National Center for biotechnology information
  • ⁇ ⁇ ⁇ http://www.ncbi.nlm.nih.gov/gene/ only the genetic information of microorganisms registered in KEGG or NCBI is used.
  • the phrase “by gene recombination technology” means that the base sequence is changed by inserting another DNA into the native gene, replacing or deleting a part of the gene, or a combination thereof. All may be included, for example, the result of a mutation.
  • the microorganism in which the activity of the factor or enzyme is inactivated refers to a microorganism in which the intrinsic activity of the factor or enzyme is impaired by some method.
  • the microorganism can be produced by, for example, disrupting a gene encoding a factor or enzyme (gene disruption).
  • Examples of gene disruption in the present invention include insertion of another DNA into the gene so that the function of the gene is not exhibited, and mutation of the base sequence by substitution or deletion of a certain part of the gene. It is done.
  • the gene is not transcribed into mRNA and the protein is not translated, or the transcribed mRNA is incomplete and the amino acid sequence of the translated protein is mutated or deleted, resulting in the original function. Demonstrate becomes impossible.
  • the gene-disrupted strain can be produced by any method as long as a disrupted strain that does not express an enzyme or protein is obtained.
  • Various methods of gene disruption have been reported (natural breeding, addition of mutagen, ultraviolet irradiation, irradiation, introduction of random mutation, transposon insertion or transfer, site-specific gene disruption), but specific genes Gene disruption by homologous recombination is preferable in that it can only be disrupted.
  • Homologous recombination methods are: JournalJof Bacteriology, 1985; 161 (3): 1219-1221, Journal of Bacteriology, 1995; 177 (6): 1511-1519, Proceedings of the National Academy of Sciences of the United States of America , 2000; 97 (12): 6640-6645, which can be easily implemented by those skilled in the art by these methods and their applications.
  • “(native) does not have” means that the host microorganism does not inherently exist in nature.
  • the “host” in the present invention means a microorganism to which one or more genes are introduced from the outside.
  • the “host” is in a state where one or a plurality of genes can be exerted as a result of the introduction of one or more genes from the outside.
  • the “host” in the present invention may have a production path for useful metabolites.
  • the “useful metabolite” in the present invention means a general term for main metabolites in the metabolic pathway of microorganisms such as alcohol, amino acid, organic acid, terpenes and the like.
  • the “host” may be any microorganism that can have the ability to produce a useful metabolite by using any means regardless of whether or not it originally has the ability to produce a useful metabolite.
  • the classification of the enzyme referred to in the present specification is a classification based on the report of the International Union of Biochemistry (IUB) Enzyme Committee, and the “enzyme number” is the enzyme number based on the report of the IUB Enzyme Committee. It is.
  • metabolite having acetyl CoA as an intermediate and “(useful) metabolite derived from acetyl CoA” means (useful) metabolism produced via acetyl CoA on the metabolic pathway. It means the general term for products.
  • the alcohol include isopropyl alcohol, ethanol, and butanol.
  • amino acids include L-glutamic acid, L-glutamine, L-arginine, L-ornithine, L-citrulline, L-leucine, L-isoleucine, and L-proline.
  • organic acids examples include 2-oxoglutaric acid, 3-hydroxybutyric acid, poly-3-hydroxybutyric acid, polyglutamic acid, 3-hydroxyisobutyric acid, 3-aminoisobutyric acid, 2-hydroxyisobutyric acid, methacrylic acid, citric acid, and acetic acid , Propionic acid, butyric acid, caproic acid, and mevalonic acid.
  • terpenes examples include isoprene, squalene, steroids, and carotenoids. Another example is acetone.
  • production of acetyl CoA means that some substance is converted to acetyl CoA on the metabolic pathway.
  • Acetyl-CoA is a metabolic intermediate and is rapidly converted into various substances on the metabolic pathway, so the apparent amount of acetyl-CoA does not always increase, but a substance derived from acetyl-CoA is labeled with CO 2.
  • the effect can be indirectly grasped, for example, by detecting the yield of saccharides derived from acetyl-CoA or the like.
  • acetyl-CoA production is not necessarily proportional to the total amount of acetyl-CoA-derived substances Do not mean.
  • the production route from acetyl CoA to a specific substance is strengthened or the production route from acetyl CoA to a specific substance is originally strong (for example, in the case of a glutamic acid-producing microorganism described later)
  • conversion downstream from acetyl CoA Since efficiency is not easily influenced by external factors, the production efficiency of the specific substance can be regarded as an index of acetyl CoA production efficiency.
  • the acetyl-CoA producing microorganism according to the first invention has a simple and practical production route for acetyl-CoA that fixes CO 2 and converts it into acetyl-CoA.
  • the pathway through the glycine possessed by the acetyl-CoA producing microorganism of the present invention (hereinafter sometimes referred to as “glycine pathway”) will be described with reference to FIG.
  • the glycine pathway comprises at least one enzymatic reaction selected from the group consisting of: (a) and (b) below; and (c), (d), (e), ( f) and (g) enzyme reaction, the following (h) enzyme reaction, the following (i), (j), (k) and (n) enzyme reactions, and the following (i), (j), ( l), (m) and at least one selected from the group consisting of (n) enzymatic reactions.
  • A Enzymatic reaction from phosphoenolpyruvate to oxaloacetate.
  • B Enzymatic reaction from pyruvate to oxaloacetate.
  • C Enzymatic reaction from oxaloacetic acid to malic acid.
  • D Enzymatic reaction from malic acid to malyl CoA.
  • E Enzymatic reaction from malyl CoA to glyoxylic acid and acetyl CoA.
  • F Enzymatic reaction from glyoxylic acid to glycine.
  • G Enzymatic reaction from glycine to serine.
  • H Enzymatic reaction from serine to pyruvate.
  • I Enzymatic reaction from serine to 3-hydroxypyruvic acid.
  • (J) Enzymatic reaction from 3-hydroxypyruvic acid to glyceric acid.
  • (K) Enzymatic reaction from glyceric acid to 2-phosphoglyceric acid.
  • (L) Enzymatic reaction from glyceric acid to 3-phosphoglyceric acid.
  • (M) Enzymatic reaction from 3-phosphoglycerate to 2-phosphoglycerate.
  • (N) Enzymatic reaction from 2-phosphoglycerate to phosphoenolpyruvate.
  • Examples of (a) include an enzymatic reaction through any of a reaction with phosphoenolpyruvate carboxylase, a reaction with phosphoenolpyruvate carboxykinase, and a reaction with pyruvate kinase and pyruvate carboxylase.
  • Examples of (b) include an enzyme reaction via pyruvate carboxylase.
  • Examples of (c) include an enzyme reaction via malate dehydrogenase.
  • Examples of (d) include an enzyme reaction via malate thiokinase.
  • Examples of (e) include an enzyme reaction via malyl CoA lyase.
  • Examples of (f) include an enzyme reaction via glycine transaminase.
  • Examples of (g) include an enzyme reaction via a glycine cleavage system and serine hydroxymethyltransferase.
  • Examples of (h) include an enzyme reaction via serine dehydratase.
  • Examples of (i) include an enzyme reaction via serine transaminase.
  • Examples of (j) include an enzyme reaction via hydroxypyruvate reductase.
  • Examples of (k) include an enzymatic reaction via glycerate 2-kinase.
  • Examples of (l) include an enzyme reaction via glycerate 3-kinase.
  • Examples of (m) include an enzyme reaction via phosphoglycerate mutase.
  • Examples of (n) include an enzyme reaction via enolase.
  • the conversion from serine to pyruvate can be performed by an enzyme reaction directly converting from serine (reaction (h) above) or an enzyme reaction converting via 3-hydroxypyruvic acid (above (i)). And any reaction including downstream thereof).
  • the conversion from serine to pyruvic acid is an enzymatic reaction that converts via 3-hydroxypyruvic acid (the reaction including the above (i) and its downstream)
  • the conversion from glyceric acid to 2-phosphoglyceric acid is Either an enzymatic reaction directly converting from glyceric acid (reaction (k) above) or an enzymatic reaction converting via 3-phosphoglyceric acid (reaction containing (l) and (m) above) But you can.
  • pyruvate may be converted to acetyl CoA by an enzyme reaction from pyruvate to acetyl CoA (preferably an enzyme reaction by pyruvate dehydrogenase), and an enzyme reaction from pyruvate to oxaloacetate (
  • the reaction (b) preferably an enzyme reaction with pyruvate carboxylase, may be used.
  • FIG. 2 shows an enzyme reaction carried out by the following enzyme on the glycine pathway.
  • A2 At least one selected from the group consisting of pyruvate kinase (Pyk) and pyruvate carboxylase (Pyc), phosphoenolpyruvate carboxylase (Ppc), and phosphoenolpyruvate carboxykinase (Pck).
  • B2 Pyruvate carboxylase (Pyc).
  • C2 Malate dehydrogenase (Mdh).
  • F2 Glycine transaminase (Gta).
  • G2 Glycine cleavage system (Gcs) and serine hydroxymethyltransferase (Shmt).
  • H2 Serine dehydratase (Sda).
  • I2 Serine transaminase (Sga).
  • K2) Glycerate 2-kinase (GarK).
  • L2) Glycerate 3-kinase (GlxK).
  • M2 Phosphoglycerate mutase (Gpm).
  • Pyc, Ppc, and Pck are responsible for CO 2 fixation.
  • Pyruvate carboxylase (Pyc) and phosphoenolpyruvate carboxylase (Ppc) belong to a highly active class of carbonic acid-fixing enzymes.
  • the specific activity of RubisCO used in photosynthesis of plants and the like is about 3 to 20 U / mg (Journal of Biological Chemistry, 1999; 274 (8): 5078-5082, Salvucci M. E.
  • pyruvate carboxylase or phosphoenolpyruvate carboxylase has been reported to be 30 U / mg in Escherichia coli and 100-150 U / mg at the highest (Journal of Biological Chemistry, 1972; 247 (18) :) 5785-5792, Bioscience, 579Biotechnology, and Biochemistry, 1995; 59 (1): 140-142, Biochimica) et Biophysica Acta, 2000; 1475 (3): 191-206).
  • the glycine pathway does not have a circuit containing an enzyme that consumes acetyl CoA. Therefore, the glycine pathway is an ideal pathway for fixing CO 2 and converting it to acetyl CoA.
  • the enzyme that consumes acetyl CoA refers to an enzyme that converts acetyl CoA into another substance using acetyl CoA as a substrate, and examples thereof include acetyl CoA carboxylase and pyruvate synthase.
  • the absence of a circuit containing an enzyme that consumes acetyl CoA means that the enzyme that consumes acetyl CoA does not have a closed circuit in which acetyl CoA returns to acetyl CoA again through the circuit.
  • a closed circuit refers to a circuit that starts with any material on the circuit, is converted to another material through the circuit, and finally is converted to the same material as the first.
  • Acetyl CoA carboxylase is classified into enzyme number 6.4.1.2 and refers to a generic term for enzymes that convert acetyl CoA and CO 2 to malonyl CoA.
  • Pyruvate synthase is classified into enzyme number 1.2.7.1 and refers to a general term for enzymes that convert acetyl CoA to pyruvate.
  • an advantage of the glycine pathway is that it is independent of the glycolytic pathway, so that it can be combined with various other glycolytic pathways.
  • the pentose / phosphate pathway has a high production amount of NADPH, it is often used for substance production (Japanese Patent Publication No. 2007-510411) and is independent of the glycine pathway and can be easily combined.
  • NADH or NADPH
  • glyoxylic acid is converted to glycine, it has a reducing power equivalent to one NADH (or NADPH) directly by glycine dehydrogenase or indirectly by aminotransferase such as glyoxylate aminotransferase via other amino acids.
  • the glycine cleavage system consumes NAD + (or NADP + ) and converts it to NADH (or NADPH).
  • NAD + When serine is converted to 3-hydroxypyruvic acid, NAD + (or NADP + ) is consumed directly by serine dehydrogenase or indirectly by other amino acids by aminotransferases such as serine aminotransferase. , NADH (or NADPH).
  • Malate thiokinase (Mtk), glycerate 2-kinase (GarK), glycerate 3-kinase (GlxK) and pyruvate carboxylase (Pyc) consume ATP. When ammonia is taken into the metabolic system, ATP may be consumed. Pyruvate kinase (Pyk) produces ATP.
  • the balance of the glycine pathway is “phosphoenolpyruvate + 2CoA + CO 2 + 3NAD (P) H + 3-5ATP ⁇ 2acetyl CoA + 3NAD (P) + + 3-5ADP” when phosphoenolpyruvate is used as a starting material.
  • phosphoenolpyruvate + 2CoA + CO 2 + 3NAD (P) H + 3-5ATP ⁇ 2acetyl CoA + 3NAD (P) + + 3-5ADP” when phosphoenolpyruvate is used as a starting material.
  • pyruvic acid + 2CoA + CO 2 + 3NAD (P) H + 4 to 6ATP ⁇ 2acetyl CoA + 3NAD (P) + +4 to 6ADP when pyruvic acid is used as a starting material.
  • Table 1 shows a balance equation of a route for consuming oxygen during fermentation in the fermentation route using acetyl CoA as an intermediate.
  • a reduced coenzyme such as NADH
  • the reduced coenzyme produced can be consumed by the glycine pathway instead of oxygen, the reducing power produced during fermentation can be effectively utilized in the acetyl-CoA production circuit, and CO 2 can be fixed to the product. It is expected that it can be converted.
  • the reduced coenzyme is a coenzyme involved in oxidation / reduction such as NADH, NADPH, FADH 2 , FMNH 2 , and reduced quinone coenzyme, and refers to a coenzyme in a reduced state.
  • the reduced coenzyme is preferably NADH or NADPH, more preferably NADH.
  • the oxidized coenzyme is an oxidized form of a reduced coenzyme, such as NAD + , NADP + , FAD, FMN, oxidized quinone coenzyme, etc., preferably NAD + or NADP + , more preferably NAD Point to + .
  • a reducing power may be applied by adding a substance capable of producing the reducing power or applying energy from the outside.
  • a substance with a high degree of reduction for example, hydrogen, sulfite, alcohols, paraffin
  • supplying reducing energy directly by electroculture for example, hydrogen, sulfite, alcohols, paraffin
  • supplying reducing energy directly by electroculture for example, supplying reducing power by photochemical reaction of living organisms, etc. Is mentioned.
  • the reducing power can be replenished from the outside, it is possible to drive the carbonic acid fixation pathway of the present invention even in the case of fermentation where reduced coenzyme is generated as shown in Table 1.
  • Pyruvate kinase is classified as an enzyme number 2.7.1.40 and refers to a generic name of enzymes that generate pyruvate and ATP from phosphoenolpyruvate and ADP. Examples thereof include those derived from Corynebacterium bacteria such as Corynebacterium glutamicum, Escherichia bacteria such as Escherichia coli, and Pantoea bacteria such as Pantoea ananatis.
  • DNA having a base sequence of a gene encoding pyruvate kinase obtained from the above-mentioned microorganism, or a synthetic DNA sequence synthesized based on the known base sequence may be used.
  • Preferable examples include DNA having a base sequence of a gene derived from a Corynebacterium bacterium such as Corynebacterium glutamicum, an Escherichia bacterium such as Escherichia coli, or a Pantoea bacterium such as Pantoea ananatis. .
  • Pyruvate carboxylase is classified into enzyme number 6.4.1.1 and refers to a general term for enzymes that convert pyruvate and carbon dioxide into oxaloacetate. During the reaction, ATP is consumed and ADP and phosphoric acid are produced. Examples thereof include those derived from Corynebacterium bacteria such as Corynebacterium glutamicum, and Mycobacterium bacteria such as Mycobacterium smegmatis.
  • DNA having the base sequence of the gene encoding pyruvate carboxylase obtained from the above-mentioned microorganism, or a synthetic DNA sequence synthesized based on the known base sequence may be used.
  • Preferable examples include DNA having a base sequence of a gene derived from a genus Corynebacterium such as Corynebacterium glutamicum, and a genus Mycobacterium such as Mycobacterium smegmatis. .
  • Phosphoenolpyruvate carboxylase is classified into enzyme number 4.1.1.13 and refers to a general term for enzymes that convert phosphoenolpyruvate and carbon dioxide into oxaloacetate and phosphate.
  • Corynebacterium bacteria such as Corynebacterium glutamicum, Escherichia bacteria such as Escherichia coli, Pantoea bacteria such as Pantoea ananatis, Hyphomicrobium methylovorum and Hyphomicrobium genus such as Hyphomicrobium methylovorum Derived from bacteria, Starkeya novella and other Starkella bacteria, Rhodopseudomonas sp.
  • Streptomyces coelicolor and other Streptomyces genus bacteria Things are examples of Streptomyces coelicolor and other Streptomyces genus bacteria Things.
  • the phosphoenolpyruvate carboxylase gene is a DNA having a base sequence of a gene encoding phosphoenolpyruvate carboxylase obtained from the above-mentioned microorganism, or a synthetic DNA sequence synthesized based on the known base sequence May be used.
  • Preferred examples include corynebacterium bacteria such as Corynebacterium glutamicum, Escherichia bacteria such as Escherichia coli, Pantoea bacteria such as Pantoea ananatis, and hyphomicrobium methylovorum.
  • Examples thereof include DNA having a base sequence of a gene derived from bacteria.
  • Phosphoenolpyruvate carboxykinase is classified into enzyme number 4.1.1.32, enzyme number 4.1.1.38, enzyme number 4.1.1.49, and phosphoenolpyruvate and A generic term for enzymes that convert carbon dioxide into oxaloacetate.
  • enzyme number 4.1.1.32 is a reaction for converting GDP to GTP
  • enzyme number 4.1.1.38 is a reaction for converting phosphate to pyrophosphate
  • enzyme number 4.1.1.49. Is accompanied by a reaction to convert ADP to ATP.
  • a bacterium belonging to the genus Actinobacillus such as Actinobacillus succinogenes
  • a bacterium belonging to the genus Mycobacterium such as Mycobacterium ⁇ smegmatis
  • the genus Trypanosoma ⁇ brucei The thing of origin is mentioned.
  • DNA having a base sequence of a gene encoding phosphoenolpyruvate carboxykinase obtained from the above-mentioned microorganism, or a synthesis synthesized based on the known base sequence A DNA sequence may be used.
  • Suitable examples include Actinobacillus bacteria such as Actinobacillus succinogenes, Mycobacterium bacteria such as Mycobacterium smegmatis, Trypanosoma brucei, and Trypanosoma brucei. Examples are those derived from Trypanosoma bacteria.
  • Malate dehydrogenase is a general term for enzymes that are classified into enzyme number 1.1.1.37 and use NADH as a coenzyme to produce malate from oxaloacetate. Examples thereof include those derived from Corynebacterium bacteria such as Corynebacterium glutamicum, and Escherichia bacteria such as Escherichia coli.
  • malate dehydrogenase gene (mdh) DNA having the base sequence of the gene encoding malate dehydrogenase obtained from the above-mentioned micro tax, or a synthetic DNA sequence synthesized based on the known base sequence is used. It's okay.
  • Preferable examples include DNA having a base sequence of a gene derived from a Corynebacterium bacterium such as Corynebacterium glutamicum, an Escherichia bacterium such as Escherichia coli, or a Pantoea bacterium such as Pantoea ananatis. .
  • Malate thiokinase is classified into enzyme number 6.2.1.9, and refers to a generic name of enzymes that combine malic acid and CoA to convert to malyl CoA. During the reaction, one molecule of ATP is consumed and one molecule of ADP and phosphoric acid are produced.
  • This enzyme is composed of a large subunit of about 400 amino acids and a 300 amino acid small subunit. On genes, they usually exist in the order of large subunit, small subunit. In this specification, for convenience, the large subunit is referred to as mtkB and the small subunit is referred to as mtkA.
  • mtkB the large subunit
  • mtkA As the specific activity of this enzyme, an example of 2.5 U / mg for a purified enzyme has been reported (Analytical Biochemistry, 1995; 227 (2): 363-367).
  • Malate thiokinase is mainly utilized in the utilization pathway of C1 carbon sources such as methane (Journal of Bacteriology, 1994; 176 (23): 7398-7404) and 3-hydroxypropionic acid pathway (Archives of Microbiology, 1989; 151: 252-256).
  • C1 carbon sources such as methane (Journal of Bacteriology, 1994; 176 (23): 7398-7404) and 3-hydroxypropionic acid pathway (Archives of Microbiology, 1989; 151: 252-256).
  • C1 carbon sources such as methane (Journal of Bacteriology, 1994; 176 (23): 7398-7404) and 3-hydroxypropionic acid pathway (Archives of Microbiology, 1989; 151: 252-256).
  • malyl-CoA lyase gene in the vicinity of the malate thiokinase gene, and the malate thiokinase gene present in such a manner is preferable.
