WO2014109456A1 - 카테킨 또는 그 유도체를 포함하는 모낭각화 이상의 예방 또는 치료용 약학적 조성물 - Google Patents

카테킨 또는 그 유도체를 포함하는 모낭각화 이상의 예방 또는 치료용 약학적 조성물 Download PDF

Info

Publication number
WO2014109456A1
WO2014109456A1 PCT/KR2013/008856 KR2013008856W WO2014109456A1 WO 2014109456 A1 WO2014109456 A1 WO 2014109456A1 KR 2013008856 W KR2013008856 W KR 2013008856W WO 2014109456 A1 WO2014109456 A1 WO 2014109456A1
Authority
WO
WIPO (PCT)
Prior art keywords
egcg
catechin
pharmaceutical composition
derivative
abnormalities
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2013/008856
Other languages
English (en)
French (fr)
Inventor
서대헌
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
SNU R&DB Foundation
Original Assignee
SNU R&DB Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020130117831A external-priority patent/KR20140092205A/ko
Application filed by SNU R&DB Foundation filed Critical SNU R&DB Foundation
Publication of WO2014109456A1 publication Critical patent/WO2014109456A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/35—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom
    • A61K31/352—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom condensed with carbocyclic rings, e.g. methantheline 
    • A61K31/353—3,4-Dihydrobenzopyrans, e.g. chroman, catechin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19—Carboxylic acids, e.g. valproic acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0014—Skin, i.e. galenical aspects of topical compositions
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders

