WO2014078868A1 - Méthodes de traitement de lésions issues de kératinocytes - Google Patents

Méthodes de traitement de lésions issues de kératinocytes Download PDF

Info

Publication number
WO2014078868A1
WO2014078868A1 PCT/US2013/070833 US2013070833W WO2014078868A1 WO 2014078868 A1 WO2014078868 A1 WO 2014078868A1 US 2013070833 W US2013070833 W US 2013070833W WO 2014078868 A1 WO2014078868 A1 WO 2014078868A1
Authority
WO
WIPO (PCT)
Prior art keywords
camphor
scc
trpv3
risk
skin
Prior art date
Application number
PCT/US2013/070833
Other languages
English (en)
Inventor
Ellen LUMPKIN
David Owens
Aislyn NELSON
Original Assignee
The Trustees Of Columbia University In The City Of New York
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Trustees Of Columbia University In The City Of New York filed Critical The Trustees Of Columbia University In The City Of New York
Priority to EP13855655.0A priority Critical patent/EP2919773A4/fr
Publication of WO2014078868A1 publication Critical patent/WO2014078868A1/fr
Priority to US14/716,865 priority patent/US20160051493A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/69—Boron compounds
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents

Definitions

  • SCC Squamous cell carcinoma
  • methods are provided for diagnosing and treating or preventing keratinocyte-derived lesions, e.g., SCC (including high-risk forms), non-melanoma skin cancers (including high-risk forms), and actinic keratinosis ("AK") by administering to the subject a therapeutically effective amount of one ore more TRPV3 agonists or derivative thereofs.
  • the TRPV3 agonist may be a monoterpene as listed in Table A herein, or the TRPV3 agonist may be camphor oil which contains other monoterpene constituents as listed in Table A herein, or the TRPV-3 agonist is 2-APB.
  • Embodiments are also directed to pharmaceutical compositions and kits comprising one or more TRPV3 agonists, preferably formulated for topical application.
  • camphor in acetone was also applied at concentrations from about 10%-30% to mice to stimulate the expression of a keratinocyte terminal differentiation marker and camphor oil at 20% treat SCC in vivo.
  • the TRPV3 agonists camphor and camphor oil can be applied in amounts ranging from 0.0608-99.5% (wt/vol or vol/vol), preferably in the range of 10-50%.
  • the amount of 2-APB was tested in concentrations of 12.5 ⁇ to 100 ⁇ in vitro and about 25 ⁇ to 50 ⁇ was found to be effective in attenuating proliferation, which corresponds to 0.000056-0.00011%.
  • the amount of 2-APB for treating or preventing SCC, (including high- risk forms) or non-melanoma cancers (including high-risk forms), or AK in vivo ranges from about 0.00005-5%.
  • the TRPV3 agonist(s) or derivatives thereof are preferably applied directly to the affected area, including the margins of the tumor. , either before the lesions surgically removed or after the lesion is surgically removed. In some cases treatment with the TRPV3 agonist(s) or derivative thereof may eliminate the need for surgical removal of a non- aggressive, non-high risk lesion.
  • TRPV3, TRPC1, TRPV1, and TRPA1 are TRP channels that are regulated for a high risk form of SCC and high risk non-melanoma respectively.
  • a method is provided to diagnose the high-risk form of SCC (or high risk non- melanoma) in a patient by determining if a biopsy of the SCC (or high risk non-melanoma), has a significantly higher or a significantly lower level of mRNA encoding one or more TRP channels (e.g., TRPV3, TRPCl, TRPV1, and TRPA1) compared to the respective mRNA levels in a control sample of normal tissue.
  • TRP channels e.g., TRPV3, TRPCl, TRPV1, and TRPA1
  • methods comprise obtaining a biopsy from a subject suspected of having or diagnosed as having SCC or non- melanoma cancers, and obtaining a control biopsy— either from a normal patient not afflicted with any cancer and not having an endogenous TRP mutation, or from a matched- sample from a non-involved, normal area from the cancer subject.
  • the levels of mRNA encoding TRPV3, TRPCl, TRPV1, and TRPA1 in the cancer biopsy and in the control biopsy are then
  • the level of mRNA encoding one or more of the following: TRPV3, TRPCl, TRPV1, and TRPA1 in the cancer biopsy is significantly changed (i.e. , is either significantly higher or significantly lower) than the corresponding level in the control biopsy, then diagnosing that the patient has a high-risk form of cancer: i.e., either high risk SCC or high risk non- melanoma.
  • high-risk SCC or high risk non-melanoma Once the diagnosis of high-risk SCC or high risk non-melanoma is made, then it is determined that the subject is in need of more aggressive treatment (e.g., Mohs surgery followed by chemotherapy and radiation).
  • Or treatment may be the direct application of a TRPV3 agonist to the squamous cell carcinoma or high-risk non-melanoma cancer before and after it is removed.
  • High-risk subjects can be immunocompromised patients (e.g. , organ transplant patients.)
  • TRPV3 agonists may be a monoterpene (e.g. , camphor, (+)-Borneol, (-)-Isopinocampheol, (-)-Fenchone, (-)-Trans-pinocarveol, Isoborneol, (+)-Camphorquinone, (- )-a-Thujone, alpha-pinene oxide, 1, 8-Cineole, (-)-alpha-Pinene, Isobornyl acetate, 6-tert-butyl- m-cresol, Carvacrol, Dihydrocarbeol, Thymol, /?-xylenol, Kreosol, Propofol, p-cymene, Carvacrol methylether, Dihydrocarveol, (-)
  • a monoterpene e.g. , camphor, (+)-Borneol, (-)-Isopinocampheo
  • TRPV3 agonists or derivatives thereof are directed to sunscreens containing one or more of these TRPV3 agonists or derivatives thereof in amounts that reduce or prevent abnormal keratinocyte proliferation.
  • Sunscreens comprising the TRPV3 agonists or derivatives thereof are
  • compositions may be formulated into liposomes for topical application or microinjection and sold commercially in kits.
  • Other embodiments may include: (i) methods for treating squamous cell carcinoma or actinic keratosis in a patient in need thereof, (ii) for slowing the progression of benign tumors to squamous cell carcinoma or actinic keratosis in a patient in need thereof, (iii) promoting regression of pre-malignant skin tumors in a patient in need thereof, (iv) attenuating malignant squamous cell carcinoma conversion in a patient in need thereof, or (v) preventing metastasis into an area around the tumor are also contemplated comprising contacting one or more skin lesions with the above-described pharmaceutical composition.
  • FIG. 1 Cytoplasmic calcium signals elicited by TRP-channel agonists are potentiated in differentiating human keratinocytes.
  • Responses to TRP-channel agonists (A-D) and gene expression levels (E) were compared in normal human epidermal keratinocytes cultured for 2-3 days in 0.06 mM Ca (Growth; green) or in (Differentiated; blue).
  • A-D Live-cell Ca ⁇ + imaging.
  • A Pseudocolor images depict fura-2 ratios of human keratinocytes at rest (left) and during acute application of saturating concentrations of two TRP channel agonists (10 mM Camphor; middle) and TRPV4 (3 ⁇ 4aPDD; right).
  • B The percent increases in fluorescence ratio are plotted for representative individual keratinocytes (colored lines). Responding cells were identified as those showing a 20% increase in fluorescence ratio during agonist application. Symbols depict time points in (A).
  • FIG. 2 TRP channel responses and expression in human keratinocytes.
  • TRPAl was only amplified in one out of three experimental replicates, demonstrating that this transcript is expressed at low levels compared with TRPV3, TRPVl and TRPCl.
  • TRPV3 expression is plotted for reference.
  • FIG.3 Constitutive activation of TRPV3 arrests human keratinocyte proliferation and promotes differentiation.
  • FIG.4 Inhibition of TPV1 does not alter camphor effects on human keratinocytes.
  • B Proliferation assays (45-min EdU pulse) after 24 hours treatment with vehicle, 2-8 mM, camphor with or without 0.5-1 ⁇ AMG 9810.
  • FIG. 5. Epidermal TRP channels are potential therapeutic targets for the treatment of human SCC.
  • B Live-cell calcium imaging of TRP-channel activation in two SCC cell lines. Fura-2 fluorescence ratios of SCC cells at rest and during camphor application (10 mM) are shown.
  • FIG. 6 TRP channel and SCC biomarker expression in SCC biopsies.
  • A TRPV1,
  • B TRPA1,
  • C TRPC1,
  • D CCDN1,
  • FIG. 8 SCC skin equivalents show reduced tumor thickness when treated with 2-APB.
  • Micrographs show organotypic human skin equivalents with (A) SCC- 73, (B) SCC-39, and (C) SCC-13 cells treated with vehicle (upper) or 50 ⁇ 2-APB (lower) for 14 days. These three SCC cell lines were derived from three independent, de-identified, human high-risk SCC tumors.
  • FIG. 9 SCC-13 skin equivalents show reduced tumor thickness when treated with 2-APB.
  • Micrographs show organotypic human skin equivalents with SCC- 13 cells treated with vehicle (A) or 50 ⁇ 2-APB (B) for 14 days.
  • FIG. 10 Two-stage chemical carcinogenesis model (DMBA-TPA).
  • FIG. 12 Example of regression of benign papillomas in a camphor oil-treated mouse compared with an acetone (vehicle) -treated control animal. At week 0 in the camphor oil-treated mouse, 10 tumors and at week 7, 1 tumor compared at week 0 in the vehicle-treated control, 13 tumors and at week 7, 11 tumors.
  • FIG. 14 Regression of early-stage SCC and papilloma in a camphor-oil treated mouse.
  • An advanced SCC (bracket), which appeared by treatment day 9, progressed to an experimental endpoint by 38 days of treatment.
  • An early-stage SCC (arrow) and a papilloma (arrowhead) on this mouse appeared to regress between treatment day 37 and 38.
  • FIG. 15 Hematoxylin and eosin (H&E) staining of paraffin sections from SCC tumors in control and camphor-oil treatment groups.
  • Advanced SCCs showed neoplastic keratinocytes surrounding muscle tissue (arrowheads), indicating an invasive lesion.
  • a regressed SCC tumor from the camphor-oil group (right) showed an intact muscle layer (brackets).
  • the middle and right panels are imagines of the advanced and regressed SCCs in Figure 14.
  • FIG. 18 Topical camphor upregulates levels of a keratinocytes terminal differentiation marker (K10) in vivo.
  • actinic keratosis also called “solar keratosis” and “senile keratosis,” herein “AK”
  • actinic keratosis means a premalignant condition of thick, scaly, or crusty patches of skin. It is more common in fair-skinned people and it is associated with those who are frequently exposed to the sun, as it is usually accompanied by solar damage. AK is potentially precancerous, since some progress to squamous cell carcinoma, so treatment is recommended. Untreated lesions have up to 20% risk of progression to squamous cell carcinoma. People who take immunosuppressive drugs, such as organ transplant patients, are 250 times more likely to develop actinic keratosis that may lead to skin cancer.