  • malate thiokinase for example, derived from the genus Methylobacterium such as Methylobacterium extorquens (SEQ ID NO: 1 and SEQ ID NO: 2), Hyphomicrobium methylovorum (sequence) No. 3 and SEQ ID NO: 4), derived from the genus Hyphomicrobium such as Hyphomicrobium denitrificans (SEQ ID NO: 5 and SEQ ID NO: 6), Rhizobium sp. NGR234, etc. From Rhizobium (SEQ ID NO: 7 and SEQ ID NO: 8), from Granulibacter spp.
  • SEQ ID NO: 9 and SEQ ID NO: 10 such as Granulibacter bethesdensis, and nitroso such as Nitrosomonas europaea From the genus Monas (SEQ ID NO: 11 and SEQ ID NO: 12), those derived from the genus Methylococcus such as Methylococcus capsulatus (SEQ ID NO: 13 and SEQ ID NO: 14), and those derived from the gamma proteobacteria (SEQ ID NO: 15 and SEQ ID NO: 16).
  • Hyphomicrobium From the genus Hyphomicrobium (SEQ ID NO: 3 and SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6), from Rhizobium (SEQ ID NO: 7 and SEQ ID NO: 8), and from the genus Nitrosomonas (SEQ ID NO: 11 and SEQ ID NO: 12) ) Have 65% to 80% homology with each other.
  • Malate thiokinase SEQ ID NO: 13 and SEQ ID NO: 14
  • derived from the genus Methylococcus has 70% to 80% homology with malate thiokinase (SEQ ID NO: 15 and SEQ ID NO: 16) derived from gamma proteobacteria.
  • malate thiokinase gene DNA having the base sequence of the gene encoding malate thiokinase obtained from the above-mentioned microorganism, or a synthetic DNA sequence synthesized based on the known base sequence may be used.
  • Preferable examples include those derived from the genus Methylobacterium such as Methylobacterium Extorcus (SEQ ID NO: 17 and SEQ ID NO: 18), Hyphomicrobium methyloborum, Hyphomicrobium denitrificans, etc. Hyphomicrobium genus, Rhizobium sp.
  • Rhizobium genus Rhizobium genus
  • Granulibacter genus such as Bethesdensis
  • Nitrosomonas genus such as Nitrosomonas europia
  • Methylococcus examples thereof include DNA having a base sequence of a gene derived from the gamma proteobacteria world.
  • acetyl-CoA preferably, from the genus Hyphomicrobium (SEQ ID NO: 19 and SEQ ID NO: 20, SEQ ID NO: 21 and SEQ ID NO: 22), from Rhizobium (SEQ ID NO: 23 and SEQ ID NO: 24), Granu From the genus Rebacter (SEQ ID NO: 25 and SEQ ID NO: 26), from the genus Nitrosomonas (SEQ ID NO: 27 and SEQ ID NO: 28), from the genus Methylococcus (SEQ ID NO: 29 and SEQ ID NO: 30), from the gamma proteobacterial kingdom (SEQ ID NO: 31) And DNA having the base sequence of the gene of SEQ ID NO: 32).
  • SEQ ID NO: 19 and SEQ ID NO: 20 from the genus Hyphomicrobium (SEQ ID NO: 19 and SEQ ID NO: 20, SEQ ID NO: 21 and SEQ ID NO: 22), from Rhizobium (SEQ ID NO: 23 and SEQ ID NO: 24), from the genus Nitrosomonas (SEQ ID NO: 27 and Examples include DNAs having the base sequences of genes of SEQ ID NO: 28), Methylococcus genus (SEQ ID NO: 29 and SEQ ID NO: 30), and gamma proteobacteria (SEQ ID NO: 31 and SEQ ID NO: 32).
  • Malyl CoA lyase is classified into enzyme number 4.1.3.24 and refers to an enzyme that produces glyoxylic acid and acetyl CoA from malyl CoA.
  • Methylobacterium such as Methylobacterium extorquens
  • Hyphomicrobium such as Hyphomicrobium methyloborum
  • Hyphomicrobium denitrichicans Chloroflexus aurantix And those derived from the genus Methylococcus such as Methylococcus capsulatas and the like.
  • specific activity of malyl-CoA lyase there is a report of 28.1 U / mg as a purified enzyme in Methylobacterium extroxen (Biochemical Journal, 1974; 139 (2): 399-405).
  • malyl CoA lyase from the viewpoint of the production efficiency of acetyl CoA, particularly preferably derived from the genus Methylobacterium (SEQ ID NO: 33) derived from the genus Hyphomicrobium (SEQ ID NO: 34 and SEQ ID NO: 35), derived from the genus Nitrosomonas ( SEQ ID NO: 36) and enzymes having amino acid sequences derived from the genus Methylococcus (SEQ ID NO: 37) are exemplified.
  • SEQ ID NO: 33 genus Methylobacterium
  • SEQ ID NO: 34 and SEQ ID NO: 35 derived from the genus Nitrosomonas
  • SEQ ID NO: 37 enzymes having amino acid sequences derived from the genus Methylococcus
  • DNA having the base sequence of the gene encoding malyl CoA lyase obtained from the above-mentioned microorganism, or a synthetic DNA sequence synthesized based on the known base sequence may be used.
  • Preferable examples include those derived from the genus Methylobacterium such as Methylobacterium Extorcence, those derived from the genus Hyphomicrobium such as Hyphomicrobium methyloborum, Hyhomicrobium denitrichicans, and Chloroflexus.
  • the DNA which has the base sequence of the gene derived from chloroflexus genus, such as Aurantax, is illustrated. From the viewpoint of the production efficiency of acetyl CoA, particularly preferred is DNA having a base sequence of a gene derived from the genus Methylobacteria and from the genus Hyphomicrobium.
  • Examples of particularly preferred base sequences include, as an example derived from the genus Methylobacteria, a base sequence of a gene derived from Methylobacterum extruens (SEQ ID NO: 38), and as an example derived from the genus Hyphomicrobium, hyphomicrobium.
  • nucleotide sequence of a gene derived from methyloboram SEQ ID NO: 39
  • nucleotide sequence of a gene derived from Hyphomicrobium denitrificans SEQ ID NO: 40
  • nucleotide sequence of a gene derived from Nitrosomonas europia as an example derived from the genus Nitrosomonas ( SEQ ID NO: 41)
  • an example derived from the genus Methylococcus is the base sequence of the gene derived from Methylococcus capsuleatus (SEQ ID NO: 42).
  • Glycine transaminase refers to an enzyme that converts an amino group from a compound having an amino group (secondary amine or primary amine) to glyoxylic acid and converts it to glycine.
  • enzymes classified into the enzyme number 2.6.1 group enzymes using glyoxylic acid as a substrate can be mentioned.
  • 2.6.1. *; * 4, 35, 44, 45, 60, 63 and 73.
  • Glycine transaminase may also have the activity of serine transaminase described below.
  • glycine dehydrogenase (Gdh) is also included in the glycine transaminase, and the glycine dehydrogenase gene (gdh) is also included in the glycine transaminase gene.
  • glycine transaminase are derived from the genus Methylococcus (SEQ ID NO: 43) such as Methylococcus capsulatus, which is classified into enzyme numbers 2.6.1.44 or 2.6.1.45. ⁇ Derived from the genus Allochromatium such as Allochromatium vinosum (SEQ ID NO: 44), derived from the genus Hahera such as Hahella chejuensis (SEQ ID NO: 45), Candidatus Ruthia magnifica) and other Candidatus Russian genus (SEQ ID NO: 46), Methylomonas methanica and other Methylomonas genus (SEQ ID NO: 47), Methylomicrobium alcaliphilum, etc.
  • Allochromatium such as Allochromatium vinosum (SEQ ID NO: 44)
  • SEQ ID NO: 45 derived from the genus Hahera such as Hahella chejuensis
  • Candidatus Ruthia magnifica
  • nitroso such as Nitrosococcus oceani Derived from the genus Cocus (SEQ ID NO: 54), derived from the genus Thioalkalivibrio sp. (SEQ ID NO: 55), Colwellia psychrerythraea (Colwellia psychrerythraea), etc.
  • SEQ ID NO: 56 SEQ ID NO: 57
  • Ferrimonas Such as Balerica (Ferrimonas balearica) Derived from Limonas balerica (SEQ ID NO: 58), derived from genus Schwanella (Shewanella oneidensis) (SEQ ID NO: 59), derived from genus Photobacterium such as Photobacterium profundum (SEQ ID NO: 60), Vibrio cholerae (SEQ ID NO: 61), Vibrio fischeri (SEQ ID NO: 62), and the like.
  • those derived from the genus Volbox SEQ ID NO: 63
  • Volvox carteri which are classified into enzyme number 2.6.1.4.
  • More preferred examples are derived from the genus Methylococcus (SEQ ID NO: 43) and derived from the genus Arochromatium (SEQ ID NO: 44).
  • 3A to 3G show amino acids conserved among microorganisms in the amino acid sequence of glycine transaminase.
  • glycine transaminase gene DNA having the base sequence of the gene encoding glycine transaminase obtained from the above-mentioned microorganism, or a synthetic DNA sequence synthesized based on the known base sequence may be used.
  • Preferable examples include those derived from the genus Methylococcus such as Methylococcus capsuleatus (SEQ ID NO: 64), derived from the genus Arochromati such as Arochromatium vinosaum (SEQ ID NO: 65), and derived from the genus Volbox such as Volbox Carteri (SEQ ID NO: 66) Can be mentioned. More preferable examples include those derived from the genus Methylococcus such as Methylococcus capsulatas and those derived from the genus Allochromatium such as alocromatium and binosam.
  • glycine dehydrogenase gene a DNA having a base sequence of a gene encoding glycine dehydrogenase obtained from the aforementioned microorganism, or a synthetic DNA sequence synthesized based on the known base sequence may be used.
  • Glycine cleavage system refers glycine, tetrahydrofolate, and NAD +, 5,10-methylenetetrahydrofolate, a generic term for a series of enzymes that convert into NH 3, CO 2 and NADH. It is composed of proteins called H-protein, P-protein, L-protein, and T-protein (Molecular and Cellular Biochemistry, 1973; 1 (2): 169-187). P-protein, L-protein and T-protein are classified into enzyme numbers 1.4.4.2, 1.8.1.4 and 2.2.1.10.
  • Escherichia bacteria such as Escherichia coli (SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69 and SEQ ID NO: 70)
  • Pantoea bacteria such as Pantoea ananatis (SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73) And SEQ ID NO: 74).
  • the glycine cleavage gene group includes a DNA having a base sequence of a gene encoding a glycine cleavage system enzyme group obtained from the above-mentioned microorganism, or a synthetic DNA sequence synthesized based on the known base sequence May be used.
  • Preferred are derived from Escherichia bacteria such as Escherichia coli (SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77 and SEQ ID NO: 78), derived from Pantoea bacteria such as Pantoea ananatis (SEQ ID NO: 79, SEQ ID NO: 80). , SEQ ID NO: 81 and SEQ ID NO: 82), and the DNA having the base sequence of the gene is exemplified.
  • the 5,10-methylenetetrahydrofolic acid produced in the glycine cleavage system reacts with new glycine by the action of serine hydroxymethyltransferase and is converted to serine. That is, two glycine molecules and NAD + are converted into serine, NH 3 , CO 2 and NADH by the action of the glycine cleavage system and serine hydroxymethyltransferase.
  • Serine hydroxymethyltransferase is classified into enzyme number 2.1.2.1, and is a general term for enzymes that produce serine and tetrahydrofolate from 5,10-methylenetetrahydrofolate and glycine. Examples thereof include those derived from Corynebacterium bacteria such as Corynebacterium glutamicum, Escherichia bacteria such as Escherichia coli, and Pantoea bacteria such as Pantoea ananatis.
  • DNA having the base sequence of the gene encoding serine hydroxymethyltransferase obtained from the above-mentioned microorganism, or a synthetic DNA sequence synthesized based on the known base sequence is used. It's okay.
  • Preferable examples include DNA having a base sequence of a gene derived from a Corynebacterium bacterium such as Corynebacterium glutamicum, an Escherichia bacterium such as Escherichia coli, or a Pantoea bacterium such as Pantoea ananatis. .
  • Serine dehydratase is classified into enzyme number 4.3.1.17 and refers to a general term for enzymes that produce pyruvic acid and ammonia from serine. The same activity may be reported for the enzyme with enzyme number 4.3.1.19. Examples thereof include those derived from Corynebacterium bacteria such as Corynebacterium glutamicum, Escherichia bacteria such as Escherichia coli, and Pantoea bacteria such as Pantoea ananatis.
  • DNA having the base sequence of the gene encoding serine dehydratase obtained from the above-mentioned microorganism, or a synthetic DNA sequence synthesized based on the known base sequence may be used.
  • Preferable examples include DNA having a base sequence of a gene derived from a Corynebacterium bacterium such as Corynebacterium glutamicum, an Escherichia bacterium such as Escherichia coli, or a Pantoea bacterium such as Pantoea ananatis. .
  • Serine transaminase refers to an enzyme that transfers amino group from serine to a compound having carbonyl group (keto group or aldehyde group) to convert it into 3-hydroxypyruvic acid.
  • enzymes classified in the enzyme number 2.6.1 group enzymes using serine as a substrate can be mentioned. Examples include 2.6.1.51 and 2.6.1.45, but similar activities are reported in the enzyme groups 2.6.1.44 and 2.6.1.35. May have been. It may also have the above-mentioned glycine transaminase activity. Examples thereof include those derived from the genus Methylococcus such as Methylococcus capsuleatus.
  • serine 2-dehydrogenase is also considered to be included in serine transaminase.
  • serine transaminase gene DNA having the base sequence of the gene encoding serine transaminase obtained from the above-mentioned microorganism, or a synthetic DNA sequence synthesized based on the known base sequence may be used. Suitable examples include those derived from the genus Methylococcus such as Methylococcus capsuleatus.
  • the serine 2-dehydrogenase gene is also considered to be included in the serine transaminase gene.
  • Serine 2-dehydrogenase (Sdh) is classified into enzyme number 1.4.1.7, and is a generic term for enzymes that produce 3-hydroxypyruvic acid and ammonia from serine. For example, the thing derived from plants, such as Petro serinum crispam (parsley), is mentioned.
  • serine 2-dehydrogenase gene DNA having the base sequence of the gene encoding serine 2-dehydrogenase obtained from the above-mentioned organism, or a synthetic DNA sequence synthesized based on the known base sequence is used. It's okay.
  • Preferable examples include DNA having a base sequence of a gene derived from a plant such as Petrocerinum crispam (parsley).
  • Hydroxypyruvate reductase is classified into the enzyme number 1.1.1.1.81, and refers to a general term for enzymes that convert hydroxypyruvic acid to glyceric acid using NADH or NADPH as a coenzyme. Examples thereof include those derived from Escherichia bacteria such as Escherichia coli and Pantoea bacteria such as Pantoea ananatis.
  • a gene (ycdW) of hydroxypyruvate reductase DNA having the base sequence of the gene encoding hydroxypyruvate reductase obtained from the above-mentioned microorganism, or a synthetic DNA sequence synthesized based on the known base sequence is used. It's okay.
  • Preferable examples include DNA having a base sequence of a gene derived from a bacterium belonging to the genus Escherichia such as Escherichia coli and the genus Pantoea such as Pantoea ananatis.
  • Glyceric acid 2-kinase (GarK) is classified into enzyme number 2.7.1.165 and refers to a general term for enzymes that convert glyceric acid into 2-phosphoglyceric acid.
  • One molecule of ATP is consumed and one molecule of ADP and phosphoric acid are produced. Examples thereof include those derived from Corynebacterium bacteria such as Corynebacterium glutamicum, and Escherichia bacteria such as Escherichia coli.
  • the glycerate 2-kinase gene includes a DNA having a base sequence of a gene encoding glycerate 2-kinase obtained from the above-mentioned microorganism, or a synthetic DNA sequence synthesized based on the known base sequence May be used.
  • Preferable examples include DNA having a base sequence of a gene derived from a Corynebacterium bacterium such as Corynebacterium glutamicum, an Escherichia bacterium such as Escherichia coli, or a Pantoea bacterium such as Pantoea ananatis. .
  • Glycerate 3-kinase is a generic term for enzymes that are classified into enzyme number 2.7.1.31 and convert glycerate to 3-phosphoglycerate.
  • One molecule of ATP is consumed and one molecule of ADP and phosphoric acid are produced.
  • Examples thereof include those derived from Corynebacterium bacteria such as Corynebacterium glutamicum, and Escherichia bacteria such as Escherichia coli.
  • the glycerate 3-kinase gene includes a DNA having a base sequence of a gene encoding glycerate 3-kinase obtained from the above-mentioned microorganism, or a synthetic DNA sequence synthesized based on the known base sequence May be used.
  • Preferable examples include DNA having a base sequence of a gene derived from a Corynebacterium bacterium such as Corynebacterium glutamicum, an Escherichia bacterium such as Escherichia coli, or a Pantoea bacterium such as Pantoea ananatis. .
  • Phosphoglycerate mutase is classified as enzyme number 5.4.2.1, and is a generic term for enzymes that convert 3-phosphoglycerate into 2-phosphoglycerate. Examples thereof include those derived from Corynebacterium bacteria such as Corynebacterium glutamicum, Escherichia bacteria such as Escherichia coli, and Pantoea bacteria such as Pantoea ananatis.
  • a DNA having a base sequence of a gene encoding phosphoglycerate mutase obtained from the above-mentioned microorganism, or a synthetic DNA sequence synthesized based on the known base sequence is used. It's okay.
  • Preferable examples include DNA having a base sequence of a gene derived from a Corynebacterium bacterium such as Corynebacterium glutamicum, an Escherichia bacterium such as Escherichia coli, or a Pantoea bacterium such as Pantoea ananatis. .
  • Enolase is a generic term for enzymes that are classified into enzyme number 4.2.1.11 and convert 2-phosphoglycerate to phosphoenolpyruvate. Examples thereof include those derived from Corynebacterium bacteria such as Corynebacterium glutamicum, Escherichia bacteria such as Escherichia coli, and Pantoea bacteria such as Pantoea ananatis.
  • DNA having the base sequence of the gene encoding enolase obtained from the above-mentioned microorganism, or a synthetic DNA sequence synthesized based on the known base sequence may be used.
  • Preferable examples include DNA having a base sequence of a gene derived from a Corynebacterium bacterium such as Corynebacterium glutamicum, an Escherichia bacterium such as Escherichia coli, or a Pantoea bacterium such as Pantoea ananatis. .
  • Pyruvate dehydrogenase is classified under enzyme number 1.2.4.1 and refers to a generic term for enzymes that produce acetyl CoA, CO 2 , and NADH from pyruvate, CoA, and NAD + .
  • Examples thereof include those derived from Corynebacterium bacteria such as Corynebacterium glutamicum, Escherichia bacteria such as Escherichia coli, and Pantoea bacteria such as Pantoea ananatis.
  • a DNA having a base sequence of a gene encoding pyruvate dehydrogenase obtained from the above-mentioned microorganism, or a synthetic DNA sequence synthesized based on the known base sequence may be used.
  • Preferable examples include DNA having a base sequence of a gene derived from a Corynebacterium bacterium such as Corynebacterium glutamicum, an Escherichia bacterium such as Escherichia coli, or a Pantoea bacterium such as Pantoea ananatis. .
  • the acetyl-CoA-producing microorganism of the present invention can be obtained by adding an enzyme that is not retained to a microorganism that does not form the glycine pathway.
  • Escherichia coli does not have malate thiokinase, malyl CoA lyase, and glycine transaminase, and therefore, at least malate thiokinase, malyl CoA lyase, and glycine transaminase may be added.
  • Pantoea bacteria such as Pantoea ananatis, do not have malate thiokinase, malyl CoA lyase, and glycine transaminase. Therefore, at least malate thiokinase, malyl CoA lyase, and glycine transaminase may be added.
  • Corynebacterium glutamicum does not have malate thiokinase, malyl CoA lyase, glycine transaminase, glycine cleavage system, and serine transaminase, so at least malate thiokinase, malyl CoA lyase, glycine A transaminase and glycine cleavage system may be added.
  • the 2-oxoglutarate-producing microorganism according to the second invention has a pathway for producing 2-oxoglutarate by fixing CO 2 .
  • the microorganism may have a pathway for producing glutamic acid from 2-oxoglutaric acid according to the purpose.
  • the pathway via 2-oxoglutarate possessed by the 2-oxoglutarate producing microorganism of the second invention (hereinafter sometimes referred to as “2-oxoglutarate production pathway”) will be described with reference to FIG.
  • the route shown in FIG. 4 may be referred to as “route of FIG. 4”.
  • U Enzymatic reaction from oxaloacetic acid to malic acid.
  • V Enzymatic reaction from malic acid to malyl-CoA.
  • W Enzymatic reaction from malyl CoA to glyoxylic acid and acetyl CoA.
  • Z Enzymatic reaction from 4-oxoglutaconic acid to 2-oxoglutaric acid.
  • the reaction of (t) includes, for example, phosphoenolpyruvate carboxylase (Ppc); phosphoenolpyruvate carboxykinase (Pck); pyruvate kinase (Pyk) and pyruvate carboxylase (Pyc); pyruvate carboxylase (Pyc); Catalyzed by
  • the reaction (u) is catalyzed by, for example, malate dehydrogenase (Mdh).
  • the reaction (v) is catalyzed by, for example, malate thiokinase (Mtk).
  • the reaction of (w) is catalyzed by, for example, malyl CoA lyase (Mcl).