Definitions

  • the present invention relates to the field of prophylaxis or treatment of hair follicular keratosis abnormalities comprising catechins or derivatives thereof.
  • Acne which is one of the follicular keratosis diseases, is known to be associated with various etiologies.
  • the excessive production of sebum in the sebaceous gland causes skin diseases such as acne.
  • the common etiology for a class of diseases called acne is the comedo that occurs in hair follicles, which may involve damage to the hair follicle unit.
  • Early scalp from acne consists of sticky keratin substances. These keratinous impaction causes bacteria to multiply, causing inflammatory symptoms in the form of pustules, papules, cysts and sintered nodes.
  • catechins is a major polyphenol component of green tea is known to inhibit tumor progression, and improve inflammatory diseases such as diabetes, allergies and the like.
  • Korean Patent Application No. 2006-0024905 discloses a cosmetic composition containing green tea extract or at least one selected from the group consisting of catechins, flavonols, and derivatives of green tea in a certain ratio Is disclosed.
  • the present application is to provide a material that is effective in the prevention, alleviation, or treatment of hair follicle keratosis diseases derived from a novel natural material based on the mechanism of the occurrence of hair follicle keratosis abnormalities.
  • the present invention provides a pharmaceutical composition for the prevention or treatment of hair follicular keratosis abnormalities comprising a catechin or a derivative thereof.
  • the present invention may include various catechins and / or derivatives thereof as long as the effects of the present application are achieved, and for example, the catechins or derivatives thereof may be EGCG (epigallocatechin gallate), GCG (gallocatechin gallate), EGC (epigallocatechin), or ECG (epicathechin). 3-gallate), GC (gallocatechin), CG (cathechin 3-gallate), EC (epicatechin), C (catechin), Kaempferol, Formononetin, Quercetin, or Ellagic acid includes, but is not limited to. In one embodiment in particular EGCG (epigallocatechin gallate) can be used.
  • catechins or derivatives thereof according to the present invention may be included in an amount suitable for exerting the effect according to the present application, and those skilled in the art may suitably select the amount included according to the specific purpose of the treatment and the characteristics of the specific component selected, for example, catechin Or a derivative thereof may be included in an amount of about 0.1% to 30% (w / v), but is not excluded.
  • said follicular keratosis abnormality is accompanied by inflammation, said inflammation being for example Propionibacterium acnes, Staphylococcus aureus , or Staphylo Caused by, but not limited to, Staphylococcus epidermidis .
  • compositions comprising catechins or derivatives thereof according to the present invention have an effect by affecting mechanisms associated with hair follicular keratosis abnormalities, but are not limited to the present mechanism, regulation of AMPK-SREBP-1 cell signal transduction, IGF-1 / PI3K / Inhibition of Akt cell signaling, inhibition of NF-kB and AP-1 cell signaling, reducing IL-1 ⁇ in keratinocytes.
  • the follicular keratosis disorder may include, but is not limited to, injection, pore keratosis, facial cervical follicular erythema, or inflammatory or non-inflammatory acne.
  • the disease may be interpreted as being caused by hair follicular keratosis abnormalities.
  • the present invention also relates to a pharmaceutical composition for the prevention or treatment of cystosis abnormality further comprising a catechin or a derivative thereof and a skin dermabrasion agent.
  • the peeling agent included in the composition according to the present application is representative and may include one or more of AHA (Alpha-Hydroxy Acid) or BHA (Beta-Hydroxy Acid), examples of which include glycolic acid and examples of salicylic acid It is possible, but not limited to.
  • compositions comprising the above components in combination according to the present application has a synergistic effect compared to the use alone, and may be included to exhibit such an effect, for example, the catechin or its derivative is about 0.1% to 30% ( w / v), and the peeling agent is included in about 1 to 70% (w / v).
  • a cosmetic composition for alleviation and / or amelioration of hair follicle anomaly comprising a catechin or a derivative thereof or a skin dermabrasion in combination with such a composition, for example, a face wash, soap, shampoo, lotion, lotion, cream. Or for packs.
  • the catechin or derivative thereof included in the cosmetic composition is included in 0.1% to 30% (w / v), and the peeling agent is included in about 1 to 10% (w / v).
  • a dietary supplement, functional food, or food additive for alleviating and / or ameliorating hair follicular keratosis abnormalities comprising a catechin or a derivative thereof.
  • the present invention relates to a method for preparing a pharmaceutical composition for preventing or treating follicular keratosis abnormalities comprising a catechin derivative, wherein the catechin or a derivative thereof is dissolved by dissolving catechin or a derivative thereof in alcohol and then using water. It provides a manufacturing method, characterized in that for preparing a solution containing 0.1% to 30% (w / v).
  • the peeling agent may be included in an amount of about 1 to 70% (w / v), and the amount may vary depending on the specific purpose.
  • the catechin derivative is EGCG (epigallocatechin gallate), GCG (gallocatechin gallate), EGC (epigallocatechin), ECG (epicathechin 3-gallate), GC (gallocatechin), CG (cathechin 3-gallate), EC (epicatechin) , C (catechin), Kaempferol, Formononetin, Foreronetin (Quercetin), or at least one selected from Ellagic acid (Ellagic acid), in particular the catechin or derivatives thereof is EGCG (epigallocatechin gallate).
  • a pharmaceutical composition for preventing or treating follicular keratosis abnormalities comprising catechins or derivatives thereof according to the present invention, which effectively prevents follicular keratinization abnormalities without causing skin irritation without causing resistance to antibiotics, thereby causing follicular keratosis such as acne. It can be effectively used for skin diseases due to the above, and when included in a combination of skin dermabrasion, brings a synergistic effect.
  • FIG. 1 shows that EGCG inhibits the expression of sterol regulatory site binding protein (SREBP) -1 protein via AMP-activated protein kinase (AMPK) pathway to inhibit lipid formation in SEB-1 sebaceous gland cells.
  • 1a is the result of total lipid analysis of SEB-1 sebaceous gland cells in the presence of 14 C acetate 24 hours after EGCG treatment;
  • Figure 1b shows the change of lipid components in thin layer chromatography (C: cholesterol, FOH: fatty alcohol, OA: oleic acid, TAG: triglyceride, WE: wax ester, CO: cholesterol oleate, SQ: squalene), Unit : mean ⁇ SE cpm / 10 3 cells / hour;
  • FIG. 1C is a western blot result of detecting precursor or mature of SREBP according to EGCG concentration
  • FIG. 1D shows the results of real-time quantitative PCR analysis of SREBP-1a, SREBP-1c, SREBP-2, fatty acid synthase (FAS), and acetyl-CoA carboxylase (ACC) RNA after 24 hours of EGCG treatment.
  • FAS fatty acid synthase
  • ACC acetyl-CoA carboxylase
  • FIG. 2A shows that EGCG inhibits the expression of sterol regulatory site binding protein (SREBP) -1 protein via AMP-activated protein kinase (AMPK) pathway, thereby inhibiting lipid formation in SEB-1 sebaceous gland cells.
  • SREBP sterol regulatory site binding protein
  • AMPK AMP-activated protein kinase
  • 2C shows SEB-1 cells treated with 20 ⁇ M Compound C for 30 minutes and / or with EGCG for 24 hours. After treatment, it is stained with Nile Red. (scale bar 10 ⁇ m) All experiments were repeated at least five times and the results are expressed as mean ⁇ SEM.
  • FIG. 3 shows that EGCG inhibits NF-kB and activating protein 1 (AP-1) pathways to reduce inflammation caused in SEB-1 cells due to heat inactivated P. acnes .
  • Treatment of acnes stimulated SEB-1 cells with EGCG for 24 hours followed by quantitative RT-PCR data of cytokines (IL-1 ⁇ , IL-1 ⁇ , tumor necrosis factor (TNF) - ⁇ and IL-8) Result;
  • FIG. 3B shows ELISA results of proteins of TNF- ⁇ and IL-8 extracted from the culture medium of cells treated as (a);
  • FIG. 3C shows phospho-c-Jun, phospho IkB ⁇ , matrix metalloproteinase (MMP) for proteins extracted from SEB-1 cells stimulated with P.
  • MMP matrix metalloproteinase
  • FIG. 3D shows Western blot results of NF-kB p65 for nuclear and cytoplasmic fractions after heat-inactivated P. acnes stimulated SEB-1 cells with EGCG for 30 minutes and 24 hours;
  • FIG. 3E is Western blot results of phospho-IkB ⁇ , NF-kB p65, and IL-1 ⁇ before and after 24 hours treatment with EGCG in heat-inactivated P.
  • Figure 3f is a quantitative RT-PCR results for IL-1 ⁇ using RNA isolated from cells treated in the same manner as (e). All experiments (ae) were repeated at least five times, data (a, b, f) were mean ⁇ SEM and statistically analyzed using Student's t-test: * P ⁇ 0.05 (control and each P. acnes treatment group); ⁇ P ⁇ 0.05 (P. acnes treated and EGCG-untreated or each EGCG treated group).
  • Figure 4 shows the killing effect of EGCG on SEB-1 cells and the growth inhibitory effect on P. acnes
  • Figure 4a shows each cell at 24 hours or 48 hours of EGCG treatment in SEB-1 sebaceous gland cells and HaCaT keratin cells Survival was measured by MTT assay; 4B is microscopic observation showing DAPI staining (scale bar, 10 ⁇ m; X400); 4C shows results (bar.
  • FIG. 5 is a result showing the effect of 5% EGCG on acne lesions performed for 8 weeks in the clinic
  • FIG. 5A is a photograph showing the result after 8 weeks of applying EGCG to the skin of a patient according to one embodiment of the present application
  • FIG. 5B is a result showing a modified lead grade
  • FIG. 5C is a non-inflammatory site (comedones)
  • FIG. 5D is a result showing a change in inflammatory sites (papules, pustules, and nodules)
  • 5E shows the results of a visual analog scale (VAS) measurement for subjective evaluation.
  • VAS visual analog scale
  • FIG. 6 shows the results of staining with antibodies of IL-8, phospho-c-JUN, SREBP-1, and NF-kB p65 as a result of histological changes after 8 weeks of EGCG treatment in the clinic, and TUNEL analysis.
  • Scale Bar 100 ⁇ m, all experiments were repeated at least 5 times and the result was mean ⁇ SEM, was performed by Wilcoxon signed rank test, and * P ⁇ 0.05 was determined to be statistically significant compared to the default value.
  • FIG. 8 is a photograph before and after applying 1% EGCG to the affected area of the arm where follicular keratinization occurred twice daily.
  • the present application is based on the discovery that catechins and derivatives thereof can control hair follicular keratosis abnormalities in the skin.
  • the present invention relates to a pharmaceutical composition for preventing or treating hair follicle keratosis abnormalities comprising catechin and derivatives thereof.
  • the term "catechin” is a type of polyphenolic compound and is a type of flavonoid.
  • “Flavonoid” refers to a non-nitrogen pigment contained in a plant having a C6-C3-C6 type carbon skeletal structure in which two phenyl groups are bonded through a C3 chain, and flavonoids according to the basic skeleton of the flavonoids depending on the structure and position of the substituents. It is divided into five types: flavonoids, flavones, anthocyanins, isoflavonoids, and neoflavonoids. The types of flavonoids to which the catechins of the present disclosure belong are listed below, but are not limited thereto:
  • Flavonoids flavone-3-ols (Flavan-3-ols), GCG (gallocatechin gallate), GC (gallocatechin), CG (cathechin 3-gallate), C (catechin), EGCG (epigallocatechin gallate), EGC (epigallocatechin), Leucoanthocyanidin, which is epicathechin 3-gallate, EC (epicatechin), flavone-4-ols, flavone-3, 4-diols ), Flavonol; Flavones: Luteolin, Apigen, Tangerine, Quercetin, Kaempferol, Myricetin, Fisetin, Iso Isorhamnetin, Pachypodium, Rhamnazin, Hesperetin, Naringenin, Eridictyol, Homocliodictyol, Taxifolin ), Dihydroquercetin, Dihydrokaempferol; Anthocyanins: anthocyanin, cyani
  • EGCG epigallocatechin gallate
  • GCG gallocatechin gallate
  • EGC epigallocatechin
  • ECG epicathechin 3-gallate
  • GC gallocatechin
  • CG cathechin 3-gallate
  • Epicatechin, C catechin
  • Kaempferol Formononetin, Quercetin, or Ellagic acid
  • the term “sebum” refers to the secretion of sebaceous glands, especially including triglycerides, free fatty acids, wax esters, squalene, cholesterol and cholesteryl esters.
  • cell death induces spontaneous killing of cells in a form in which cells are controlled and killed by genes.
  • hair follicle keratinization is one of the proteins that protects the skin, keratin (keratin) is excessively produced in the hair follicles, clogging the hair follicles, making bumps and preventing the release of sebum and scalp inflammation This means that too much keratinogenesis can occur.
  • follicular keratose abnormality or “follicular hyperkeratosis” is a red or brown area around the pores sometimes caused by a keratin stopper embedded in the hair follicles, causing aesthetic problems, which may be caused by dry skin or by atopy.
  • diseases caused by follicular keratosis abnormalities may include, but are not limited to, acne, injection, pore keratosis, or facial cervical follicular erythema.
  • acne includes any skin disease commonly referred to in the art as acne, or any skin disease invented through a mechanism similar to acne and includes inflammatory, non-inflammatory and acne lesions. Also by cause, for example, collective acne, common acne, congoblate acne, acne from cosmetic use, acne detergicans, adolescent acne, acne fulminans, acne furunculoid , Acne caused by halogen, acne acne, keloid acne, mechanical acne, drug acne, necrotic acne, lip acne, acne neonatorum, acne oil, It may include papular acne, pomade acne, premenstrual acne, acne rosacea, swelling acne, tropical acne, acne venenata, adult acne or vulgar acne. However, it is not limited thereto.
  • injection is a chronic disease with the main symptoms of papules, pustules, edema, etc., accompanied by erythema in the middle of the face such as nose and cheeks (Meyer-Hoffert U et al., J Investig Dermatol Symp Proc 2011 Dec; 15 (1): 16-23).
  • poreskeratosis is a disease in which small bumps appear along the pores of the arms, legs, and the like, and apparently show chicken skin.
  • facial hair follicle erythematous epithelium is a disease in which the pigmentation with clear borders of erythema and reddish brown, which are centered on the hair follicle, occurs mainly in the face and neck (van Pelt HP et al., Acta Derm Venereol 1999, Jan; 79 (1): 65-6)
  • Hair follicular keratosis disorders can involve inflammation, and the causes of such inflammation are, for example , Propionibacterium acnes, Staphylococcus aureus, or Staphylococcus epidermis. Dermides (Staphylococcus epidermidis) . In particular, it may be caused by Propionibacterium acnes (Propionibacterium acnes) , but is not limited thereto, the composition of the present application is effective in diseases caused by these various causative bacteria.
  • the above-mentioned diseases are all problems with normal keratinization process such as hyperkeratosis or aberrant keratinization, and the composition according to the present invention treats the keratinosis abnormality to improve or treat the disease.
  • the catechins or derivatives thereof according to the present invention are effective for improving, alleviating, preventing, or treating follicular keratosis abnormalities.
  • treatment means any action that improves or advantageously alters the symptoms of a related disease by administration of the composition.
  • prevention means any action that inhibits or delays the onset of a follicular keratosis-related disease, including acne, by administration of the composition herein. It will be apparent to those skilled in the art that the present compositions can prevent these conditions when administered prior to, or before, the appearance of follicular keratosis.
  • catechin derivatives regulate follicular keratinocytes by regulating AP (activator protein) -1 and nuclear factor kappa-light-chain-enhancer of activated B cells (NF-kB) signaling pathways and inhibiting cell death in sebaceous and keratinocytes. It relates to a pharmaceutical composition capable of preventing or treating abnormalities.
  • AP activator protein
  • NF-kB nuclear factor kappa-light-chain-enhancer of activated B cells
  • AP-1 is one of the major transcription factors regulated by protein kinase C, which is the target of TPA (12-O-tetradecanoylpobol 13-acetic acid).
  • AP-1 is the primary cancer gene Jun (c Jun is 340). Dog amino acid residues) and Fos (c-Fos consists of 380 amino acid residues).
  • NF- ⁇ B is one of the most important transcription factors involved in the inflammatory mechanism in immune cells, NF- ⁇ B is due to the stimulation of various receptors involved in immunity such as T-cell receptor, B-cell receptor, CD40, Regulates expression of growth factors.
  • Abnormal NF- ⁇ B activity caused by various causes is known as a mechanism of various autoimmune diseases such as atopy, allergy, lupus, arthritis, and is involved in various physiological control mechanisms such as brain, skin, and bone in addition to immune cells.
  • EGCG animalallocatechin gallate
  • EGCG epigallocatechin gallate
  • AP-1 and NF-kB signaling pathways
  • the pharmaceutical composition comprising the catechin derivative of the present invention can inhibit sebum production and the resulting follicular keratinosis abnormalities by regulating the AMPK-SREBP-1 signaling pathway.
  • the catechin derivative EGCG activates AMP-activated protein kinase (AMPK) in sebaceous gland cells, and activated AMPK reduces lipid production and expression of SterBP (Sterol regulatory element-binding protein).
  • AMPK is an enzyme that regulates energy homeostasis in cells, inhibits cholesterol synthesis, lipid production, triglyceride synthesis, and regulates insulin secretion.
  • SREBP is a transcription factor that binds to sterol regulatory DNA and is involved in cholesterol biosynthesis and fatty acid biosynthesis and absorption.
  • the pharmaceutical composition comprising the catechin derivative of the present invention inhibits IGF-1 / PI3K / Akt cell signal transduction AMPK dependent, IGF-1 / PI3K / Akt signaling pathway is lipid production through SREBP and thereby It can suppress hair follicular keratinosis abnormalities.
  • Insulin-like growth factor-1 (IGF-1) plays an important role in cell growth and development, and the phosphatidylinositol 3-kinase (PI3K) / Akt signaling pathway is also involved in anticancer.
  • the pharmaceutical composition comprising the catechin derivative of the present invention can inhibit the inflammatory response by inhibiting NF-kB and AP-1 signaling pathways, which are very important signaling pathways of inflammation regulation.
  • EGCG a catechin derivative
  • the inflammatory response induced by P. acnes and signaling pathways of NF-kB and AP-1 by reducing the phosphorylation of IkB in sebaceous gland cells. May lead to correction of follicular keratosis abnormalities.
  • inhibition of AMPK restored the signaling pathways of NF-kB and AP-1 that were inhibited by EGCG.
  • the pharmaceutical composition comprising the catechin derivative of the present invention inhibits the follicular keratinization abnormality of hair follicle keratinocytes by reducing IL-1 ⁇ in keratinocytes.
  • the pharmaceutical composition comprising the catechin derivative of the present invention reduces cell death and cell cycle arrest by inhibiting the NF-kB or Akt signaling pathway.
  • apoptosis and cell cycle arrest are due to the antiproliferation of the catechin derivatives, thereby inhibiting sebum secretion and follicular keratinization at the sebaceous gland site.
  • the composition of the present invention is a pharmaceutical composition for the prevention or treatment of diseases caused by follicular keratosis, including acne, injection, pore keratosis, or facial cervical follicular erythema, as well as cosmetic compositions, in particular to treat, ameliorate, alleviate or prevent acne. It can be used as a cosmetic composition for.
  • the range to which the composition can be applied is not particularly limited as long as it is a site where follicular keratosis abnormalities can occur, and preferably various routes of administration to the face, scalp or the back, for example, systemic or topical, especially topical administration, oral , Transdermal, or injection, in particular by the transdermal route.
  • a cosmetic composition for preventing, ameliorating or alleviating diseases caused by hair follicular keratinosis disorders including catechins or derivatives thereof, the content of which depends on the specific use or formulation of the desired product. But may be included in about 0.1-30% (w / v) in the total composition, and may be included in about 5-25% (w / v), about 5-20% (w / v).