  • TRPV channel transient receptor potential vanilloid ion channel
  • active agent refers to TRPV3 agonists as disclosed herein, and derivatives thereof (e.g., monoterpenes such as those listed in Table A, such as camphor, camphor oil, which contains monoterpene constitutents, and 2-APB for treatment or prevention of keratinocyte-derived lesions, e.g., SCC (including high-risk forms), non-melanoma skin cancers (including high-risk forms), and AK.
  • monoterpenes such as those listed in Table A, such as camphor, camphor oil, which contains monoterpene constitutents
  • 2-APB for treatment or prevention of keratinocyte-derived lesions, e.g., SCC (including high-risk forms), non-melanoma skin cancers (including high-risk forms), and AK.
  • keratinocyte-derived lesion means any keratinocyte-derived lesion including SCC (which encompasses the high risk form), non-melanoma cancer (which encompasses the high risk form), and AK.
  • administering an active agent may be performed using any of the various methods or delivery systems well known to those skilled in the art.
  • administering can also be performed, for example, orally, parenterally, intraperitoneally, intravenously, intraarterially, transdermally, sublingually, intramuscularly, rectally, transbuccally, intranasally, liposomally, via inhalation, vaginally, intraoccularly, via local delivery, subcutaneously, intraadiposally, intraarticularly, intrathecally, into a cerebral ventricle, intraventicularly, intratumorally, into cerebral parenchyma or intraparenchchymally or microinjection.
  • agonist refers to molecules or compounds which mimic the action of a "native” or “natural” compound that activates one or more of the ion channels TRPV3, TRPV1, TRPA1, or TRPC1. Agonists may or may not be homologous to these natural compounds in respect to conformation, charge or other characteristics. In any event, regardless of whether the agonist is recognized in a manner similar to the "natural" ion channel, the agonist may cause physiologic and/or biochemical changes within the cell, such that the cell reacts to the presence of the agonist in the same manner as if the natural ion channel was present.
  • Non-limiting examples of agonists for TRPV3 ion channels are 2-aminoethoxydiphenyle borate (2-APB), monoterpenes, including, but not limited to, those listed in Table A herein (e.g. , camphor, (+)- Borneol, (-)-Isopinocampheol, (-)-Fenchone, (-)-Trans-pinocarveol, Isoborneol, (+)- Camphorquinone, (-)-a-Thujone, alpha-pinene oxide, 1, 8-Cineole, (-)-alpha-Pinene, Isobornyl acetate, 6-tert-butyl-m-cresol, Carvacrol, Dihydrocarbeol, Thymol, /?-xylenol, Kreosol,
  • 2-APB 2-aminoethoxydiphenyle borate
  • monoterpenes including, but not limited to, those listed
  • Antagonist refers to molecules or compounds which inhibit the action of a “native” or “natural” molecule, such as TRPV3. Antagonists may or may not be
  • antagonists may be recognized as acting on the same receptor, in this case TRPV3.
  • Antagonists may have allosteric effects which prevent the action of an agonist (e.g. , by modifying a DNA adduct, or antagonists may prevent the function of the agonist (e.g., by blocking a DNA repair molecule).
  • animal means any animal (e.g., mammals, (including, but not limited to humans, primates, dogs, cattle, cows, horses, kangaroos, pigs, sheep, goats, cats, rabbits, rodents, and transgenic non-human animals), and the like, which are to be the recipient of a particular treatment.
  • mammals including, but not limited to humans, primates, dogs, cattle, cows, horses, kangaroos, pigs, sheep, goats, cats, rabbits, rodents, and transgenic non-human animals
  • the terms “animal” “subject” and “patient” are used interchangeably herein in reference to a human subject or a rodent.
  • the preferred animal, patient, or subject is a human.
  • 2-aminoethoxydiphenyl borate or "2-APB” as used herein, means a chemical that acts to inhibit IP3 receptors, Orai channels and TRP channels (although it activates TRPV1, TRPV2, & TRPV3 at higher concentrations) and derivatives thereof. In research it is used to manipulate intracellular release of calcium ions (Ca 2+ ) and modify TRP channel activity.
  • 2-aminoethoxydiphenyl borate or "2-APB” derivative as used herein means any variation, deviation, change, or analog of the 2-APB molecule. This may include, but is not limited to a variation in stereochemistry to either increase or decrease the size of the ring, or such as an addition or deletion of a substituent, or a variation in functional group, or an analog.
  • 2-APB derivatives or analogs are known in the art (e.g. , Y, Dobrydneva et al., 2005).
  • an individual at risk means one may or may not have detectable disease, and may or may not have displayed detectable disease prior to the treatment methods described herein.
  • At risk denotes that an individual who is determined to be more likely to develop a symptom based on conventional risk assessment methods or has one or more risk factors that correlate with development of diabetes. An individual having one or more of these risk factors has a higher probability of developing SCC than an individual without these risk factors. Examples (i.e. , categories) of risk groups are well known in the art and discussed herein.
  • biomarker means any biological feature from an organism which is useful or potentially useful for measuring the initiation, progression, severity, pathology, aggressiveness, grade, activity, disability, mortality, morbidity, disease sub- classification or other underlying feature of one or more biological processes, pathogenic processes, diseases, or responses to therapeutic intervention.
  • biomarkers of high risk SCC or high risk non-melanoma skin cancer are one or more of the proteins TRPV3, TRPV1, TRPA1, and TRPC1.
  • camphor as used herein, means a terpenoid with the chemical formula ⁇ . It is an organic compound of the isoprenoid family that belongs to the group of bicyclic monoterpenes. A white, waxy solid with a penetrating, somewhat musty aroma, it is obtained from the wood of the camphor laurel (laurel family), Cinnamomum camphor a (found in Asia), or produced synthetically from oil of turpentine. It exists in the optically active dextro and levo forms, and as the racemic mixture of the two forms. All of these melt within a degree of 178°C (352°F).
  • Camphor is also synthesized commercially on a large scale from pinene which yields mainly the racemic variety. Camphor is readily absorbed through the skin and produces substance feeling of warmth, and acts as a slight local anesthetic and anti-itch substance. There are anti-itch gels and soothing gels with camphor as the active ingredient. Camphor is an active ingredient (along with menthol) in vapor-steam products, such as Vicks VapoRub.
  • the IUPAC name for camphor is 1,7,7 Trimethylbicyclo[2.2.1]heptan-2-one. Since 1983, the Federal Food and Drug Administration (FDA) have banned the sale of products with more than 11% camphor because it can be toxic if ingested.
  • FDA Federal Food and Drug Administration
  • camphor derivative means any variation, deviation, or change in the camphor molecule. This may include, but is not limited to a variation in stereochemistry to either increase or decrease the size of the ring, or such as an addition or deletion of a substituent, or a variation in functional group, or an analog.
  • camphor derivatives 4-methyl-benzylidene camphor, [3-(4'- methyl)benzylidene-bornan-2-one] , 3-benzylidene camphor(3-benzylidene-bornan-2-one), polyacrylamidomethylbenzylidene camphor ⁇ N-[2(and 4)-2-oxyborn-3-ylidene- methyl)benzyl]acrylamide polymer ⁇ , trimonium-benzylidene camphor sulfate[3-(4'- trimethylammonium)-benzylidene-bornan-2-one methyl sulfate], terephthalydene
  • camphorsulfonic acid [3-(4'-sulfo)benzylidenebornan-2-one] or salts thereof.
  • 4- Methylbenzylidene camphor. (4-MBC) is an organic camphor derivative that is used in the cosmetic industry for its ability to protect the skin against UV, specifically UV B radiation. As such it is used in sunscreen lotions and other skincare products claiming a SPF value. Its tradenames include Eusolex 6300 (Merck) and Parsol 5000 (DSM).
  • Norcamphor which is a camphor derivative with the three methyl groups replaced by hydrogen. More specifically, Norcamphor is a chemical compound, classified as a ketone, which is an analog of camphor without the three methyl groups. It is used as a chemical building block in organic synthesis.
  • camphor oil means a colorless liquid obtained from the wood of the camphor tree (Cinnamomum camphora) by distillation and separation from the solid camphor, used in varnish, soaps, and shoe polish, and in medicine chiefly as a
  • rubefacient It is extracted from the wood by steam distillation.
  • Chemical components include but are not limited to a-pinene, camphene, b-pinene, sabinene, phellandrene, limonene, 1 ,8- cineole, y-terpinene, p-cymene, terpinolene, furfural, camphor, linalool, bornyl acetate, terpinen-4-ol, caryophyllene, boraeol, piperitone, geraniol, saf ole, cinnam aldehyde, methyl cinnamate and eugenol.
  • Camphor oil may be a natural extract or a synthetic mixture of components ⁇ e.g., CAS number 8008-51-3). A natural extract or naturally derived camphor oil may have a different composition from lot to lot from that of a synthetic camphor oil.
  • Monoterpenes other than camphor are major constituents of camphor oil.
  • TRPV3 agonists see Vogt- Eisele et al Br J Pharmacol 2007 151:530-540; PMID 17420775
  • linalool has been reported to make up 90% of camphor oil in one study, and borneol is more effective than camphor as a TRPV3 agonist.
  • kit means any manufacture ⁇ e.g., a package or container) comprising at least one reagent, e.g., a TRPV3 agonist for treatment of SCC (including high risk forms), non-melanoma cancers (including high-risk forms), and AK.
  • reagent e.g., a TRPV3 agonist for treatment of SCC (including high risk forms), non-melanoma cancers (including high-risk forms), and AK.
  • the manufacture may be promoted, distributed, or sold as a unit for performing the methods of the present invention.
  • Nociception means an unpleasant sensation which may be associated with actual or potential tissue damage and which may have physical Nociception and emotional components.
  • Nociception is a neurophysiological term and denotes specific activity in nerve pathways.
  • receptor means a structure expressed by cells and which recognizes binding molecules (e.g., ligands).
  • SCC squamous cell carcinoma
  • SCC means a cancer of a kind of epithelial cell, the squamous cell that make up the main part of the epidermis of the skin.
  • SCC is one of the major forms of skin cancer.
  • squamous cells also occur in the lining of the digestive tract, lungs, and other areas of the body, and SCC occurs as a form of cancer in diverse tissues, including the lips, mouth, esophagus, urinary bladder, prostate, lung, vagina, and cervix, among others.
  • SCC is a histologically distinct form of cancer arising from the uncontrolled multiplication of cells of epithelium, or cells showing particular cytological or tissue architectural characteristics of squamous cell differentiation, such as the presence of keratin, tonofilament bundles, or desmosomes, structures involved in cell-to-cell adhesion.
  • Squamous cell carcinomas are at least twice as frequent in men as in women. They rarely appear before age fifty and are most often seen in individuals in their seventies. The majority of skin cancers in African- Americans are squamous cell carcinomas, usually arising on the sites of preexisting inflammatory skin conditions or burn injuries. SCC is still sometimes referred to as "epidermoid carcinoma" and "squamous cell epithelioma,” though the use of these terms has decreased.
  • high risk form of SCC and “high risk form of non-melanoma cancer” as used herein mean SCC and non-melanoma cancers, respectively, that expresses either significantly higher or significantly lower than normal levels of mRNA encoding one or more of the proteins of TRPV3, TRPV1, TRPA1, and TRPC1, which are biomarkers of high risk SCC and non-melanoma cancers that permit one to make a definitive diagnosis.