  • the reaction (x) is catalyzed by, for example, 4-hydroxy-2-oxoglutarate aldolase.
  • the reaction (y) is catalyzed by, for example, 4-hydroxy-2-oxoglutarate dehydratase.
  • the reaction of (z) is catalyzed by, for example, 4-oxoglutaconic acid reductase.
  • the enzyme reaction from 2-oxoglutarate to glutamate is catalyzed by, for example, glutamate synthase in the same manner as in the usual glutamate fermentation pathway.
  • 2-oxoglutaric acid and glutamic acid can be converted to 2-oxoglutaric acid and glutamic acid via the TCA cycle, as in the normal glutamic acid fermentation pathway. That is, through an enzyme reaction from acetyl CoA and oxaloacetate to citric acid, an enzyme reaction from citric acid to aconitic acid, an enzyme reaction from aconitic acid to isocitrate, and an enzyme reaction from isocitrate to 2-oxoglutarate.
  • -It can be converted into oxoglutaric acid and further converted into glutamic acid via an enzymatic reaction from 2-oxoglutaric acid to glutamic acid.
  • the pathway of FIG. 4 fixes CO 2 in converting phosphoenolpyruvate or pyruvate to oxaloacetate.
  • the pathway of FIG. 4 does not include an enzymatic reaction that releases CO 2 . Therefore, the route of FIG. 4 can be said to be an extremely efficient route from the viewpoint of carbon yield.
  • the pathway of FIG. 4 is that reduced coenzyme is converted to oxidized coenzyme in the enzyme reaction converting oxaloacetate to malic acid and the enzyme reaction converting 4-oxoglutaconic acid to 2-oxoglutarate. Reducing power is required in the form. Therefore, the route of the microorganism of the present invention is expected to improve the yield of 2-oxoglutarate or glutamate by combining it with a route that can supply reduced coenzyme.
  • the enzyme activity possessed by the 2-oxoglutarate-producing microorganism is not particularly limited as long as the 2-oxoglutarate production pathway is functionally constructed, and should be appropriately selected within the range described in this specification according to the host microorganism. Can do. Since a part of the enzyme on the pathway of FIG. 4 is not retained, it is necessary to impart an enzyme that is not retained in a microorganism in which the pathway of FIG. 4 is not formed. Corynebacterium glutamicum among corynebacteria, for example, has not been found to catalyze each enzymatic reaction from malic acid to 2-oxoglutaric acid, so each enzyme is given to Corynebacterium glutamicum do it.
  • the acetyl-CoA producing microorganism according to the first invention includes the following (o), (p), (q), (r) and (s): , (Q) and (r) are not added, or one or more of the following (o), (p), (q) and (r) A microorganism with enhanced CoA production ability is preferred. The same applies to the 2-oxoglutaric acid-producing microorganism according to the second invention.
  • S At least one selected from the group consisting of malate thiokinase and malyl CoA lyase.
  • the expression “enhanced acetyl CoA production ability” means that CO 2 can be efficiently converted into acetyl CoA as compared with a microorganism not including the pathway of the microorganism of the present invention.
  • FIG. 1 of International Publication No. 2011/099006. 1 is a circuit in which acetyl CoA is converted to acetyl CoA again via malonyl CoA, 3-hydroxypropionic acid, propionyl CoA, malic acid, and malyl CoA.
  • FIG. 4A A circuit shown in 4A, in which acetyl CoA is converted to acetyl CoA again via malonyl CoA, malonic acid semialdehyde, ⁇ -alanine, malic acid, malyl CoA.
  • FIG. 8 is a circuit in which acetyl CoA is converted to acetyl CoA again via malonyl CoA, malonic acid semialdehyde or hydroxypropionic acid, pyruvic acid, malic acid, malyl CoA.
  • FIG. Of International Publication No. 2011/099006. A circuit shown in 9A, 9B, or 9C, in which acetyl CoA is converted back to acetyl CoA via malonyl CoA, hydroxypropionic acid, 2-ketoglutaric acid, malic acid, and malyl CoA.
  • FIG. of International Publication No. 2011/099006. 17 is a circuit in which acetyl CoA is converted to acetyl CoA again via malonyl CoA, malonic acid semialdehyde or hydroxypropionic acid, methylmalonyl CoA, pyruvate, oxaloacetate, malic acid, malyl CoA.
  • the carbonic acid fixing circuit of (1) to (7) above has an enzyme reaction from malonyl CoA to malonic acid semialdehyde or 3-hydroxypropionic acid. These reactions are catalyzed by malonic acid semialdehyde dehydrogenase or malonyl-CoA reductase (WO 2011/099006). Such reduction reaction of carboxylic acid or its (thio) ester, such as reduction of succinyl CoA and malonyl CoA, is generally difficult as an enzyme reaction, and it is desirable to avoid it as much as possible as a fermentation route. (Nature, 2008; 451: 86-89, Nature Chemical Biolory, 2011; 7: 445-452).
  • FIG. of International Publication No. 2011/099006. 1 is a circuit in which acetyl CoA is converted to acetyl CoA again via pyruvic acid, phosphoenolpyruvic acid, oxaloacetic acid, malic acid, and malyl CoA.
  • FIG. 7C, 7D, or 7E A circuit shown in 7C, 7D, or 7E in which acetyl CoA is converted to acetyl CoA again via pyruvic acid, malic acid, and malyl CoA.
  • FIG. Of International Publication No. 2011/099006. A circuit shown in 9M, in which acetyl CoA is converted to acetyl CoA again via pyruvic acid, 2-ketoglutaric acid, malic acid, and malyl CoA.
  • the carbonic acid fixing circuits of (8) to (10) have an enzyme reaction from acetyl CoA and CO 2 to pyruvic acid in common. It is pyruvate synthase that catalyzes this reaction (WO 2011/099006).
  • the synthesis reaction of pyruvic acid by pyruvate synthase requires a strong reducing power via ferredoxin, and the reaction is slow, and since it is weak against oxygen, the reaction does not proceed under extreme anaerobic conditions.
  • (q) a carbonic acid fixation circuit having an enzyme reaction from crotonyl CoA and CO 2 to ethylmalonyl CoA or glutaconyl CoA refers to FIG. 1 of International Publication No. 2011/099006.
  • the circuit shown in 9H or 9J indicates that acetyl CoA is converted to acetyl CoA again through crotonyl CoA, ethylmalonyl CoA or glutaconyl CoA, oxaloacetate, malic acid, malyl CoA.
  • Crotonyl CoA carboxylase-reductase or methylcrotonyl CoA carboxylase catalyzes the conversion of crotonyl CoA and CO 2 to ethylmalonyl CoA or glutaconyl CoA.
  • Crotonyl CoA carboxylase-reductase has a high Km for carbonate (14 mM. Proceedings of the National Academy of Sciences of the United States of America, 2007; 104 (25): 10631-10636) and is expected to be active at low concentrations. Absent.
  • the substrate crotonyl-CoA is produced from 3-hydroxybutyryl-CoA by dehydration.
  • FIG. 1 A circuit for producing 5,10-methylenetetrahydrofolic acid via the circuit shown in 5, 6, 13 or 14, ie, CO 2 , formic acid, 5-formyltetrahydrofolic acid, and 5,10-methylenetetrahydrofolic acid and glycine Reacts to produce serine, which passes through 3-hydroxypyruvic acid, glyceric acid, 3-phosphoglyceric acid, phosphoenolpyruvate, oxaloacetic acid, malic acid, malyl CoA, glyoxylic acid,
  • Malonate semialdehyde dehydrogenase is classified into enzyme number 1.2.1.18 and refers to a generic term for enzymes that convert malonyl CoA to malonate semialdehyde.
  • Malonyl CoA reductase is a generic term for enzymes that convert malonyl CoA into malonic acid semialdehyde or 3-hydroxypropionic acid.
  • Pyruvate synthase is classified into enzyme number 1.2.7.1 and refers to a general term for enzymes that convert acetyl CoA to pyruvate.
  • Crotonyl CoA carboxylase-reductase is classified under the enzyme number 1.3.1.85 and refers to the generic name of enzymes that convert crotonyl CoA to ethylmalonyl CoA.
  • Methylcrotonyl CoA carboxylase is classified into enzyme number 6.4.1.4, and refers to the generic name of enzymes that convert crotonyl CoA to glutaconyl CoA.
  • the microorganism used as the host in the first and second inventions is preferably a microorganism that does not have any of the above (o), (p), (q), (r), and (s).
  • Examples thereof include microorganisms belonging to the family Enterobacteriaceae, microorganisms belonging to coryneform bacteria, filamentous fungi, actinomycetes, and the like.
  • microorganisms belonging to the family Enterobacteriaceae include bacteria belonging to the genus Enterobacter, Erwinia, Escherichia, Klebsiella, Pantoea, Providencia, Salmonella, Serratia, Shigella, Morganella, and the like. Among these, bacteria belonging to the genus Escherichia or Pantoea are preferable from the viewpoint that useful metabolites can be efficiently produced. Escherichia and Pantoea are very closely related (Journal of General and Applied Microbiology, 1997; 43 (6): 355-361, International Journal of Systematic Bacteriology, 1997; 47 (4): 1061-1067 ).
  • the Escherichia bacterium is not particularly limited, and examples thereof include Escherichia coli (E. coli). Specific examples of Escherichia coli include prototype wild-type B strain Escherichia coli B (ATCC 11303), prototype wild-type K12 strain-derived Escherichia coli W3110 (ATCC 27325), Escherichia coli MG1655 (ATCC 47076) and the like. Can be mentioned.
  • Pantoea Ananatis AJ13355 (FERM BP-6614) (European Patent Application Publication No. 0952211)
  • Pantoea Ananatis AJ13356 (FERM BP-6615)
  • These strains are described as Enterobacter agglomerans in European Patent Application Publication No. 0952211, but as described above, these strains have been reclassified into Pantoea ananatis by 16S rRNA nucleotide sequence analysis as described above. Yes.
  • bacteria belonging to the genus Enterobacter have been reclassified as Pantoea agglomerans or Pantoea dispersa (International Journal of Systematic Bacteriology, 1989; 39 (3): 337-345).
  • Some bacteria belonging to the genus Ervinia have been reclassified as Pantoea Ananas and Pantoea Stuarti (International Journal of Systematic Bacteriology, 1993; 43 (1): 162-173).
  • Enterobacter bacteria examples include Enterobacter agglomerans, Enterobacter aerogenes, and the like. Specifically, the strains exemplified in European Patent Application Publication No. 952221 can be used. A representative strain of the genus Enterobacter is Enterobacter agglomerans ATCC 12287.
  • Coryneform bacteria refer to the genus Corynebacterium, Brevibacterium, or Microbacterium as defined in Bergey's Manual of Determinative Bacteriology, 8th ed., P599 (1974). It refers to the microorganisms to which it belongs. In addition, microorganisms (Classic Bacteriology, 1991; 41 (2): 255-260) that have been classified as Brevibacterium but later reclassified as Corynebacterium, and related bacteria A microorganism belonging to a certain genus Brevibacterium is also mentioned. Examples of coryneform bacteria are listed below.
  • Corynebacterium acetoacidophilum ATCC 13870 Corynebacterium acetoglutamicum ATCC 15806, Corynebacterium alkanolyticum ATCC 21511, Corynebacterium carnae ATCC 15991, Corynebacterium glutamicum ATCC 13020, 13032, 13060, Corynebacterium Lilium ATCC 15990, Corynebacterium merasecola ATCC 17965, Corynebacterium thermoaminogenes AJ12340 (FERM BP-1539), Corynebacterium herculis ATCC 13868, Brevibacterium divalicatam ATCC 14020, Brevibacterium flavum ATCC 13826, ATCC 14067A, ATCC 14067A 8 (FERM BP-2205), Brevibacterium immophilophilum ATCC 14068, Brevibacterium lactofermentum (Corynebacterium
  • the acetyl-CoA-producing microorganism according to the present invention may have various pathways for producing metabolites using acetyl-CoA as an intermediate, or may have enhanced enzyme activity related to the pathway.
  • Examples of the route include a route for producing isopropyl alcohol, a route for producing acetone, and a route for producing glutamic acid.
  • microorganisms having these pathways and capable of producing useful metabolites derived from acetyl CoA will be described.
  • the acetyl-CoA producing microorganism according to the present invention which has an isopropyl alcohol production pathway, is obtained by, for example, constructing the acetyl-CoA producing microorganism of the present invention using a microorganism having an isopropyl alcohol production pathway as a host, or In the acetyl-CoA-producing microorganism of the present invention, the microorganism is obtained by adding or enhancing an enzyme gene related to the isopropyl alcohol production pathway.
  • microorganism having an isopropyl alcohol production pathway may be referred to as “isopropyl alcohol-producing microorganism”, and Escherichia coli having an isopropyl alcohol production pathway may be referred to as “isopropyl alcohol-producing Escherichia coli”.
  • Isopropyl alcohol-producing Escherichia coli is an Escherichia coli having an isopropyl alcohol production pathway, and means an Escherichia coli having isopropyl alcohol production ability introduced by a gene recombination technique.
  • Such an isopropyl alcohol production route is not particularly limited as long as the target Escherichia coli produces isopropyl alcohol.
  • the isopropyl alcohol-producing Escherichia coli is preferably imparted or enhanced with four types of enzyme activities: thiolase activity, CoA transferase activity, acetoacetate decarboxylase activity, and isopropyl alcohol dehydrogenase activity.
  • a microorganism having thiolase activity, CoA transferase activity, and acetoacetate decarboxylase activity in the isopropyl alcohol production pathway can be used.
  • the microorganism does not have isopropyl alcohol dehydrogenase activity in the sopropyl alcohol production pathway.
  • the acetyl-CoA-producing microorganism of the present invention is a microorganism constructed using an Escherichia bacterium as a host
  • the following embodiments are preferred.
  • An example of a preferred embodiment is an acetyl-CoA producing microorganism in which a thiolase activity, a CoA transferase activity, an acetoacetate decarboxylase activity, and an isopropyl alcohol dehydrogenase activity are imparted or enhanced to a bacterium belonging to the genus Escherichia. Isopropyl alcohol is efficiently produced by the microorganism.
  • Another example of a preferred embodiment is an acetyl-CoA-producing microorganism in which Escherichia bacteria are imparted or enhanced with thiolase activity, CoA transferase activity, and acetoacetate decarboxylase activity. Acetone is efficiently produced by the microorganism.
  • Thiolase is classified as enzyme number 2.3.1.9 and refers to a generic name of enzymes that catalyze the reaction of producing acetoacetyl CoA from acetyl CoA.
  • Genus Candida Genus Candida, Caulobacter crescentus and other Streptomyces collinus, Streptomyces bacterium, Enterococcus faka Scan those derived from (Enterococcus faecalis) Enterococcus bacteria, and the like.
  • thiolase gene DNA having a base sequence of a gene encoding thiolase obtained from the above-mentioned microorganism, or a synthetic DNA sequence synthesized based on the known base sequence may be used.
  • Preferable examples include Clostridium bacteria such as Clostridium acetobutylicum and Clostridium beigerinki, Escherichia bacteria such as Escherichia coli, Halobacteria species, Zogroa bacteria such as Zugroa lamigera, Rhizobium species, Brady Bradyrizobium bacteria such as Rhizobium japonica, Candida bacteria such as Candida tropicalis, Caulobacter bacteria such as Caulobacter crescentus, Streptomyces genus bacteria such as Streptomyces colinas, Enterococcus faecalis
  • DNA having a base sequence of a gene derived from Enterococcus bacterium DNA having a base sequence of a gene derived from Enterococcus bacterium.
  • More preferable examples include DNA having a base sequence of a gene derived from a prokaryotic organism such as a Clostridium bacterium and an Escherichia bacterium, and particularly preferably a base of a gene derived from Clostridium acetobutylicum or Escherichia coli.
  • a DNA having a sequence is exemplified.
  • CoA transferase is classified into enzyme number 2.8.3.8 and refers to a general term for enzymes that catalyze a reaction for producing acetoacetate from acetoacetyl CoA.
  • Clostridium acetobutylicum Clostridium acetobutylicum
  • Clostridium ⁇ ⁇ beijerinckii Clostridium bacteria
  • Roseburia intestinalis Roseburia intestinalis
  • Roseburia intestinalis such as Roseburia intestinalis (Faecali)
  • Examples include those derived from bacteria belonging to the genus Escherichia, such as bacteria belonging to the genus Calibacteria, bacteria belonging to the genus Coprococcus, trypanosoma such as Trypanosoma brucei, and Escherichia coli.
  • CoA transferase gene DNA having the base sequence of the gene encoding CoA transferase obtained from the above-mentioned microorganism, or a synthetic DNA sequence synthesized based on the known base sequence may be used. Suitable examples include Clostridium bacteria such as Clostridium acetobutylicum, Roseburia bacteria such as Roseburia intestinalis, Facalibacteria bacteria such as Fakaribacterium plausents, Coprococcus bacteria, Trypanosoma brucei, etc. And DNA having a base sequence of a gene derived from a bacterium belonging to the genus Escherichia such as Trypanosoma and Escherichia coli.
  • Clostridium bacteria such as Clostridium acetobutylicum
  • Roseburia bacteria such as Roseburia intestinalis
  • Facalibacteria bacteria such as Fakaribacterium plausents
  • Coprococcus bacteria Trypanosoma brucei
  • More preferable examples include DNA having a nucleotide sequence of a gene derived from a bacterium belonging to the genus Clostridium or Escherichia, and particularly preferred is a DNA having a nucleotide sequence of a gene derived from Clostridium acetobutylicum or Escherichia coli. Illustrated.
  • Acetoacetate decarboxylase is classified into enzyme number 4.1.1.4 and refers to a general term for enzymes that catalyze the reaction of producing acetone from acetoacetate. Examples thereof include those derived from Clostridium bacteria such as Clostridium acetobutylicum and Clostridium beijerinckii, and Bacillus bacteria such as Bacillus polymyxa.
  • DNA having a base sequence of a gene encoding acetoacetate decarboxylase obtained from the above-mentioned microorganism, or a synthetic DNA sequence synthesized based on the known base sequence may be used.
  • Preferable examples include DNA having a base sequence of a gene derived from a Clostridium bacterium such as Clostridium acetobutylicum or a Bacillus bacterium such as Bacillus polymixa. Particularly preferred is DNA having a base sequence of a gene derived from Clostridium acetobutylicum.
  • Isopropyl alcohol dehydrogenase is classified into enzyme number 1.1.1.180 and refers to a general term for enzymes that catalyze the reaction of producing isopropyl alcohol from acetone. Examples thereof include those derived from Clostridium bacteria such as Clostridium beijerinckii.
  • a DNA having a base sequence of a gene encoding isopropyl alcohol dehydrogenase obtained from the above-mentioned microorganism, or a synthetic DNA sequence synthesized based on the known base sequence may be used.
  • Preferable examples include DNA having a base sequence of a gene derived from a bacterium belonging to the genus Clostridium such as Clostridium beigerinki.
  • each of the four types of enzymes is preferably derived from at least one selected from the group consisting of Clostridium bacteria, Bacillus bacteria, and Escherichia bacteria, and the thiolase and CoA transferase are Escherichia bacteria. More preferably, the acetoacetate decarboxylase and isopropyl alcohol dehydrogenase are derived from a Clostridium bacterium.
  • each of the four types of enzymes is preferably derived from at least one selected from the group consisting of Clostridium acetobutylicum, Clostridium beijurinki and Escherichia coli; and thiolase and CoA transferase are each of Clostridium More preferably from acetobutylicum or Escherichia coli, acetoacetate decarboxylase from Clostridium acetobutylicum, isopropyl alcohol dehydrogenase from Clostridium begerinki; thiolase and CoA transferase are from Escherichia coli, Acetate decarboxylase is derived from Clostridium acetobutylicum and isopropyl alcohol It is further preferred dehydrogenase is derived from Clostridium beijerinckii.
  • the CoA transferase gene (atoD and atoA) and the thiolase gene (atoB) derived from E. coli form an operon on the E. coli genome in the order of atoD, atoA, and atoB (Journal of Bacteriology, 1987; 169 (1): 42) -52). Therefore, it is possible to simultaneously control the expression of the CoA transferase gene and the thiolase gene by modifying the atoD promoter.
  • the promoter responsible for the expression of both enzyme genes is replaced with another promoter from the viewpoint of obtaining sufficient isopropyl alcohol production ability. It is preferable to enhance the expression of both enzyme genes by, for example.
  • the promoter used for enhancing the expression of CoA transferase activity and thiolase activity include glyceraldehyde 3-phosphate dehydrogenase (GAPDH) promoter derived from Escherichia coli.