  • the cosmetic composition herein may include, in addition to the catechin or derivative thereof, conventional adjuvants and carriers such as antioxidants, stabilizers, solubilizers, vitamins, pigments and flavorings.
  • the cosmetic compositions herein can also be prepared in any formulations commonly prepared in the art, including, for example, solutions, suspensions, emulsions, pastes, gels, creams, lotions, powders, soaps, surfactant-containing cleansing , Oils, powder foundations, emulsion foundations, wax foundations and sprays, and the like, but are not limited thereto. More specifically, it may be prepared in the form of a flexible lotion, nutrition lotion, nutrition cream, massage cream, essence, eye cream, hair tonic, shampoo, rinse, cleansing cream, cleansing foam, cleansing water, pack, spray or powder. .
  • the formulation of the present composition is a paste, cream or gel, animal oils, vegetable oils, waxes, paraffins, starches, trachants, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicas, talc or zinc oxide may be used as carrier components.
  • animal oils, vegetable oils, waxes, paraffins, starches, trachants, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicas, talc or zinc oxide may be used as carrier components.
  • animal oils vegetable oils, waxes, paraffins, starches, trachants, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicas, talc or zinc oxide
  • cellulose derivatives polyethylene glycols
  • silicones bentonites
  • silicas talc or zinc oxide
  • the formulation of the composition is a powder or a spray
  • lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used, especially in the case of a spray, additionally chlorofluorohydrocarbon, propane Propellant such as butane or dimethyl ether.
  • a solvent, solubilizing agent or emulsifying agent is used as the carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1 Fatty acid esters of, 3-butylglycol, glycerol aliphatic ester, polyethylene glycol or sorbitan may be used.
  • liquid diluents such as water, ethanol or propylene glycol
  • suspending agents such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol esters and polyoxyethylene sorbitan esters, microcrystals Castle cellulose, aluminum metahydroxy, bentonite, agar or tracant and the like can be used.
  • the formulation of the present composition is a surfactant-containing cleansing
  • a surfactant-containing cleansing as a carrier component, an aliphatic alcohol sulfate, an aliphatic alcohol ether sulfate, a sulfosuccinic acid monoester, isethionate, an imidazolium derivative, a methyltaurate, a sarcosinate, a fatty acid amide ether Sulfates, alkylamidobetaines, aliphatic alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives or ethoxylated glycerol fatty acid esters, etc.
  • Pharmaceutically acceptable excipients in particular dermatologically acceptable excipients.
  • composition for skin of each formulation other components than the essential ingredients described above can be selected and blended without difficulty by those skilled in the art according to other skin compositions or purposes of use.
  • composition according to the present disclosure may also include at least one adjuvant selected from thickeners, preservatives, flavorings, colorants, chemical or inorganic salt filters, humectants, thermal spring water, and the like, which are known pharmaceutical agents.
  • preservatives commonly used in cosmetics or nutraceuticals include molecules with antimicrobial activity, such as capryl derivatives (capryloylglycine and glyceryl caprylate), for example hexanediol and sodium levulinate, zinc And copper derivatives (gluconate and PCA), phytosphingosine and derivatives thereof, benzoyl peroxide, pyroxtonolamine, zinc pyrithione and selenium sulfides, econazole, ketoconazole, or topical antibiotics such as erythromycin and Clindamycin.
  • compositions herein also include sebum modifiers, antibacterial agents, antifungal agents, keratolytic agents, keratin regulators, astringents, anti-inflammatory / anti-irritants, antioxidant / free radical capture agents, wound healing agents, anti-aging agents and And / or at least one anti-acne compound selected from moisturizers.
  • the composition is prepared by dissolving catechin or a derivative thereof in an amount of an organic solvent, such as methanol, ethanol, propanol, butanol, and then using water to prepare an aqueous solution of a catechin derivative of about 0.1% to 30% (w / v). It may be, but is not limited thereto.
  • EGCG epigallocatechin gallate
  • EGCG solution is prepared by dissolving catechin or a derivative thereof in an amount of an organic solvent, such as methanol, ethanol, propanol, butanol, and then using water to prepare an aqueous solution of a catechin derivative of about 0.1% to 30% (w / v). It may be, but is not limited thereto.
  • EGCG epigallocatechin gallate
  • compositions of the present invention can be administered by various routes. All modes of administration can be envisaged, for example, may be administered by transdermal, oral, or intravenous, intramuscular or subcutaneous injection, but it is preferred to administer orally or directly to the skin, but the method of administration It is possible to modify accordingly according to the state.
  • transdermal administration is preferred, in which case a composition comprising from about 0.1% to 30% (w / v) of catechin or a derivative thereof is once daily for a period of indefinite period from day to day when acne improves in the affected area. To several times.
  • the pharmaceutical or cosmetic composition according to the present disclosure may further comprise a peeling agent.
  • Dermabrasion is a material that can injure wounds to a desired depth using certain acidic chemicals.
  • Alpha-Hydroxy Acid (AHA) or Beta-Hydroxy Acid (BHA) can be used.
  • AHAs include glycolic acid
  • BHAs include, but are not limited to, salicylic acid.
  • ECGC is mixed with a low concentration of skin dermabrasion, e.g. 1) the skin dermabrasion component removes the stratum corneum and epidermal barrier that interferes with the absorption of EGCG into the acne lesion. Increase the local concentration, 2) increase the stability of the EGCG molecule itself in a weak acidic environment, and 3) skin dermabrasion is also expected to improve acne lesions as an independent mechanism, simply because of the acne It is included in concentrations that can produce a more synergistic effect than the combined effect.
  • skin dermabrasion component removes the stratum corneum and epidermal barrier that interferes with the absorption of EGCG into the acne lesion.
  • Increase the local concentration 2) increase the stability of the EGCG molecule itself in a weak acidic environment, and 3) skin dermabrasion is also expected to improve acne lesions as an independent mechanism, simply because of the acne It is included in concentrations that can produce a more synergistic effect than the combined effect.
  • the peeling agent may be included in an amount of about 1 to 70% (w / v) and in the case of a cosmetic composition about 1 to 10% (w / v).
  • glycolic acid is included at a concentration of about 5%
  • salicylic acid at about 2%
  • EGCG may be included at a concentration of 5%, but is not limited thereto.
  • composition of the present invention can be used in various ways, such as health foods and beverages for the prevention and improvement of hair follicle anomaly.
  • Foods to which the composition of the present invention may be added include, for example, various foods, beverages, gums, teas, vitamin complexes, health supplements, and the like, and may be used in the form of powders, granules, tablets, capsules, or beverages. have.
  • composition of the present invention Since the composition of the present invention has little toxicity and side effects, it is a medicament that can be used safely even when taken for a long time for the purpose of prevention.
  • the composition of the present invention may be added to food or beverage for the purpose of preventing and improving hair follicle keratosis.
  • the amount of the composition in the food or beverage is generally added to the health food composition of the present invention to 0.01 to 15% by weight of the total food weight, the health beverage composition is 0.02 to 30 g based on 100 ml, preferably May be added in a ratio of 0.3 to 10 g, but is not limited thereto.
  • the composition of the present invention includes various nutrients, vitamins, minerals (electrolytes), flavors such as synthetic flavors and natural flavors, coloring and neutralizing agents (such as cheese and chocolate), pectic acid and salts thereof, alginic acid and its Salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated beverages, and the like.
  • the compositions of the present invention may also contain pulp for the production of natural fruit juices and fruit juice beverages and vegetable beverages. These components can be used independently or in combination.
  • the proportion of such additives is generally selected from the range of 0 to about 20 weight per 100 weight of the composition of the present invention, but is not limited thereto.
  • the present invention may be practiced using conventional techniques that are within the skill of one of ordinary skill in the art of cell biology, cell culture, molecular biology, gene transformation techniques, microbiology, DNA recombination techniques unless otherwise noted. Also, a more detailed description of the general technology can be found in Molecular Biotechnology: (Bernard et al., ASM press 1994); Molecular Cloning: A Laboratory Manual, 3rd Ed. (Sambrook et al., Harbor Laboratory Press 2001); Short Protocols in Molecular Biology, 4th Ed. (Ausubel et al. Eds., John Wiley & Sons 1999); See DNA Cloning, Volumes I and II (Glover ed., 1985).
  • SEB-1 sebocytes To determine whether EGCG can regulate lipids in human SEB-1 sebocytes, Thiboutot et al. Human skin is a steroidogenic tissue: steroidogenic enzymes and cofactors are expressed in epidermis, normal sebocytes, and an immortalized sebocyte cell line (SEB-1) .
  • SEB-1 The sebaceous gland activity model described in J Invest Dermatol 120: 905-14, 2003) Used.
  • SEB-1 was treated with different concentrations of EGCG described in Figure 1 and after 24 hours the total amount of lipids from SEB-1 sebaceous gland cells was analyzed in the presence of 14 C-acetate. Changes in the major lipid components were analyzed using thin-layer chromatography. As a result, as shown in FIG.
  • SREBPs sterol regulatory element-binding proteins
  • EGCG increased phosphorylation of AMPK Thr172 and acetyl-CoA carboxylase Ser79.
  • Gwangstein, EGCG, and capsaicin inhibit adipocyte differentiation process via activating AMP-activated protein kinase.Biochem Biophys Res Commun 338: 694-9, 2005 and Collins et al., Epigallocatechin-3-gallate ( EGCG), a green tea polyphenol, suppresses hepatic gluconeogenesis through 50-AMP-activated protein kinase.J Biol Chem 282: 30143-9, 2007), as shown in J Biol Chem 282: 30143-9, 2007). This shows that it activates.
  • Example 3 EGCG heat-inactivation P. acnes Induced inflammation reduction
  • SEB-1 cells stimulated with heat-inactivated P. acnes were treated with EGCG for 24 hours, RNA was isolated, and cytokine concentrations were measured using quantitative reverse transcription PCR.
  • heat-inactivated P. acnes induced the expression of inflammatory molecular markers, including IL-1 ⁇ , IL-1 ⁇ , tumor necrosis factor (TNF) - ⁇ and IL-8 in sebaceous gland cells
  • Treatment with EGCG for 24 hours significantly reduced mRNA levels of IL-1 ⁇ , IL-1 ⁇ , TNF- ⁇ , and IL-8. This shows the anti-inflammatory effect of EGCG.
  • IL-1 ⁇ a cytokine involved in hair follicle epithelial hyperkeratosis
  • IL-8 a cytokine involved in hair follicle epithelial hyperkeratosis
  • Treatment with EGCG also inhibited intranuclear translocation of NF-kB p65 upstream of NF-kB signaling (FIG. 3D) and increased levels of IL-1 ⁇ , NF-kB and phospho-IkB in HaCaT keratinocytes. Reduced (FIGS. 3E and F). These results show the inhibitory effect of EGCG on the main cells constituting the skin in inflammatory reactions related to acne.
  • Clinical trials were conducted to investigate the efficacy and persistence of EGCG in the treatment of facial acne. Clinical trials were conducted according to Helsinki Declaration (2000) and approved by the Institutional Review Board of Seoul National University Hospital.
  • a randomly selected 35 patients male: 17 female: 18 average age: 22.1 years
  • 17 were treated with 1% EGCG (w / v) and 18 were treated with 5% EGCG (w / v) to determine the relationship between dose and response.
  • One half of the patient's face was applied with 1 or 5% EGCG (w / v) solution twice a day and the other half with only 3% ethanol as a control.
  • Baseline visit schedules were 1, 2, 4, 6, and 8 weeks.
  • Modified Leeds scores reflecting inflammatory acne lesions such as papules, pustules, nodule, cysts and non-inflammatory acne lesions such as comedones were used to measure acne status.
  • the mean Leeds score interval corrected at baseline was 5.1 ⁇ 0.4 (mean ⁇ standard deviation, range 2-7), which is O'Brien et al., (Leeds revised acne grading system.J Dermatol Treat 9: 215-20 , 1998).
  • the modified Leeds scores decreased significantly to 1.2 ⁇ 0.4 and 1.7 ⁇ 0.6, respectively, after 8 weeks.
  • the number of inflammatory and non-inflammatory sites was significantly reduced from 53.8 ⁇ 19.8 and 10.0 ⁇ 3.1 to 15.6 ⁇ 6.2 and 1.1 ⁇ 0.5 with 1% EGCG (w / v) solution, respectively. This is a reduction of 79 and 89%, respectively, compared to the default value (FIGS. 5C and D). Similar results were obtained with 5% EGCG (w / v).
  • VAS visual analogue scale
  • EGCG treatment generally lasted well, and no serious side effects were observed. Erythema or mild irritation was observed in 4 patients treated with 5% EGCG (w / v), but sedated after several hours. Patients treated with 1% EGCG (w / v) did not see any side effects.
  • Oil red O staining was performed to measure the increase and decrease of lipid droplets accumulated in the cytoplasm of 1.
  • Each material was treated with cells cultured at concentrations of 0, 0.5, 1, 5, and 10 ⁇ M for 72 hours, and then lipid staining was performed. The effect of the substance was evaluated by showing the total area stained with oil red O per cell by increasing or decreasing the lipid droplet accumulated in the cytoplasm under a microscope. As a result, as shown in FIG.
  • the percentage of reduction (or increase) compared to the number of inflammatory-non-inflammatory acne measured at the initial visit was compared.
  • the main question is how much the EGCG and glycolic acid mixed treatment group decreased compared to the EGCG or glycolic acid individual treatment group, and how much the EGCG and salicylic acid mixed treatment group decreased compared to the EGCG or salicylic acid individual treatment group.
  • subjective satisfaction of patients in each treatment group was further analyzed.
  • non-inflammatory acne decreased by 23.4% on the face with EGCG and 15.2% on the face with glycolic acid solution. On the face with EGCG and glycolic acid mixed solution, the average decrease was 56.5%.
  • the reduction width average of the mixed solution showed a significantly higher synergistic effect than the average for the sum of the individual solution reduction widths ( P ⁇ 0.05).
  • the experimental method is as described in Example 8. The results are shown in FIG. 10, and were effective for both non-inflammatory and non-inflammatory acne, and a synergistic effect was obtained by mixing EGCG and salicylic acid.
  • non-inflammatory acne decreased by 23.4% on the face with EGCG and 25.2% on the face with salicylic acid solution.
  • the average decrease was 59.8%.
  • the reduction width average of the mixed solution showed a significantly higher synergistic effect than the average for the sum of the individual solution reduction widths ( P ⁇ 0.05).
  • non-inflammatory acne decreased by an average of 33.2% on the face with EGCG and 26.6% on the face with salicylic acid solution. On the face with EGCG and glycolic acid mixed solution, the average decrease was 68.6%. Statistically, it was confirmed that the reduction width average of the mixed solution showed a significantly higher synergistic effect than the average for the sum of the individual solution reduction widths ( P ⁇ 0.05).
  • the patient's subjective satisfaction with the face applied with the mixed solution was 9.1 points (out of 10 points), which was significantly higher than 5.2 points of the EGCG-only surface and 4.9 points of the salicylic acid-only surface. High ( P ⁇ 0.05).
  • SEB-1 immortalized cells were generated by transfection of secondary sebaceous gland cells with SV40 Large T antigen. SEB-1 cells were treated with 5% CO 2 , 5.5 mM glucose / Ham's F-12 3: 1 (Invitrogen), fetal bovine serum 2.5% (HyClone, Logan, UT) in a 37 ° C.
  • adenine 1.8 X 10 -4 M Sigma, USA
  • DMEM comprising 0.4 ⁇ gml -1 (Sigma), insulin 10 ngml -1 (Sigma), epidermal growth factor 3 ngml -1 (Austral Biologicals, USA), and cholera toxin 1.2 X 10 -10 M Incubated in (Invitrogen).
  • Human keratinocytes HaCaT were treated with 5% fetal bovine serum, 20 mM L-glutamine, 1 mM sodium pyruvate, and antibiotic / antimycotic solution (10 Uml -1 penicillin, 10 ⁇ gml -1 streptomycin, and 0.25 ⁇ gml - in a 5% CO 2 , 37 ° C incubator. Incubated in DMEM (Invitrogen) containing 1 amphoterin).
  • DMEM Invitrogen
  • EGCG was treated to SEB-1 cells at the concentrations described in each corresponding figure and after 24 hours total RNA was extracted using Trizol (Biorad, USA). Then, cDNA was synthesized using RevertAid TM First-Strand cDNA Synthesis kit (Fermentas), and real-time PCR was performed using SYBR Green / ROX q-PCR kit (Fermentas) using 1 ⁇ g of cDNA as a template.
  • SREBP-1a (Forward): GCTGCTGACCGACATCGAA, (Reverse) TCAAATAGGCCAGGGAAGTCA; ADD / SREBP-1c (F): GGAGCCATGGATTGCACTTTC, (R): ATCTTCAATGGAGTGGGTGCAG; SREBP-2 (F): AACGGTCATTCACCCAGGTC, (R): GGCTGAAGAATAGGAGTTGCC; FAS (F): CCGAGGAACTCCCCTCAT, (R): GCCAGCGTCTTCCACACT; ACC (F): CCACTTGGCTGAGCGATT, (R): CCAGGTCCTCCAGCAGAA; And GAPDH (F): CAAGGTCATCCATGACAACTTTG, (R): GTCCACCACCCTGTTGCTGTTGCTGT
  • IL-1 ⁇ (assay ID number Hs 00174092), IL-1 ⁇ (assay ID number Hs 01555410), TNF- ⁇ (assay ID number Hs 00174128), IL-8 (assay ID number Hs 99999034) and GAPDH (assay ID number Hs 00266705) used a TaqMan probe (TaqMan® Applied Biosystems, USA). PCR conditions using the TaqMan probe were denatured at 95 ° C. for 15 seconds; Annealing / extension 60 cycles, 40 cycles were carried out with a cycle of 1 minute.
  • Protein was extracted using cell lysis (Cell Signaling Technology, Beverly, MA). The amount of protein contained in the lysate was determined using BCA protein quantification (Pierce, Rockford, IL). The same amount of protein was loaded on 10% SDS-PAGE and transferred to a PVDF (Polyvinylidene difluoride) membrane to attach the primary antibody of each protein as shown below, using anti-rabbit IgG and anti-mouse IgG as the secondary antibody. Primary antibodies were detected. Blots were developed using WESTSAVE Up (LabFrontier, Seoul, South Korea) and exposed to film. Blots of the films were analyzed and quantified by a densitometric program (TINA; Raytest Isotopenmebgerate, Straubenhardt, Germany).
  • TAA Densitometric program
  • cleaved caspase-3 (Asp175) (5A1) rabbit antibody, cyclin D1 (DCS6) mouse antibody, Bax rabbit antibody, BCL-2 mouse antibody, Akt rabbit antibody, Phospho-Akt (Thr308 ) rabbit antibody, Phospho-PI3K p85 (Tyr 458) / p55 (Tyr199) rabbit antibody, Phospho-IRS-1 (Ser307) rabbit antibody, Phospho-ACC (Ser79) rabbit antibody, Phospho-AMPKa (Thr172) rabbit antibody, AMPKa rabbit antibody, Phospho-c-Jun (Ser63) rabbit antibody, Phospho-IkB (Ser32 / 36) mouse antibody (Cell Signaling Technology), b-actin mouse antibody, Lamin A, NF-kB p65 mouse antibody, SREBP-1 rabbit antibody (Santa Cruz Biotechnology, Santa Cruz, CA), Phospho-IGF 1 receptor rabbit antibody (Abcam, Cambridge, UK), MMP-2 mouse antibody, MMP-2 mouse antibody,
  • SEB-1 cells were cultured to 80% confluency in 35 mm dishes and treated with control or different concentrations of EGCG for 24 hours. In all examples cells were normalized to data. Cells were suspended in DMEM solution containing 1 ⁇ Ci 14 C-acetate and incubated at 37 ° C. for 2 hours. Extracted twice with ether ether and nonradioactive carrier lipids.
  • the sample was dissolved in a small amount of ethyl acetate and placed on a 20 cm silica gel thin layer chromatography (Merck, Darmstadt, Germany) plate, up to 19.5 cm in front of nucleic acid followed by benzene, and the last 11 cm in hexane: ethyl ether: glacial acetic acid (69.5: 30: 1.5). Lipid spots were quantified for radiation with a liquid scintillation counter. Each experiment was repeated at least five times.
  • composition for preventing or treating follicular keratosis abnormalities of the present application can be widely used in a variety of applications that require this purpose effectively without causing resistance to bacteria.