  • a diagnosis of high-risk SCC was based entirely on a battery of clinical and histological criteria because there was no known biological marker.
  • a surgeon refers to a high risk SCC as one that that has a greater risk for recurrence (following treatment) and metastasis, based on the following criteria:
  • Anatomic site particularly SCCs of lip and ear, other high risk sites include eyelids, nose, mucous membranes, scalp/forehead/temple, anogenital region
  • the term "monoterpenes” as used herein, are a group of naturally occurring organic compounds (like camphor, borneol or methol) derived from two isoprene units. Most of them are fragrant and form major constitutents of many plant-derived essential oils. A number of monoterpenes have also been described as agonists or antagonists of different members of the transient receptor potential (TRP) channel family and are described herein in Table A.
  • TRP transient receptor potential
  • prophylactically effective amount means an amount of a drug that, when administered to a subject, will have the intended prophylactic effect, e.g. , preventing or delaying the onset (or reoccurrence) of the disease or symptoms, or reducing the likelihood of the onset (or reoccurrence) of the disease or symptoms.
  • the full prophylactic effect does not necessarily occur by administration of one dose and may occur only after administration of a series of doses.
  • a prophylactically effective amount may be administered in one or more administrations.
  • An "effective amount" of an agent is an amount that produces the desired effect.
  • the term "significantly higher” as used herein, means that levels of mRNA encoding the TRP channel (e.g., TRPV3, TRPVl, TRPAl, and TRPCl) in a subject biopsy are a statistically significant increase over control levels.
  • the term “significantly lower” as used herein, means levels of mRNA encoding the TRP channel (e.g., TRPV3, TRPVl, TRPAl, and TRPCl) in a subject biopsy are a statistically significant decrease below control levels.
  • terapéuticaally effective amount means an amount that achieves the intended therapeutic effect of reducing or controlling or eliminating a keratinocyte- derived lesion such as SCC or AK, including precancerous lesions and benign tumors having the morphological characteristics of SCC in a subject.
  • the full therapeutic effect does not necessarily occur by administration of one dose and may occur only after administration of a series of doses.
  • a therapeutically effective amount may be administered in one or more administrations per day for successive days.
  • TRPV3 transient receptor potential vanilloid 3
  • the term "transient receptor potential vanilloid 3" or "TRPV3" protein as used herein, means a nonselective calcium cation channel that is proposed to function in a variety of processes, including temperature sensation and vasoregulation.
  • the TRPV3 channel is widely expressed in the human body, especially in the skin in keratinocytes, but also in the brain. It is a thermosensitive ion channel expressed predominantly in the skin and neural tissues. It is activated by warmth and the monoterpene camphor and has been hypothesized to be involved in skin sensitization.
  • beneficial or desired clinical results include, but are not limited to alleviation or amelioration of one or more symptoms of the SCC cancer (including high-risk forms), or non- melanoma cancers (including high-risk forms), or AK; diminishing the extent of disease;
  • beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable.
  • Treatment can also mean prolonging survival as compared to expected survival if not receiving treatment. Those in need of treatment include those already having cancer and those with benign tumors or precancerous lesions.
  • cancer includes the enumerated diseases which are any keratinocyte-derived lesions, e.g. , a member of any class of SCC diseases, non-melanoma skin cancers and actinic keratinosis (AK) characterized by the uncontrolled or aberrant growth of aberrant keratinocytes.
  • Cancer includes high-risk forms of SCC and high risk non-melanoma skin cancers and neoplastic conditions, whether characterized as malignant, benign, soft tissue, or solid, and cancers of all stages and grades including pre- and post- metastatic cancers.
  • SCC cancers can appear on the skin, lips, mouth, lung, headhead stomach, prostate, colon, rectum, throat, urinary tract, reproductive tract, and esophagus.
  • a “tumor” comprises one or more cancer cells or benign cells or precancerous cells.
  • sample means, any biological specimen obtained from a subject.
  • Samples include, without limitation, a tissue sample (e.g. , tumor tissue) such as a biopsy of a tumor or of an area of skin having or suspected of having SCC (including high-risk forms), non-melanoma cancers (including high-risk forms), or AK, the tissue is typically exposed skin but can also be lips, mouth, esophagus, urinary bladder, prostate, lung, vagina, and cervix.
  • a biopsy of cells of a solid tumor or of skin suspected of having SCC (including high-risk forms), non-melanoma cancers (including high-risk forms), or AK can be obtained using any technique known in the art.
  • TRP channel transient receptor potential channel
  • TRP channel mean a group of ion channels located mostly on the plasma membrane of numerous human and animal cell types. There are about 28 TRP channels that share some structural similarity to each other. These are grouped into two broad groups: group 1 includes, TRPC ("C” for canonical), TRPV ("V” for vanilloid), TRPM ("M” for melastatin), TRPN and TRPA. In group 2, there are TRPP ("P” for polycystic) and TRPML (“ML” for mucolipin). Many of these channels mediate a variety of sensations like the sensations of pain, hotness, warmth or coldness, different kinds of tastes, pressure, and vision.
  • TRP channels are thought to behave like microscopic thermometers and used in animals to sense hot or cold.
  • Some TRP channels are activated by molecules found in spices like garlic (allicin), chilli pepper (capsaicin), wasabi (allyl isothiocyanate); others are activated by menthol, camphor, peppermint, and cooling agents; yet others are activated by molecules found in cannabis (i.e. THC, CBD and CBN).
  • keratinocyte-derived cancerous or precancerous lesions such as any form of SCC, (including high risk SCC), non- melanoma skin cancers (including high risk non-melanoma skin cancers) and AK ("the enumerated diseases").
  • Certain embodiments are directed to diagnosing a high-risk form of SCC or high risk non-melanoma skin cancer by determining if the level of expression of mRNA encoding one or more TRP channels, e.g., TRPV3, TRPCl, TRPVl, TRPAl in a biopsy of the lesion from a subject is either significantly higher or significantly lower compared to the corresponding level in normal tissue
  • TRP channels e.g., TRPV3, TRPCl, TRPVl, TRPAl
  • the enumerated diseases are treated by applying one or more of the active agents, to the affected area for a period of time either before the area is surgically removed, and/or for a period of time after the surgery.
  • the invention is directed to pharmaceutical formulations and kits comprising them having one or more TRPV3 agonists, for example monoterpenes ⁇ e.g., camphor), camphor oil, which contains other monoterpene constituents, and 2-APB.
  • Other embodiments are directed to sunscreens that contain the active agents for the purposes of preventing keratinocyte-derived lesions from developing.
  • Non-melanoma skin cancers are the most common cancers in the United States. Little is known about the pathophysiological mechanisms underlying keratinocyte-derived skin cancers and their relation to normal keratinocyte growth and differentiation.
  • the human epidermis is a multilayered stratified epithelium whose differentiation program is triggered in part by increased Ca 2+ levels.
  • the role of Ca 2+ in epidermal physiology, including the molecular basis for differentiation, is not fully understood. It is known that Ca 2+ triggers the commitment switch from keratinocyte proliferation to differentiation.
  • keratinocyte-derived skin cancers and their relation to normal keratinocyte growth and differentiation.
  • a better understanding of normal keratinocyte maturation is critical for unmasking the pathophysiological changes resulting in tumorigenesis.
  • Environmental factors and genetic alterations that contribute to keratinocyte-derived skin cancers have been identified; however, a better understanding of normal keratinocyte physiology is critical for unmasking pathophysiological changes resulting in tumorigenesis.
  • keratinocyte differentiation in upper strata (Mascia et al, 2012). These conditions can be mimicked in vitro through a calcium- switch procedure. Normal keratinocytes proliferate in media containing 0.06 mM calcium and then are induced to differentiate by culturing them for a few days in >1 mM extracellular calcium. Calcium-triggered differentiation programs are dysregulated in non-melanoma skin cancers, leading to uncontrolled cellular proliferation.
  • TRP transient receptor potential
  • This tyrosine kinase pathway governs multiple steps in epidermal homeostasis, including keratinocyte proliferation and differentiation (Schneider et al, 2008).
  • EGFR signaling also potentiates TRPV3 activity, illustrating that positive feedback links these receptors (Cheng et al, 2010).
  • TRPV1, TRPA1 and TRPC1 are coupled to the epidermal growth factor receptor (EGFR) pathway by means of cytokine factor release and calcium signaling, respectively (Pan et al, 2011; Tareddine & Gailly, 2012).
  • EGFR overexpression is a characteristic feature of SCC, a keratinocyte-derived neoplasm that is the second most common malignancy in the US. Increased expression and activation of EGFR correlates with poor prognosis in SCC (Hardisson, 2003). A number of EGFR inhibitors are FDA-approved for SCC treatment but their efficacies are inconsistent and some are associated with severe skin toxicity (Bauman et al, 2012).
  • TRP channels are one large family of non-selective cation channels that function to help regulate ion flux and membrane potential. These TRP channels are subdivided into six subfamilies including the TRPV family. TRPV3 is a member of the TRPV class of TRP channels.
  • TRPV3 is a calcium permeable nonselective cation channel.
  • TRPV3 channels are permeable to other cations, for example sodium.
  • TRPV3 channels modulate membrane potential by modulating the flux of cations such as calcium and sodium ions.
  • TRPV3 receptors are mechanistically distinct from voltage-gated calcium channels.
  • Voltage-gated calcium channels respond to membrane depolarization and open to permit an influx of calcium from the extracellular medium that result in an increase in intracellular calcium levels or concentrations.
  • TRPV3 proteins are thermo sensitive channels expressed in skin cells (Peier et al.
  • TRPV3 may also play an important role in regulating inflammation and pain that results from the release of inflammatory stimuli.
  • TRPV3 While Moran mentions that calcium, hence TRPV3, may play a role in SCC, it is not mentioned that TRPV3 should be stimulated with an agonist to treat SCC, nor indeed is any TPRV3 agonist identified; instead the entire focus is primarily on using TRPV3 antagonists therapeutically.
  • SCC is a cancer of a kind of epithelial cell, the squamous cell that makes up the main part of the epidermis of the skin.
  • SCC is one of the major forms of skin cancer.
  • squamous cells also occur in the lining of the digestive tract, lungs, and other areas of the body, and SCC occurs as a form of cancer in diverse tissues, including the lips, oral mucosa, nasopharynx, esophagus, urinary bladder, prostate, lung, vagina, and cervix, among others.
  • SCC is a histologically distinct form of cancer arising from the uncontrolled multiplication of cells of epithelium, or cells showing particular cytological or tissue architectural characteristics of squamous cell differentiation, such as the presence of keratin, tonofilament bundles, or desmosomes, structures involved in cell-to-cell adhesion.
  • Squamous cell carcinomas are at least twice as frequent in men as in women. They rarely appear before age 50 and are most often seen in individuals in their 70s.
  • the majority of skin cancers in African-Americans are squamous cell carcinomas, usually arising on the sites of preexisting inflammatory skin conditions or burn injuries.
  • SCC is still sometimes referred to as "epidermoid carcinoma” and "squamous cell epithelioma", though the use of these terms has decreased.