  • GAPDH promoter derived from Escherichia coli is described in base numbers 397 to 440 in the base sequence information of GenBank accession number X02662.
  • Examples of the isopropyl alcohol-producing Escherichia coli include pIPA / B strains and pIaaa / B strains described in International Publication No. 2009/008377, which can produce isopropyl alcohol from plant-derived materials.
  • a CoA transferase activity and a thiolase activity enhanced the expression of each gene on the E. coli genome
  • an acetoacetate decarboxylase activity and an isopropyl alcohol dehydrogenase activity enhanced the expression by introducing a plasmid (in this specification, pIa / B :: atoDAB strain).
  • examples of the isopropyl alcohol-producing Escherichia coli include microorganisms described in International Publication No. 2009/094485, International Publication No. 2009/094485, International Publication No. 2009/046929, and International Publication No. 2009/046929. .
  • Isopropyl alcohol-producing Escherichia coli exhibits an enzyme activity pattern in which the activity of the transcriptional repressor GntR is inactivated, and the isopropyl alcohol production pathway and the enzyme activity pattern that maintains or enhances the ability to produce isopropyl alcohol with the inactivation of GntR activity.
  • An isopropyl alcohol-producing E. coli provided with an auxiliary enzyme group may be used. Thereby, isopropyl alcohol can be produced at a higher rate.
  • the “auxiliary enzyme group” refers to one or more enzymes that affect the ability to produce isopropyl alcohol.
  • the auxiliary enzyme group need not be composed of a plurality of enzymes, and may be composed of one enzyme.
  • Each enzyme activity of the auxiliary enzyme group is inactivated, activated or enhanced, and the “enzyme activity pattern of the auxiliary enzyme group” in the present invention means an improved isopropyl obtained only by inactivating the GntR activity.
  • Alcohol production refers to the enzyme activity pattern of each enzyme that can be maintained or increased, including one or a combination of two or more enzymes.
  • Preferred examples of the enzyme activity pattern of the auxiliary enzyme group include the following patterns (i) to (iii). Among these, the following (iii) is more preferable from the viewpoint of the ability to produce isopropyl alcohol.
  • Ii Inactivation of glucose-6-phosphate isomerase (Pgi) activity and enhancement of glucose-6-phosphate-1-dehydrogenase (Zwf) activity.
  • auxiliary enzyme group and its enzyme activity pattern are not limited to the above, and include an inactivation of GntR activity, and an auxiliary enzyme group and its enzyme activity pattern that can increase the amount of isopropyl alcohol produced in isopropyl alcohol-producing Escherichia coli. Both are included in the present invention.
  • GntR refers to a transcription factor that negatively regulates the operon involved in gluconate metabolism via the Entner-Doudoroff pathway.
  • GntR refers to a generic term for GntR transcriptional repressors that suppress the action of two gene groups (GntI and GntII) responsible for gluconic acid uptake and metabolism.
  • Glucose-6-phosphate isomerase (Pgi) is classified into enzyme number 5.3.1.9 and catalyzes a reaction for producing D-fructose-6-phosphate from D-glucose-6-phosphate.
  • Glucose-6-phosphate-1-dehydrogenase (Zwf) is classified into enzyme number 1.1.1.149, and D-glucose-6-phosphate to D-glucono-1,5-lactone-6-phosphorus
  • Dinococcus spp. Such as Dinococcus radiophilus, Aspergillus spp. Aspergillus niger, Aspergillus aculeatus, Acetiiacter hansen, etc.
  • Thermotoga maritima and other Thermotoga genus Cryptococcus neoformans Cryptococcus genus, Dictyostelium discoideum Dicchosterium genus Fungi, Pseudomonas fluorescens, Pseudomonas aeruginosa, etc., Pseudomonas genus, Saccharomyces cerevisiae, etc.
  • Examples include those derived from Bacillus bacteria such as Mrs., Bacillus megaterium, and Escherichia bacteria such as Escherichia coli.
  • Zwf glucose-6-phosphate-1-dehydrogenase
  • An array may be used.
  • Preferred examples include the genus Dinococcus such as Deinococcus radiophilus, the Aspergillus niger, the Aspergillus genus Aspergillus and the like, Acetobacter hanseni hansenii), Thermotoga maritima, Thermotoga, Cryptococus neoformans, Cryptococcus neoformans, Dictyostelium discoideum, etc.
  • Pseudomonas fluorescens Pseudomonas aeruginosa, etc.
  • Pseudomonas genus Saccharomyces cerevisiae Examples thereof include DNA having a base sequence of a gene derived from a genus Saccharomyces such as Bacillus megaterium, a Bacillus genus such as Bacillus megaterium, and an Escherichia bacterium such as Escherichia coli.
  • DNA having a base sequence of a gene derived from a prokaryotic organism such as Dinococcus, Aspergillus, Acetobacter, Thermotoga, Pseudomonas, Bacillus, Escherichia, etc. Illustrated. Particularly preferred is DNA having a base sequence of a gene derived from Escherichia coli.
  • Phosphogluconate dehydrogenase is classified into enzyme number 1.1.1.144 and catalyzes the reaction of producing D-ribulose-5-phosphate and CO 2 from 6-phospho-D-gluconic acid.
  • a generic term for enzymes is
  • the above-mentioned enzyme activity can be imparted or enhanced by gene introduction into the host, enhancement of the promoter activity of the enzyme gene possessed by the host on the genome, substitution of the promoter with a promoter, or a combination thereof.
  • the promoter in isopropyl alcohol-producing Escherichia coli means a site where RNA polymerase having a sigma factor binds and initiates transcription.
  • the promoter is not particularly limited as long as it can control the expression of the gene, but is preferably a strong promoter that constantly functions in microorganisms and is less susceptible to suppression of expression even in the presence of glucose. Specific examples include GAPDH promoter and serine hydroxymethyltransferase promoter.
  • lactate dehydrogenase (LdhA) gene may be disrupted. Thereby, since the production of lactic acid is suppressed even under culture conditions in which oxygen supply is restricted, isopropyl alcohol can be produced efficiently.
  • Culture conditions with limited oxygen supply are generally 0.02 vvm to 2.0 vvm (vvm; aeration capacity [mL] / liquid capacity [when liquid is used as the gas to be aerated by stirring the culture medium] mL] / hour [minute]), and a rotation speed of 200 rpm to 600 rpm.
  • Lactate dehydrogenase (LdhA) refers to an enzyme that produces D-lactic acid and NAD from pyruvate and NADH.
  • the acetyl-CoA producing microorganism according to the present invention may have various pathways for producing glutamic acid using acetyl-CoA as an intermediate, or may have enhanced enzyme activity associated with the pathway.
  • the acetyl-CoA-producing microorganism according to the present invention which has a glutamate production pathway, is obtained by, for example, constructing the acetyl-CoA-producing microorganism of the present invention using a microorganism having a glutamate production pathway as a host, or the present invention. It is obtained by imparting or enhancing the gene of an enzyme relating to the glutamate production pathway in the acetyl-CoA-producing microorganism.
  • a microorganism having a glutamic acid production pathway may be referred to as a “glutamic acid producing microorganism”.
  • glutamic acid-producing microorganisms include microorganisms capable of producing L-amino acids.
  • the glutamic acid-producing microorganism include enterobacteriaceae such as Escherichia bacteria and Pantoea bacteria, and coryneform bacteria such as Corynebacterium glutamicum, to which a glutamic acid production pathway is imparted or enhanced.
  • the method for imparting or enhancing glutamic acid-producing ability to a microorganism includes, for example, modifying so that expression of a gene encoding L-glutamic acid biosynthetic enzyme is increased and / or overexpressed.
  • L-glutamate biosynthetic enzymes include glutamate dehydrogenase, glutamine synthetase, glutamate synthase, isocitrate dehydrogenase, aconite hydratase, citrate synthase, phosphoenolpyruvate carboxylase, pyruvate carboxylase, pyruvate dehydrogenase, pyruvate kinase Phosphoenolpyruvate synthase, enolase, phosphoglyceromutase, phosphoglycerate kinase, glyceraldehyde-3-phosphate dehydrogenase, triose phosphate isomerase, fructose-2
  • glutamic acid-producing microorganisms include glutamic acid-producing microorganisms described in Japanese Patent Application Laid-Open No. 2005-278643.
  • the ability to accumulate L-glutamic acid in an amount exceeding the saturation concentration of L-glutamic acid in a liquid medium when cultured under acidic conditions (hereinafter referred to as “the ability to accumulate L-glutamic acid under acidic conditions”) can be used).
  • the ability to accumulate L-glutamic acid under acidic conditions can be used.
  • the ability to accumulate L-glutamic acid in an amount exceeding the saturation concentration is obtained. It can be given to microorganisms.
  • microorganisms having an ability to accumulate L-glutamic acid under acidic conditions include Pantoea Ananatis AJ13356 (FERM BP-6615) and AJ13601 (FERM BP-7207) (above, European Patent Application Publication No. 0952211) ).
  • Pantoea Ananatis AJ13356 was established in the Institute of Biotechnology, Institute of Industrial Science and Technology, Ministry of International Trade and Industry (currently, the National Institute for Product Evaluation and Technology (NITE-IPOD)). Deposited under the deposit number FERM P-16645, transferred to the international deposit under the Budapest Treaty on January 11, 1999, and given the deposit number FERM BP-6615.
  • the strain was identified as Enterobacter agglomerans at the time of its isolation, and deposited as Enterobacter agglomerans AJ13355. Recently, the strain was assigned to Pantoea ananatis by 16S rRNA nucleotide sequence analysis. Reclassified (see examples). Strains AJ13356 and AJ13601 derived from AJ13355 are also deposited with the depository organization as Enterobacter agglomerans, but are described herein as Pantoea Ananatis. On August 18, 1999, AJ13601 received the accession number FERM P- to the Biotechnology Institute of Industrial Technology, Ministry of International Trade and Industry (currently the National Institute for Product Evaluation and Technology (NITE-IPOD)). No. 17156, transferred to an international deposit under the Budapest Treaty on July 6, 2000, and assigned the deposit number FERMBP-7207.
  • a method for imparting resistance to an organic acid analog or a respiratory inhibitor, or a method for imparting sensitivity to a cell wall synthesis inhibitor may be mentioned.
  • a method of imparting monofluoroacetic acid resistance Japanese Patent Laid-Open No. 50-113209
  • a method of imparting adenine resistance or thymine resistance Japanese Patent Laid-Open No. 57-065198
  • a method of weakening urease Japanese Patent Laid-Open No. 52-038088
  • a method for imparting malonic acid resistance Japanese Patent Laid-Open No.
  • Such resistant bacteria include the following strains. Brevibacterium flavum AJ3949 (FERMBP-2632; JP 50-113209 A) Corynebacterium glutamicum AJ11628 (FERM P-5736; Japanese Patent Laid-Open No. 57-065198) Brevibacterium flavum AJ11355 (FERM P-5007; JP 56-1889) Corynebacterium glutamicum AJ11368 (FERM P-5020; JP-A-56-1889) Brevibacterium flavum AJ11217 (FERM P-4318; Japanese Patent Laid-Open No.
  • microorganisms having L-glutamine-producing ability include bacteria having enhanced glutamate dehydrogenase activity, bacteria having enhanced glutamine synthetase (glnA) activity, and bacteria having a disrupted glutaminase gene (European Patent Application Publication Nos. 1229121 and 1424398). Issue description). Enhancement of glutamine synthetase activity can also be achieved by destruction of glutamine adenyl transferase (glnE) or PII regulatory protein (glnB).
  • glnE glutamine adenyl transferase
  • glnB PII regulatory protein
  • strains belonging to the genus Escherichia and having a mutant glutamine synthetase in which the tyrosine residue at position 397 of glutamine synthetase is substituted with another amino acid residue can also be exemplified as suitable L-glutamine producing bacteria (US patent application) (Publication No. 2003-0148474).
  • Brevibacterium flavum AJ11573 (FERM P-5492; JP 56-161495 A) Brevibacterium flavum AJ11576 (FERM BP-10381; Japanese Patent Laid-Open No. 56-161495) Brevibacterium flavum AJ12212 (FERM P-8123; JP-A 61-202694)
  • microorganisms producing proline, leucine, isoleucine, valine, arginine, citrulline, ornithine and / or polyglutamic acid are described in JP 2010-41920 A.
  • Microorganisms producing acetic acid, (poly) 3-hydroxybutyric acid, itaconic acid, citric acid, and / or butyric acid are described in “Fermentation Handbook” (Kyoritsu Shuppan).
  • Examples of microorganisms that produce 4-aminobutyric acid include microorganisms in which glutamate decarboxylase is introduced into glutamic acid-producing microorganisms (Japanese Patent Laid-Open No. 2011-167097).
  • microorganisms that produce 4-hydroxybutyric acid include microorganisms in which glutamate decarboxylase, aminotransferase, and aldehyde dehydrogenase are introduced into a glutamate-producing microorganism (Japanese Patent Laid-Open No. 2009-171960).
  • microorganisms that produce 3-hydroxyisobutyric acid include microorganisms introduced with the route described in International Publication No. 2009/135074 or International Publication No. 2008/145737.
  • microorganisms that produce 2-hydroxyisobutyric acid include microorganisms that have introduced the pathway described in International Publication No. 2009/135074 or International Publication No. 2009/156214.
  • microorganisms that produce 3-aminoisobutyric acid and / or methacrylic acid include microorganisms into which the pathway described in International Publication No. 2009/135074 has been introduced.
  • the 2-oxoglutarate-producing microorganism according to the second invention may have various pathways for producing metabolites using 2-oxoglutarate as an intermediate, or has enhanced enzyme activity related to the pathway. Also good.
  • the pathway include a pathway for producing glutamic acid from 2-oxoglutaric acid.
  • the pathway for producing glutamate from 2-oxoglutarate and the enzymes that form the pathway are as described above.
  • the microorganism that produces glutamic acid from 2-oxoglutaric acid is obtained, for example, by constructing the 2-oxoglutarate-producing microorganism of the present invention using a microorganism having a pathway for producing glutamic acid from 2-oxoglutaric acid as a host; In a 2-oxoglutarate-producing microorganism, it is obtained by adding or strengthening an enzyme gene relating to the pathway for producing glutamic acid from 2-oxoglutarate; in the 2-oxoglutarate-producing microorganism of the present invention, glutamic acid is converted from 2-oxoglutarate to 2-aminoglutarate. It is obtained by inactivating or reducing the enzyme activity that inhibits the production pathway.
  • Another example of a route for producing a metabolite derived from 2-oxoglutaric acid is a route for producing arginine, citrulline, or ornithine (“Fermentation Handbook” p40 to p42; Kyoritsu Publishing).
  • Specific examples of microorganisms capable of producing arginine, citrulline, and ornithine include coryneform bacteria such as Corynebacterium glutamicum.
  • Another example of a route for producing a metabolite derived from 2-oxoglutarate is a route for producing L-glutamine (“Fermentation Handbook” p56 to p57; Kyoritsu Shuppan).
  • Specific examples of microorganisms capable of producing L-glutamine include coryneform bacteria such as Corynebacterium glutamicum.
  • Another example of a pathway for producing a metabolite derived from 2-oxoglutarate is a pathway for producing L-glutamine (“Fermentation Handbook” p141 to p145; Kyoritsu Shuppan) Microorganisms capable of producing L-glutamine Specific examples thereof include coryneform bacteria such as Corynebacterium glutamicum.
  • Another example of a route for producing a metabolite derived from 2-oxoglutarate is a route for producing polyglutamic acid (“Fermentation Handbook” p373; Kyoritsu Shuppan).
  • Specific examples of microorganisms capable of producing L-glutamine include Bacillus anthracis and Bacillus licheniformis.
  • 2-Oxoglutaric acid is a fermentation intermediate, but bacteria having the ability to produce 2-oxoglutaric acid itself are also known (“Fermentation Handbook” p56; Kyoritsu Shuppan).
  • Typical producing bacteria include coryneform bacteria such as Corynebacterium glutamicum, Pseudomonas fluorescens, Bacillus megaterium, Candida lipolytica, Serratia marcescens, Escherichia coli, and the like.
  • the method for producing acetyl-CoA according to the first invention and the method for producing a metabolite having acetyl-CoA as an intermediate are a culture process for culturing by bringing the acetyl-CoA-producing microorganism according to the first invention into contact with a carbon source material. And a recovery step of recovering a target product (acetyl CoA or a metabolite having acetyl CoA as an intermediate) obtained by the contact.
  • Examples of the metabolite having acetyl CoA as an intermediate include acetone, isopropyl alcohol, and glutamic acid.
  • acetyl CoA and metabolites having acetyl CoA as an intermediate are sometimes collectively referred to as “target product”.
  • the carbon source material is assimilated by the acetyl-CoA producing microorganism and fixing carbon dioxide.
  • the target product can be produced efficiently.
  • the method for producing 2-oxoglutarate according to the second invention and the method for producing a metabolite having 2-oxoglutarate as an intermediate are obtained by bringing the 2-oxoglutarate producing microorganism according to the second invention into contact with a carbon source material. And a recovery step of recovering the target product (2-oxoglutarate or a metabolite having 2-oxoglutarate as an intermediate) obtained by the contact.
  • An example of a metabolite having 2-oxoglutarate as an intermediate is glutamic acid.
  • 2-oxoglutaric acid and metabolites having 2-oxoglutaric acid as an intermediate are sometimes collectively referred to as “target product”.
  • the carbon source material is assimilated by the 2-oxoglutarate producing microorganism, and carbon dioxide
  • the target product can be efficiently produced while fixing.
  • the carbon source material is not particularly limited as long as it contains a carbon source that can be assimilated by microorganisms, but is preferably a plant-derived material.
  • the plant-derived material refers to organs such as roots, stems, trunks, branches, leaves, flowers, seeds, plant bodies containing them, degradation products of these plant organs, and further plant bodies, plant organs, or degradation products thereof.
  • those that can be utilized as a carbon source in culture by microorganisms are also included in the plant-derived material.
  • Carbon sources included in plant-derived materials generally include sugars such as starch, sucrose, glucose, fructose, xylose, arabinose, and herbaceous degradation products, cellulose hydrolysates containing these components, and these Can be mentioned. Furthermore, glycerin or fatty acid derived from vegetable oil is also included in the carbon source in the present invention.
  • crops such as cereals are preferable, and specifically, corn, rice, wheat, soybean, sugar cane, beet, cotton, and combinations thereof can be preferably mentioned, and the usage form as the material is , Unprocessed products, juice, pulverized products, etc. are not particularly limited. Moreover, the form of only the above-mentioned carbon source may be sufficient.
  • Contact between the microorganism and the plant-derived material in the culturing step is generally performed by culturing the microorganism in a medium containing the plant-derived material.
  • the contact density between the plant-derived material and the microorganism varies depending on the activity of the microorganism.
  • the initial sugar concentration in terms of glucose is used as the concentration of the plant-derived material in the culture medium (mixture containing the microorganism and the carbon source material). It may be 20% by mass or less based on the total mass, and from the viewpoint of sugar resistance of the microorganism, the initial sugar concentration is preferably 15% by mass or less.
  • Each of these other components may be added in an amount usually added to the microorganism medium, and is not particularly limited.
  • Each production method of the present invention may further include a step of supplying carbonate ions, hydrogen carbonate ions, carbon dioxide gas (carbon dioxide gas) and / or a reducing agent to the medium used for culture (hereinafter referred to as a supply step).