Landscapes

  • Health & Medical Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical & Material Sciences (AREA)
  • Epidemiology (AREA)
  • Dermatology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

본원은 카테킨 또는 그 유도체, 또는 카테킨 또는 그 유도체와 피부 박피제를 조합으로 포함하는 모낭각화 이상의 예방 또는 치료용 약학 조성물, 또는 상기 성분을 포함하는 모강각화 이상의 완화 또는 개선용 화장품 조성믈을 제공한다. 본원에 따른 조성물은 항생제에 대한 내성을 유발하지 않으면서도, 피부에 자극이 없이 효과적으로 모낭각화이상의 치료 또는 개선 완화에 효과적으로 사용될 수 있다.

Description

카테킨 또는 그 유도체를 포함하는 모낭각화 이상의 예방 또는 치료용 약학적 조성물
카테킨(catechins) 또는 그 유도체를 포함하는 모낭각화 이상의 예방 또는 치료제 분야에 관한 것이다.
주사, 모공각화증, 안면경부모낭성홍색흑피증 또는 여드름 등을 포함하는 모낭각화 이상 및 피지분비 이상을 초래하는 피부질환은 특히 사춘기 청소년기에 유병률이 높은 매우 흔한 질환이며 생명을 위협하는 질병은 아니지만, 안면 및 구간 영역에서 발생하고 적절한 치료를 하지 않을 경우 흉터가 생긴다. 또한 이러한 질환은 환자의 외모에 영향을 미쳐 어떠한 질병보다 정신적인 고민을 안겨주는 질환이므로 국민들의 생활수준이 높아짐에 따라서 이러한 질환으로 인한 병변 및 흉터에 대한 치료를 하려는 사람들이 점차 증가하고 있다.
모낭각화질환 중 하나인 여드름은 다양한 병인과 관련되어 있다고 알려져 있는데, 피지선에서 피지가 과다 생성되면 여드름 등의 피부 질환을 야기시키는 원인이 된다. 특히, 여드름이라 지칭되는 질병의 부류에 공통적인 병인은 모낭에 발생하는 면포(comedo)이며, 이는 모낭 단위의 손상을 수반하기도 한다. 여드름에서 발생하는 초기의 면포는 점착성 케라틴 물질로 이루어져있다. 이러한 각질의 매복(impaction)으로 박테리아가 번식하게 되어 농포, 구진, 낭종 및 소결절의 형태의 염증 증상을 유발한다.
기존 여드름 치료제는 효과의 한계와 함께 여러 가지 부작용으로 인해 환자들이 불편해하는 경우가 많았다. 먹는 여드름 치료제인 경구 이소트레티노인(isotretinoin)은 기형아 유발, 간기능 이상, 지질대사이상 등을 초래할 수 있는 문제점이 제기되었으며, 통상적인 국소 치료제는 특별히 효과적인 것이 밝혀지지 않았다. 더욱이 여드름 도포 치료제 중 레티노이드는 화끈거리고 붉어지는 자극증상을 유발하고, 항생제는 항균제 내성이 문제되어 왔다.
한편, 카테킨(catechins)은 녹차의 주요 폴리페놀 성분으로서 종양의 진행을 저해하고, 당뇨, 알러지 등과 같은 염증성 질환을 개선시키는 것으로 알려져 있다. 한국 출원번호 제 2006-0024905호에는 녹차 추출물 또는 녹차 구성 성분인 카테킨(catechins)류, 플라보놀 (flavonols)류 및 그 유도체로 이루어진 군에서 선택된 1종 이상과 백자인 추출물을 일정한 성분비로 함유하는 화장료 조성물이 개시되어 있다.
그러나 모공각화증 또는 여드름과 같은 피부 모낭각화 이상을 치료하는 치료제의 개발은 아직 요원한 상태이다. 특히 부작용이 적은 천연물 유래의 물질이 바람직하나, 천연물은 종류가 매우 다양하고 무한한 잠재력을 가지고 있어, 천연물에서 새로운 활성성분의 개발을 통한 모낭각화 치료제의 개발이 요구된다.
본원은 모낭각화 이상 발생 기전에 근거한 신규 천연물질 유래의 모낭각화 질환의 예방, 완화, 또는 치료에 효과가 있는 물질을 제공하고자 한다.
한 양태에서 본원은 카테킨 또는 그 유도체를 포함하는 모낭각화 이상의 예방 또는 치료용 약학적 조성물을 제공한다.
본원에는 본원의 효과를 달성하는 한 다양한 카테킨 및/또는 그 유도체가 포함될 수 있으며, 예를 들면 상기 카테킨 또는 그 유도체는 EGCG (epigallocatechin gallate), GCG (gallocatechin gallate), EGC (epigallocatechin), ECG(epicathechin 3-gallate), GC (gallocatechin), CG(cathechin 3-gallate), EC (epicatechin), C (catechin), 카엠페롤(Kaempferol), 포모노네틴(Formononetin), 쿠에르세틴(Quercetin), 또는 엘라직산(Ellagic acid)를 포함하나 이로 제한하는 것은 아니다. 일 구현예에서는 특히 EGCG (epigallocatechin gallate)가 사용될 수 있다.
본원에 따른 카테킨 또는 그 유도체는 본원에 따른 효과를 나타내기에 적절한 양으로 포함될 수 있으며, 당업자라면 치료의 구체적 목적 및 선택하는 특정 성분의 특징에 따라 포함되는 양을 적의 선택할 수 있으며, 예를 들면 카테킨 또는 그 유도체는 약 0.1 % 내지 30 % (w/v)로 포함될 수 있으나, 이 범위를 벗어나는 것을 제외하는 것은 아니다.
본원에 따른 일 구현예에서, 상기 모낭각화 이상은 염증을 수반하며, 상기 염증은 예를 들면 프로피오니박테리움 아크네스 (Propionibacterium acnes), 스타필로코쿠스 아우레우스(Staphylococcus aureus), 또는 스타필로코쿠스 에피데르미데스(Staphylococcus epidermidis)에 의해 발생하나, 이로 제한하는 것은 아니다.
본원에 따른 카테킨 또는 그 유도체를 포함하는 조성물 모낭각화 이상과 관련된 기전에 영향을 미쳐 효과를 나타내며, 본 기전으로 한정하는 것은 아니나, AMPK-SREBP-1 세포신호 전달의 조절, IGF-1/PI3K/Akt 세포신호 전달 저해, NF-kB 및 AP-1 세포신호 전달을 저해, 케라틴 세포에서 IL-1α를 감소시킨다.
본원에 따른 일 구현예에서 모낭각화 이상 질환은 주사, 모공각화증, 안면경부모낭성홍색흑피증 또는 염증성 또는 비염증성 여드름을 들 수 있으나, 이로 제한하는 것은 아니다. 다른 측면에서 상기 질환은 모낭각화 이상에 의해 유발되는 것으로 해석될 수 있다.
다른 양태에서 본원은 또한 카테킨 또는 그 유도체와 피부 박피제를 추가로 포함하는 낭각화 이상의 예방 또는 치료용 약학적 조성물에 관한 것이다. 본원에 따른 조성물에 포함되는 박피제는 대표적인 것으로 AHA (Alpha-Hydroxy Acid) 또는 BHA (Beta-Hydroxy Acid) 중 하나 이상을 포함할 수 있으며, 전자의 예로는 글리콜산, 후자의 예로는 살리실산을 들 수 있으나, 이로 제한하는 것은 아니다. 본원에따른 위의 성분을 조합으로 포함하는 조성물은 단독으로 사용한 것과 비교하여 상승효과를 가져오며, 이러한 효과를 나타내도록 포함될 수 있으며, 예를 들면 상기 카테킨 또는 그 유도체는 약 0.1 % 내지 30 %(w/v) 로 포함되고, 상기 박피제는 약 1 내지 70% (w/v)로 포함된다.
다른 양태에서 카테킨 또는 그 유도체 또는 이와 피부 박피제를 조합으로 포함하는 모낭각화 이상의 완화 및/또는 개선을 위한 화장 조성물을 제공하며, 이러한 조성물은 예를 들면 세안제, 비누, 샴푸, 화장수, 로션, 크림 또는 팩용으로 제공될 수 있다. 화장 조성물에 포함되는 상기 카테킨 또는 그 유도체는 0.1 % 내지 30 %(w/v) 로 포함되고, 상기 박피제는 약 1 내지 10% (w/v)로 포함된다.
또 다른 양태에서 카테킨 또는 그 유도체를 포함하는 모낭각화 이상의 완화 및/또는 개선을 위한 건강보조식품, 기능성 식품, 또는 식품첨가제를 제공한다.
또다른 양태에서 본원은 카테킨 유도체를 포함하는 모낭각화 이상의 예방 또는 치료용 약학 조성물의 제조방법에 관한 것으로, 상기 방법은 카테킨 또는 그 유도체를 알코올에 용해한 후, 물을 이용하여 카테킨 또는 그 유도체가 약 0.1 % 내지 30 % (w/v)로 포함된 용액을 제조하는 것을 특징으로 하는, 제조방법을 제공한다. 상기 방법에서 박피제를 포함하는 경우, 박피제는 약 1 내지 70% (w/v)로 포함될 수 있으며, 구체적 목적에 따라 양이 변할 수 있다.
본원의 방법에서 상기 카테킨 유도체는 EGCG (epigallocatechin gallate), GCG (gallocatechin gallate), EGC (epigallocatechin), ECG(epicathechin 3-gallate), GC (gallocatechin), CG(cathechin 3-gallate), EC (epicatechin), C (catechin), 카엠페롤(Kaempferol), 포모노네틴(Formononetin), 쿠에르세틴(Quercetin), 또는 엘라직산(Ellagic acid) 중에서 선택되는 적어도 하나 이상이며, 특히 상기 카테킨 또는 그 유도체는 EGCG (epigallocatechin gallate)이다.
본원에 따른 카테킨(catechins) 또는 그 유도체를 포함하는 모낭각화 이상의 예방 또는 치료용 약학적 조성물로 항생제에 대한 내성을 유발하지 않으면서도 피부에 자극이 없이 효과적으로 모낭각화 이상을 예방하여 여드름과 같은 모낭각화 이상으로 인한 피부 질환에 효과적으로 사용될 수 있으며, 피부박피제를 조합으로 포함하는 경우, 상승효과를 가져온다.
도 1은 EGCG가 AMP 활성화 단백질 카이나제 (AMPK) 경로를 통해 스테롤 조절부위 결합 단백질 (SREBP)-1 단백질의 발현을 억제하여 SEB-1 피지선세포에서 지질생성을 억제하는 것을 나타내는 결과로, 도 1a 는 EGCG 처리 24시간 후에 14C 아세테이트의 존재하의 SEB-1 피지선세포의 총 지질 분석 결과이고; 도 1b 는 박층 크로마토크래피에서 지질 성분들의 변화를 보여주는 결과 (C: cholesterol, FOH: fatty alcohol, OA: oleic acid, TAG: triglyceride, WE: wax ester, CO: cholesterol oleate, SQ: squalene), Unit: mean± SE c.p.m/103 세포/hour; 도 1c 는 EGCG 농도에 따른 SREBP의 전구체(precursor) 또는 성숙체(mature)를 검출한 웨스턴 블랏 결과이고; 도 1d 는 EGCG 처리 24시간 후에 SREBP-1a, SREBP-1c, SREBP-2, fatty acid synthase (FAS), 및 acetyl-CoA carboxylase(ACC) RNA를 실시간 정량 PCR로 분석한 결과이다.
도 2는 EGCG가 AMP 활성화 단백질 카이나제 (AMPK) 경로를 통해 스테롤 조절부위 결합 단백질 (SREBP)-1 단백질의 발현을 억제하여 SEB-1 피지선세포에서 지질생성을 억제하는 것을 나타내는 결과로 도 2a는 SBE-1 세포를 30분간 표시된 농도의 화합물 C로 처리하고/하거나 EGCG로 처리한 후, 각각 3시간 및 12시간 후에 phospho-/total AMPK 및 phospho-ACC의 농도를 측정한 웨스턴 블랏 결과이고, 대조군 대비 *P< 0.05, **P< 0.01 (Student's t-test, a-e)이며; 도 2b는 Nile Red 염색을 정량화 한 결과로 대조군과 비교한 상대적 비를 나타낸 것으로 표시된 농도의 EGCG 처리하여 상대적 비를 얻고 화합물 C를 처리한 군과 처리하지 않는 군을 비교하여, 처리군과 비처리군은 유의한 차이를 보였으며, (*P< 0.05, Ŧ P<0.05; Student's t-test, g) 도 2c는 SEB-1 세포를 30분간 20μM 화합물 C로 처리하고/하거나 24시간 동안 EGCG로 처리한 후, Nile Red로 염색한 결과이다. (scale bar 10μm) 모든 실험은 최소 5회 반복되었으며 결과는 mean±SEM로 나타냈다.
도 3은 EGCG가 NF-kB 및 활성화 단백질 1 (AP-1) 경로를 억제하여 열로 불활성화된 P. acnes로 인해 SEB-1 세포에 야기된 염증을 감소시키는 것을 나타내는 결과로 도 3a는 P. acnes로 자극된 SEB-1 세포를 EGCG로 24시간 동안 처리한 뒤, 사이토카인 (IL-1α, IL-1β, tumor necrosis factor (TNF)-α 및 IL-8)의 정량 RT-PCR 데이터를 보여주는 결과이고; 도 3b 는 (a)와 같이 처리된 세포의 배양액에서 추출한 TNF-α 및 IL-8의 단백질의 ELISA 결과이고; 도 3c 는 20 μM 화합물 C로 30분간 및/또는 EGCG로 처리 시에 열로 불활성화된 P. acnes로 자극된 SEB-1 세포에서 추출한 단백질에 대한 phospho-c-Jun, phospho IkBα, matrix metalloproteinase (MMP)-2, 및 MMP-9의 웨스턴 블랏을 보여주는 결과이고; 도 3d 는 열로 불활성화된 P. acnes로 자극된 SEB-1 세포를 EGCG로 30분 및 24 시간 처리한 후 핵 및 세포질 분획에 대한 NF-kB p65의 웨스턴 블랏 결과이고; 도 3e 는 열로 불활성화된 P. acnes로 자극된 HaCaT 케라티노사이트에서 EGCG로 24 시간 처리 전 및 후의 phospho-IkBα, NF-kB p65, 및 IL-1α의 웨스턴 블랏 결과이고; 도 3f는 (e)와 동일하게 처리된 세포에서 분리한 RNA를 이용한 IL-1α에 대한 정량적 RT-PCR 결과이다. 모든 실험 (a-e) 는 최소 5회 반복하였으며, 데이터 (a, b, f)는 mean ± SEM로 나타냈고, Student's t-test를 이용하여 통계분석을 하였다: *P<0.05 (대조군과 각 P. acnes 처리 군); Ŧ P<0.05 (P. acnes 처리군과 EGCG-비처리군 또는 각 EGCG 처리군).
도 4는 EGCG의 SEB-1 세포에 대한 사멸효과 및 P. acnes에 대한 성장 억제 효과를 나타내는 것으로 도 4a 는 SEB-1 피지선세포 및 HaCaT 케라틴 세포에서의 EGCG 처리 24시간 또는 48 시간 처리 시 각 세포의 생존을 MTT 분석으로 측정한 결과이고; 도 4b 는 DAPI 염색을 보여주는 현미경 관찰 결과이고 (scale bar, 10 μm; X400); 도 4c 는 세포의 핵을 메틸 그린으로 염색한 TUNEL-양성 염색 세포를 보여주는 결과 (bar. 20μm)이고; 도 4d 는 (c)를 정량화한 결과이고; 도 4e 는 EGCG 처리 12, 24 및 48 시간 후 Bcl-2, Bax, capase-3, 및 cyclin D1의 발현 정도를 나타내는 웨스턴 블랏 결과이고, Bax/Bcl-2 단백질의 비율은 밴드의 강도를 상대적으로 비교하여 계산하였고, 도 4f 는 상이한 각 EGCG의 농도에 따른 P. acnes의 성장에 미치는 효과를 보여주는 결과이고; 도 4g 는 증가하는 EGCG의 농도에 따라 생성된 P. acnes의 콜로니 수를 대조군과 비교하여 백분율로 나타낸 결과이다. 모든 실험 (a-g) 은 최소 5회 반복되었고 결과는 mean ± SEM로 나타내고, 통계분석은 Student's t-test를 이용하였으며, 대조군과 비교하여 * P<0.05; ** P<0.01로 표시하였다.
도 5는 임상에서 8 주간 수행된 여드름 병변에 대한 5% EGCG의 효과를 나타내는 결과로, 도 5a 는 본원의 한 구현예에 따른 EGCG를 환자의 피부에 적용한 8주 후의 결과를 보여주는 사진이고; 도 5b 는 수정된 리드 등급을 나타내는 결과이며 도 5c 는 비염증성 부위 (comedones)이며, 도 5d 는 염증성 부위 (papules, pustules, 및 nodules)의 변화를 보여주는 결과이고; 도 5e 는 주관적 평가를 위해 VAS (visual analogue scale) 측정 결과를 나타낸다. 통계적 유의성은 Wilcoxon signed rank test로 수행하였다: *P<0.05 (각 EGCG 처리 군 및 기저군간의 비교); Ŧ P<0.05 (각 EGCG 처리 군 및 대조군간의 비교)
도 6은 임상에서 8주간 EGCG 처리 후 조직학적 변화를 나타내는 결과로 IL-8, phospho-c-JUN, SREBP-1, 및 NF-kB p65의 항체를 이용한 염색 결과 및 TUNEL 분석결과를 나타낸다. Scale Bar: 100μm, 모든 실험은 최소 5회 반복되었고 결과는 mean ± SEM로 나타내고, Wilcoxon signed rank test로 수행하였으며, *P<0.05를 기본값과 비교하여 통계적으로 유의한 것으로 판단하였다.
도 7은 본원의 한 구현예에 따른 카엠페롤(Kaempferol), 에피갈로카테킨(EGC, Epigallocatechin), 포모노네틴(Formononetin), 쿠에르세틴(Quercetin), 카테킨(Catechin), 엘라직산 (Ellagic acid)의 오일레드 O 및 MTT 분석을 보여주는 결과이다.
도 8은 하루 2회 1% EGCG를 모낭각화가 발생한 팔의 환부에 도포하기 전 및 후의 사진이다.
도 9는 EGCG 및 글리콜산 혼합 용액을 환부에 도포하기 전 및 후의 사진이다.
도 10은 EGCG 및 살리실산 혼합 용액을 환부에 도포하기 전 및 후의 사진이다.
본원은 카테킨 및 그 유도체가 피부의 모낭각화 이상을 제어할 수 있다는 발견에 근거한 것이다.
따라서 한 양태에서 본원은 카테킨 및 그 유도체를 포함하는 모낭각화 이상의 예방 또는 치료용 약학적 조성물에 관한 것이다.