  • SCC is the second-most common cancer of the skin (after basal cell carcinoma) and it is more common than melanoma. World-wide, it is the most common cancer that has the potential to metastasize. It usually occurs in areas exposed to the sun. Sunlight exposure and
  • SCC immunosuppression are risk factors for SCC of the skin, with chronic sun exposure being the strongest environmental risk factor. Other risk factors include fair skin, age, male gender, history of skin cancer, and smoking. There is a risk of metastasis, often spreading to the lymph nodes, starting more than 10 years after diagnosable appearance of SCC. The risk of SCC metastasis is low, though it is much higher than with basal cell carcinoma. It is important to note that SCC of the lip and ears has significantly higher rates of local recurrence and distant metastasis (20-50%). SCC of the skin in individuals on immunotherapy or suffering from lymphoproliferative disorders (i.e. leukemia) also tend to be much more aggressive, regardless of their location. SCCs represent about 20% of the non-melanoma skin cancers, but due to their more obvious nature and growth rates, they represent 90% of all head and neck cancers that are initially presented.
  • lymphoproliferative disorders i.e. leukemia
  • Squamous cell carcinoma is generally treated by surgical excision or Mohs surgery after biopsy. While it is relatively easy to identify SCC, it is more challenging to diagnose a high-risk form of SCC. Morphological factors that indicate a high-risk form of SCC include the depth of the tumor (at > 2cm), poorly differentiated cells, ulceration, the location of the area involved (e.g., ears, face, scalp are at higher risk), and intravascular invasion. Other high- risk factors for SCC include the immune status of the subject (immune compromised subjects have a higher risk of SCC), and whether or not the abnormal cells involve the nervous system. Patients receiving organ transplants ("OTR") are immune compromised and are at highest risk for metastatic SCCs.
  • OTR organ transplants
  • SCC and non-melanoma biopsies can now be tested to determine whether they are high risk by determining if the expression of one or more of these biomarkers is significantly higher or significantly lower compared to a corresponding level in a normal subject. If the SCC or the non-melanoma is a high risk cancer, it warrants the most treatment: aggressive surgery and adjuvant therapy, including the newly described therapy of administering one or more TRPV3 agonists to treat the cancer. Even if the cancer is not high risk, treatment should include administration of therapeutically effective amounts of TRPV3 agonists as described herein, preferably before and after removal of the lesion and/or other treatment of the lesion.
  • the over or underexpression of the one or more of the biomarkers is detected in a biopsy from a subject, it is recommended that treatment, especially with the agonists, be started as soon as possible, even before the biopsy results are received.
  • treatment with TRPV3 agonists should be continued for a period of time after surgery to assure that all cancerous or precancerous cells are killed. It is preferred that all SCC and non-melanoma subjects, both high risk and non-aggressive cancers, receive TRPV3 agonist therapy applied topically to the site from which the SCC was removed for an extended period of time, possibly indefinitely, to prevent abnormal keratinocyte proliferation and/or cancer recurrence.
  • Non-surgical options for the treatment of cutaneous SCC include topical chemotherapy, topical immune response modifiers, photodynamic therapy (PDT), radiotherapy, and systemic chemotherapy.
  • Radiation therapy is a primary treatment option for patients in whom surgery is not feasible and is an adjuvant therapy for those with metastatic or high-risk cutaneous SCC.
  • systemic chemotherapy is used exclusively for patients with metastatic disease. Mohs surgery, also known as chemosurgery, enables the surgeon to obtain complete margin control during removal of a skin and it allows for the removal of a skin cancer with very narrow surgical margin and a high cure rate.
  • Actinic keratosis also called “solar keratosis” and “senile keratosis,” herein “AK”
  • AK senile keratosis
  • It is more common in fair- skinned people and it is associated with those who are frequently exposed to the sun, as it is usually accompanied by solar damage.
  • AKs are pre-cancerous lesions, as some progress to squamous cell carcinoma, so treatment is recommended. Untreated lesions have up to 20 % risk of progression to squamous cell carcinoma. People who take immunosuppressive drugs, such as organ transplant patients, are 250 times more likely to develop AK that may lead to skin cancer.
  • Medicated creams and solutions are typically used topically to treat actinic keratosis.
  • topical therapy such as Imiquimod cream and PDT is generally limited to premalignant (i.e., AKs) and in situ lesions.
  • 5-fluorouracil (5-FU) ointment or liquid in concentrations from 0.5 to 5 percent has FDA approval and is the most widely used topical treatment for AK as it is effective against not only the surface lesions but also the subclinical ones. Rubbed gently onto the lesions once or twice a day for two to four weeks, it produces cure rates of up to 93 percent.
  • Imiquimod 5% cream also FDA-approved, works by
  • Diclofenac is a non-steroidal anti-inflammatory drug used in combination with hyaluronic acid.
  • the resulting gel is applied twice a day for two to three months to prevent an inflammatory response, so this topical is well-tolerated.
  • the hyaluronic acid delays uptake of the diclofenac, leading to higher concentrations in the skin.
  • the gel used in 0.015% or 0.05% concentrations depending on the AK site, is the first topical therapy to effectively treat AKs in just two or three days.
  • Certain embodiments are directed to pharmaceutical formulations for topical applications of the above listed formulations that further include one or more of the active agents as described herein.
  • Cryosurgery is the most commonly used treatment method when a limited number of lesions exist. Other treatment includes laser surgery, and
  • agonists of TRPV3 have therapeutic use in treating any cancerous or precancerous keratinocyte-derived lesions including SCC (including high-risk forms), non-melanoma skin cancers (including high-risk forms), and AK.
  • SCC cancerous or precancerous keratinocyte-derived lesions
  • AK AK
  • the function of TRPV3 was examined in the maturation of normal human epidermal keratinocytes.
  • Human biopsy-derived SCC cells were cultured in vitro in a preclinical organotypic model, found to have functional TRPV3, and responded to the TRPV3 agonist, 2-APB, by reducing cancer cell proliferation thereby reducing tumor burden and invasion.
  • Topical camphor-oil treatment in vivo also reduced tumor burden and invasion, promoted regression of pre- malignant skin tumors and slowed progression of benign tumors to SCC. Dose-dependent effects of 2-APB and camphor were also observed on normal keratinocyte behavior. The following is a summary of results of experiments described in the Examples of this application.
  • TRP-channel agonists induce fate switch from proliferation to differentiation in
  • TRP-channel gene expression and protein function is upregulated in normal human epidermal keratinocytes upon differentiation
  • TRP-channel gene expres sion TRPV3 , TRPV 1 , tRPA 1 , and TRPC 1 ) is dysregulated in human high-risk SCC biopsies compared with normal skin;
  • transcript levels were higher in keratinocytes cultured in differentiation compared with proliferative conditions
  • Stimulating TRP-channel activity is sufficient to induce early differentiation which enhanced TRP-mediated calcium signaling, caused either by raising extracellular calcium or by exposure to TRP agonists, promotes differentiation in normal human epidermal keratinocytes;
  • Topical camphor-oil treatment promotes regression of pre-malignant skin tumors in vivo
  • Topical camphor-oil treatment slows progression of benign tumors to SCC in vivo
  • Topical camphor-oil treatment suppresses SCC proliferation and invasion in vivo
  • Topical camphor-oil treatment is sufficient to completely clear tumors in a subset of animals in carcinogenesis models in vivo;
  • Embodiments are directed to pharmaceutical compositions that contain one or more TRPV3 agonists or derivatives thereof (e.g. , monoterpenes listed in Table A, preferably camphor, camphor oil which contains other monoterpene constituents, and 2-APB) for treatment or prevention of keratinocyte-derived lesions, e.g., SCC (including high-risk forms), non- melanoma skin cancers (including high-risk forms), and AK.
  • TRPV3 agonists or derivatives thereof e.g. , monoterpenes listed in Table A, preferably camphor, camphor oil which contains other monoterpene constituents, and 2-APB
  • SCC including high-risk forms
  • non- melanoma skin cancers including high-risk forms
  • AK e.g., keratinocyte-derived lesions
  • Other embodiments are directed to sunscreens containing one or more of these TRPV3 agonists.
  • compositions and kits comprising them may be formulated as described below and are typically in topical formulations including creams, ointments, paste, powers, lotions, and gels, preferably in an ointment that is topically applied and is hydrophobic enough to keep the camphor in the ointment but also hydrophilic enough that it would not dry the skin and would be tolerated daily.
  • the contemplated pharmaceutical compositions include the active agents described herein in an amount sufficient to treat one or more of the enumerated diseases: SCC, (including high-risk forms) non-melanoma skin cancers (including high risk forms), or AK in a subject or prevent reoccurrence.
  • SCC including high-risk forms
  • non-melanoma skin cancers including high risk forms
  • AK a subject or prevent reoccurrence.
  • the doses of active agents for formulations to treat the enumerated diseases are discussed below.
  • compositions or Formulations Containing Camphor or 2-APB are provided.
  • the pharmaceutical composition for treatment of a keratinocyte-derived cancerous or precancerous lesion is comprised of one or more TRPV3 agonists such as camphor and, 2-APB.
  • TRPV3 agonists such as camphor and, 2-APB.
  • Balmosa Cream (camphor 4%, menthol 2%, methyl salicylate 4%, capsicum oleoresin
  • Mentholatum Vapour Rub (camphor 9%, menthol 1.35%, methyl salicylate 0.33%)
  • Nasciodine iodine 1.26%, menthol 0.59%, methyl salicylate 3.87%, turpentine oil 3.87%, camphor 3.87%)
  • Nicobrevin methyl valerate lOOmg, quinine 15mg, camphor lOmg, eucalyptus oil lOmg
  • Tixylix inhalant (camphor 60mg, menthol 25mg, turpentine oil 50mg,eucalyptus oil 20mg)
  • Camphor Linctus compound Camphor spirit compound 1ml, glycerol 1.5ml, tolu syrup to 5ml.
  • Camphor Liniment (BP 1973): Camphor 20% w/w in arachis oil (AKA Camph. Lin;
  • one or more active agents preferably camphor or 2-APB in sunscreens, (also commonly known as sun block, sun tan lotion, sun screen, sunburn cream or block out) formulated for topical application as a lotion, spray, gel or other product that absorbs or reflects some of the sun's ultraviolet (UV) radiation on skin exposed to sunlight and thus helps protect against sunburn.
  • sunscreens can be classified into physical sunscreens (i.e., those that reflect the sunlight) or chemical sunscreens (i.e., those that absorb the UV light).
  • Sunscreens contain one or more of the following ingredients: (i) organic chemical compounds that absorb ultraviolet light; (ii) inorganic particulates that reflect, scatter, and absorb UV light (such as titanium dioxide, zinc oxide, or a combination of both); and (iii) organic particulates that mostly absorb light like organic chemical compounds, but contain multiple chromophores, may reflect and scatter a fraction of light like inorganic particulates, and behave differently in formulations than organic chemical compounds.
  • Still other useful sunscreens are those disclosed in U.S. Pat. No. 4,937,370, to Sabatelli and U.S. Pat. No. 4,999,186, to Sabatelli et al.
  • the sun screening agents disclosed therein have, in a single molecule, two distinct chromophore moieties which exhibit different ultra-violet radiation absorption spectra.