  • a supply step a step of supplying carbonate ions, hydrogen carbonate ions, carbon dioxide gas (carbon dioxide gas) and / or a reducing agent to the medium used for culture.
  • Enzyme activities such as phosphoenolpyruvate carboxylase, pyruvate carboxylase, and phosphoenolpyruvate carboxykinase are enhanced by supplying carbonate ion, bicarbonate ion and / or carbon dioxide gas to the medium used for culture.
  • the fixed amount of carbon increases, and the target product can be produced efficiently.
  • Conditions such as the temperature and pH in the supplying step may be the same as those in the culturing step unless otherwise specified.
  • the carbonate ion or hydrogen carbonate ion may be derived from a component that can generate carbonate ion and / or hydrogen carbonate ion by supplying it to the medium.
  • the component capable of generating carbonate ion and / or hydrogen carbonate ion include sodium carbonate, sodium hydrogen carbonate, potassium carbonate, potassium hydrogen carbonate, ammonium carbonate, ammonium hydrogen carbonate, magnesium carbonate, calcium carbonate and the like.
  • the amount of carbonate ions and / or bicarbonate ions supplied to the medium is not particularly limited as long as the target product can be produced efficiently.
  • the total supply amount per 1 L of the medium is preferably 150 mmol or more. By supplying carbonate ions and / or bicarbonate ions of 150 mmol / L or more, the yield of the target product can be sufficiently improved.
  • the total supply amount of carbonate ions and / or bicarbonate ions per liter of the medium is more preferably 200 mmol or more. Moreover, it is preferable that the total supply amount of carbonate ions and / or bicarbonate ions per liter of the medium is 5 mol or less.
  • the total supply amount per 1 L of the medium is 5 mol or less, there is a low possibility that a large amount of carbonate ions or bicarbonate ions that are not used in the cells in the culturing step are generated.
  • the total supply amount of carbonate ions and / or bicarbonate ions per liter of medium is more preferably 3 mol or less, and even more preferably 2 mol or less.
  • a method for supplying carbonate ions and / or hydrogen carbonate ions to the medium may follow a known method.
  • the supply time may be at the start of culture or during culture, and is not particularly limited. Carbonate ions and / or hydrogencarbonate ions may be supplied all at once or may be supplied separately.
  • the carbon dioxide gas may be any gas containing carbon dioxide, and may be air, for example.
  • the carbon dioxide concentration of the carbon dioxide gas is preferably not less than the carbon dioxide concentration in the air, more preferably not less than 0.1 v / v%, and still more preferably not less than 1 v / v%.
  • the carbon dioxide concentration is preferably 75 v / v% or less, more preferably 50 v / v% or less, and still more preferably 25 v / v% or less.
  • Carbon dioxide gas can be dissolved in the medium by bubbling or the like.
  • the average bubble diameter of the carbon dioxide gas supplied into the medium is not particularly limited as long as the target product can be efficiently produced.
  • carbon dioxide gas having an average bubble diameter of 100 ⁇ m or more is preferable. If carbon dioxide gas has an average cell diameter of 100 ⁇ m or more, the foamability in the medium is extremely increased, and there is a low possibility that it is difficult to continue fermentation culture. More preferred is carbon dioxide gas having an average bubble diameter of 200 ⁇ m or more, and further preferred is carbon dioxide gas having an average bubble diameter of 500 ⁇ m or more.
  • Carbon dioxide gas can be supplied to the culture medium using a commonly used bubble generator.
  • the bubble generator include an air sparger.
  • a measuring method of the average bubble diameter for example, a method of measuring by a laser diffraction scattering method using a particle size distribution measuring device (for example, LS 13-320 manufactured by Beckman Coulter, Inc.) Examples include a method of measuring by a pore electrical resistance method using a Multisizer3), a method of binarizing a shadow image using a high-speed video camera, and the like.
  • the reducing agent is not particularly limited as long as the components in the medium and cells are reduced during culture and the reducing agent itself is oxidized.
  • sulfide, carbon compound, hydrogen and the like can be mentioned.
  • sulfides include sulfites (sodium sulfite, sodium hydrogen sulfite, potassium sulfite, ammonium sulfite, etc.), thiosulfates (sodium thiosulfate, potassium thiosulfate, etc.), and salts of sulfide ions (sodium sulfide, hydrogen sulfide).
  • the carbon compound include alcohols, fatty acids, paraffin, carbon monoxide and the like.
  • reducing agent sulfide is preferable, and among them, sodium sulfite, sodium hydrogen sulfite, sodium sulfide, and cysteine are preferable, and sodium sulfite is most preferable.
  • the concentration of the reducing agent supplied to the medium is not particularly limited as long as the target product can be efficiently produced, and can be appropriately set according to the components to be supplied.
  • the concentration of sodium sulfite is preferably 0.01 g / L or more, more preferably 0.1 g / L or more, and even more preferably 1 g / L or more, per 1 L of the medium.
  • the concentration of the reducing agent to be supplied is preferably 50 g / L or less, more preferably 20 g / L or less, and further preferably 10 g / L or less.
  • Each production method of the present invention may further include a gas supply step of collecting a gas containing carbon dioxide generated by the culture and supplying the gas to a medium used for the culture. That is, the carbon dioxide gas released as exhaust without being consumed in the medium may be circulated and reused by supplying it again to the medium.
  • the method for supplying gas to the medium is not particularly limited as long as it is a commonly used method.
  • a method in which gas is pressurized and ejected from a ring-shaped or plate-shaped member having pores a method called aerator or aeration when the gas is air
  • a draft tube Air sparger gas disperser
  • a porous material with numerous holes is attached to generate fine bubbles such as air at the tip of plastic or stainless steel pipes.
  • a medium used for culturing microorganisms a commonly used medium containing carbon sources, nitrogen sources, inorganic ions, inorganic trace elements required by microorganisms to produce the desired product, nucleic acids, vitamins, etc. If there is no restriction in particular.
  • the culture conditions in the culture step there are no particular restrictions on the culture conditions in the culture step.
  • the pH is 4 to 9 (preferably pH 6 to 8) and the temperature is 20 ° C. to 50 ° C. (preferably 25 ° C. to 42 ° C.) under aerobic conditions. Incubate while controlling the pH and temperature within the range.
  • the amount of gas that flows into the mixture containing the microorganism and the carbon source material there is no particular limitation on the amount of gas that flows into the mixture containing the microorganism and the carbon source material.
  • it is generally 0.02 vvm to 2.0 vvm (vvm; aeration capacity [mL ] / Liquid volume [mL] / hour [minute]), 50 to 600 rpm, preferably from 0.1 vvm to 2.0 vvm from the viewpoint of suppressing physical damage to microorganisms, more preferably 0.1 vvm ⁇ 1.0 vvm.
  • the culture process can be continued from the start of the culture until the carbon source material in the mixture is consumed or until the activity of the microorganism is lost.
  • the duration of the culturing step varies depending on the number and activity of microorganisms in the mixture and the amount of the carbon source material, but is generally 1 hour or longer, preferably 4 hours or longer.
  • the culturing period can be continued indefinitely by re-inputting the carbon source material or the microorganism, but from the viewpoint of treatment efficiency, it can generally be 5 days or less, preferably 72 hours or less. .
  • the conditions used for normal culture may be applied as they are.
  • the method for recovering the target product accumulated in the culture solution is a mixed solution in which the target product and other components are mixed, for example, after removing the cells from the culture solution by centrifugation, the condition depends on the type of the target product.
  • a method of separating the target product by a conventional separation method such as distillation or membrane separation can be employed.
  • Each production method of the present invention may include a pre-culturing step for bringing the microorganism to be used into an appropriate number of bacteria and / or an appropriate active state before the culturing step.
  • the pre-culture process may be a culture under a culture condition that is normally used according to the type of microorganism.
  • the isopropyl alcohol production method and the acetone production method of the present invention include producing isopropyl alcohol or acetone, which are target products, from a carbon source material using an acetyl CoA-producing microorganism. That is, the method for producing isopropyl alcohol and the method for producing acetone of the present invention comprise a culture step in which an acetyl-CoA producing microorganism and a carbon source material are brought into contact with each other, and a target product (isopropyl alcohol or acetone) obtained by the contact. A recovery step of recovering.
  • acetyl CoA producing microorganism used in the isopropyl alcohol production method those having thiolase activity, CoA transferase activity, acetoacetate decarboxylase activity and isopropyl alcohol dehydrogenase activity described above as a preferred embodiment of the acetyl CoA producing microorganism are isopropyl alcohol. From the viewpoint of production efficiency.
  • acetyl-CoA-producing microorganism used in the acetone production method those having the thiolase activity, the CoA-transferase activity and the acetoacetate decarboxylase activity described above as a preferred embodiment of the acetyl-CoA-producing microorganism are preferable from the viewpoint of the production efficiency of acetone. .
  • the isopropyl alcohol production method and the acetone production method are preferably a culture step (referred to as “aeration culture step”) of culturing an acetyl CoA-producing microorganism while supplying a gas to the mixture containing the acetyl-CoA producing microorganism and the carbon source material. And a target product recovery step of separating and recovering the target product (isopropyl alcohol or acetone) produced by the culturing step from the mixture.
  • the target product is released into the mixture and is evaporated from the mixture. As a result, the target product can be easily separated from the mixture.
  • the target product is continuously separated from the mixture, an increase in the concentration of the target product in the mixture can be suppressed. Therefore, it is not particularly necessary to consider the resistance of the acetyl CoA-producing microorganism to the target product.
  • the above-mentioned matters are applied as they are.
  • any method can be used as long as it can collect the target product in the form of gas or droplets evaporated from the mixture by culturing.
  • a collection member such as a generally used sealed container, and from the viewpoint of recovering only the target product with high purity, the capture liquid for capturing the target product and the purpose separated from the mixture Preferred is a method comprising contacting the product.
  • the target product can be recovered as a form dissolved in a capture liquid or a mixture.
  • a recovery method include a method described in International Publication No. 2009/008377.
  • the present invention may further include a dehydration step.
  • the target product can be dehydrated by a conventional method.
  • the recovered target product can be confirmed using a normal detection means such as HPLC.
  • the recovered target product may be further purified as necessary. Examples of the purification method include distillation.
  • FIG. 1 of International Publication No. 2009/008377 As an apparatus applied to a production method of a target product that can be recovered as a form dissolved in a capture liquid or a mixture, for example, a production apparatus shown in FIG. 1 of International Publication No. 2009/008377 can be cited.
  • an infusion tube for injecting gas from the outside of the apparatus is connected to a culture tank containing a culture medium containing microorganisms and plant-derived materials to be used, and aeration can be performed on the culture medium.
  • a trap tank containing a capture liquid (trap liquid) is connected to the culture tank via a connection tube.
  • the target product produced by aeration culture in the culture tank is evaporated by aeration and easily separated from the culture medium.
  • the gas or liquid moved to the trap tank comes into contact with the trap liquid, resulting in bubbling and trapped in the trap liquid.
  • the target product can be produced continuously and simply in a more purified form.
  • the glutamic acid production method of the present invention includes producing glutamic acid as a target product from a carbon source material using an acetyl CoA-producing microorganism or a 2-oxoglutaric acid-producing microorganism. That is, the method for producing glutamic acid according to the present invention comprises a culturing step in which an acetyl-CoA-producing microorganism or 2-oxoglutaric acid-producing microorganism is brought into contact with a carbon source material, and a target product (glutamic acid) obtained by the contact is recovered. And a recovery step.
  • the glutamic acid production method of the present invention since the acetyl-CoA-producing microorganism or 2-oxoglutaric acid-producing microorganism is brought into contact with the carbon source material and cultured, the carbon source material is obtained by the acetyl-CoA producing microorganism or 2-oxoglutaric acid-producing microorganism. Glutamic acid can be produced efficiently while being assimilated and fixing carbon dioxide.
  • the medium used for the culture can be a normal medium containing a carbon source; a nitrogen source; inorganic salts; organic micronutrients such as amino acids and vitamins; Either a synthetic medium or a natural medium can be used. Any type of carbon source and nitrogen source may be used as long as the strain to be cultured is available.
  • nitrogen source ammonia, ammonium salts such as ammonium sulfate, ammonium carbonate, ammonium chloride, ammonium phosphate, and ammonium acetate; nitrates; and the like can be used.
  • inorganic salts phosphates, magnesium salts, calcium salts, iron salts, manganese salts and the like can be used.
  • organic micronutrients examples include amino acids, vitamins, fatty acids, nucleic acids, peptone containing these, casamino acids, yeast extracts, soybean protein degradation products, and the like.
  • auxotrophic mutant that requires an amino acid or the like for growth, it is preferable to supplement the required nutrients.
  • the culture is preferably carried out by aeration culture while controlling the temperature at 20 to 45 ° C. and the pH at 3 to 9.
  • an inorganic or organic acid, alkaline substance, ammonia gas, or the like can be used.
  • L-amino acids are accumulated in the culture solution or in the cells.
  • a microorganism can be cultured using a liquid medium adjusted to conditions where L-glutamic acid is precipitated while precipitating L-glutamic acid in the medium.
  • the conditions under which L-glutamic acid is precipitated include, for example, pH 4.0 to 5.0, preferably pH 4.0 to 4.5, more preferably pH 4.0 to 4.3, and particularly preferably pH 4.0. Conditions can be mentioned.
  • the pH is preferably 4.0 to 5.0, more preferably 4.0 to 4.5. More preferably, it is 4.0 to 4.3.
  • the culture at the above pH may be the whole culture period or a part thereof.
  • the method for collecting L-amino acid from the culture solution after completion of the culture may be performed according to a known recovery method. For example, there are a method of concentration crystallization after removing bacterial cells from the culture solution, and a method by ion exchange chromatography.
  • L-glutamic acid precipitated in the culture solution can be collected by centrifugation or filtration. In this case, L-glutamic acid dissolved in the culture solution may be crystallized and then collected together.
  • proline As a method of producing proline, leucine, isoleucine, valine, arginine, citrulline, ornithine, acetic acid, (poly) 3-hydroxybutyric acid, itaconic acid, citric acid, butyric acid, polyglutamic acid by applying the microorganism of the present invention,
  • “Fermentation Handbook” Korean University Press
  • p363-p364 p61-p63, p61-p63, p61-p63, p61-p63, p40-p42, p40-p42, p40-p42, p189-p192, p377-p378, p64-p65
  • Examples include the methods described in p124 to p125, p19 to p23, and p373, respectively.
  • Examples of a method for producing 4-aminobutyric acid by applying the microorganism of the present invention include a production method using a microorganism (Japanese Patent Laid-Open No. 2011-167097) in which glutamic acid decarboxylase is introduced into a glutamic acid-producing microorganism.
  • a method for producing 4-hydroxybutyric acid by applying the microorganism of the present invention for example, a microorganism in which glutamic acid decarboxylase, aminotransferase, and aldehyde dehydrogenase are introduced into a glutamic acid-producing microorganism (Japanese Patent Application Laid-Open No. 2009-2009). -171960 publication).
  • Examples of a method for producing 2-hydroxyisobutyric acid by applying the microorganism of the present invention include a production method using a microorganism into which a route described in International Publication No. 2009/135074 or International Publication No. 2009/156214 is introduced. It is done.
  • Examples of a method for producing 3-aminoisobutyric acid and / or methacrylic acid by applying the microorganism of the present invention include a production method using a microorganism into which a route described in International Publication No. 2009/135074 is introduced.
  • GAPDH glyceraldehyde 3-phosphate dehydrogenase
  • Escherichia coli MG1655 is available from ATCC (American Type Culture Collection).
  • Escherichia coli B (ATCC 11303) is available from ATCC.
  • the genomic DNA of Methylococcus capsuleatus ATCC 33009 (ATCC 33009D-5) can be obtained from ATCC.
  • Corynebacterium DSM 1412 is available from DSMZ (German Collection of Microorganisms and Cell Cultures).
  • Example 1 ⁇ Preparation of Escherichia coli B strain atoD genome-enhanced strain>
  • the entire base sequence of the genomic DNA of Escherichia coli MG1655 is known (GenBank accession number U00096), and the base sequence of the gene encoding the CoA transferase ⁇ subunit of Escherichia coli MG1655 (hereinafter sometimes referred to as “atoD”) is also included. It has been reported. That is, atoD is described in 232469-3232131 of the Escherichia coli MG1655 genomic sequence described in GenBank accession number U00096.
  • the restriction enzyme was obtained by amplifying the DNA fragment obtained by PCR using the genomic DNA of Escherichia coli MG1655 as a template, and using CGCTCAATTGCAAATTGATCACGATCTCCG (SEQ ID NO: 83) and ACAGAATTCGCTATTTTGTTAGGTGAATAAAAGGG (SEQ ID NO: 84) as primers.
  • a DNA fragment encoding the GAPDH promoter of about 100 bp was obtained by digestion with MfeI and EcoRI.
  • the resulting DNA fragment was mixed with plasmid pUC19 (GenBank accession number X02514) digested with restriction enzyme EcoRI and further treated with alkaline phosphatase, and ligated with ligase, and then Escherichia coli DH5 ⁇ strain competent cell ( Toyobo Co., Ltd. DNA-903) was transformed to obtain transformants that grew on LB agar plates containing 50 ⁇ g / mL ampicillin.
  • Escherichia coli MG1655 genomic DNA was used as a template, and CGAATTCGCTGGTGGAACATATGAAAACAAAAATTGATGATACATTACAAGAC (SEQ ID NO: 85) and GCGGTACCTTTTTGCTCTCTCCTGTGAAACG (SEQ ID NO: 86) was used as a primer. Digestion with EcoRI and KpnI yielded an approximately 690 bp atoD fragment.
  • This DNA fragment was mixed with pUCgapP digested with the restriction enzymes EcoRI and KpnI, ligated with ligase, transformed into Escherichia coli DH5 ⁇ competent cell (Toyobo Co., Ltd., DNA-903), and 50 ⁇ g / A transformant that grew on an LB agar plate containing mL ampicillin was obtained. A plasmid was recovered from the obtained bacterial cells, and it was confirmed that atoD was correctly inserted. This plasmid was named pGAPatoD.