본원에서 사용된 용어 "카테킨"은 폴리페놀 화합물의 일종으로 플라보노이드의 한 종류이다. "플라보노이드"는 페닐기 2개가 C3사슬을 매개하여 결합한 C6-C3-C6형 탄소골격구조로 되어 있는 식물에 들어있는 비질소성 색소를 말하며, 치환기의 구조와 위치에 따라 플라보노이드의 기본골격에 따라 플라보노이드(flavonoids), 플라본(flavone), 안토시아닌(anthocyanin), 이소플라본(isoflavonoids), 네오플라보노이드(Neoflavonoids)의 5 종류로 나누어진다. 본원의 카테킨이 속하는 플라보노이드의 종류는 하기에 나열된 바와 같으나, 이에 한정되는 것은 아니다:
플라보노이드: 플라본-3-올 (Flavan-3-ols)인 GCG (gallocatechin gallate), GC (gallocatechin), CG(cathechin 3-gallate), C (catechin), EGCG (epigallocatechin gallate), EGC (epigallocatechin), ECG(epicathechin 3-gallate), EC (epicatechin), 플라본-4-올 (Flavan-4-ols), 플라본-3, 4-디올 (Flavan-3, 4-diols)인 루코안토시아니딘(Leucoanthocyanidin), 플라보놀; 플라본(flavone): 루테올린(Luteolin), 아피젠(apigen), 탠저리틴(Tangeritin), 쿠에르세틴(Quercetin), 캄페롤(Kaempferol), 미리세틴(Myricetin), 피세틴(Fisetin), 이소함네틴(Isorhamnetin), 파키포디움(Pachypodium), 르함나진(Rhamnazin), 헤스페레틴(Hesperetin), 나링제닌(Naringenin), 에리딕티올(Eridictyol), 호모크리오딕티올(homocriodictyol), 탁시폴린(Taxifolin), 디하이드로쿠에르세틴(Dihydroquercetin), 디하이드로캄페롤(Dihydrokaempferol); 안토시아닌: 안토시아닌(anthocyanin), 시아니딘(cyanidin), 델피니딘(delphinidin), 말비딘(Malvidin), 페라르고니딘(Pelargonidin), 페오니딘(Peonidin), 페투니딘(Petunidin); 이소플라본(isoflavonoids) : 피토에스트로겐(Phytoestrogen), 게니스테인(Genistein), 데이드자인(Daidzein), 글리드테인(Glydtein), 에쿠올(equol), 론조카르판(Lonchocarpan), 락시플로란(Laxifloran); 네오플라보노이드(Neoflavonoids): 칼로필라드(Calophyllalld), 달페르기크로멘(Dalbergichromene), 쿠타레아게닌(Coutareagenin), 달베르긴(Dalbergin), 니베틴(Nivetin).
본원에 따른 일 구현예에서는 특히 상기 플라보노이드 중 특히 EGCG (epigallocatechin gallate), GCG (gallocatechin gallate), EGC (epigallocatechin), ECG(epicathechin 3-gallate), GC (gallocatechin), CG(cathechin 3-gallate), EC (epicatechin), C (catechin), 카엠페롤(Kaempferol), 포모노네틴(Formononetin), 쿠에르세틴(Quercetin), 또는 엘라직산(Ellagic acid) 이 사용되나, 이로 제한하는 것은 아니다.
본원에서 사용된 용어 " 피지" 는 특히 트리글리세라이드, 유리 지방산, 왁스 에스테르, 스쿠알렌, 콜레스테롤 및 콜레스테릴 에스테르를 포함하는 피지선의 분비물을 의미한다.
본원에서 사용된 용어 "세포사멸"는 세포(細胞)가 유전자에 의해 제어되어 사멸하는 방식의 한 형태로 세포의 자발적인 사멸을 유도한다.
본원에서 사용된 용어 "모낭각화" 는 피부를 보호하는 단백질 중 하나인 각질(케라틴)이 과도하게 모낭에 생성되어, 털구멍을 막으면서 오돌토돌한 돌기를 만들기도 하고 피지 및 면포의 배출을 막아 염증을 유발할 수 있는 각질형성이 지나치게 많이 일어나는 것을 의미한다.
본원에서 사용된 용어 "모낭각화 이상"또는 "모낭과각화"는 모낭에 박힌 각질 마개에 의해 때때로 모공 주위가 붉거나 갈색으로 보여 미관상 문제를 일으키는 것으로 피부가 건조하거나, 아토피에 의하여도 발생할 수 있다. 본원의 한 구현예에 따르면 모낭각화 이상으로 인한 질환은 여드름, 주사, 모공각화증, 또는 안면경부모낭성홍색흑피증을 들 수 있으나, 이로 제한하는 것은 아니다.
본원에서 사용된 용어 "여드름"은 당업계에서 여드름으로 통칭되는 모든 피부질환, 또는 여드름과 유사한 기전을 통해 발명되는 모든 피부 질환을 포함하며, 염증성, 비염증성 및 여드름 병변을 포함한다. 또한 원인별로는 예컨대, 집합성 여드름, 일반적 여드름, 응괴성 여드름(congoblate acne), 화장품 사용에 의한 여드름, 세제성 여드름(acne detergicans), 청춘기 여드름, 전격성 여드름(acne fulminans), 절성 여드름(acne furunculoid), 할로겐에 의한 여드름, 경결성 여드름, 켈로이드성 여드름, 물리적 자극에 의한 여드름(mechanical acne), 약물성 여드름, 괴사성 여드름, 속립성 여드름, 신생아 여드름(acne neonatorum), 지성 여드름(acne oil), 구진성 여드름, 적창(pomade acne), 월경 전 여드름, 주사 여드름(acne rosacea), 모창성 여드름, 열대성 여드름(tropical acne), 중독성 여드름 (acne venenata), 성인 여드름 또는 심상성 여드름 등을 포함할 수 있으나, 이에 제한되는 것은 아니다.
본원에서 사용된 용어 "주사"는 코와 뺨 등 얼굴의 중간 부위에 홍반을 동반하는 구진, 농포, 부종 등을 주 증상으로 하는 만성질환이다 (Meyer-Hoffert U et al., J Investig Dermatol Symp Proc 2011 Dec; 15(1):16-23).
본원에서 사용된 용어 "모공각화증"은 팔, 다리 등에 모공을 따라 작은 돌기가 나타나고 외관상 닭살 모양의 피부를 보이는 질환이다. (Lateef A et al., Cutis 1999, Apr; 63(4):205-7).
본원에서 사용된 용어 "안면모낭성홍색흑피증"은 모낭을 중심으로 나타나는 홍반과 적갈색의 경계가 뚜렷한 색소침착이 안면부와 경부에 주로 나타나는 질환이다 (van Pelt HP et al., Acta Derm Venereol 1999, Jan; 79(1):65-6)
모낭각화 이상 질환에는 염증이 수반될 수 있으며, 이러한 염증의 원인균으로는 예를 들면 프로피오니박테리움 아크네스 (Propionibacterium acnes), 스타필로코쿠스 아우레우스(Staphylococcus aureus), 또는 스타필로코쿠스 에피데르미데스(Staphylococcus epidermidis)를 들 수 있다. 특히 프로피오니박테리움 아크네스(Propionibacterium acnes)에 의하여 발생될 수 있으나, 이에 한정되는 것은 아니며, 본원의 조성물은 이러한 다양한 원인균으로 인한 질환에 효과가 있다.
상술한 질환들은 모두 과각화나 이상각화 등 정상 각화 과정에 문제가 있는 질환으로 본원에 따른 조성물은 이러한 각화 이상을 치료하여 상기 질환을 개선 또는 치료한다.
본원에 따른 카테킨 또는 그 유도체는 모낭각화 이상 개선, 완화, 예방, 또는 치료에 효과가 있다. 본원에서 사용된 용어 "치료" , "완화" 또는 "개선" 이란 본원 조성물의 투여로 관련 질환의 증세를 호전시키거나 이롭게 변경하는 모든 행위를 의미한다. 본원이 속하는 기술분야에서 통상의 지식을 가진 자라면, 대한의학협회 등에서 제시된 자료를 참조하여 질환의 정확한 기준을 알고, 개선, 향상 및 치료된 정도를 판단할 수 있을 것이다.
본 명세서에서 사용된 용어 "예방"은 본원 조성물의 투여로 여드름을 포함하는 모낭각화 이상 관련 질환의 발병을 억제 또는 지연시키는 모든 행위를 의미한다. 본원 조성물은 모낭각화 초기 증상, 또는 나타나기 전에 투여할 경우 이러한 질환을 예방할 수 있다는 것은 당업자에게 자명할 것이다.
본 발명은 카테킨 유도체가 피지선세포 및 케라틴 세포에서 AP(activator protein)-1 및 NF-kB(nuclear factor kappa-light-chain-enhancer of activated B cells) 신호경로를 조절하고 세포사멸을 저해함으로써 모낭각화 이상을 예방 또는 치료할 수 있는 약학적 조성물에 관한 것이다.
AP-1은 TPA(12-O -테트라데카노일포볼 13-아세트산)의 표적이 되는 단백질인산화효소 C에 의해 조절되는 주요 전사인자의 하나로서, AP-1은 원암유전자 산물 Jun(c Jun은 340개 아미노산 잔기로 구성)과 Fos(c-Fos는 380개 아미노산 잔기로 구성)의 복합체이다. 또한, NF-κB는 면역 세포에서 염증 기전에 관여하는 가장 중요한 전사인자 중 하나로서, NF-κB는 T세포 수용체, B세포 수용체, CD40 등 면역에 관여하는 다양한 수용체의 자극으로 인하여 세포활성 물질과 성장 인자의 발현을 조절한다. 다양한 원인에 의한 비정상적인 NF-κB의 활성은 아토피, 알레르기, 루푸스, 관절염 등 여러 가지 자가면역 질환의 기전으로 알려져 있으며, 면역 세포 외에도 발달 및 뇌, 피부, 뼈 등 다양한 생리 조절 기전에 관여한다.
본 발명의 한 구현예에서는 카테킨 유도체 중 EGCG (epigallocatechin gallate)가 피지선세포 및 케라틴 세포에서 AP-1 및 NF-kB 신호경로를 조절하고 세포사멸를 저해함으로써 모낭각화 이상을 예방 또는 치료할 수 있다.
본 발명의 카테킨 유도체를 포함하는 약학적 조성물은 AMPK-SREBP-1 신호전달 경로를 조절함으로써 피지 생성 및 이로 인한 모낭각화 이상을 억제할 수 있다.
본 발명의 한 구현예에서 카테킨 유도체인 EGCG는 피지선 세포에서 AMP-activated protein kinase(AMPK)를 활성화시키고, 활성화된 AMPK는 지질생성 및 SREBP(Sterol regulatory element-binding protein)의 발현을 감소시킨다. AMPK는 세포내에서 에너지 항상성을 조절하는 역할을 하는 효소로서, 콜레스테롤 합성, 지질생성, 중성지방 합성을 저해하고, 인슐린 분비를 조절한다. SREBP는 스테롤 조절 DNA에 결합하는 전사인자로서 콜레스테롤 생합성 및 지방산 생합성과 흡수에 관여한다.
또한, 본 발명의 카테킨 유도체를 포함하는 약학적 조성물은 AMPK 의존적으로 IGF-1/PI3K/Akt 세포신호 전달을 저해하는데, IGF-1/PI3K/Akt 신호전달 경로는 SREBP를 통하여 지질 생성 및 이로 인한 모낭각화 이상을 억제할 수 있다. IGF-1(Insulin-like growth factor-1)은 세포성장 및 발달에 중요한 역할을 하며, PI3K(phosphatidylinositol 3-kinase)/Akt 신호전달 경로는 항암에도 관련되어 있다.
또한, 본 발명의 카테킨 유도체를 포함하는 약학적 조성물은 염증 조절의 매우 중요한 신호전달 경로인 NF-kB 및 AP-1 신호전달 경로를 저해함으로써 염증 반응을 억제할 수 있다. 특히, 본 발명의 한 구현예에서 카테킨 유도체인 EGCG는 피지선세포에서 IkB의 인산화를 감소시킴으로써 P. acnes에 의하여 유도된 염증 반응 및 NF-kB 및 AP-1의 신호전달 경로를 억제하였고, 이러한 저해는 모낭각화 이상 교정으로 연결될 수 있다. 또한, AMPK를 억제하면 EGCG에 의하여 억제되었던 NF-kB 및 AP-1의 신호전달 경로를 복구시켰다. IkB의 인산화는 NF-kB 및 AP-1 신호전달 경로의 상위에서 이루어지는 것으로서, 이러한 결과는 카테킨 유도체에 의하여 활성화된 AMPK가 NF-kB 경로, 염증 반응을 억제시키고 및 이로 인한 모낭각화 이상을 교정하는 것을 보여주는 것이다.
또한, 본 발명의 카테킨 유도체를 포함하는 약학적 조성물은 케라틴 세포에서 IL-1α를 감소시킴으로써 모낭 케라틴세포의 모낭각화 이상을 저해한다.
또한, 본 발명의 카테킨 유도체를 포함하는 약학적 조성물은 NF-kB 또는 Akt 신호전달 경로를 저해함으로써 세포의 세포사멸 및 세포주기 휴지(cell cycle arrest)를 감소시킨다. 이러한 세포사멸 및 세포주기 휴지 감소는 카테킨 유도체의 항증식 작용(antiproliferation)에 의한 것으로서 피지선 부위에서의 피지 분비 및 모낭각화를 억제할 수 있도록 한다.
본원 조성물은 여드름, 주사, 모공각화증, 또는 안면경부모낭성홍색흑피증을 포함하는 모낭각화 이상으로 인한 질환의 예방 또는 치료를 위한 약학 조성물은 물론 화장용 조성물, 특히 여드름 치료, 개선, 완화 또는 예방용 화장 조성물로 이용될 수 있다. 이때, 상기 조성물이 적용될 수 있는 범위는 모낭각화 이상이 발생할 수 있는 부위라면 특별히 제한되지 않으며, 바람직하게는 얼굴, 두피 또는 등 부위에 다양한 투여 경로, 예를 들면 전신 또는 국소, 특히 국소 투여, 경구, 경피, 또는 주사, 특히 경피 경로로 투여될 수 있다.
본원에 따른 일 구현예에서는 카테킨 또는 그 유도체를 포함하는 모낭각화 이상으로 인한 질환 예를 들면 여드름 예방, 개선 또는 완화용 화장용 조성물을 개시하며, 함량은 목적하는 제품의 구체적 용도 또는 제형 등에 따라 달라질 수 있으나, 전체 조성물 중에 약 0.1 내지 30 % (w/v)로 함유될 수 있으며, 약 5 내지 25 % (w/v), 약 5 내지 20 % (w/v)로 포함될 수 있다.
본원의 화장 조성물은 상기 카테킨 또는 그 유도체 이외에 항산화제, 안정화제, 용해화제, 비타민, 안료 및 향료와 같은 통상적인 보조제 및 담체를 포함할 수 있다.
또한 본원의 화장 조성물은 당업계에서 통상적으로 제조되는 어떠한 제형으로도 제조될 수 있으며, 예를 들어, 용액, 현탁액, 유탁액, 페이스트, 겔, 크림, 로션, 파우더, 비누, 계면활성제-함유 클렌징, 오일, 분말 파운데이션, 유탁액 파운데이션, 왁스 파운데이션 및 스프레이 등으로 제형화될 수 있으나, 이에 한정되는 것은 아니다. 보다 상세하게는, 유연 화장수, 영양 화장수, 영양 크림, 마사지 크림, 에센스, 아이크림, 헤어토닉, 샴푸, 린스, 클렌징 크림, 클렌징 폼, 클렌징 워터, 팩, 스프레이 또는 파우더의 제형으로 제조될 수 있다.
본원 조성물의 제형이 페이스트, 크림 또는 겔인 경우에는 담체 성분으로서 동물성유, 식물성유, 왁스, 파라핀, 전분, 트라칸트, 셀룰로오스 유도체, 폴리에틸렌 글리콜, 실리콘, 벤토나이트, 실리카, 탈크 또는 산화아연 등이 이용될 수 있다.
본원 조성물의 제형이 파우더 또는 스프레이인 경우에는 담체 성분으로서 락토스, 탈크, 실리카, 알루미늄 히드록시드, 칼슘 실리케이트 또는 폴리아미드 파우더가 이용될 수 있고, 특히 스프레이인 경우에는 추가적으로 클로로플루오로히드로카본, 프로판/부탄 또는 디메틸 에테르와 같은 추진체를 포함할 수 있다.
본원 조성물의 제형이 용액 또는 유탁액인 경우에는 담체 성분으로서 용매, 용해화제 또는 유탁화제가 이용되고, 예컨대 물, 에탄올, 이소프로판올, 에틸 카보네이트, 에틸 아세테이트, 벤질 알코올, 벤질 벤조에이트, 프로필렌글리콜, 1,3-부틸글리콜, 글리세롤 지방족 에스테르, 폴리에틸렌 글리콜 또는 소르비탄의 지방산 에스테르가 사용될 수 있다.
본원 조성물의 제형이 현탁액인 경우에는 담체 성분으로서 물, 에탄올 또는 프로필렌 글리콜과 같은 액상의 희석제, 에톡실화 이소스테아릴 알코올, 폴리옥시에틸렌 소르비톨 에스테르 및 폴리옥시에틸렌 소르비탄 에스테르와 같은 현탁제, 미소 결정성 셀룰로오스, 알루미늄 메타히드록시드, 벤토나이트, 아가 또는 트라칸트 등이 사용될수 있다.
본원 조성물의 제형이 계면-활성제 함유 클렌징인 경우에는 담체 성분으로서 지방족 알코올 설페이트, 지방족 알코올 에테르설페이트, 설포숙신산 모노에스테르, 이세티오네이트, 이미다졸리움 유도체, 메틸타우레이트, 사르코시네이트, 지방산 아미드 에테르 설페이트, 알킬아미도베타인, 지방족 알코올, 지방산 글리세리드, 지방산 디에탄올아미드, 식물성유, 라놀린 유도체 또는 에톡실화 글리세롤 지방산 에스테르 등이 이용될 수 있다.바람직한 투여 유형에 따르면, 본 발명의 조성물은 최소한 하나의 약학적으로 허용되는 부형제, 특히 피부학적으로 허용 가능한 부형제를 포함할 수 있다.
또한, 상기 각 제형의 피부용 조성물에 있어서, 상기한 필수 성분 이외의 다른 성분들은 기타 피부용 조성물 또는 사용목적 등에 따라 당업자가 어려움 없이 선정하여 배합할 수 있다.
본원에 따른 조성물은, 본 분야의 숙련가에게 알려진 약학적 보조제인, 증점제, 보존제, 향료, 착색제, 화학 또는 무기염류 필터, 보습제, 열 온천수 등에서 선택되는 최소한 하나의 보조제를 또한 포함할 수 있다. 예들 들면 화장품 또는 기능식품에서 통상 사용되는 보존제는, 항균 활성을 가지는 분자, 예를들면 카프릴 유도체 (카프릴로일글리신 및 글리세릴 카프릴레이트), 예를들면 헥산디올 및 소듐 레불리네이트, 아연 및 구리 유도체 (글루콘 산염 및 PCA), 피토스핑고신 및 이의 유도체, 벤조일 페록사이드, 피록톤올아민, 아연 피리치온 및 셀레늄 황화물, 에코나졸, 케토코나졸, 또는 국소용 항생제 예를 들면 에리트로마이신 및 클린다마이신을 들 수 있다.