  • chromophore moieties absorbs predominantly in the UVB radiation range and the other absorbs strongly in the UVA radiation range. These sun screening agents provide higher efficacy, broader UV absorption, lower skin penetration and longer lasting efficacy relative to
  • sunscreens include those selected from the group consisting of 4-N,N-(2-ethylhexyl)methylanminobenzoic acid ester of 2,4- hydroxybenzophenone, 4-N,N-(2-ethylhexyl)methylaminobenzoic acid ester with 4- hydroxydibenzoylmethane, 4-N,N-(2-ethylhexyl)methylaminobenzoic acid ester of 2-hydroxy-4- (2-hydroxyethoxy)benzophenone, 4-N,N-(2-ethylhexyl)-methylaminobenzoic acid ester of 4-(2- hydroxyethoxy)dibenzoylmethane, and mixtures thereof.
  • the sunscreens can comprise from about 0.5 percent to about 20 percent of the compositions useful herein. Exact amounts will vary depending upon the sunscreen formulation chosen, the particular active agent , and the desired Sun Protection Factor (SPF). SPF is a commonly used measure of photoprotection of a sunscreen against erythema. See Federal Register, Vol. 43, No. 166, pp. 38206-38269, Aug. 25, 1978.
  • UVA/UVB sunscreens can address this concern.
  • UV-filter Other names Maximum Permitted in Results of concentration these safety countrie testing p-Aminobenzoic PABA 15% (EC- USA, AUS Protects acid banned from against sale to skin consumers tumors in from 8 October mice. 2009) Shown to increase DNA
  • Octyl salicylate Octisalate, 2-Ethylhexyl 5% ECUSA, Not tested salicylate, Escalol 587, (EC,USA,AUS AUS, JP
  • Titanium dioxide CI77891 25% (No limit ECUSA, Not tested
  • Camphor derivatives as used herein means any variation, deviation, or change in the camphor molecule. This may include, but is not limited to a variation in stereochemistry to either increase or decrease the size of the ring, or such as an addition or deletion of a substituent, or a variation in functional group, or an analog.
  • camphor derivatives 4-methyl- benzylidene camphor, [3-(4'-methyl)benzylidene-bornan-2-one], 3-benzylidene camphor(3- benzylidene-bornan-2-one), polyacrylamidomethylbenzylidene camphor ⁇ N-[2(and 4)-2- oxyborn-3-ylidene-methyl)benzyl]acrylamide polymer ⁇ , trimonium-benzylidene camphor sulfate[3-(4'-trimethylammonium)-benzylidene-bornan-2-one methyl sulfate], terephthalydene dicamphorsulfonic acid ⁇ 3,3'-(l,4-phenylenedimethine)-bis(7,7-dimethyl-2-oxo- bicyclo[2.2.1]hepta- ne-l-methanesulfonic acid ⁇ or salts thereof, and benzy
  • camphorsulfonic acid [3-(4'-sulfo)benzylidenebornan-2-one] or salts thereof.
  • 4- Methylbenzylidene camphor (4-MBC) is an organic camphor derivative that is used in the cosmetic industry for its ability to protect the skin against UV, specifically UV B radiation. As such it is used in sunscreen lotions and other skincare products claiming a SPF value. Its tradenames include Eusolex 6300 (Merck) and Parsol 5000 (DSM).
  • Other derivatives may include, e.g., salts of 10-camphorsulphonic acid (CSA) that are used in pharmaecutical preparations as an aqueous soluble form of camphor.
  • CSA 10-camphorsulphonic acid
  • Camphorsulfonic acid is a while crystalline acid C 0 FJ 5 OSO 3 made by reaction of camphor with sulfuric acid and acetic anhydride.
  • the most frequently found are camphorsulphonates of sodium, codein, piperazine, ephedrine, and ethylmorphine, which are used in tablets, suppositories, oral drops, syrups and injections.
  • the raw material for the preparation of camphorsulphonates for medical use is synthetic camphor, a mixture of optical isomers.
  • camphor derivatives of the invention may include a structural change in the molecule, such as norcamphor.
  • Norcamphor has three methyl groups replaced by hydrogen. Therefore, embodiments of the present invention may include camphor derivatives that may or may not carry a secondary hydroxyl group on the ring.
  • camphor belongs to the group of the bicyclic monoterpenes, other monoterpenes belonging to the monocyclic group that are structurally similar are also highly effective TRPV3 agonists. It is known in the art that other monoterpenes similar in structure to camphor carry a secondary hydroxyl group. Oxidation to a carbonyl group reduced the activity of the substance drastically, arguing that a hydroxyl group is a structural requirement for efficient activation of
  • the position of the hydroxyl group on the ring does not appear to be critical for TRPV3 activation in aromatic substances, but it is relevant for non-aromatic compunds such as dihydrocarveol and (-)-carveol (where the hydroxyl group in the meta position to the isopropyl residue), rather than in the ortho positions as in (-)-isopulegol and (-)-menthol.
  • camphor- oil which contains (in addition to camphor oil) other monoterpene constitutents (as shown in Table A herein).
  • Camphor-oil is a colorless liquid obtained from the wood of the camphor tree iCinnamomum camphora) by distillation and separation from the solid camphor, used in varnish, soaps, and shoe polish, and in medicine chiefly as a rubefacient. It is extracted from the wood by steam distillation.
  • camphor oil besides camphor include but are not limited to a-pinene, camphene, b-pinene, sabinene, phellandrene, limonene, 1,8-cineole, y- cerpinene, p-cymene, cerpinoiene, furfural, camphor, linaiooi, bornyl acetate, terpinen-4-oi, caryophyliene, borneol, piperitone, geranioi, safrole, cinnamaldehyde, methyl cinnamate and eugenol.
  • Camphor oil can be a natural extract or a synthetic mixture of components (e.g., CAS number 8008-51-3).
  • Monoterpenes like camphor, borneol or methol
  • Monoterpenes comprise a group of naturally occurring organic compounds drived from two isoprene units. Most of them are fragrant and form major constitutents of many plant-derived essential oils. While most commonly used as antimicrobial agents, monoterpenes have a wide range of applications in pharmaceutical, emdical and cosmetic fields.
  • compositions containing camphor oil may also include monterpenes described above in Table A. More preferably, the monoterpene constituents may include linalool, pinene, limonene, geraniol, and borneol, but may be one of those listed in Table
  • Camphor or 2-APB Derivatives thereof, and Camphor-Oil Which Contains Monoterpene Constituents
  • compositions or formulations comprising the active agents may exist in a wide variety of presentation forms, for example: in the form of liquid preparations as emulsions known in the art, or microemulsions gels, oils, creams, milk or lotions, powders lacquers, tablets or make-up, a stick, sprays (with propellent gas or pump-action spray) or aerosols, foams, or pastes.
  • Embodiments are also directed to cosmetic preparations for the skin comprising one or more active agents including light-protective preparations, such as sun milks, lotions, creams, oils, sunblocks or tropicals, pretanning preparations or after-sun preparations, also skin-tanning preparations, for example self-tanning creams.
  • light-protective preparations such as sun milks, lotions, creams, oils, sunblocks or tropicals
  • pretanning preparations or after-sun preparations also skin-tanning preparations, for example self-tanning creams.
  • sun protection creams sun protection lotions, sun protection milk and sun protection preparations in the form of a spray.
  • Topical formulations of the active agents are preferred. Delivery may occur via dropper or applicator stick, as a mist via an aerosol applicator, via an intradermal or transdermal patch, or by simply spreading a formulation of the invention onto the affected area with fingers.
  • Camphor is well absorbed after inhalation, (if formulated at a dose that is not toxic
  • compositions of the invention may also include one or more emollients.
  • An emollient is an oleaginous or oily substance, which helps to smooth and soften the skin, and may also reduce its roughness, flaking, cracking or irritation.
  • suitable emollients include mineral oil having a viscosity in the range of 50 to 500 centipoise (cps), lanolin oil, coconut oil, cocoa butter, olive oil, almond oil, macadamia nut oil, aloe extracts such as aloe vera
  • the emollient is a cocoglyceride, which is a mixture of mono, di and triglycerides of cocoa oil, sold under the trade name of Myritol 331 from Henkel KGaA, or Dicaprylyl Ether available under the trade name Cetiol OE from Henkel KGaA or a C 12 -C 15 Alkyl Benzoate sold under the trade name Finsolv from Finetex.
  • Another suitable emollient is DC 200 Fluid 350, a silicone fluid.
  • Suitable emollients include squalane, castor oil, polybutene, sweet almond oil, avocado oil, calophyllum oil, ricin oil, vitamin E acetate, olive oil, silicone oils such as dimethylopolysiloxane and cyclomethicone, linolenic alcohol, oleyl alcohol, the oil of cereal germs such as the oil of wheat germ, isopropyl palmitate, octyl palmitate, isopropyl myristate, hexadecyl stearate, butyl stearate, decyl oleate, acetyl glycerides, the octanoates and benzoates of (C ⁇ -Cis) alcohols, the octanoates and decanoates of alcohols and polyalcohols such as those of glycol and glyceryl, ricinoleates esters such as isopropyl adipate, hex
  • Still other suitable emollients which are solids or semi-solids at ambient temperatures may be used.
  • Such solid or semi-solid cosmetic emollients include glyceryl dilaurate, hydrogenated lanolin, hydroxylated lanolin, acetylated lanolin, petrolatum, isopropyl lanolate, butyl myristate, cetyl myristate, myristyl myristate, myristyl lactate, cetyl alcohol, isostearyl alcohol and isocetyl lanolate.
  • One or more emollients can optionally be included in the present invention ranging in amounts from about 1 percent to about 10 percent by weight, preferably about 5 percent by weight.
  • Topical formulations that include an emulsion.
  • topical formulations can be in the form of the following:
  • stratum corneum outer layer of skin well stratum corneum outer layer of skin well.
  • Paste - Combines three agents - oil, water, and powder; an ointment in which a powder is suspended. • Powder - A finely subdivided solid substance
  • Topical carriers for use in embodiments of the invention are disclosed in REMINGTON: THE SCIENCE AND PRACTICE OF PHARMACY 282-291 (Alfonso R. Gennaro ed. 19th ed. 1995).
  • Suitable gels for use in the invention are disclosed in REMINGTON: THE SCIENCE AND PRACTICE OF PHARMACY 1517- 1518 (Alfonso R. Gennaro ed. 19th ed. 1995),U.S. Pat. No. 6,387,383 (issued May 14, 2002); U.S. Pat. No. 6,517,847 (issued Feb. 11, 2003); and U.S. Pat. No. 6,468,989 (issued Oct. 22 2002. Dow Coming Corp.
  • compositions of the invention are typically prepared by mixing a TRPV3 agonist, (e.g., (e.g., camphor, camphor oil, which contains other monoterpene constituents, and 2-APB or derivatives thereof) with a topical carrier according to well-known methods in the art.
  • TRPV3 agonist e.g., (e.g., camphor, camphor oil, which contains other monoterpene constituents, and 2-APB or derivatives thereof
  • the topical carriers include pharmaceutically acceptable solvents, such as a polyalcohol or water; emulsions (either oil-in- water or water- in-oil emulsions), such as creams or lotions; micro emulsions; gels; ointments.