  • Escherichia coli MG1655 using Escherichia coli MG1655 as a template of Escherichia coli MG1655, using primers of GCTCTAGATGCTGAAATCCCACTAGTCTTGTTC (SEQ ID NO: 87) and TACTGCAGCGTTCCAGCCACTTACAACC (SEQ ID NO: 88), which were prepared based on the gene information of the 5 'vicinity region of atoD of Escherichia coli MG1655 An about 1.1 kbp DNA fragment was amplified by PCR.
  • GGTCTAGAGCAATGATTGACACGATTCCCG (SEQ ID NO: 89) prepared based on the sequence information of the GAPDH promoter of Escherichia coli MG1655 and GCGGTACCTTTTGTCTCTCTGGAACG primer prepared using the sequence information of atD of Escherichia coli MG1655 (SEQ ID NO: 89) Then, PCR was performed using plasmid pGAPatoD as a template to obtain a DNA fragment of about 790 bp consisting of GAPDH promoter and atoD.
  • the about 1.1 kbp DNA fragment was digested with restriction enzymes PstI and XbaI, the about 790 bp DNA fragment was digested with restriction enzymes XbaI and KpnI, and both fragments were digested with temperature sensitive plasmid pTH18cs1 (GenBank accession number AB019610) (Gene , 2000; 241: 185-191) were mixed with a fragment obtained by digesting with PstI and KpnI, ligated with ligase, transformed into DH5 ⁇ strain, and LB agar containing 10 ⁇ g / mL chloramphenicol. A transformant that grew on the plate at 30 ° C. was obtained.
  • the obtained colony was cultured overnight at 30 ° C. in an LB liquid medium containing 10 ⁇ g / mL chloramphenicol, and the plasmid was recovered from the obtained cells.
  • This plasmid was transformed into Escherichia coli B (ATCC 11303) and cultured on an LB agar plate containing 10 ⁇ g / mL chloramphenicol at 30 ° C. overnight to obtain a transformant.
  • the obtained transformant was inoculated into an LB liquid medium containing 10 ⁇ g / mL chloramphenicol and cultured at 30 ° C. overnight.
  • the obtained cultured cells were applied to an LB agar plate containing 10 ⁇ g / mL chloramphenicol and cultured at 42 ° C. to obtain colonies.
  • the obtained colonies were cultured in an LB liquid medium containing no antibiotics at 30 ° C. for 2 hours, and applied to an LB agar plate containing no antibiotics to obtain colonies that grew at 42 ° C.
  • PCR was performed using the genomic DNA of Escherichia coli MG1655 as a template, and a PCR fragment was amplified using CGAGCTACATATGCAATGATTGACACGATTCCG (SEQ ID NO: 91) and CGCGCGCATGCCTATTGTTAGTAGGAATAAAAGG (SEQ ID NO: 92) as a primer.
  • a DNA fragment corresponding to the GAPDH promoter of about 110 bp was obtained by digesting with NdeI and SphI.
  • This DNA fragment was mixed with a fragment obtained by digesting plasmid pBR322 (GenBank accession number J01749) with restriction enzymes NdeI and SphI, ligated with ligase, and then Escherichia coli DH5 ⁇ strain competent cell (Toyo) Spinning Co., Ltd. DNA-903) was transformed to obtain transformants that grew on LB agar plates containing 50 ⁇ g / mL ampicillin. The obtained colonies were cultured overnight at 37 ° C. in an LB liquid medium containing 50 ⁇ g / mL ampicillin, and the plasmid was recovered from the obtained cells to obtain plasmid pBRgapP.
  • the genomic DNA of Clostridium beigerinki NRRL B-593 was used as a template, AATATGCATGCTGGGTGGAACATATGAAGGGTTTGCAATGCTAGGG (SEQ ID NO: 93) and ACGCGTCGAACTTAATAATAACTACTAGCTPCR No.
  • the obtained DNA fragment was digested with restriction enzymes SphI and SalI to obtain an isopropyl alcohol dehydrogenase fragment of about 1.1 kbp.
  • the obtained DNA fragment and the fragment obtained by digesting plasmid pUC119 with restriction enzymes SphI and SalI were mixed, ligated with ligase, transformed into Escherichia coli DH5 ⁇ competent cell, and 50 ⁇ g A transformant that grew on an LB agar plate containing / mL ampicillin was obtained.
  • the obtained colonies were cultured overnight in an LB liquid medium containing 50 ⁇ g / mL ampicillin at 37 ° C., and the plasmid was recovered from the obtained bacterial cells to confirm that IPAdh was correctly inserted. I was named.
  • a fragment containing IPAdh obtained by digesting plasmid pUC-I with restriction enzymes SphI and EcoRI and a fragment obtained by digesting plasmid pBRgapP with restriction enzymes SphI and EcoRI were mixed and ligated using ligase. Thereafter, the cells were transformed into Escherichia coli DH5 ⁇ competent cells to obtain transformants that grew on LB agar plates containing 50 ⁇ g / mL ampicillin. The obtained colonies were cultured overnight at 37 ° C. in an LB liquid medium containing 50 ⁇ g / mL ampicillin, and the plasmid was recovered from the obtained bacterial cells to confirm that IPAdh was correctly inserted. I was named.
  • the genomic DNA of Clostridium acetobutylicum ATCC824 was used as a template, and ACGCGTCGACGCTGGTGGAACATATGTTAAAGGATGGAAGTATAAACAAATTTAGC (SEQ ID NO: 95) and GCTCTTAGAGGTTACCTACTATAGACT PCR were used as primers.
  • the fragment was digested with restriction enzymes SalI and XbaI to obtain an acetoacetate decarboxylase fragment of about 700 bp.
  • the obtained DNA fragment was mixed with the fragment obtained by digesting plasmid pGAP-I with restriction enzymes SalI and XbaI, ligated with ligase, and transformed into Escherichia coli DH5 ⁇ competent cell.
  • a transformant that grows on an LB agar plate containing 50 ⁇ g / mL ampicillin was obtained.
  • the obtained colony was cultured overnight in an LB liquid medium containing 50 ⁇ g / mL ampicillin at 37 ° C., and the plasmid was recovered from the obtained bacterial cells to confirm that adc was correctly inserted. Named.
  • the obtained DNA fragment and the fragment obtained by digesting the plasmid pIa with the restriction enzymes XbaI and BamHI were mixed, ligated with ligase, transformed into Escherichia coli DH5 ⁇ competent cell, 50 ⁇ g / A transformant that grew on an LB agar plate containing mL ampicillin was obtained.
  • the obtained colony was cultured overnight at 37 ° C. in an LB liquid medium containing 50 ⁇ g / mL ampicillin, and the resulting plasmid was designated as pIaz.
  • Example 3 ⁇ Preparation of plasmid pMWKGC> Using the plasmid pBRgapP as a template, CCGCTCGAGCATATGCTGTCCGCAATGATTGACACG (SEQ ID NO: 99) and GCCTTCCATATGCAGGGTTATTGTTCCATGAGC (SEQ ID NO: 100) are used as primers, and the resulting DNA fragment is T4PolyK A DNA fragment containing the promoter was obtained.
  • Plasmid pMW119 (GenBank accession number AB005476) is treated with restriction enzymes AatII and NdeI, and the resulting DNA fragment is blunted with KOD plus DNA polymerase (Takara) to obtain a DNA fragment containing the replication origin of pMW119. It was.
  • a DNA fragment containing the GAPDH promoter and a DNA fragment containing the replication origin of pMW119 were mixed and ligated using ligase, then transformed into an Escherichia coli DH5 ⁇ strain competent cell and applied to an LB agar plate containing 50 ⁇ g / mL ampicillin. A growing transformant was obtained. The obtained colony was cultured overnight at 37 ° C. in an LB liquid medium containing 50 ⁇ g / mL ampicillin, and the plasmid was recovered from the obtained bacterial cells to obtain a plasmid pMWG.
  • the DNA obtained was amplified by PCR using pTH18cs1 (GenBank accession number AB019610) as a template and TCGGCACGTAAGAGGTTCC (SEQ ID NO: 101) and CGGGTCGAATTTGCTTTCG (SEQ ID NO: 102) as primers.
  • the fragment was phosphorylated with T4 Polynucleotide Kinase (Takara) to obtain a DNA fragment containing a chloramphenicol resistance gene.
  • CTAGATCTGACATAGATAGACGGGTAAGCC SEQ ID NO: 103
  • CTAGATCTCAGGGTTTATTGTTCCATGAGC SEQ ID NO: 1044
  • CCTTTGGTTAAAGGCTTTAAGATTCTTCAGTGGACAAACTATGCCC SEQ ID NO: 105
  • GGCATAGTTTGTCCCACTGAGAAGATTCTAAGCCCTTTAACCAAAGG SEQ ID NO: 106
  • the transformant which grows on the LB agar plate containing was obtained.
  • the obtained colonies were cultured overnight at 37 ° C. in an LB liquid medium containing 25 ⁇ g / mL chloramphenicol, and the plasmid was recovered from the obtained bacterial cells to obtain plasmid pMWGKC.
  • Example 4 ⁇ Production of Escherichia coli strain for evaluation> SD of each of the malyl-CoA lyase gene (SEQ ID NO: 42), the malate thiokinase subunit ⁇ gene (SEQ ID NO: 30), and the malate thiokinase subunit ⁇ gene (SEQ ID NO: 29) derived from Methylococcus capsuleatus ATCC 33009
  • the region covering the sequence (Shine dalgarno sequence) and the start codon to the translation stop codon was amplified by PCR. Since these three genes are continuous on the genome of Methylococcus capsuleatus, they can be obtained as one fragment.
  • the obtained amplified fragment was ligated under the control of the gap promoter possessed by the plasmid pMWGKC.
  • the obtained plasmid was designated as pMWWGC_mcl (Mc) _mtk (Mc).
  • the region covering the SD sequence and the start codon to the translation stop codon was amplified by the PCR method.
  • the obtained amplified fragment was ligated downstream of the malate thiokinase (mtk) sequence of the plasmid pMWGKC_mcl (Mc) _mtk (Mc).
  • the obtained plasmid was designated as pMWWGC_mcl (Mc) _mtk (Mc) _gta (Mc).
  • the B :: atoDAB strain was transformed with the plasmid pIaz and the plasmid pMWGKC or the plasmid pMWGKC_mcl (Mc) _mtk (Mc) _gta (Mc), which were named EC / vec and EC / mtk_mcl_gta, respectively.
  • Example 5 ⁇ Verification of introduction of 13 C-labeled CO 2 into isopropyl alcohol> 100 mL of LB liquid medium was prepared in a 500 mL baffled Erlenmeyer flask and sterilized by autoclaving at 121 ° C. for 20 minutes. Ampicillin (final concentration 50 ⁇ g / mL) and chloramphenicol (final concentration 34 ⁇ g / mL) were added to this medium, and one platinum ear inoculation of EC / vec or EC / mtk_mcl_gta prepared in Example 4 was performed. The culture was performed at 20 ° C. and 130 rpm for about 20 hours. Only the cells were separated from the culture solution by centrifugation (5000 G ⁇ 15 minutes), and the cells were resuspended in 10 mL of physiological saline to obtain a cell suspension.
  • Ampicillin final concentration 50 ⁇ g / mL
  • chloramphenicol final concentration 34 ⁇ g
  • the obtained culture broth was filtered under reduced pressure using a filter holder for vacuum filtration (ADVANTEC, KGS-47) in which a hydrophilic PTFE membrane filter (ADVANTEC, H050A047A, pore size 0.5 ⁇ M, diameter 47 mm) was set. Separated into supernatant and cells.
  • the membrane filter to which the bacterial cells adhered was immediately immersed in 1.6 mL methanol (LC / MS grade) cooled to ⁇ 20 ° C. and stirred, and then left at ⁇ 20 ° C. for 1 hour. After 1 hour, 1.6 mL of chloroform (HPLC grade) cooled to ⁇ 20 ° C. and 0.64 mL of pure water cooled to 4 ° C. were added, and the mixture was stirred for 30 seconds by vortexing. Thereafter, the supernatant was collected by centrifugation at 4 ° C. to obtain a methanol extract of bacterial cells. This was analyzed by LC-MS / MS, and the molecular weight distribution of acetyl CoA in the cells was measured. In the molecular weight distribution of acetyl CoA, the ratios of the molecular weights 808, 809 and 810 of the mass spectrum peak were converted as M + 0, M + 1 and M + 2, respectively.
  • the alcohol and acetone were concentrated and extracted from the culture supernatant by distillation and used as raw materials for molecular weight distribution measurement.
  • the molecular weight distribution of isopropyl alcohol and ethanol in the culture supernatant was analyzed by GC-MS.
  • IPA isopropyl alcohol
  • the ratios of the molecular weights 117, 118, and 119 of the mass spectrum peak were converted as M + 0, M + 1, and M + 2, respectively.
  • ethanol ethanol
  • the ratios of the molecular weights 103, 104, and 105 of the mass spectrum peak were converted as M + 0, M + 1, and M + 2, respectively.
  • Plasmid RSFCPG was removed from Pantoea ananatis AJ13601 (patent deposited strain BP-7207).
  • the plasmid RSFCPG is a tetracycline resistant plasmid having glutamate dehydrogenase, citrate synthase, and phosphoenolpyruvate carboxylase, which are enzymes that catalyze the biosynthesis reaction of L-glutamic acid (Japanese Patent Laid-Open No. 2001-333769).
  • Pantoea ananatis AJ417 (patent deposited strain BP-8646) was transformed by the CaCl 2 method (Molecular Cloning: A Laboratory Manual, 3rd Edition, Cold Spring Harbor Laboratory Press (2001)), and 10 ⁇ g / mL
  • CaCl 2 method Molecular Cloning: A Laboratory Manual, 3rd Edition, Cold Spring Harbor Laboratory Press (2001)
  • PHA strain Pantoea ananatis AJ417 / RSFCPG
  • Example 7 ⁇ Construction of Pantoea Ananatis strain for evaluation>
  • the PA strain prepared in Example 6 was transformed with pMWGKC or pMWKGC_mcl (Mc) _mtk (Mc) _gta (Mc), and named PA / vec and PA / mtk_mcl_gta, respectively.
  • Example 8 ⁇ Verification of introduction of 13 C-labeled CO 2 into glutamic acid by Pantoair strain>
  • the target Pantoea strain was pre-cultured in LB medium containing 30 ⁇ g / mL chloramphenicol, 120 ⁇ g / mL spectinomycin, 15 ⁇ g / mL tetracycline at 220 rpm and 30 ° C.
  • the cells were collected from the preculture solution by centrifugation (5000 rpm ⁇ 5 minutes).
  • Pantoair minimum medium (17 g / L Na 2 HPO 4) containing 100 mM sodium bicarbonate ( 13 C labeled), 20 g / L glucose, 30 ⁇ g / mL chloramphenicol, 120 ⁇ g / mL spectinomycin, 15 ⁇ g / mL tetracycline 12H 2 O, 3 g / L KH 2 PO 4 , 0.5 g / L NaCl, 1 g / L NH 4 Cl, 10 mM MgSO 4 , 10 ⁇ M CaCl 2 , 50 mg / L L-lysine, 50 mg / L L-Methionine, pH 6 0.0) was prepared, and the precultured cells were adjusted and added so that the OD was in the range of 1-5.
  • the cells were cultured at 30 ° C. and 220 rpm for 1 day.
  • the culture solution is periodically sampled, centrifuged (12,000 rpm ⁇ 3 minutes) to remove the cells, and the supernatant is filtered with a hydrophilic PTFE membrane filter (MILLIPORE, MSGVN2B50) to obtain a culture sample. .
  • MILLIPORE hydrophilic PTFE membrane filter
  • the molecular weight 432 is a structure composed of the most abundant isotope of all atoms, and the molecular weights 433 and 434 are considered to be structures further including one and two neutrons.
  • 13 C derived from NaH 13 CO 3 is introduced into only one of the 1st and 5th carbons of glutamic acid via oxaloacetic acid, and thus is on the stated baseline.
  • the reference line is obtained by the following formula.
  • x (x 0 ⁇ x 0 ⁇ ⁇ + ⁇ ) / (1 ⁇ )
  • y (y 0 ⁇ y 0 ⁇ ⁇ + x 0 ⁇ ⁇ ) / (1- ⁇ )
  • ⁇ represents the proportion of 13 C isotopes of CO 2 -derived carbon (position 1 or 5) in glutamic acid ⁇ 13 C / ( 13 C + 12 C) ⁇ .
  • x and y indicate the coordinates of an arbitrary point on the reference line.
  • x 0 , y 0 is the ratio of 12 C in the isotope ratio of carbon derived from CO 2 (the carbon at the 1st or 5th position of glutamic acid) in glutamic acid, and the other atoms are natural
  • the reference line is expressed by the following equation.
  • 13 C derived from NaH 13 CO 3 is immobilized by carbonic acid-fixing enzymes such as phosphoenolpyruvate carboxylase (Ppc), pyruvate carboxylase (Pyc), and phosphoenolpyruvate carboxykinase (Pck).
  • Ppc phosphoenolpyruvate carboxylase
  • Pyc pyruvate carboxylase
  • Pck phosphoenolpyruvate carboxykinase
  • Example 9 ⁇ Glutamic acid production by Pantoair strain> The amount of glutamic acid and the amount of by-products in the culture solution of Example 8 were measured.
  • HPLC Waters 2695
  • NN-814 column Showa Denko
  • UV / Vis detector Waters 2489
  • glucose and other products in the filtrate an HPLC (Waters 2695) equipped with a ULTRON PS-80H column (Shinwa Kako) and an RI detector (Waters 2414) were used.
  • the strain (PA / mtk_mcl_gta) into which the carbonic acid fixation pathway was introduced showed a higher glutamic acid yield than the control strain (PA / vec).
  • Example 10 ⁇ Preparation of plasmid pCASET> Using pHSG298 (Takara) as a template, CGCCCTCGAGTGACTCATACCACGGCTG (SEQ ID NO: 107) and CGCCTCGAGGCACAACCACTTCTTCACGAG (SEQ ID NO: 108) as primers were amplified by the PCR method, and the resulting DNA fragment was digested with the restriction enzyme XhoI and ligated. After that, it was transformed into Escherichia coli DH5 ⁇ strain competent cell (Toyobo Co., Ltd. DNA-903) to obtain a transformant that grows on an LB agar plate containing 25 ⁇ g / mL kanamycin. The plasmid was recovered from the obtained cells, and the plasmid in which the XhoI recognition sequence was inserted into pHSG298 was named pHSG298-XhoI.
  • amplification was performed by PCR using pKK223-3 (Pharmacia) as a template, ATCATCCAGCTGTGCAGGCAGCCATCGGAAG (SEQ ID NO: 109) and ATCCCCGGGAATTCTGTT (SEQ ID NO: 110) as primers, and the resulting DNA fragment was restricted to the restriction enzyme PvuII And digested with SmaI to obtain a DNA fragment encoding about 0.2 kbp tac promoter.
  • a DNA fragment encoding the tac promoter and an about 2.4 kbp DNA fragment obtained by digesting the plasmid pHSG298-XhoI with the restriction enzyme PvuII and treating with alkaline phosphatase were mixed and ligated using ligase, followed by Escherichia coli DH5 ⁇ strain
  • the cells were transformed into competent cells (Toyobo Co., Ltd., DNA-903) to obtain transformants that grew on LB agar plates containing 25 ⁇ g / mL kanamycin.
  • the plasmid was recovered from the obtained bacterial cells, and the pHSG298-XhoI lac promoter was replaced with the tac promoter to obtain a plasmid pHSGT1 in which the direction of the tac promoter was the same as the original lac promoter.
  • pHSG298 was digested with restriction enzymes EcoRI and ClaI to obtain a DNA fragment of about 1.0 kbp containing the multi-cloning site of pHSG298. .
  • the obtained DNA fragment was mixed with an approximately 1.7 kbp DNA fragment obtained by digesting plasmid pHSGT1 with restriction enzymes EcoRI and ClaI and further treated with alkaline phosphatase, and ligated with ligase, and then competed with Escherichia coli DH5 ⁇ strain competent.
  • a cell (Toyobo Co., Ltd., DNA-903) was transformed to obtain a transformant that grew on an LB agar plate containing 25 ⁇ g / mL kanamycin.
  • the plasmid was recovered from the obtained bacterial cells to obtain a plasmid pHSGT2 in which a multi-cloning site of pHSG298 was linked downstream of the tac promoter.
  • the DNA fragment obtained by digesting the prepared DNA fragment with the restriction enzyme XhoI was mixed with the DNA fragment obtained by digesting the plasmid pHSGT2 with the restriction enzyme XhoI and further treated with alkaline phosphatase, and ligated with ligase.
  • a plasmid was recovered from the obtained bacterial cells, and a plasmid in which a DNA fragment containing the replication origin of pCASE1 and repA and repB was inserted into the XhoI recognition site of pHSGT2 was named pCSET.
  • pCSET a plasmid in which a DNA fragment containing the replication origin of pCASE1 and repA and repB was inserted into the XhoI recognition site of pHSGT2 was named pCSET.
  • the direction of pCASE1-derived repA was opposite to that of the tac promoter.
  • Example 11 ⁇ Production of Corynebacterium glutamicum strain for evaluation> Regarding the glycine cleavage system T-protein gene (SEQ ID NO: 75), H-protein (SEQ ID NO: 76), P-protein gene (SEQ ID NO: 77), L-protein gene (SEQ ID NO: 78) derived from Escherichia coli MG1655, A region covering the translation stop codon from each SD sequence and start codon was amplified by the PCR method (gcs).
  • glycine transaminase gene (SEQ ID NO: 64) derived from Methylococcus capsuleatus
  • gta glycine transaminase gene
  • Both obtained amplified fragments were ligated under the control of the tac promoter of the plasmid pCASET.
  • the obtained plasmid was designated as pCASET_mcl (Mc) _mtk (Mc) _gcs (Ec) _gta (Mc).
  • Corynebacterium glutamicum DSM1412 (hereinafter sometimes referred to as “CG strain”) is transformed by electroporation with either plasmid pCASET or plasmid pCASET_mcl (Mc) _mtk (Mc) _gcs (Ec) _gta (Mc). Converted. Each strain was applied to an LB agar medium containing 15 ⁇ g / mL kanamycin, and the grown strain was used as an evaluation strain. The evaluation strains were named CG / vec and CG / mtk_mcl_gcs_gta, respectively.
  • Example 12 ⁇ Verification of introduction of 13 C-labeled CO 2 into glutamic acid>
  • the Corynebacterium strain prepared in Example 11 can be evaluated in the same manner as in Example 8.
  • the strain (CG / mtk_mcl_gcs_gta) into which the carbonic acid fixation pathway has been introduced shows a value above the reference line.
  • the control strain (CG / vec) shows a value almost on the baseline. Therefore, it can be seen that in the CG / mtk_mcl_gcs_gta strain, carbon derived from carbonic acid labeled with 13 C in acetyl CoA is introduced.
  • Example 13 ⁇ Glutamic acid production by Corynebacterium glutamicum> The amount of glutamic acid in the culture medium of Example 12 can be measured by the same method as in Example 9. When measured, the strain (CG / mtk_mcl_gcs_gta) provided with a carbonic acid fixation pathway shows a higher glutamic acid yield than the control strain (CG / vec).
  • CO 2 can be efficiently converted into acetyl CoA.
  • substances derived from acetyl CoA such as isopropyl alcohol, acetone, and glutamic acid can also be efficiently produced.