또한 본원의 조성물은 필요한 경우 피지조절제, 항균제, 항진균제, 각질용해제, 각질조절인자, 수렴제 (astringent), 항-염증제/항-자극제, 항산화제/자유라디칼 포획제, 상처 치료제, 항-노화제 및/또는 보습제에서 선택 되는 최소한 하나의 항-여드름 화합물을 더욱 포함할 수 있다.
한 구현예에서 본원 조성물은 카테킨 또는 그 유도체를 일정량의 메탄올, 에탄올, 프로판올, 부탄올 등의 유기용매를 이용하여 용해한 후 물을 이용하여 카테킨 유도체 약 0.1 % 내지 30 % (w/v) 수용액으로 제조할 수 있으나, 이에 한정되는 것은 아니다. 한 구현예에서 카테킨 유도체 중 EGCG (epigallocatechin gallate)를 에탄올에 녹이고 증류수로 약 1 % 또는 5 %(v/v) EGCG 용액을 제조한다.
본 발명의 조성물은 다양한 경로로 투여될 수 있다. 투여의 모든 방식은 예상될 수 있는데, 예를 들면, 경피, 경구, 또는 정맥, 근육 또는 피하 주사에 의해 투여될 수 있으나, 경구 또는 피부에 직접 투여하는 것이 바람직하다, 그러나 상기 투여 방법은 환자의 상태에 따라 적절히 수정되는 것이 가능하다. 본원의 한 구현예에서는 경피 투여가 바람직하며, 이 경우, 카테킨 또는 그 유도체를 약 0.1 % 내지 30 % (w/v)로 포함하는 조성물을 환부에 하루에서 여드름이 호전될 때까지 부정기간 하루 일회 내지 여러 번 도포할 수 있다.
본원에 따른 약학 또는 화장 조성물은 박피제를 추가로 포함할 수 있다. 박피제는 특정한 산성의 화학 물질을 사용하여 원하는 깊이까지 상처를 만들 수 있는 물질로, AHA (Alpha-Hydroxy Acid) 또는 BHA (Beta-Hydroxy Acid)이 사용될 수 있다. AHA의 예로는 글리콜산을 들 수 있고, BHA의 예로는 살리실산을 들 수 있으나, 이로 제한하는 것은 아니다.
본원에 따른 일 구현예에서, ECGC는 저농도의 피부 박피제와 혼합되며, 예를 들면 1) EGCG 의 여드름 병변 으로의 흡수를 방해하는 각질층 및 표피 장벽을 피부 박피제 성분이 제거하여 EGCG 의 병변 주변 국소 농도를 상승시키고, 2) 약한 산성 환경에서 EGCG 분자 자체의 안정도를 높이며, 3) 피부 박피제 성분 역시 독립적인 기전으로 여드름 병변을 호전시킬 것으로 기대되어 단순히 각각의 두 물질에서 기대할 수 있는 여드름의 치료 효과를 합한 것보다 더욱 상승 효과가 날 수 있을 농도로 포함된다. 예를 들면 약학 조성물의 경우, 박피제는 약 1 내지 70% (w/v), 화장 조성물의 경우에는 약 1 내지 10% (w/v)의 양으로 포함될 수 있다. 본원에 따른 일 구현예에서, 글리콜산은 약 5%, 살리실산은 약 2%의 농도로 포함되고, EGCG는 5%의 농도로 포함될 수 있으나 이로 제한하는 것은 아니다.
나아가 본 발명의 조성물은 모낭각화 이상의 예방 및 개선을 위한 건강식품 및 음료 등에 다양하게 이용될 수 있다. 본 발명의 조성물을 첨가할 수 있는 식품으로는, 예를 들어, 각종 식품류, 음료, 껌, 차, 비타민 복합제, 건강보조 식품류 등이 있고, 분말, 과립, 정제, 캡슐 또는 음료인 형태로 사용할 수 있다.
본 발명의 조성물은 독성 및 부작용은 거의 없으므로 예방 목적으로 장기간 복용 시에도 안심하고 사용할 수 있는 약제이다.
한 구현예에서 본 발명의 상기 조성물은 모낭각화 이상의 예방 및 개선을 목적으로 식품 또는 음료에 첨가될 수 있다. 이 때, 식품 또는 음료 중의 상기 조성물의 양은 일반적으로 본 발명의 건강식품 조성물은 전체 식품 중량의 0.01 내지 15 중량%로 가할 수 있으며, 건강 음료 조성물은 100 ㎖를 기준으로 0.02 내지 30 g, 바람직하게는 0.3 내지 10 g의 비율로 가할 수 있으나, 이에 한정되는 것은 아니다.
상기 외에 본 발명의 조성물은 여러 가지 영양제, 비타민, 광물(전해질), 합성 풍미제 및 천연 풍미제 등의 풍미제, 착색제 및 중진제(치즈, 초콜릿 등), 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알콜, 탄산 음료에 사용되는 탄산화제 등을 함유할 수 있다. 그밖에 본 발명의 조성물들은 천연 과일 쥬스 및 과일 쥬스 음료 및 야채 음료의 제조를 위한 과육을 함유할 수 있다. 이러한 성분은 독립적으로 또는 조합하여 사용할 수 있다. 이러한 첨가제의 비율은 본 발명의 조성물 100 중량당 0 내지 약 20 중량의 범위에서 선택되는 것이 일반적이나, 이에 한정되는 것은 아니다.
이하, 본 발명을 하기의 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 의해 한정되는 것은 아니다.
본 발명은 달리 언급이 없는 한 세포생물학, 세포배양, 분자생물학, 유전자 형질전환 기술, 미생물학, DNA 재조합기술에 관한 당업자의 기술수준 내인 통상의 기술을 사용하여 실시될 수 있다. 또한 일반적인 기술에 관한 보다 자세한 설명은 Molecular Biotechnology: (Bernard et al., ASM press 1994); Molecular Cloning: A Laboratory Manual, 3rd Ed. (Sambrook et al., Harbor Laboratory Press 2001); Short Protocols in Molecular Biology, 4th Ed. (Ausubel et al. eds., John Wiley &Sons 1999); DNA Cloning, Volumes I and II (Glover ed., 1985)을 참고할 수 있다.
실시예 1: EGCG 의 지방 생성 억제 효과
EGCG가 인간 SEB-1 피지선세포(sebocyte)에서 지질을 조절할 수 있는지를 확인하기 위하여 Thiboutot et al. ,(Human skin is a steroidogenic tissue: steroidogenic enzymes and cofactors are expressed in epidermis, normal sebocytes, and an immortalized sebocyte cell line(SEB-1). J Invest Dermatol 120:905-14, 2003)에 기재된 피지선 활성 모델을 사용하였다. 요약하면, SEB-1에 도 1에 기재된 각각 다른 농도의 EGCG로 처리하고 24시간 후 14C-아세테이트의 존재 하에서 SEB-1 피지선세포로부터 지질의 총량을 분석하였다. 주요 지질 성분의 변화는 박층크로마토그래피(thin-layer chromatography)를 사용하여 분석하였다. 그 결과 도 1a에 나타낸 바와 같이 14C-아세테이트 와 결합하는 총지질의 양이 유의하게 감소하였으며, 40 μM의 EGCG로 처리한 SEB-1 피지선세포에서 세포내 지질의 수준이 55% 감소하는 것으로 나타났다. 이러한 지질의 감소는 콜레스테롤과 중성지방(triglyceride)의 감소에 따른 것이었다. (도 1 b)
EGCG의 지방생성억제 효과를 이해하기 위하여 콜레스테롤/지방산 대사의 주요 전사인자로 알려진 SREBPs (sterol regulatory element-binding proteins)가 관련되는지의 여부를 테스트 하였다. 그 결과 도 1c에 나타난 바와 같이 EGCG 처리 24시간 후 SREBPs의 전구체(precursor) 또는 성숙체(mature)는 유의하게 감소되었다. 또한 정량 실시간 PCR에서 EGCG는 SREBP의 아이소형(isoform)인 SREBP-1a, SREBP-1c 및 SREBP-2의 mRNA 수준을 모두 감소시키는 것으로 나타났다. 이는 EGCG가 전사 수준에서 SREBPs의 발현을 저해하는 것을 나타내는 것이다. 도 1d에서 나타낸 바와 같이 SREBPs의 2개의 하위 표적(downstream targets)인 지방산 생성효소(fatty acid synthase) 및 acetyl-CoA carboxylase의 발현이 감소하는 것을 확인하였다.
이러한 결과들은 모두 SREBP 신호 전달을 저해를 통하여 EGCG가 피지를 억제함을 나타내는 결과이다.
실시예 2: EGCG 처리시 지방 생성 억제에 의한 AMPK 신호전달 조절
AMPK 활성이 EGCG에 의한 SREBP-1의 감소에 필요한 것인지를 확인하기 위하여 McCullough LD. et al.에 기재된 AMPK 선택적 저해제인 화합물 C( (Pharmacological inhibition of AMP-activated protein kinase provides neuroprotection in stroke. J Biol Chem 280: 20493-502, 2005)를 사용하였다.
도 2a에서 나타낸 바와 같이 EGCG는 AMPK Thr172 및 acetyl-CoA 카르복실라제 Ser79의 인산화를 증가시켰다. 이는 Hwang et al.,(Genistein, EGCG, and capsaicin inhibit adipocyte differentiation process via activating AMP-activated protein kinase. Biochem Biophys Res Commun 338:694-9, 2005) 및 Collins et al.,(Epigallocatechin-3-gallate (EGCG), a green tea polyphenol, suppresses hepatic gluconeogenesis through 50-AMP-activated protein kinase. J Biol Chem 282:30143-9, 2007)에서 보여주었던 다른 세포에서의 결과와 같이 EGCG가 SEB-1 피지선세포에서 AMPK를 활성화시킨다는 것을 보여주는 결과이다. 20μM의 화합물 C를 30분간 전처리하고, EGCG를 처리한 후, 인산화/ 총 AMPK 및 인산화-ACC를 3시간 후 측정하였다. 성숙체 SREBP-1을 12시간 후 측정한 결과, 화합물 C는 EGCG에 의하여 유도된 AMPK 활성을 효과적으로 저해하였다. 또한, 화합물 C는 EGCG에 의하여 유도된 SREBP-1 발현을 차단하였는데, 이는 AMPK가 EGCG로 인한 SREBP-1 발현의 저해에 중요한 매개체임을 보여주는 것이다. 이러한 결과로 AMPK의 저해는 EGCG의 피지억제 효과를 차단한다는 것을 알 수 있었다.
EGCG 로 처리된 SEB-1 피지선세포의 세포내 지질 농도를 관찰하기 위하여 20μM의 화합물 C를 30분간 전처리하고, EGCG를 24시간 동안 처리한 SEB-1 세포를 나일레드 O 염색으로 관찰하였다. 그 결과 도 2 b 및 c에 나타난 바와 같이 EGCG 로 처리된 SEB-1 피지선세포의 세포내 지질 수준은 감소되었으나, SEB-1이 화합물 C로 선처리된 경우에는 EGCG는 세포내 지질 수준을 감소시키지 못하였다. 이러한 결과들은 SEB-1 피지선세포에서 AMPK-SREBP-1 경로를 통하여 지방 생성이 억제됨을 보여주는 것이다.
실시예 3: EGCG 열-불활성화 P. acnes 에 의하여 유도된 염증 감소
열-불활성화된 P. acnes로 자극된 SEB-1 세포를 24시간 동안 EGCG로 처리하고 RNA를 분리한 후, 정량 역전사 PCR을 이용하여 사이토카인 농도를 측정하였다. 도 3a에서 나타난 바와 같이, 열-불활성화 P. acnes는 피지선세포에서 IL-1α, IL-1β, TNF (tumor necrosis factor)-α 및 IL-8를 포함하는 염증 분자마커의 발현을 유도하였으나, EGCG를 24시간 처리한 경우에는 IL-1α, IL-1β, TNF-α, 및 IL-8의 mRNA 수준을 유의하게 감소시켰다. 이는 EGCG의 항염 효과를 보여주는 것이다.
또한, 도 3b, 3c에서 나타난 바와 같이, 열-불활성화된 P. acnes로 자극된 SEB-1 세포에서 TNF-α, 및 IL-8의 발현이 증가하는 것을 ELISA로 확인하였으며, 젤라티나제(gelatinases), MMP(matrix metalloproteinase)-2 및 MMP-9의 수준이 증가하는 것을 웨스턴 블랏으로 확인하였다(도 3b 및 c). 그 결과 AP-1 및 NF-kB 경로의 분자 마커인 인산화 c-Jun 및 인산화 IkB가 유의하게 증가하였고, 도 3d에 나타난 바와 같이 NF-kB p65 의 핵내 전좌(translocation) 역시 증가됨을 확인하였다. 모낭 상피 과각화증(hyperkeratosis)에 관여하는 사이토카인인 IL-1α가 열-불활성화 P. acnes로 자극된 HaCaT 케라틴 세포로부터 유도되었음을 확인할 수 있었다(도 3e 및 f) 그러나, EGCG를 24시간 처리한 실험군에서는 IL-8, TNF-α, MMP-2, MMP-9, c-Jun 및 phospho-IkB를 유의하게 감소시켰으며, 표적 단백질 발현도 동일하게 감소하는 결과를 보여주었다.
EGCG를 처리한 경우에는 NF-kB 신호전달의 상류인 NF-kB p65 의 핵내 전좌를 역시 저해하였으며(도 3d), HaCaT 케라틴 세포에서 IL-1α, NF-kB, phospho-IkB의 증가된 수준을 감소시켰다(도 3e 및 f). 이러한 결과는 여드름에 관련된 염증반응에서 EGCG의 피부를 구성하는 주세포에 대한 염증 억제 효과를 보여주는 것이다.
또한, 열-불활성화된 P. acnes로 자극된 SEB-1 피지선세포를 20μM의 화합물 C로 전처리한 경우에는 phospho-c-JUN, phospho-IkB, 및 젤라티나제(gelatinases)의 결과는 바뀌었으며, 이는 AMPK 경로가 EGCG의 항염 효과에 역할을 하고 있음을 나타내는 것이다.
이러한 결과들은 EGCG가 P. acnes에 의해 유발되는 SEB-1 피지선세포 및 HaCaT 케라틴 세포의 염증과 관련된 분자경로인 AP-1 및 NF-kB 신호경로를 조절함으로써, 염증 반응을 감소시킨다는 것을 보여주는 결과이다.
실시예 4: EGCG의 세포사멸을 통한 SEB-1 피지선세포의 세포독성 유도
SEB-1 피지선세포 생존에 EGCG의 효과를 확인하기 위하여 배양된 세포에 24 및 48시간 동안 EGCG를 처리한 후 MTT (3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) 분석을 수행하였다. SEB-1은 96웰 플레이트의 각 웰에 1×104 개 정도의 밀도로 초기에 추가하였다. 24 시간 배양 후 EGCG를 처리하고 한 웰은 처리하지 않고 대조군으로 두었다. 농도별로 EGCG를 처리하고 72 시간 후에 각각의 웰 상층액을 MTT로 처리한 다음 37℃에서 24 및 48시간 동안 배양하였다. 살아있는 세포는 미토콘드리아의 석시네이트 디하이드로게나제(succinate dehydrogenase)에 의해 MTT를 분해하여 MTT 포마존(formazon)을 형성하였다. 전환된 염료(Converted dye)를 DMSO에 녹인 다음 540 nm에서 마이크로플레이트 판독기를 이용하여 대조군과 비교하였다.
그 결과 도 4a에서 나타낸 바와 같이 EGCG로 처리된 경우 세포 성장의 유의한 감소가 확인되었다. 유사한 감소가 HaCaT 세포에서 확인되었으나, 감소 정도는 다소 적었다. 이는 EGCG에 의한 성장 저해가 SEB-1 피지선세포에서 보다 민감함을 보여준다. 48시간 배양 후 DAPI (4',6-diamidino-2-phenylindole) 염색을 실시하고 핵을 메틸 그린으로 염색한 결과, SEB-1 피지선세포의 핵이 응축되어 있었으나 EGCG 처리 후에는 세포사멸이 일어난 핵과 같이 해체됨을 보여주었다(도 4b).
EGCG가 세포사멸를 유도하는지를 확인하기 위하여 SEB-1를 EGCG로 처리하고, TUNEL 염색을 수행하였다. EGCG 처리 48시간 후 TUNEL양성 핵이 증가하였으며, 이러한 결과는 세포사멸 증가를 보여주는 결과이다(도 4c 및 d). EGCG 유도되는 세포사멸에 관여하는 분자 메커니즘을 확인하기 위하여 세포사멸 경로에 관련된 단백질 발현 수준을 조사하였다. EGCG로 처리된 SEB-1 피지선세포에서 내재적 세포사멸 경로의 중요 마커인 Bax 및 Bcl-2 사이의 비율이 통계적으로 유의하게 증가함을 확인하였다. 또한 EGCG는 활성 caspase-3를 증가시켰다. G1-/S-phase 진행의 중요 조절자인 cyclin D1 역시 유의하게 감소하였으며, 이는 EGCG가 세포주기 진행을 중단시킨다는 것을 보여준다(도 4e).
이러한 결과들은 EGCG가 세포사멸을 증가시킴으로써 SEB-1 피지선세포의 생존을 저해하고 세포주기의 진행을 멈추게 하며, 여드름 부위에서 피지선세포의 과증식을 저해한다는 것을 보여준다.
실시예 5: EGCG의 P. acnes 성장 저해
EGCG가 P. acnes에 대하여 항박테리아 효과를 조사하기 위해 다음의 실험을 수행하였다. 다른 농도의 EGCG에서 배양한 P. acnes의 콜로니 형성 단위를 측정하였다. 그 결과 도 4의 g에서 나타낸 바와 같이 EGCG가 P. acnes의 성장을 저해하는 것으로 나타났으며, 이는 EGCG가 여드름 발달에서 P. acnes의 비정상적인 콜로니화를 표적으로 함을 보여준다.
실시예 6: EGCG의 여드름 개선 효과 및 지속성
얼굴의 여드름의 치료에서 EGCG의 효능 및 지속성을 알아보기 위하여 환자를 대상으로 임상시험을 실시하였다. 임상 시험은 Helsinki Declaration (2000)에 따라 실시하였으며, 서울대학교 병원(Institutional Review Board of Seoul National University Hospital)으로부터 승인되었다.