  • Suitable protectives and adsorbents include, but are not limited to, dusting powders, zinc sterate, collodion, dimethicone, silicones, zinc carbonate, aloe vera gel and other aloe products, vitamin E oil, allatoin, glycerin, petrolatum, and zinc oxide.
  • Topical pharmaceutical compositions of the invention in the form of an emulsion may optionally contain drying agents. Drying agents generally promote rapid drying of moist areas and coats the skin for protection and healing. In particular, it acts to prevent irritation of the involved area and water loss from the skin layer by forming a physical barrier on the skin.
  • drying agents include calamine; zinc containing drying agents such as zinc oxide, zinc acetate, zinc stearate, zinc sulfate, copper sulfate, kaolin, potassium permanganate, Burow's aluminum solution, talc, starches such as wheat and corn starch, silver nitrate, and acetic acid.
  • compositions or formulations may be in the form of an aqueous solution or suspension, preferably, an aqueous solution.
  • Suitable aqueous topical formulations for use in the invention are disclosed in REMINGTON: THE SCIENCE AND PRACTICE OF PHARMACY 1563-1576 (Alfonso R. Gennaro ed. 19th ed. 1995),.
  • Other suitable aqueous topical carrier systems are disclosed in U.S. Pat. No. 5,424,078 (issued Jun. 13, 1995); U.S. Pat. No. 5,736,165 (issued Apr. 7, 1998); U.S. Pat. No. 6,194,415 (issued Feb. 27, 2001); U.S. Pat. No. 6,248,741 (issued Jun. 19, 2001); 6,465,464 (issued Oct. 15, 2002.)
  • compositions of the invention can comprise pharmaceutically acceptable excipients other than emollients, demulcents, and antioxidants such as those listed in REMINGTON: THE SCIENCE AND PRACTICE OF PHARMACY 866-885(Alfonso R.
  • preservatives include moisturizers, buffering agents, solubilizing agents, skin-penetration agents, and surfactants.
  • Suitable demulcents include, but are not limited to, benzoin, hydroxypropyl cellulose, hydroxypropyl methylcellulose, and polyvinyl alcohol.
  • Suitable emollients include, but are not limited to, animal and vegetable fats and oils, myristyl alcohol, alum, and aluminum acetate.
  • Suitable preservatives include, but are not limited to, quaternary ammonium compounds, such as benzalkonium chloride, benzethonium chloride, cetrimide, dequalinium chloride, and
  • cetylpyridinium chloride cetylpyridinium chloride; mercurial agents, such as phenylmercuric nitrate, phenylmercuric acetate, and thimerosal; alcoholic agents, for example, chlorobutanol, phenylethyl alcohol, and benzyl alcohol; antibacterial esters, for example, esters of parahydroxybenzoic acid; and other anti-microbial agents such as chlorhexidine, chlorocresol, benzoic acid and polymyxin.
  • mercurial agents such as phenylmercuric nitrate, phenylmercuric acetate, and thimerosal
  • alcoholic agents for example, chlorobutanol, phenylethyl alcohol, and benzyl alcohol
  • antibacterial esters for example, esters of parahydroxybenzoic acid
  • other anti-microbial agents such as chlorhexidine, chlorocresol, benzoic acid and polymyxin.
  • Suitable antioxidants include, but are not limited to, ascorbic acid and its esters, sodium bisulfite, butylated hydroxytoluene, butylated hydroxyanisole, tocopherols, and chelating agents like EDTA and citric acid.
  • Suitable moisturizers include, but are not limited to, glycerin, sorbitol, polyethylene glycols, urea, and propylene glycol.
  • Suitable buffering agents for use with the invention include, but are not limited to, acetate buffers, citrate buffers, phosphate buffers, lactic acid buffers, and borate buffers.
  • Suitable solubilizing agents include, but are not limited to, quaternary ammonium chlorides, cyclodextrins, benzyl benzoate, lecithin, and polysorbates. More specifically, camphor is slightly soluble in water, soluble in alcohol, ether, benzene, acetone, oil of turpentine, glacial acetic acid, chloroform, carbon disulphide, solvent naphtha and fixed and volatile oils. It is also soluble in aniline, nitrobenzene, tetralin, decalin, methylhexalin, petroleum
  • Embodiments may include skin-penetration agents such as, but are not limited to, ethyl alcohol, isopropyl alcohol, octylphenylpolyethylene glycol, oleic acid, polyethylene glycol 400, propylene glycol, N-decylmethylsulfoxide, fatty acid esters (e.g. , isopropyl myristate, methyl laurate, glycerol monooleate, and propylene glycol monooleate); and N-methyl pyrrolidone.
  • skin-penetration agents such as, but are not limited to, ethyl alcohol, isopropyl alcohol, octylphenylpolyethylene glycol, oleic acid, polyethylene glycol 400, propylene glycol, N-decylmethylsulfoxide, fatty acid esters (e.g. , isopropyl myristate, methyl laurate, glycerol monooleate,
  • the pharmaceutical composition is contained within a laminated structure that serves as a drug delivery device to be affixed to the skin.
  • the pharmaceutical composition is contained in a layer, or "reservoir", underlying an upper backing layer.
  • the laminated structure may contain a single reservoir, or it may contain multiple reservoirs.
  • the reservoir comprises a polymeric matrix of a pharmaceutically acceptable contact adhesive material that serves to affix the system to the skin during active ingredients delivery.
  • suitable skin contact adhesive materials include, but are not limited to, polyethylenes, polysiloxanes, polyisobutylenes, polyacrylates, polyurethanes, and the like.
  • the particular polymeric adhesive selected will depend on the particular active ingredients, vehicle, etc., i.e. , the adhesive must be compatible with all components of the active ingredients-containing composition.
  • the active ingredients-containing reservoir and skin contact adhesive are present as separate and distinct layers, with the adhesive underlying the reservoir which, in this case, may be either a polymeric matrix as described above or it may be a liquid or hydrogel reservoir, or may take some other form.
  • Targeted drug delivery of the pharmaceutical composition is a method of delivering medication to a patient in a manner that increases the concentration of the medication in some parts of the body relative to others.
  • the goal of a targeted drug delivery system is to prolong, localize, target and have a protected drug interaction with the diseased tissue, (e.g, in this case a slow-release transdermal patch).
  • the conventional drug delivery system is the absorption of the drug across a biological membrane, whereas the targeted release system releases the drug in a dosage form.
  • the advantages to the targeted release system is the reduction in the frequency of the dosages taken by the patient, having a more uniform effect of the drug, reduction of drug side-effects, and reduced fluctuation in circulating drug levels.
  • the active agents are formulated into liposomes for delivery.
  • Liposomes are microscopic spheres made from fatty materials, predominantly phospholipids. Because of their similarity to phospholipid domains of cell membranes and an ability to carry substances, liposomes can be used to protect active ingredients and to provide time-release properties in medical treatment. Liposomes are made of molecules with hydrophilic and hydrophobic ends that form hollow spheres. They can encapsulate water-soluble ingredients in their inner water space, and oil-soluble ingredients in their phospholipid membranes. Liposomes are made up of one or more concentric lipid bilayers, and range in size from 50 nanometers to several micrometers in diameter. Liposomal formulations have been used for many years to enhance the penetration of topically applied ingredients.
  • Liposomes are made from lecithin, egg or it can be synthesized. These phospholipids can be both hydrogenated and non-hydrogenated. Phosphatidylcholine is extracted from these sources and can be both saturated and unsaturated. Other phospholipids including essential fats like linoleic acid and alpha linolenic acid can be used. Additionally, polyethylene glycol and cholesterol are considered liposomal material because of their lipid structure.
  • the active agents can be delivered to cancers such as SCCs in the digestive tract for example, or in another location that is difficult to access, e.g. locally in a slow-release formulation or via an implanted pump. Any formulation that delivers the active agents to the intended site is within the scope of this invention.
  • the literature on making such formulations is well known to those in the art.
  • camphor, camphor-oil, and 2-APB were tested.
  • the preferred embodiment is topical administration. It has been shown that topical administration of toxic doses of camphor has little effect on elevating systemic amounts. (See D. Martin, et al., J. Clin. Pharmacol, 2004 Oct; 44 (10): 1151-57.)
  • the toxicity of the active agents will have to be determined as a factor affecting their formulation and mode of application. Some agents formulated to have very low toxicity may be able to be administered to cancers inside the body, as opposed to on the skin. Routine experimentation will determine this.
  • camphor High doses of camphor (>20%) have been reported to cause skin irritation as well as toxicity when ingested.
  • the high doses of camphor described herein for therapeutic use of keratinocyte-derived lesions are neither intended for ingestion nor for application on very large areas of the body. Rather, it is intended that camphor for treating cancers or AK is applied locally to affected areas and in doing so it would not cause systemic toxicity even if applied at very high doses.
  • the goal is to treat the patient' s cancer, and in doing so doses higher than 11% may be necessary to eliminate or control the cancer or AK.
  • the cancer is relatively nonaggressive it may respond to a lower dose than would be needed for treating aggressive forms of keratinocyte-derived cancers.
  • therapeutic doses of camphor up to 30% were tested for topical application without systemic toxicity. Ultimately, any side effects at higher doses may be further managed. It is not expected that high dose formulations of camphor or any other active that is potentially toxic if ingested, would be available over the counter. Rather it would be a prescription drug for treating cancer or AK. It may be advisable that very high doses be applied by a physician or under the direction of a physician.
  • camphor In Canada, amounts of camphor are approved for over the counter formulations of up to 20% for multiple, daily applications in over the counter preparations. Some high doses of camphor may cause necrosis of normal cells along with killing the cancer; however, there is a cost benefit risk to controlling the cancer even at the expense of killing some normal cells. Moreover the dose can be adjusted once the cancer is under control. Normal cells around the periphery of the lesion that may become necrotic can be removed and healthy skin/cells will grow back.
  • Dosages and dosing frequency will be determined by a trained medical professional depending on the activity of the TRPV3 agonist or derivative thereof, the dose, the particular topical formulation, and the identity and severity of the dermatologic disorder.
  • Camphor applied to the skin of volunteers as a 20% solution in alcohol produced no significant sensation of irritation or pain at normal skin temperatures (Green 1990).
  • therapeutically effective amounts of camphor range from about 0.0608-99.5%, preferably in the range of 10%- 50%
  • therapeutically effective amounts of camphor-oil range from about 0.0608-99.5%, preferably in the range of 10%-50%
  • therapeutically effective amounts of 2-APB 0.00005- 5% range from about 0.0608-99.5%, preferably in the range of 10%-50%
  • therapeutically effective amounts of 2-APB 0.00005- 5% range from about 0.0608-99.5%, preferably in the range of 10%-50%
  • therapeutically effective amounts of 2-APB 0.00005- 5% preferably in the range of 2-APB 0.00005- 5%.
  • kits include a pharmaceutical composition as described herein and instructions for the use of the pharmaceutical composition and dosage regime.
  • the kit can comprise the pharmaceutical composition of the invention in a suitable container with labeling and instructions for use.
  • the container can be, but is not limited to, a dropper or tube.
  • the pharmaceutical composition of the invention can be filled and packaged into a plastic squeeze bottle or tube. Suitable
  • container-closure systems for packaging pharmaceutical compositions of the invention are commercially available for example, from Wheaton Plastic Products, 1101 Wheaton Avenue, Millville, N.J. 08332.