  • Example 14 ⁇ Examination of additives> Example 12 except that CG / mtk_mcl_gcs_gta constructed in Example 11 was used as an evaluation strain, sodium bicarbonate ( 13 C labeling) was not introduced, and carbonate, carbon dioxide gas or a reducing agent was added to the medium.
  • the cells are cultured in the same manner as in Example 13 and analyzed in the same manner as in Example 13. Compared with the amount of glutamic acid produced by the control strain (CG / vec), the strain (CG / mtk_mcl_gcs_gta) provided with the carbonic acid fixation pathway shows a high yield.
  • Cultivation and analysis can be performed in the same manner by supplying carbonate, carbon dioxide gas or a reducing agent as an additive to the medium.
  • the test plots for supplying carbonate, carbon dioxide gas or reducing agent to the additive show higher yields for sugars than the test plots for which no carbonate, carbon dioxide gas or reducing agent is supplied. That is, in a strain provided with a CO 2 fixation pathway, supply of carbonate, carbon dioxide gas, or a reducing agent is considered to be effective in improving the sugar yield.
  • Example 15 ⁇ Escherichia coli B strain atoD genome enhancement / pgi gene deletion strain> The entire base sequence of the genomic DNA of Escherichia coli MG1655 is known (GenBank accession number U00096), and the base sequence of the gene encoding phosphoglucose isomerase of Escherichia coli (hereinafter sometimes referred to as “pgi”) has also been reported. (GenBank accession number X15196).
  • the primer of SEQ ID NO: 112 has an EcoRI recognition site on the 5 ′ end side
  • the primers of SEQ ID NO: 113 and SEQ ID NO: 114 have an XbaI recognition site on the 5 ′ end side
  • the primer of SEQ ID NO: 115 has a PstI recognition site on the 5 ′ end side. Respectively.
  • a genomic DNA of Escherichia coli MG1655 was prepared, and the obtained genomic DNA was used as a template, and PCR was performed with the primer pair of SEQ ID NO: 112 and SEQ ID NO: 113, whereby a DNA fragment of about 1.0 kb was amplified. (Hereinafter sometimes referred to as “pgi-L fragment”). Further, by performing PCR using the primer pair of SEQ ID NO: 114 and SEQ ID NO: 115, a DNA fragment of about 1.0 kb was amplified (hereinafter sometimes referred to as “pgi-R fragment”).
  • DNA fragments were separated and collected by agarose gel electrophoresis, the pgi-L fragment was digested with EcoRI and XbaI, and the pgi-R fragment was digested with XbaI and PstI, respectively.
  • the two digested fragments were mixed with EcoRI and PstI digests of temperature sensitive plasmid pTH18cs1 (GenBank accession number AB019610), reacted with T4 DNA ligase, and then Escherichia coli DH5 ⁇ strain competent cell (manufactured by Toyobo Co., Ltd.).
  • a transformant that grew on an LB agar plate containing 10 ⁇ g / mL chloramphenicol at 30 ° C. was obtained.
  • a plasmid was recovered from the obtained transformant, and it was confirmed that two fragments, a 5 'upstream vicinity fragment and a 3' downstream vicinity fragment of the gene encoding pgi were correctly inserted into pTH18cs1.
  • the obtained plasmid was digested with XbaI, and then blunt-ended with T4 DNA polymerase.
  • the plasmid was recovered from the obtained transformant, and it was confirmed that the kanamycin resistance gene was correctly inserted between the 5 ′ upstream neighboring fragment and the 3 ′ downstream neighboring fragment of the gene encoding pgi, and pTH18cs1-pgi and did.
  • the prepared pTH18cs1-pgi was transformed into the B :: atoDAB strain prepared in Example 1, and cultured on an LB agar plate containing 10 ⁇ g / mL chloramphenicol and 50 ⁇ g / mL kanamycin at 30 ° C. overnight. Got the body.
  • the obtained transformant was inoculated into an LB liquid medium containing 50 ⁇ g / mL kanamycin and cultured at 30 ° C. overnight.
  • a part of this culture solution was applied to an LB agar plate containing 50 ⁇ g / mL kanamycin to obtain colonies that grew at 42 ° C.
  • the obtained colonies were cultured in an LB liquid medium containing 50 ⁇ g / mL kanamycin for 24 hours at 30 ° C., and further applied to an LB agar plate containing 50 ⁇ g / mL kanamycin to obtain colonies that grew at 42 ° C.
  • Example 16 ⁇ Escherichia coli B strain atoD genome enhancement / pgi gene deletion / gntR gene deletion strain>
  • the entire base sequence of the genomic DNA of Escherichia coli B strain is known (GenBank accession number CP000819), and the base sequence of the gene encoding the transcriptional repressor GntR is the genome sequence of the Escherichia coli B strain described in GenBank accession number CP000819. 3509184-351010.
  • SEQ ID NO: 116 In order to clone the neighboring region of the gene encoding GntR (gntR), GGAATTCGGGTCAATTTTCACCCTCTATC (SEQ ID NO: 116), GTGGGCCGTCCCGAGAGTACAACCAGAGTAGATCCTG (SEQ ID NO: 117) did.
  • the primers of SEQ ID NO: 116 and SEQ ID NO: 119 each have an EcoRI recognition site on the 5 'end side.
  • a genomic DNA of Escherichia coli B strain (GenBank accession number CP000819) is prepared, and the obtained genomic DNA is used as a template, and PCR is performed with a primer pair of SEQ ID NO: 116 and SEQ ID NO: 117.
  • the fragment was amplified (hereinafter sometimes referred to as “gntR-L fragment”). Further, by performing PCR with the primer pair of SEQ ID NO: 118 and SEQ ID NO: 119, a DNA fragment of about 1.0 kb was amplified (hereinafter sometimes referred to as “gntR-R fragment”).
  • DNA fragments were separated and collected by agarose gel electrophoresis, and PCR was performed with a primer pair of SEQ ID NO: 116 and SEQ ID NO: 119 using the gntR-L fragment and the gntR-R fragment as a template to obtain about 2.0 kb.
  • the DNA fragment was amplified (hereinafter sometimes referred to as “gntR-LR fragment”).
  • the gntR-LR fragment was separated and collected by agarose gel electrophoresis, digested with EcoRI, mixed with the EcoRI digest of temperature sensitive plasmid pTH18cs1 (GenBank accession number AB019610), and reacted with T4 DNA ligase.
  • the obtained plasmid pTH18cs1-gntR was transformed into the B :: atoDAB ⁇ pgi strain prepared in Example 15, and cultured on an LB agar plate containing 10 ⁇ g / mL chloramphenicol at 30 ° C. overnight. Obtained.
  • the obtained transformant was inoculated into an LB liquid medium containing 10 ⁇ g / mL chloramphenicol and cultured at 30 ° C. overnight.
  • a part of this culture solution was applied to an LB agar plate containing 10 ⁇ g / mL chloramphenicol to obtain colonies that grew at 42 ° C.
  • the obtained colonies were cultured in an LB liquid medium at 30 ° C. for 24 hours, and further applied to an LB agar plate to obtain colonies that grew at 42 ° C.
  • Example 17 ⁇ Escherichia coli B strain atoD genome enhancement / pgi gene deletion / gntR gene deletion / gnd gene deletion strain> CGGCATATGAATGGCGCGCGCGGGGCCCGGTGGG (SEQ ID NO: 120), TGGAGCTCTGTATCATGACGGTG (SEQ ID NO: 121), TGGAGCTCCTGATGCATGCATGG (SEQ ID NO: 120) A seed was synthesized.
  • the primer of SEQ ID NO: 120 has an NdeI recognition site at the 5 ′ end
  • the primers of SEQ ID NO: 121 and SEQ ID NO: 122 have a SacI recognition site at the 5 ′ end
  • the primer of SEQ ID NO: 123 is at the 5 ′ end. Has a BamHI recognition site.
  • a genomic DNA of Escherichia coli B strain (GenBank accession number CP000819) was prepared, and a DNA fragment of about 1.0 kb was amplified by PCR using the primer pair of SEQ ID NO: 120 and SEQ ID NO: 121 (hereinafter referred to as “gnd ⁇ ”). L fragment "). Further, by performing PCR with the primer pair of SEQ ID NO: 122 and SEQ ID NO: 123, a DNA fragment of about 1.0 kb was amplified (hereinafter sometimes referred to as “gnd-R fragment”).
  • a plasmid was recovered from the obtained transformant, and it was confirmed that two fragments of the 5 ′ upstream neighboring fragment and the 3 ′ downstream neighboring fragment of the gene encoding gnd were correctly inserted into pTH18cs1, and this plasmid was transformed into pTH18cs1. -Gnd.
  • the obtained plasmid pTH18cs1-gnd was transformed into the B :: atoDAB ⁇ pgi ⁇ gntR strain prepared in Example 16, and cultured on an LB agar plate containing 10 ⁇ g / mL chloramphenicol at 30 ° C. overnight. Obtained.
  • the obtained transformant was inoculated into an LB liquid medium containing 10 ⁇ g / mL chloramphenicol and cultured at 30 ° C. overnight. Next, a part of this culture solution was applied to an LB agar plate containing 10 ⁇ g / mL chloramphenicol to obtain colonies that grew at 42 ° C.
  • the obtained colonies were cultured in an LB liquid medium at 30 ° C. for 24 hours, and further applied to an LB agar plate to obtain colonies that grew at 42 ° C.
  • AtoD genome enhancement / pgi gene deletion / gntR gene deletion / gnd gene deletion strain (hereinafter sometimes referred to as “B :: atoDAB ⁇ pgi ⁇ gntR ⁇ gnd strain”).
  • Example 18 ⁇ Preparation of plasmid pMWKGC2>
  • Escherichia coli MG1655 genomic DNA was used as a template, CACTAGTCTGTCGCAATGATTGACACGATTCCCG (SEQ ID NO: 124) and GCTCGAATTCCCATATTTCCACCAGCTATTTTGTTAGGTGAATAAAAGG (SEQ ID NO: 125).
  • the DNA fragment containing the GAPDH promoter was obtained by digesting with EcoRI and phosphorylating the end with T4 Polynucleotide Kinase.
  • Plasmid pMW119 (GenBank accession number AB005476) was digested with the restriction enzyme NdeI, the ends were blunted, and then digested with EcoRI to dephosphorylate the ends.
  • This pMW119 DNA fragment and the above-mentioned GAPDH promoter-containing DNA fragment were mixed and ligated, and then transformed into an Escherichia coli DH5 ⁇ strain competent cell and applied to an LB agar plate containing 50 ⁇ g / mL ampicillin. A growing transformant was obtained. The obtained colonies were cultured overnight at 37 ° C. in an LB liquid medium containing 50 ⁇ g / mL ampicillin, and the plasmid was recovered from the obtained bacterial cells to obtain plasmid pMWG2.
  • the DNA obtained was amplified by PCR using pTH18cs1 (GenBank accession number AB019610) as a template and TCGGCACGTAAGAGGTTCC (SEQ ID NO: 101) and CGGGTCGAATTTGCTTTCG (SEQ ID NO: 102) as primers.
  • the fragment was phosphorylated with T4 Polynucleotide Kinase (Takara) to obtain a DNA fragment containing a chloramphenicol resistance gene.
  • CTAGATCTGACATAGTAAGAGGGGTAAGCC SEQ ID NO: 103
  • CTAGATCTCAGGGTTTATTGTCTCATGAGC SEQ ID NO: 1044
  • CCTTTGGTTAAAGGCTTTAAGATCTTCCCAGTGGACAAACTATGCCC SEQ ID NO: 105
  • GGCATAGTTTGTCCCACTGGGAAGATTCTAAGCCCTTTAACCAAGG SEQ ID NO: 106
  • the transformant which grows on the LB agar plate containing was obtained.
  • the obtained colonies were cultured overnight at 37 ° C. in an LB liquid medium containing 25 ⁇ g / mL chloramphenicol, and the plasmid was recovered from the obtained bacterial cells to obtain plasmid pMWGKC2.
  • Example 19 ⁇ Construction of glycine transaminase expression plasmid derived from Methylococcus capsuleatus ATCC 33009>
  • the region covering the translation termination codon from the respective SD sequence and start codon is defined as GGAATTCCATATGCGTGTAAAAATCGTCTAC ( SEQ ID NO: 126) and GCTCTAGATTTAGAATCTGATTCCGTGTTC (SEQ ID NO: 127) were used as primers to amplify by PCR.
  • the fragment obtained by cleaving the amplified fragment with NdeI and XbaI was ligated to the plasmid pMWKC2 prepared in Example 18 that had been cleaved with NdeI and XbaI, and ligated under the control of the gap promoter possessed by pMWKC2.
  • the obtained plasmid was designated as pMWWGC2_mcl (Mc) _mtkAB (Mc).
  • a PCR method using a glycine transaminase gene (SEQ ID NO: 64) derived from Methylococcus capsuleatus as a primer using GCTCTAGACGGGAGAAAGTCTTATGCCTGGTCGCCAACCCATCT (SEQ ID NO: 128) and GGAATTCAAGCTTTTAGACTCGGGGCTGGATCACC (SEQ ID NO: 129).
  • the fragment obtained by cleaving the amplified fragment with XbaI and HindIII was ligated to the plasmid pMWKC2_mcl (Mc) _mtkAB (Mc) digested with XbaI and HindIII, and malate thiokinase of the plasmid pMWKGK2_mcl (Mc) _mtkAB (Mc). (Mtk) Ligated downstream of the sequence.
  • the obtained plasmid was designated as pMWWGC2_mcl (Mc) _mtkAB (Mc) _gtaA.
  • Example 20 ⁇ Construction of glycine transaminase expression plasmid derived from aromachromium vinosam> Base sequence optimized for Escherichia coli based on the amino acid sequence of the glycine transaminase (SEQ ID NO: 44), SD sequence, and XbaI recognition sequence on the N-terminal side in order to obtain a glycine transaminase gene derived from aromachromium vinosam And a base sequence having a HindIII recognition sequence on the C-terminal side (SEQ ID NO: 130) was prepared by total synthesis.
  • the fragment obtained by cleaving this synthetic fragment with XbaI and HindIII was ligated to the plasmid pMWGKC2_mcl (Mc) _mtkAB (Mc) digested with XbaI and HindIII, and malatethio of plasmid pMWKKC2_mcl (Mc) _mtkAB (Mc). Ligated downstream of the kinase (mtk) sequence.
  • the obtained plasmid was designated as pMWWGC_mcl (Mc) _mtkAB (Mc) _ALV.
  • Example 21 ⁇ Mtk and mcl-introduced isopropyl alcohol production atoD genome enhancement / pgi gene deletion / gntR gene deletion / gnd gene deletion strain> A competent cell of the strain prepared in Example 17 (B :: atoDAB ⁇ pgi ⁇ gntR ⁇ gnd strain) was transformed with the plasmid pIaz prepared in Example 2 and any of the plasmids prepared in Examples 18 to 20, and 25 mg / L Of chloramphenicol and 100 mg / L ampicillin were applied to an LB agar medium and grown to obtain a strain. These strains are summarized in Table 2.
  • Example 22 ⁇ Production of isopropyl alcohol> Each test strain constructed in Example 21 was inoculated into a test tube containing 25 mL / L chloramphenicol and LB Broth, Miller culture solution (Difco244620) containing 100 mg / L ampicillin as a preculture. The culture was performed overnight at a culture temperature of 30 ° C. and 120 rpm. OD of preculture was measured, cells corresponding to OD3.0 were collected, suspended in 300 ⁇ l of 0.9% NaCl solution, 20 ⁇ l was suspended in 5% glucose, 25 mg / L chloramphenicol, 100 mg / L ampicillin.
  • the production amount of isopropyl alcohol at 48 hours was 4.8 g in the control strain (vec / atoDAB ⁇ pgi ⁇ gntR ⁇ gnd), 7.2 g in the mtk + mcl-introduced strain (MtkAB / atoDAB ⁇ pgi ⁇ gntR ⁇ gnd / ⁇ Agt / MtAgt / MtAg / MtAg / MtAgt) It was 8.8 g in the ALV + mtk + mcl-introduced strain (MtkAB, ALV / atoDAB ⁇ pgi ⁇ gntR ⁇ gnd).
  • the amount of acetone produced at 48 hours was 0.1 g in the control strain (vec / atoDAB ⁇ pgi ⁇ gntR ⁇ gnd), 0.2 g in the mtk + mcl-introduced strain (MtkAB / atoDAB ⁇ pgi ⁇ gntR ⁇ gnd), ⁇ GtaAg in the GtaA + mtk + mclAta It was 0.8 g in the ALV + mtk + mcl-introduced strain (MtkAB, ALV / atoDAB ⁇ pgi ⁇ gntR ⁇ gnd). From this, it was found that the amount of isopropyl alcohol and acetone produced was improved when glycine transaminase was introduced in addition to mtk and mcl.
  • the yields of isopropyl alcohol and acetone for 48 hours were 14.8% for the control strain (vec / atoDAB ⁇ pgi ⁇ gntR ⁇ gnd), 17.3% for the mtk + mcl-introduced strain (MtkAB / atoDAB ⁇ pgi ⁇ gntR ⁇ gndGtAgGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGtGt
  • Example 23 ⁇ Verification of introduction of 13 C-labeled CO 2 into glutamic acid and production of glutamic acid using the plasmid pMWGKC2 by Pantoea strain> Pantoea ananatis PA strain was transformed with pMWGKC2 or pMWGKC2_mcl (Mc) _mtkAB (Mc) _gtaA and named PA / vec2 and PA / mtk_mcl_gta2, respectively.
  • Example 24 ⁇ Search for 4-hydroxy-2-oxoglutarate dehydratase and 4-oxoglutaconate reductase>
  • a standard method for enzyme screening from the environment may be followed. First, natural soil samples are cultured using 4-hydroxy-2-oxoglutaric acid or 4-oxoglutaconic acid as a carbon source, and microorganisms that can grow are isolated. Thereafter, the microorganism is incubated with 4-hydroxy-2-oxoglutaric acid using a culture solution or a crude extract, and the production of 4-oxoglutaconic acid is confirmed by HPLC.
  • the enzyme gene can be cloned from In the search for 4-oxoglutaconate reductase, a natural soil sample can be cultured using 4-oxoglutaconate or 2-oxoglutarate as a carbon source and the enzyme gene can be cloned in the same manner as described above.
  • Example 25 ⁇ Construction of enzyme expression plasmid using pMWGKC> PCR method for the region covering the translation stop codon from the respective SD sequences and start codons for the malyl-CoA lyase gene, the malate thiokinase subunit ⁇ gene, and the malate thiokinase subunit ⁇ gene derived from Methylococcus capsulatus ATCC 33009 Amplified by Since these three genes are continuous on the genome of Methylococcus capsuleatus, they can be obtained as one fragment. The obtained amplified fragment was ligated under the control of the gap promoter possessed by the plasmid pMWGKC. The obtained plasmid was designated as pMWWGC_mcl_mtk.
  • the SD sequence and the start codon are used in the same manner as described above.
  • a region covering the translation stop codon is amplified by the PCR method.
  • the obtained amplified fragment is ligated under the control of the gap promoter downstream of mtk of the plasmid pMWGKC_mcl_mtk.
  • the resulting plasmid is designated as pMWWGC_mcl_mtk_enz.
  • Example 26 ⁇ Confirmation of enzyme activity> Escherichia coli DH5 ⁇ competent cells were transformed with the plasmid pMWGKC or the plasmid pMWGKC_mcl_mtk to obtain respective transformants. The cells were cultured in an LB medium containing chloramphenicol, and the cells were crushed with a bead shocker to obtain a crude extract of each cell. Using this crude bacterial cell extract, malt, acetyl CoA and ATP as substrates, according to the method described in the literature (Journal of Bacteriology, 2001; 183 (14): 4305-4316), the continuous reaction of mtk and mcl Activity was measured. As a result, the transformant of the control strain pMWKC showed no activity, whereas the transformant of pMWKGC_mcl_mtk showed activity. Therefore, the activities of the expressed proteins mcl and mtk could be confirmed.
  • Example 27 ⁇ Construction of Pantoea Ananatis strain for evaluation>
  • the Pantoea Ananatis PA strain prepared in Example 6 is transformed with pMWGKC of Example 3 or pMWGK_mcl_mtk_enz of Example 25 by the CaCl 2 method or the electroporation method.
  • Each strain is applied to an LB agar medium containing 30 ⁇ g / mL chloramphenicol and 15 ⁇ g / mL tetracycline, and the grown strain is used as an evaluation strain.
  • the evaluation strains are named PA / vec and PA / mcl_mtk_enz, respectively.
  • Example 28 ⁇ Glutamic acid production by Pantoea Ananatis>
  • the evaluation strain prepared in Example 27 is cultured using a medium containing a carbon source
  • the PA / mcl_mtk_enz strain produces glutamic acid at a higher yield than the control strain PA / vec. Can do.
  • Example 29 ⁇ Construction of expression plasmid for corynebacterium> Regions covering the translation stop codon from the respective SD sequence and start codon for the gene encoding malyl-CoA lyase, the subunit ⁇ gene of malate thiokinase, and the subunit ⁇ gene of malate thiokinase derived from Methylococcus capsuleatus ATCC 33009 Is amplified by PCR method to obtain an amplified fragment. Since these three genes are continuous on the genome of Methylococcus capsuleatus, they can be obtained as one fragment.
  • the SD sequence and the start codon are used in the same manner as described above.
  • a region covering the translation stop codon is amplified by the PCR method to obtain an amplified fragment.
  • the above three amplified fragments are ligated under the control of the plasmid pCASET promoter.
  • the obtained plasmid is designated as pCASET_mcl_mtk_enz.
  • Example 30 ⁇ Production of Corynebacterium glutamicum strain for evaluation> Corynebacterium glutamicum DSM1412 (hereinafter sometimes referred to as “CG strain”) is transformed with pCASET or pCASET_mcl_mtk_enz by electroporation. Each strain is applied to an LB agar medium containing 15 ⁇ g / mL kanamycin, and the grown strain is used as an evaluation strain.
  • the evaluation strains are named CG / vec and CG / mcl_mtk_enz, respectively.
  • Example 31 ⁇ Glutamic acid production by Corynebacterium glutamicum>
  • glutamic acid can be produced at a higher yield in the CG / mcl_mtk_enz strain compared to the control strain CG / vec strain.
  • 2-oxoglutaric acid can also be detected as an intermediate. The total amount of glutamic acid and 2-oxoglutaric acid is higher in the CG / mcl_mtk_enz strain than in the control strain CG / vec.
  • glutamic acid and 2-oxoglutaric acid can be analyzed by supplying carbonate, carbon dioxide gas, or a reducing agent to the medium for culturing CG / mcl_mtk_enz.
  • the test group which supplies carbonate, carbon dioxide gas, or a reducing agent as an additive shows a higher sugar yield than the test group without addition. That is, in a strain provided with a CO 2 fixation pathway, it is considered that the supply of carbonate, carbon dioxide gas or a reducing agent is effective in improving the sugar yield.
  • 2-oxoglutaric acid and substances derived from 2-oxoglutaric acid, such as glutamic acid can be produced efficiently.