8주 동안 임의로 선택된 35명 (남:17명 여:18명 평균나이:22.1세)의 환자가 이중맹검 임상시험을 수행하였다. 이중 17명은 1 % EGCG(w/v)를 처리하였으며, 18명은 5% EGCG(w/v)를 처리하여 용량과 반응의 관련성을 측정하였다. 환자의 얼굴의 절반에는 1 또는 5 % EGCG(w/v) 용액을 하루에 2번 도포하였고, 다른 반쪽은 대조군으로 3% 에탄올만을 도포하였다. 기본 방문 스케줄은 1, 2, 4, 6, 및 8주로 하였다. 구진(papule), 농포(pustule), 결절(nodule), 낭종(cyst)과 같은 염증성 여드름 병변 및 면포(comedone)와 같은 비염증성 여드름 병변이 반영된 수정된 리즈점수가 여드름의 상태 측정에 사용되었다. 기본 값에서의 수정된 리즈 점수 구간 평균은 5.1±0.4(평균±표준편차, 범위 2-7)이었으며, 이는 O'Brien et al., (Leeds revised acne grading system. J Dermatol Treat 9:215-20, 1998)에 따른 것이다.
도 5의 b에서 나타난바와 같이 1 또는 5 % EGCG(w/v) 용액을 처리한 경우 8주 후 수정된 리즈 스코어는 각각 1.2±0.4 및 1.7±0.6로 현저히 감소하였다. 특히 염증성 및 비염증성 부위의 수는 1% EGCG(w/v) 용액을 도포한 경우에 각각 53.8±19.8 및 10.0±3.1에서 15.6±6.2 및 1.1±0.5로 현저히 감소하였다. 이는 기본값과 비교하여 각각 79 및 89 % 감소한 수치이다(도 5c 및 d). 5 % EGCG(w/v)를 처리한 경우에도 유사한 결과가 나타났다. 환자의 주관적 평가는 0에서 10의 VAS (visual analogue scale) 등급을 사용하여 분석하였고, 모든 환자의 기본 값은 10에 맞추었다. 1 및 5% EGCG(w/v) 처리 2주 후 VAS 점수가 현저하게 감소하였고, 8주 방문에서는 각각 3.5 및 4.9로 감소되었다(도 4e).
또한, 여드름과 관련된 몇 개의 단백질 발현을 인비보에서 확인하였다. 피부 시료는 여드름 부위로부터 얻었으며, 면역조직화학염색(immunohistochemistry) 결과 IL-8, SREBP-1, phospho-c-Jun, 및 NF-kB이 현저히 감소하였는데 이는 인비트로 결과와 일치하는 것이다. TUNEL-양성 핵은 EGCG 도포 후 증가하였으며, 이는 EGCG 처리가 세포사멸를 유도하여 여드름 부위에서 피지선세포의 과다증식을 억제하는 것을 보여주는 것이다. 이러한 면역조직화학염색 결과는 인비보 여드름 부위에서 EGCG 처리가 염증 반응을 감소시키고 세포사멸을 증가시킨다는 것을 설명한다.
EGCG 처리는 일반적으로 잘 지속되었으며, 심각한 부작용도 관찰되지 않았다. 5 % EGCG(w/v)로 처리한 4명의 환자에게 홍반이나 가벼운 자극이 관찰되었으나 몇 시간 후 진정되었다. 1 % EGCG(w/v)로 처리한 환자는 어떠한 부작용도 관찰되지 않았다.
실시예 7: 플라보노이드의 지방 생성 억제 효과
플라보노이드 계열인 카엠페롤(Kaempferol), 에피갈로카테킨(EGC, Epigallocatechin), 포모노네틴(Formononetin), 쿠에르세틴(Quercetin), 카테킨(Catechin), 엘라직산(Ellagic acid)의 피지선세포 SEB-1의 세포질(cytoplasm) 내에 축적되는 지질방울(lipid droplets)의 증감을 측정하기 위해 오일레드 O (oil red O) 염색을 수행하였다. 각 물질을 0, 0.5, 1, 5, 및 10 μM 의 농도별로 각각 배양된 세포에 72 시간 동안 처리한 후 지질 염색을 수행하여 결과를 얻었다. 현미경으로 세포질 내에 축적된 지질방울의 증감을 세포당 오일레드 O로 염색된 총 면적으로 나타내어 물질의 효과를 평가하였다. 그 결과 도 7에서 나타나는 것처럼 카엠페롤, 포모노네틴, 카테킨, 쿠에르세틴, 엘라직산을 처리한 결과 농도가 증가함에 따라 지질방울이 줄었고 SEB-1 세포 생존률이 감소하였음을 확인하였다. 에피갈로카테킨을 처리한 경우에는 농도가 증가함에 따라 지질방울이 줄었고 SEB-1 세포 생존률에는 변화가 없었다.
실시예 8: EGCG 및 글리콜산 혼합 조성물에 의한 상승효과
자원자 얼굴의 반쪽을 한 종류 용액의 처리군으로 삼았다. 총 처리 용액은 다섯 종류이다: (1) EGCG 5 % 용액, (2) EGCG 5 % +글리콜산 (Sigma USA) 5%, (3) 글리콜산 5%, (4) EGCG 5% + 살리실산 (Sigma) 2% + (폴리에틸렌클라이콜) 용액, (5) 살리실산 2% + (폴리에틸렌글라이콜). 각 군의 기본 용매는 이전 임상 시험과 같이 증류수와 3 % 에탄올로 하였으며, 폴리에틸렌콜라이콜은 지용성인 살리실산을 용해시키기 위해 소량 사용한 물질로서 이전 연구들에서 여드름 병변에는 특별한 영향을 끼치지 않으면서 살리실산을 균일하게 용해하는 기능을 가진다고 알려져 있다. 각 용액은 두 박피제 성분 모두가 약산 물질이므로 산성을 띄었으며, PH meter 를 이용하여 PH 5로 보정하였고 무균 처리를 추가적으로 시행하였다. 모든 용액이 균일하게 혼합되었다.
총 8 명의 환자군을 대상으로 하였으며 개인 당 얼굴의 두 면씩 총 16 처리 대상군 각각에 대해서, EGCG 5% 용액은 네 명의 환자 얼굴 반쪽, 다른 네 개의 처리군은 각각 세 명의 환자 얼굴 반쪽에다 무작위 배정하였다. 모든 환자에게 하루에 두 번 여드름 병변에 배정된 용액을 도포하도록 하였다. 도포 후 2 주 후에 내원하도록 하였고 염증성 여드름의 개수, 비염증성 여드름의 개수, 주관적인 만족도를 기록하였다. 주관적인 불편감이 있을 경우 한번으로 감량하거나 도포를 중단하라고 사전에 교육하였으나 연구 기간 동안 회수를 줄인 환자는 없었다.
초기 내원 시 측정한 염증성-비염증성 여드름의 개수에 비해 감소한 정도 (혹은 증가한 정도)를 백분율로 환산하여 비교하였다. EGCG 와 글리콜산 혼합 처리군이 EGCG 혹은 글리콜산 개별 처리군에 비해 얼마나 감소했는지, 그리고, EGCG 와 살리실산 혼합 처리군이 EGCG 혹은 살리실산 개별 처리군에 비해 얼마나 감소했는지가 주로 알아보고자 하는 사항이다. 치료 효과뿐만 아니라 각 처리군에서 환자들의 주관적 만족도 역시 추가로 비교 분석하였다.
결과는 도 9에 기재되어 있으며, 비염증성 및 비염증성 여드름에 모두 효과가 있었으며, EGCG와 글리콜산의 혼합에 의한 상승효과가 나타났다.
구체적으로 비염증성 여드름의 경우, EGCG 를 바른 얼굴 면에서 비염증성 여드름이 평균 23.4 % 가 감소하였고, 글리콜산 용액을 바른 얼굴 면에서는 평균 15.2 % 가 감소하였다. EGCG 와 글리콜산 혼합 용액을 바른 얼굴 면에서는 평균 56.5 % 가 감소하였다. 통계적으로 혼합 용액의 감소 폭 평균이 개별 용액 감소 폭의 합에 대한 평균 보다 유의하게 더 높은 상승 효과를 보이는 것을 확인하였다 (P < 0.05).
염증성 여드름의 경우에도, EGCG 를 바른 얼굴 면에서 염증성 여드름이 평균 33.2 % 가 감소하였고, 글리콜산 용액을 바른 얼굴 면에서는 평균 20.7 % 가 감소하였다. EGCG 와 글리콜산 혼합 용액을 바른 얼굴 면에서는 평균 61.4 % 가 감소하였다. 통계적으로 혼합 용액의 감소 폭 평균이 개별 용액 감소 폭의 합에 대한 평균 보다 유의하게 더 높은 상승 효과를 보이는 것을 확인하였다 (P < 0.05).
주관적 만족도를 조사한 결과, 2 주 경과 후 혼합 용액을 도포한 얼굴 면에 대한 환자의 주관적 만족도는 8.3 점 (10점 만점)으로 EGCG 단독 도포 면의 5.2점, 글리콜산 단독 도포 면의 4.3 점보다 유의하게 높음을 확인하였다 (P < 0.05).
실시예 9: EGCG 및 살리실산 혼합 조성물에 의한 상승효과
실험 방법은 실시예 8의 기재된 바와 같다. 결과는 도 10에 기재되어 있으며, 비염증성 및 비염증성 여드름에 모두 효과가 있었으며, EGCG와 살리실산의 혼합에 의한 상승효과가 나타났다.
구체적으로 비염증성 여드름의 경우 EGCG 를 바른 얼굴 면에서 비염증성 여드름이 평균 23.4 % 가 감소하였고, 살리실산 용액을 바른 얼굴 면에서는 평균 25.2 % 가 감소하였다. EGCG 와 살리실산 혼합 용액을 바른 얼굴 면에서는 평균 59.8 % 가 감소하였다. 통계적으로 혼합 용액의 감소 폭 평균이 개별 용액 감소 폭의 합에 대한 평균 보다 유의하게 더 높은 상승 효과를 보이는 것을 확인하였다 (P < 0.05).
염증성 여드름의 경우에도, EGCG 를 바른 얼굴 면에서 비염증성 여드름이 평균 33.2 % 가 감소하였고, 살리실산 용액을 바른 얼굴 면에서는 평균 26.6 % 가 감소하였다. EGCG 와 글리콜산 혼합 용액을 바른 얼굴 면에서는 평균 68.6 % 가 감소하였다. 통계적으로 혼합 용액의 감소 폭 평균이 개별 용액 감소 폭의 합에 대한 평균 보다 유의하게 더 높은 상승 효과를 보이는 것을 확인하였다 (P < 0.05).
주관적 만족도를 조사한 결과, 2 주 경과 후 혼합 용액을 도포한 얼굴 면에 대한 환자의 주관적 만족도는 9.1 점 (10점 만점)으로 EGCG 단독 도포 면의 5.2점, 살리실산 단독 도포 면의 4.9 점보다 유의하게 높음을 확인하였다 (P < 0.05).
통계처리
실험결과는 최소 5회 반복 실험하여 평균값을 나타내었다. 통계분석은 Student's t-test (SYSTAT program, SigmaPlot version 9, Systat Software)를 사용하였다. Student's t-test의 P 값이 <0.05 경우에 차이가 유의성이 있는 것으로 간주된다.
본 발명의 실시예에서 사용된 세포배양, 정량 역전사 PCR, 웨스턴 블랏 및 박층 크로마토그래피는 다음과 같은 방법으로 수행되었다.
세포배양
Thibutot et al. (J Am Acad Dermatol 57: 791-9, 2007)에 기재된 바와 같이 SEB-1 불멸세포(immortalized cell)는 SV40 라지 T 항원으로 2차 피지선세포에 형질감염(transfection)시켜 만들었다. SEB-1 세포는 5 % CO2, 37 ℃ 인큐베이터에서 5.5 mM glucose/Ham's F-12 3:1 (Invitrogen), fetal bovine serum 2.5 % (HyClone, Logan, UT), adenine 1.8 X 10-4M (Sigma, USA), hydrocortisone 0.4 μgml-1(Sigma), 인슐린 10 ngml-1(Sigma), epidermal growth factor 3 ngml-1 (Austral Biologicals, USA), 및 콜레라 톡신 1.2 X 10-10M를 포함하는 DMEM (Invitrogen)에서 배양하였다.
인간 케라틴 세포 HaCaT는 5 % CO2, 37 ℃ 인큐베이터에서 5% fetal bovine serum, 20mM L-glutamine, 1mM sodium pyruvate 및 antibiotic/antimycotic solution (10 Uml-1 penicillin, 10 μgml-1 streptomycin, 및 0.25 μgml-1 amphoterin)을 포함하는 DMEM (Invitrogen)에서 배양하였다.
정량 역전사 PCR
EGCG를 SEB-1 세포에 각 해당 도면에 기재된 농도별로 처리하고 24 시간 후 총 RNA를 Trizol (Biorad, USA)를 이용하여 추출하였다. 이어 RevertAidTMFirst-Strand cDNA Synthesis kit (Fermentas)을 사용하여 cDNA를 합성하였고, 1μg의 cDNA를 주형으로 하여 SYBR Green/ROX q-PCR kit (Fermentas)를 사용하여 실시간 PCR을 수행하였다. SREBP-1a, ADD/SREBP-1c, SREBP-2, FAS, ACC 그리고 GAPDH의 각 프라이머 서열을 다음과 같고, 방향은 5'->3' 이다: SREBP-1a (Forward): GCTGCTGACCGACATCGAA, (Reverse) : TCAAATAGGCCAGGGAAGTCA; ADD/SREBP-1c (F) : GGAGCCATGGATTGCACTTTC, (R) : ATCTTCAATGGAGTGGGTGCAG; SREBP-2(F) : AACGGTCATTCACCCAGGTC, (R) : GGCTGAAGAATAGGAGTTGCC; FAS (F) : CCGAGGAACTCCCCTCAT, (R) : GCCAGCGTCTTCCACACT; ACC (F) : CCACTTGGCTGAGCGATT, (R) : CCAGGTCCTCCAGCAGAA; 및 GAPDH (F) : CAAGGTCATCCATGACAACTTTG, (R) : GTCCACCACCCTGTTGCTGTAG. SYBR Green을 이용한 정량 PCR의 조건은 변성 95℃, 15 초; 어닐링, 30 초; 신장, 72 초의 주기로 40주기를 수행하였다.
IL-1α (assay ID number Hs 00174092), IL-1β (assay ID number Hs 01555410), TNF-α (assay ID number Hs 00174128), IL-8 (assay ID number Hs 99999034) 그리고 GAPDH (assay ID number Hs 00266705)는 TaqMan probe (TaqMan　Applied Biosystems, USA)를 이용하였다. TaqMan probe를 사용한 경우의 PCR 조건은 변성 95℃, 15 초; 어닐링/신장 60℃, 1 분간의 주기로 40주기를 수행하였다.
웨스턴 블랏 분석
단백질은 세포 용해(lysis) 버퍼(Cell Signaling Technology, Beverly, MA)를 이용하여 추출하였다. 융해물(lysate)에 포함된 단백질의 양은 BCA 단백질 정량(Pierce, Rockford, IL)을 이용하여 결정하였다. 동일한 양의 단백질은 10% SDS-PAGE에 로딩하여 PVDF(Polyvinylidene difluoride) 막에 트랜스퍼하여 하기와 같이 각 단백질의 1차 항체를 붙이고, anti-rabbit IgG 및 anti-mouse IgG를 2차 항체로 하여 1차 항체를 탐지하였다. 블랏은 WESTSAVE Up (LabFrontier, Seoul, South Korea)을 이용하여 현상하였으며, 필름에 노출시켰다. 필름의 블랏을 분석하여 밀도 프로그램(densitometric program, TINA; Raytest Isotopenmebgerate, Straubenhardt, Germany)으로 정량화하였다.
사용된 1차 항체는 다음과 같다: cleaved caspase-3 (Asp175) (5A1) rabbit antibody, cyclin D1 (DCS6) mouse antibody, Bax rabbit antibody, BCL-2 mouse antibody, Akt rabbit antibody, Phospho-Akt (Thr308) rabbit antibody, Phospho-PI3K p85(Tyr 458)/p55 (Tyr199) rabbit antibody, Phospho-IRS-1 (Ser307) rabbit antibody, Phospho-ACC (Ser79) rabbit antibody, Phospho-AMPKa (Thr172) rabbit antibody, AMPKa rabbit antibody, Phospho-c-Jun (Ser63) rabbit antibody, Phospho-IkB (Ser32/36) mouse antibody (Cell Signaling Technology), b-actin mouse antibody, Lamin A, NF-kB p65 mouse antibody, SREBP-1 rabbit antibody (Santa Cruz Biotechnology, Santa Cruz, CA), Phospho-IGF 1 receptor rabbit antibody (Abcam, Cambridge, UK), MMP-2 mouse antibody, MMP-9 mouse antibody, and IL-1α mouse antibody (R&D Systems, Minneapolis, MN)
박층 크로마토그래피
SEB-1 세포는 35 mm 접시에서 80 % 컨플루언시가 되도록 배양하였고 컨트롤 또는 각각 다른 농도의 EGCG를 24시간 동안 처리하였다. 모든 실시예에서 세포는 데이터로 정규화하였다. 세포를 1μCi 14C-acetate를 포함하는 DMEM 용액에서 현탁시키고 37 ℃에서 2시간 동안 배양하였다. 에텔 에테르 및 비방사성 담체 지질로 2번 추출하였다. 시료는 소량의 에틸 아세테이트에 용해시켜 20cm 실리카겔 박층 크로마토그래피(Merck, Darmstadt, Germany) 플레이트에 찍고, 19.5cm까지의 앞부분은 핵산으로 이어서 벤젠으로, 그리고 마지막 11cm는 헥산:에틸에테르:빙초산(69.5:30:1.5)으로 전개시켰다. 지질 스팟은 방사선을 액체 신틸레이션 카운터로 정량화하였다. 각 실험은 최소 5번 반복하였다.
이상의 실험 결과에서 알 수 있는 바와 같이, 본원의 모낭각화 이상을 예방 또는 치료하기 위한 조성물은 박테리아에 대한 내성을 유발하지 않으면서도 효과적으로 이러한 목적을 필요로 하는 다양한 응용분야에 폭 넓게 사용될 수 있다.
상기와 같이 본원의 실시예에 대하여 상세하게 설명하였지만 본 발명의 권리범위는 이에 한정되는 것은 아니고, 다음의 청구범위에서 정의하고 있는 본원의 기본 개념을 이용한 당업자에 의한 다양한 변형 또는 개량된 것 또한 본원의 권리범위에 속하는 것이다.