  • instructions are packaged with the formulations of the invention, for example, a pamphlet or package label.
  • the labeling instructions explain how to administer pharmaceutical compositions of the invention, in an amount and for a period of time sufficient to treat or prevent SCC and AK and symptoms associated therewith.
  • the label includes the dosage and administration instructions, the topical formulation's composition, the clinical pharmacology, drug resistance, pharmacokinetics, absorption, bioavailability, and contraindications.
  • Embodiments of the invention provide methods of diagnosing, and treating subjects having keratinocyte-derived lesions, e.g., SCC (including high-risk forms), non-melanoma skin cancers (including high-risk forms), and AK, and subjects at risk of developing non-melanoma skin cancer, SCC, or AK, in a subject.
  • SCC including high-risk forms
  • non-melanoma skin cancers including high-risk forms
  • AK e.g., keratinocyte-derived lesions
  • Treatment of these conditions preferably involves topical application of therapeutically effective amounts (amounts that reduce or prevent abnormal keratinocyte proliferation) of one or more active agents.
  • active agents The TRPV3 agonists described herein are collectively referred to as "active agents"
  • the amount of active agent will vary depending on many factors, including the severity of the disease, the size of the lesion, the location of the lesion, the age, sex and immune status of the subject.
  • therapeutically effective amounts of camphor and camphor oil range from 0.0608-99.5% (wt/vol or vol/vol), preferably in the range of 10-50%, and 2-APB ranges from about 0.00005-05%.
  • Penetration of the active agents to the targeted SCC, non-melanoma cancers, or AK cells can be optimized by adjusting the dose, but also by formulating the active agents in ways that enhance uptake, for example by using skin -penetration agents in the formulations.
  • the active agents of the invention should be applied to the lesion in such a way as to treat the margins of the tumor or affected area in addition to the bulk area of the lesion. Some normal cells will thus be contacted with active agent in this process.
  • the active agents are applied to the affected area having the cancerous lesions for a period of time before the lesion is surgically removed, or for a period of time after is the lesion surgically removed, or more preferably before and after surgery.
  • Application of the active agent before surgery will reduce tumor burden and application after surgery will kill any stray cancer cells left behind and reduce the risk of a recurrence.
  • the present therapies can be used in conjunction with other therapies that are effective in treating an enumerated disease.
  • the subject is human.
  • SCCs arising in the head and neck area are typically at higher risk for local invasion and metastasis compared to SCCs arising in the trunk and extremities. Locally advanced, aggressive, recurrent or metastatic SCC is much more difficult to treat. SCCs that arise in the head and neck area, including primary lip, oral cavity, nasal cavity, paranasal sinus, pharyngeal and laryngeal tissues exhibit a local recurrence in 50% of patients and carry an overall survival of only 6-9 months.
  • methods comprise obtaining a biopsy of the affected area from a patient diagnosed or suspected of having an enumerated disease, and obtaining a control biopsy from either a normal subject or from a matched biopsy of normal tissue from the diagnosed patient
  • the level of mRNA encoding one or more of the TRP channels (TRPV3, TRPC1, TRPV1, and TRPA1) in the patient biopsy of the affected area and in the control biopsy are then determined, and if the mRNA level in the patient biopsy of the affected area is significantly higher than the level in the control biopsy, then the diagnosis is made that the patient has a high-risk form of SCC or non-melanoma. Once the diagnosis of high-risk SCC or non-melanoma is confirmed, then it is possible to determine that the patient is in need of more aggressive treatment (e.g. , Mohs surgery followed by chemotherapy and radiation).
  • SCC squamous cell carcinoma
  • AK squamous cell carcinoma
  • Immunocompromised patients e.g., organ transplant patients, "OTR" have an increased risk of developing aggressive, high-risk SCC and high-risk non-melanoma cancers, and biopsies from such individuals should routinely be tested to determining if there is a significantly higher or significantly lower level of mRNA encoding one or more of the following biomarkers of high risk SCC/non-melanoma cancer: TRPV3, TRPC1, TRPV1, and TRPA1 to help determine the course of treatment. If an OTR subject does not have abnormal biomarker mRNA levels, the subject may respond to non-aggressive surgical removal of the SCC combined with TRPV3, TRPV1, TRPA1, and TRPC1 agonist therapy, and not require the more aggressive surgery.
  • OTR organ transplant patients
  • expression of mRNA encoding one or more of the following: TRPV3, TRPC1, TRPV1, and TRPA1 can be determined in a biological sample using known techniques, from which the level of gene expression can be inferred. Levels of mRNA can be quantitatively measured by northern blotting which gives size and sequence information about the mRNA molecules. A sample of RNA is separated on an agarose gel and hybridized to a radioactively labeled probe that is complementary to the target sequence. Or more typically RT- qPCR is used wherein reverse transcription is followed by real-time quantitative PCR (qPCR). Reverse transcription first generates a DNA template from the mRNA; this single-stranded template is called cDNA.
  • cDNA real-time quantitative PCR
  • the cDNA template is then amplified in the quantitative step, during which the fluorescence emitted by labeled hybridization probes or intercalating dyes changes as the DNA amplification process progresses.
  • qPCR can produce an absolute measurement of the number of copies of original mRNA, typically in units of copies per nanolitre of homogenized tissue or copies per cell. qPCR is very sensitive.
  • a highly specific RT-qPCR assay for human TRPV3, including well-behaved specific primers, has been developed and is potentially the basis for a diagnostic assay.
  • TRPV1, TRPA1, and TRPC1 mRNA expression using the specific primers:
  • hGAPDH_lF AAG GGC ATC CTG GGC TAC (SEQ. ID. NO. 1)
  • hGAPDH_lR AGG GGA GAT TCA GTG TGG TG (SEQ. ID. NO. 2)
  • hTRPV3_2_F gtcttgaggagcagggagag
  • hTRPV3_2_R caacccagtcacagcagaag
  • the qPCR cycling conditions are as follows:
  • Target nucleic acids are amplified to obtain amplification products.
  • Suitable nucleic acid amplification techniques are well known to a person of ordinary skill in the art, and include polymerase chain reaction (PCR) as for example described in Ausubel et al., Current Protocols in Molecular Biology (John Wiley & Sons, Inc. 1994-1998) (and incorporated herein).
  • the most commonly used nucleic acid amplification technique is the polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • PCR is well known in this field and comprehensive description of this type of reaction is provided in E. van Pelt-Verkuil et al., Principles and Technical Aspects of PCR Amplification, Springer, 2008.
  • PCR is a powerful technique that amplifies a target DNA sequence against a background of complex DNA. If RNA is to be amplified (by PCR), it must be first transcribed into cDNA (complementary DNA) using an enzyme called reverse transcriptase. Afterwards, the resulting cDNA is amplified by PCR. PCR is an exponential process that proceeds as long as the conditions for sustaining the reaction are acceptable.
  • the components of the reaction are: (i). pair of primers— short single strands of DNA with around 10-30 nucleotides complementary to the regions flanking the target sequence; (ii). DNA polymerase— a thermostable enzyme that synthesizes DNA; (iii). deoxyribonucleoside triphosphates (dNTPs)— provide the nucleotides that are incorporated into the newly synthesized DNA strand; and (iv). buffer— with MgCh to provide the optimal chemical environment for DNA synthesis.
  • PCR typically involves placing these reactants in a small tube (-10-50 ⁇ ) containing the extracted nucleic acids.
  • the tube is placed in a thermal cycler; an instrument that subjects the reaction to a series of different temperatures for varying amounts of time.
  • the standard protocol for each thermal cycle involves a denaturation phase, an annealing phase, and an extension phase.
  • the extension phase is sometimes referred to as the primer extension phase.
  • two-step thermal protocols can be employed, in which the annealing and extension phases are combined.
  • the denaturation phase typically involves raising the temperature of the reaction to 90-95 C to denature the DNA strands; in the annealing phase, the temperature is lowered to -50-60 C for the primers to anneal; and then in the extension phase the temperature is raised to the optimal DNA polymerase activity temperature of 60-72 C for primer extension. This process is repeated cyclically around 20-40 times.
  • Multiplex PCR uses multiple primer sets within a single PCR mixture to produce amplicons of varying sizes that are specific to different DNA sequences. By targeting multiple genes at once, additional information may be gained from a single test-run that otherwise would require several experiments. Optimization of multiplex PCR is more difficult though and requires selecting primers with similar annealing temperatures, and amplicons with similar lengths and base composition to ensure the amplification efficiency of each amplicon is equivalent.
  • Linker-primed PCR also known as ligation adaptor PCR, is a method used to enable nucleic acid amplification of essentially all DNA sequences in a complex DNA mixture without the need for target- specific primers.
  • the method firstly involves digesting the target DNA population with a suitable restriction endonuclease (enzyme). Double- stranded oligonucleotide linkers (also called adaptors) with a suitable overhanging end are then ligated to the ends of target DNA fragments using a ligase enzyme. Nucleic acid amplification is subsequently performed using oligonucleotide primers which are specific for the linker sequences. In this way, all fragments of the DNA source which are flanked by linker oligonucleotides can be amplified.
  • Direct PCR describes a system whereby PCR is performed directly on a sample without any, or with minimal, nucleic acid extraction. It has long been accepted that PCR reactions are inhibited by the presence of many components of unpurified biological samples, such as the haem component in blood. Traditionally, PCR has required extensive purification of the target nucleic acid prior to preparation of the reaction mixture. With appropriate changes to the chemistry and sample concentration, however, it is possible to perform PCR with minimal DNA purification, or direct PCR. Adjustments to the PCR chemistry for direct PCR include increased buffer strength, the use of polymerases which have high activity, ability to process, and additives.
  • Tandem PCR utilizes two distinct rounds of nucleic acid amplification to increase the probability that the correct amplicon is amplified.
  • One form of tandem PCR is nested PCR in which two pairs of PCR primers are used to amplify a single locus in separate rounds of nucleic acid amplification. The first pair of primers hybridize to the nucleic acid sequence at regions external to the target nucleic acid sequence. The second pair of primers (nested primers) used in the second round of amplification bind within the first PCR product and produce a second PCR product containing the target nucleic acid, that will be shorter than the first one.
  • Real-time PCR or quantitative PCR, is used to measure the quantity of a PCR product in real time.
  • a fluorophore-containing probe or fluorescent dyes along with a set of standards in the reaction, it is possible to quantitate the starting amount of nucleic acid in the sample. This is particularly useful in molecular diagnostics where treatment options may differ depending on the pathogen load in the sample.
  • RNA sequences are amplified, although in some instances RNA sequences can be amplified or converted into cDNA, such as by using RT PCR.
  • Reverse-transcriptase PCR (RT-PCR) is used to amplify DNA from RNA.
  • Reverse transcriptase is an enzyme that reverse transcribes RNA into complementary DNA (cDNA), which is then amplified by PCR.
  • RT-PCR is widely used in expression profiling, to determine the expression of a gene or to identify the sequence of an RNA transcript, including transcription start and termination sites. It is also used to amplify RNA viruses such as human immunodeficiency virus or hepatitis C virus.