Landscapes

  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

Cette invention concerne un micro-organisme comportant une voie, ladite voie comprenant : une réaction enzymatique de l'acide glyoxylique à la glycine ; une réaction enzymatique de la glycine à la sérine ; et une réaction enzymatique de la sérine à l'acide pyruvique ou une réaction enzymatique de la sérine à l'acide 3-hydroxypyruvique. Un micro-organisme comportant une voie est en outre décrit, ladite voie comprenant : une réaction enzymatique de l'acide phospho-énol-pyruvique et du CO2 à l'acide oxalo-acétique ou une réaction enzymatique de l'acide pyruvique et du CO2 à l'acide oxalo-acétique ; une réaction enzymatique de l'acide oxalo-acétique à l'acide malique ; une réaction enzymatique de l'acide malique au malyl-CoA ; une réaction enzymatique du malyl-CoA à l'acide glyoxylique et à l'acétyl-CoA ; une réaction enzymatique de l'acide glyoxylique et de l'acide pyruvique à l'acide 4-hydroxy-2-oxoglutarique ; une réaction enzymatique de l'acide 4-hydroxy-2-oxoglutarique à l'acide 4-oxoglutaconique ; et une réaction enzymatique de l'acide 4-oxoglutaconique à l'acide 2-oxoglutarique.
PCT/JP2014/051403 2013-01-24 2014-01-23 Micro-organismes comportant une voie de fixation du dioxyde de carbone qui a été introduite dans ceux-ci WO2014115816A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
JP2013-011539 2013-01-24
JP2013011539 2013-01-24
JP2013-011537 2013-01-24
JP2013011537 2013-01-24

Publications (1)

Publication Number Publication Date
WO2014115816A1 true WO2014115816A1 (fr) 2014-07-31

Family

ID=51227605

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2014/051403 WO2014115816A1 (fr) 2013-01-24 2014-01-23 Micro-organismes comportant une voie de fixation du dioxyde de carbone qui a été introduite dans ceux-ci

Country Status (2)

Country Link
TW (1) TW201443230A (fr)
WO (1) WO2014115816A1 (fr)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009008377A1 (fr) * 2007-07-11 2009-01-15 Mitsui Chemicals, Inc. Bactérie de production d'alcool isopropylique et procédé de production d'alcool isopropylique à l'aide de cette bactérie
JP2009148222A (ja) * 2007-12-21 2009-07-09 Research Institute Of Innovative Technology For The Earth Ｌ−グルタミン酸の製造方法
WO2011099006A2 (fr) * 2010-02-11 2011-08-18 Yeda Research And Development Co. Ltd. Systèmes enzymatiques pour la fixation du carbone et procédés de production associés
WO2013018734A1 (fr) * 2011-07-29 2013-02-07 三井化学株式会社 Micro-organisme dans lequel une voie de fixation du dioxyde de carbone a été introduite

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009008377A1 (fr) * 2007-07-11 2009-01-15 Mitsui Chemicals, Inc. Bactérie de production d'alcool isopropylique et procédé de production d'alcool isopropylique à l'aide de cette bactérie
JP2009148222A (ja) * 2007-12-21 2009-07-09 Research Institute Of Innovative Technology For The Earth Ｌ−グルタミン酸の製造方法
WO2011099006A2 (fr) * 2010-02-11 2011-08-18 Yeda Research And Development Co. Ltd. Systèmes enzymatiques pour la fixation du carbone et procédés de production associés
WO2013018734A1 (fr) * 2011-07-29 2013-02-07 三井化学株式会社 Micro-organisme dans lequel une voie de fixation du dioxyde de carbone a été introduite

Non-Patent Citations (11)

* Cited by examiner, † Cited by third party
Title
ABSTRACTS OF THE ANNUAL MEETING OF THE SOCIETY FOR BIOTECHNOLOGY, 2010, Japan , Heisei 22 Nendo, pages 137, 2P-2107 *
ABSTRACTS OF THE ANNUAL MEETING OF THE SOCIETY FOR BIOTECHNOLOGY, 2010, Japan , Heisei 22 Nendo, pages 225 *
BERG I A: "Ecological Aspects of the Distribution of Different Autotrophic CO2 Fixation Pathways", APPLIED AND ENVIRONMENTAL MICROBIOLOGY, vol. 77, no. 6, March 2011 (2011-03-01), pages 1925 - 1936, XP055141691, DOI: doi:10.1128/AEM.02473-10 *
BIOSCIENCE & INDUSTRY, vol. 66, no. 8, 2008, pages 426 - 432 *
GEORG FUCHS: "CO2 fixation in acetogenic bacteria: Variations on a theme", FEMS MICROBIOLOGY LETTERS, vol. 39, no. 3, 1986, pages 181 - 213, XP023921566, DOI: doi:10.1111/j.1574-6968.1986.tb01859.x *
HANA ŠMEJKALOVÁ ET AL: "Methanol Assimilation in Methylobacterium extorquens AM1: Demonstration of All Enzymes and Their Regulation", PLOS ONE, vol. 5, no. 10, 2010, pages e13001, XP055141693, DOI: doi:10.1371/journal.pone.0013001 *
SUNISA CHATSURACHAI ET AL: "An in silico platform for the design of heterologous pathways in nonnative metabolite production", BMC BIOINFORMATICS, vol. 13, no. 93, 2012 *
SYLVIA HERTER ET AL.: "A Bicyclic Autotrophic C02 Fixation Pathway in Chloroflexus aurantiacus", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 277, no. 23, 2002, pages 20277 - 20283 *
SYLVIA HERTER ET AL.: "Autotrophic C02 Fixation by Chloroflexus aurantiacus: Study of Glyoxylate Formation and Assimilation via the 3-Hydroxypropionate Cycle", JOURNAL OF BACTERIOLOGY, vol. 183, no. 14, 2001, pages 4305 - 4316 *
TOMOKAZU SHIRAI ET AL: "Study on roles of anaplerotic pathways in glutamate overproduction of Corynebacterium glutamicum by metabolic flux analysis", MICROBIAL CELL FACTORIES, vol. 6, no. 19, 2007, pages 1 - 11 *
YOHEI SHINFUKU ET AL: "Development and experimental verification of a genome-scale metabolic model for Corynebacterium glutamicum", MICROBIAL CELL FACTORIES, vol. 8, no. 43, 2009, pages 1 - 15 *

Also Published As

Publication number Publication date
TW201443230A (zh) 2014-11-16

Similar Documents

Publication Publication Date Title
TWI573869B (zh) 導入有二氧化碳固定循環之微生物
WO2014115815A1 (fr) Micro-organisme dans lequel a été introduit un cycle de fixation du dioxyde de carbone
CN104395455B (zh) 重组微生物及其使用方法
WO2015005406A1 (fr) Procédé de fabrication de substance utile
JP7380768B2 (ja) アルデヒドの製造方法
JP7359248B2 (ja) 目的物質の製造方法
JP7074133B2 (ja) 目的物質の製造方法
WO2020208842A1 (fr) Micro-organisme génétiquement modifié et procédé de production d'une substance cible l'utilisant
JP2019531756A (ja) 目的物質の製造方法
WO2014115816A1 (fr) Micro-organismes comportant une voie de fixation du dioxyde de carbone qui a été introduite dans ceux-ci
TWI631213B (zh) 生產由乙醯輔酶ａ衍生之化學物質的微生物
WO2021095635A1 (fr) Procédé de fabrication de vanilline

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14743928

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 14743928

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: JP