Claims (18)

  1. 카테킨 또는 그 유도체를 포함하는 모낭각화 이상의 예방 또는 치료용 약학적 조성물.
  2. 제 1 항에 있어서,
    상기 카테킨 또는 그 유도체는 EGCG (epigallocatechin gallate), GCG (gallocatechin gallate), EGC (epigallocatechin), ECG(epicathechin 3-gallate), GC (gallocatechin), CG(cathechin 3-gallate), EC (epicatechin), C (catechin), 카엠페롤(Kaempferol), 포모노네틴(Formononetin), 쿠에르세틴(Quercetin), 또는 엘라직산(Ellagic acid) 중에서 선택되는 하나 이상인 것인, 모낭각화 이상의 예방 또는 치료용 약학적 조성물.
  3. 제 1 항에 있어서,
    상기 카테킨 또는 그 유도체는 EGCG (epigallocatechin gallate) 인, 모낭각화 이상의 예방 또는 치료용 약학적 조성물.
  4. 제 1 항에 있어서,
    상기 조성물은 피부 박피제를 추가로 포함하는 것인, 모낭각화 이상의 예방 또는 치료용 약학적 조성물.
  5. 제 4 항에 있어서,
    상기 피부 박피제는 AHA (Alpha-Hydroxy Acid) 또는 BHA (Beta-Hydroxy Acid) 중 하나 이상인 모낭각화 이상의 예방 또는 치료용 약학적 조성물.
  6. 제 1 항 또는 제 4 항에 있어서,
    상기 카테킨 또는 그 유도체는 0.1 % 내지 30 %(w/v) 로 포함되고, 상기 박피제는 1 내지 70% (w/v)로 포함되는, 모낭각화 이상의 예방 또는 치료용 약학적 조성물.
  7. 제 1 항 내지 제 3 항 중 어느 한 항에 있어서,
    상기 카테킨 또는 그 유도체는 AMPK-SREBP-1 세포신호 전달을 조절하는 것인 모낭각화 이상의 예방 또는 치료용 약학적 조성물.
  8. 제 1 항 내지 제 3 항 중 어느 한 항에 있어서,
    상기 카테킨 또는 그 유도체는 IGF-1/PI3K/Akt 세포신호 전달을 저해하는 것인 모낭각화 이상의 예방 또는 치료용 약학적 조성물.
  9. 제 1 항 내지 제 3 항 중 어느 한 항에 있어서,
    상기 카테킨 또는 그 유도체는 NF-kB 및 AP-1 세포신호 전달을 저해하는 것인 모낭각화 이상의 예방 또는 치료용 약학적 조성물.
  10. 제 1 항 내지 제 3 항 중 어느 한 항에 있어서,
    상기 카테킨 또는 그 유도체는 케라틴 세포에서 IL-1α를 감소시키는 것인 모낭각화 이상의 예방 또는 치료용 약학적 조성물.
  11. 제 1 항 또는 제 4 항에 있어서,
    상기 모낭각화 이상은 주사, 모공각화증, 안면경부모낭성홍색흑피증 또는 염증성 또는 비영즘성 여드름을 유발하는 것인, 모낭각화 이상의 예방 또는 치료용 약학적 조성물.
  12. 제 11 항에 있어서,
    상기 염증은 프로피오니박테리움 아크네스 (Propionibacterium acnes), 스타필로코쿠스 아우레우스(Staphylococcus aureus), 또는 스타필로코쿠스 에피데르미데스(Staphylococcus epidermidis)에 의한 것인, 모낭각화 이상의 예방 또는 치료용 약학적 조성물.
  13. 카테킨 또는 그 유도체를 포함하는 모낭각화 이상의 개선 또는 완화용 화장품 조성물.
  14. 제 13 항에 있어서,
    상기 카테킨 또는 그 유도체는 EGCG (epigallocatechin gallate), GCG (gallocatechin gallate), EGC (epigallocatechin), ECG(epicathechin 3-gallate), GC (gallocatechin), CG(cathechin 3-gallate), EC (epicatechin), C (catechin), 카엠페롤(Kaempferol), 포모노네틴(Formononetin), 쿠에르세틴(Quercetin), 또는 엘라직산(Ellagic acid) 중에서 선택되는 하나 이상인 것인, 모낭각화 이상의 예방 또는 치료용 약학적 조성물.
  15. 제 14 항에 있어서,
    상기 조성물은 피부 박피제를 추가로 포함하는 것인, 모낭각화 이상의 개선 또는 완화용 화장 조성물.
  16. 제 15 항에 있어서,
    상기 피부 박피제는 AHA (Alpha-Hydroxy Acid) 또는 BHA (Beta-Hydroxy Acid) 중 하나 이상인 모낭각화 이상의 개선 또는 완화용 화장 조성물.
  17. 제 13 항 또는 제 14 항에 있어서,
    상기 조성물은 상기 모낭각화 이상의 개선 또는 완화를 위한, 세안제, 비누, 샴푸, 화장수, 로션, 크림 또는 팩으로 제공되는 것인 모낭각화 이상의 개선 또는 완화용 화장 조성물.
  18. 제 13 항 또는 제 15 항에 있어서,
    상기 카테킨 또는 그 유도체는 0.1 % 내지 30 %(w/v) 로 포함되고, 상기 박피제는 1 내지 10% (w/v)로 포함되는, 모낭각화 이상의 개선 또는 완화용 화장 조성물.
PCT/KR2013/008856 2013-01-14 2013-10-04 카테킨 또는 그 유도체를 포함하는 모낭각화 이상의 예방 또는 치료용 약학적 조성물 Ceased WO2014109456A1 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20130003750 2013-01-14
KR10-2013-0003750 2013-01-14
KR1020130117831A KR20140092205A (ko) 2013-01-14 2013-10-02 카테킨 또는 그 유도체를 포함하는 모낭각화 이상의 예방 또는 치료용 약학적 조성물
KR10-2013-0117831 2013-10-02

Publications (1)

Publication Number Publication Date
WO2014109456A1 true WO2014109456A1 (ko) 2014-07-17

Family

ID=51167082

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2013/008856 Ceased WO2014109456A1 (ko) 2013-01-14 2013-10-04 카테킨 또는 그 유도체를 포함하는 모낭각화 이상의 예방 또는 치료용 약학적 조성물

Country Status (1)

Country Link
WO (1) WO2014109456A1 (ko)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20070094340A (ko) * 2006-03-17 2007-09-20 (주)아모레퍼시픽 피지분비 억제용 조성물
KR20090064369A (ko) * 2006-08-04 2009-06-18 존슨 앤드 존슨 컨수머 캄파니즈, 인코포레이티드 칼콘을 함유하는 조성물 및 이의 용도

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20070094340A (ko) * 2006-03-17 2007-09-20 (주)아모레퍼시픽 피지분비 억제용 조성물
KR20090064369A (ko) * 2006-08-04 2009-06-18 존슨 앤드 존슨 컨수머 캄파니즈, 인코포레이티드 칼콘을 함유하는 조성물 및 이의 용도

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
YOON, J.Y ET AL.: "Epigallocatechin-3-Gallate Improves Acne in Humans by Modulating Intracellular Molecular Targets and Inhibiting P. acnes", JOURNAL OF INVESTIGATIVE DERMATOLOGY, vol. 133, October 2012 (2012-10-01), pages 429 - 440 *

Similar Documents

Publication Publication Date Title
US8313782B2 (en) Acne vulgaris treatment regimen
AU778261B2 (en) Extracts of feverfew (tanacetum parthenium) against inflammatory disorders
CA2332808C (en) Compositions of ascorbic acid derivatives for treatment of skin diseases
US9775789B2 (en) Topical liposome compositions containing phenolic anti-inflammatory agents and their methods of preparation
US20080260875A1 (en) Novel skin care compositions and methods
CN115209887A (zh) Ppar激动剂复合物及其使用方法
US20070042026A1 (en) Prophylactic and therapeutic treatment of topical and transdermal drug-induced skin reactions
US20060293257A1 (en) Methods for the treatment of scar tissue
JP2000186036A (ja) ケミカルピーリング剤組成物
WO2013146913A1 (ja) Ｈｄｃ活性化阻害剤、ｈｄｃ活性化阻害剤組成物、鎮痒剤及び鎮痒剤組成物
KR101863297B1 (ko) 클로로겐산 및 루틴 화합물을 유효성분으로 포함하는 피부 주름 예방 또는 개선용 조성물
KR20070073639A (ko) 박하 추출물의 화장 용도
KR20140092205A (ko) 카테킨 또는 그 유도체를 포함하는 모낭각화 이상의 예방 또는 치료용 약학적 조성물
EP2306999B1 (en) Compositions for treating rosacea comprising chitosan and a dicarboxylic acid amide
CA3203878A1 (en) Botanicals as wnt/.beta.-catenin activators, molecular pathway regulato rs and health biomarker regulators
JP6255154B2 (ja) 皮膚外用剤
WO2014109456A1 (ko) 카테킨 또는 그 유도체를 포함하는 모낭각화 이상의 예방 또는 치료용 약학적 조성물
US10786441B2 (en) Skin barrier repair and maintenance composition
KR20080063005A (ko) 피세아타놀 및 비타민 ａ류 (레티노이드)를 함유하는화장품 조성물
KR101834790B1 (ko) 클로로겐산, 미르센, 또는 이들의 혼합물을 유효성분으로 함유하는 피부상태 개선용 조성물
JP2014144929A (ja) ビタミン類を含有するニキビの予防又は治療用組成物
KR20260012255A (ko) 피부 투과 촉진제 및 피부 투과 촉진 방법
RU2481845C2 (ru) Стабилизированная композиция местного применения, обладающая противоугревым и антибиотическим действием
CN115484924A (zh) 透明质酸产生促进剂及胶原产生促进剂
Waranucha et al. Growth Suppression of Hamster Flank Glands by Topical Application of an Extract from" Kwao Keur"(Pueraria mirifica)

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13871210

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13871210

Country of ref document: EP

Kind code of ref document: A1