  • cDNA or “complementary DNA” is DNA synthesized from a messenger RNA (mRNA) template in a reaction catalyzed by the enzyme reverse transcriptase and the enzyme DNA polymerase.
  • Complementary base sequences are those sequences that are related by the base-pairing rules.
  • A pairs with T and C pairs with G.
  • RNA U pairs with A and C pairs with G.
  • match and mismatch refer to the hybridization potential of paired nucleotides in complementary nucleic acid strands. Matched nucleotides hybridize efficiently, such as the classical A-T and G-C base pair mentioned above. Mismatches are other combinations of nucleotides that do not hybridize efficiently.
  • a reverse transcriptase PCRTM amplification procedure may be performed when the source of nucleic acid is fractionated or whole cell RNA.
  • Methods of reverse transcribing RNA into cDNA are well known ⁇ see Sambrook et al., 1989).
  • Alternative methods for reverse polymerization utilize thermostable DNA polymerases. These methods are described in WO 90/07641. Representative methods of RT-PCR are described in U.S. Pat. No. 5,882,864.
  • Example 1 Methods and Materials for In vitro Experiments.
  • keratinocytes were harvested or images at -75% confluency. Differentiation was induced by adding CaCl 2 to the EpiLife media to reach a final [Ca2+] of 1.2 mM. Cells were typically cultured for 3 days under differentiation conditions before they were assayed. Keratinocytes were cultured for ⁇ 5 passages. Purified Camphor (CAS #76-22-2), 2-APB (Tocris) or vehicle (1% EtOH)-containing media were used as indicated.
  • Organotypic human skin cultures and primary SCC lines were isolated from human SCCs and cultured as previously described (Bachelor et al., 2011).
  • human fibroblasts were seeded in a collagen matrix on a 70 ⁇ filter insert and incubated at 37°C for 5-7 days.
  • Human keratinocytes or SCC cells were then seeded on the apical surface of the fibroblast- collagen matrix and cultured for 2 days submerged in media to allow monolayer formation.
  • the media was then removed from the apical surface (raising), exposing the keratinocytes or SCC cells to air.
  • the cultures were maintained in this fashion for up to 14 days, and the media to the fibroblasts below was changed every 2-3 days.
  • 50 ⁇ 2- APB or vehicle (1% EtOH) was added to the media.
  • H&E Hematoxylin and Eosin
  • Axiocam color CCD camera Zeiss AxioObserver.Zl. Epidermal thickness was assessed by measuring the nucleated layers with ImageJ software (NIH ImageJ). Number of invading cells was determined by counting the number of round nuclei below the basement
  • membrane per 10X field fibroblast nuclei are flatten and were excluded.
  • Four non-serial paraffin sections per experiment were examined. Six random frames per section were quantified.
  • Ratiometric Calcium imaging Human keratinocytes and SCC cells were washed in Ringer's solution (in mM: NaCl 140, KCl 5, D-gluclose 10, HEPES 10, CaCl 2 2, MgCl 2 2, pH 7.2) and loaded with 5 ⁇ fura-2AM and 1 ⁇ pluronic (Invitrogen) for 30 minutes in the dark.
  • Ringer's solution in mM: NaCl 140, KCl 5, D-gluclose 10, HEPES 10, CaCl 2 2, MgCl 2 2, pH 7.2
  • TRP agonists 10 mM Camphor, 100 ⁇ 2-APB 1 ⁇ Capsaicin, 300 ⁇ Mustard oil or 3 ⁇ 4dPDD
  • Imaging was performed on an Olympus 1X81 microscope with a 20X (NA 0.17) objective and a Hamamatsu ORCA-R2 camera. 340- and 380-nm excitation and 540-nm emission filters were used to capture fura-2 fluorescence. Data are expressed as a ratio of fluorescent signals (340/380). All data acquisition was performed in MetaFluor. Data analysis was performed with custom algorithms in IgorPro. Cells with baseline levels +2 SD above the mean were excluded from analysis as unhealthy. Responders were designated as cells whose 340/380 ratio was ⁇ 20 above baseline.
  • Example 2 Responses to TRP-channel agonists are potentiated in differentiating human keratinocytes in vitro.
  • TRP channels are selectively activated by endogenous and exogenous ligands at micromolar to millimolar concentrations. Since TRP channel activity increases over this range to allow graded Ca 2+ influx, receptor activity levels can be monitored by live-cell Ca 2+ imaging.
  • a ratiometric calcium indicator (Fura-2) was employed to determine whether a panel of TRP- channel agonists elicited cytoplasmic calcium increases in human epidermal keratinocytes. (FIG. 1, FIG. 2, and Table 1). Normal human keratinocytes were cultured in low-calcium media to promote proliferation or in 1.2-mM calcium media to induce differentiation. For live- cell imaging, keratinocytes were then washed and bathed in Ringer's solution containing 2mM calcium so that calcium signals could be directly compared between cell populations.
  • TRPV1, TRPA1, and TRPV3 were tested to determine whether these channels were functional in normal human epidermal keratinocytes. Keratinocytes displayed little or no change in cytoplasmic calcium in response to saturating concentrations of TRPV1 or TRPA1 agonists (TRPV1, 1 ⁇
  • Capsaicin and mustard oil are high efficacy agonists that robustly activate their respective TRP-channel targets (Table 1). Therefore, proliferating human keratinocytes have only low levels of functional TRPV1 or TRPA1 in vitro.
  • TRPV1 and TRPC1 which were expressed at lower levels than TRPV3, were also upregulated in differentiated keratinocytes (FIG. 2.2(B).
  • TRPA1 was only amplified at detectable levels in one out of three biological replicates.
  • TRP channel upregulation was accompanied by increased expression of well-established early differentiation markers including keratin- 1 (KRT1), loricrin (LOR), filaggrin (FLG; FIG. 1(E); (Li et al., 1995). Therefore, differentiation stimulates TRP-channel gene expression in normal keratinocytes, which results in an increase in both the proportion of keratinocytes responding to 2-APB and camphor and the magnitude of these cytoplasmic calcium signals.
  • KRT1 keratin- 1
  • LOR loricrin
  • FLG filaggrin
  • Example 3 Camphor and 2-APB exert, pleotropic effects on human keratinocyte behavior in vitro.
  • Ca + triggers the commitment switch from proliferation to differentiation in keratinocytes
  • increasing intracellular calcium by incubating keratinocytes in TRP agonists might be sufficient to induce this cell-fate switch in low-calcium growth media.
  • normal human keratinocytes were cultured for 24 hours under low-Ca 2+ conditions in the presence of low (12.5 ⁇ ), half-maximal (50 ⁇ ) and saturating (100 ⁇ ) concentrations of 2-APB (FIG. 3(A)) or camphor (0-8 mM) (FIG. 3(E)).
  • These TRP agonists were chosen because they reliably elicited intracellular calcium signaling in normal human keratinocytes (FIG. 1).
  • 2-APB exerts activity-dependent, pleotropic effects on keratinocyte behavior.
  • Example 4 TRP-channel expression is dysregulated in high-risk human cutaneous SCCs in vitro.
  • SCC is a pathological condition marked by perturbed keratinocyte differentiation and alterations in EGFR signaling.
  • TRPV3 potently activates EGFR signaling in mouse keratinocytes (Cheng et al., 2010; Pan et al., 2011; Tajeddine & Gailly, 2012), it was
  • TRPV3, TRPV1, TRPA1, and TRPV3 were quantified in high-risk human SCC specimens. It was determined that TRPV3, TRPV1, TRPA1, and
  • TRPC1 gene expression levels were significantly dysregulated in >60 of SCC of SCC biopsies compared with normal human skin. (FIG. 5(A) and FIG. 6).
  • FIG. 5(B) To ask whether TRP channels are functional in human SCC keratinocytes, two cell lines derived from human SCC tumors (SCC- 13 and SCC-39; (Bachelor et al., 2011); FIG. 5(B) were assayed with live-cell calcium imaging. Camphor-evoked cytoplasmic calcium signals were increased in SCC- 13 cells (FIG. 5(B) compared with proliferating keratinocytes (FIG. 1(C)). Consistent with enhanced camphor-evoked responses, expression levels of TRPV3, LOR, and FLG were augmented in SCC-13 cells (FIG. 5(C). Expression levels of TRPVl, TRPCl, and TRPAl were also increased (FIG. 7).
  • SCC-39 cells showed significantly fewer camphor-evoked calcium responses compared with SCC-13 cells (FIG. 5(B)).
  • SCC-39 cells showed reduced expression levels of TRPV3, TRPVl, TRPCl, TRPAl, LOR and FLG compared with normal keratinocytes and SCC-13 cells (FIG. 5(B and FIG. 7).
  • 2-APB reduces SCC tumor growth and invasion in human preclinical models.
  • TRP-channels are expressed in human SCC keratinocytes and TRP agonists arrest keratinocyte proliferation, it was reasoned that TRP agonists might be candidates for SCC-targeted therapy.
  • organotypic human skin cultures were seeded with SCC cells.
  • SCC-39's enhanced invasiveness was consistent with its less differentiated molecular signature (FIG.
  • 2-APB treatment dramatically reduced tumorigenesis in organotypic cultures seeded with each of these three SCC cell lines.
  • 2-APB treatment inhibited cell invasion by >93% compared with vehicle-treated cultures (P ⁇ 0.0001, Bonferroni post hoc, FIG. 5(E)).
  • Tumor formation above the dermis in SCC-13 and SCC-39 was reduced by >37 (P ⁇ 0.01, Bonferroni post hoc, FIG. 5(E)).
  • Tumor quantification Tumor number and location were documented weekly. Tumor diameters were estimated using digital calipers. A lesion was classified as a papilloma based on its appearance as a non-ulcerated, fleshy pedunculated or sessile wart-like mass with a diameter in any dimension >2 mm that persisted for at least one week. In this chemical carcinogenesis model, a subset of high-risk papillomas will convert to malignant SCCs. Lesions were classified as malignant SCCs based on the following criteria: 1) conversion from a fleshy lesion to a flattened circular growth with a depressed center, 2) spontaneous ulceration (Allen et al, 2003; PMID: 12566297).
  • mice were monitored daily and euthanized when they reached one of the following IACUC-approved endpoints: 1) a tumor >20 mm in diameter in any dimension, 2) tumor ulceration that penetrates below the dermis, leading to loss of skin barrier, 3) signs of anemia for >24 h, 4) tumor burden that interferes with eating or drinking (e.g., on the mouth), or 5) gross appearance indicating distress (hunched posture, lethargy, persistent recumbence). Tissue from euthanized animals was harvested for histology and molecular analysis. Lungs and lymph nodes were examined for SCC-derived metastases.
  • Epidermal lysates were subjected to western blot analysis to measure levels of keratin 10 (K10, a keratinocyte terminal differentiation marker) and beta-tubulin (a house keeping gene used to normalize samples for protein loading). Protein levels were detected by peroxidase activated luminol exposure to X-ray film and estimated by densitometry using NIH- Image J software. Levels of K10 were normalized to levels of beta-tubulin for each sample; therefore, data are expressed as the ratio of K10 to beta-tubulin (K10/beta- tubulin). Mean protein levels between experimental groups were compared with Student's t tests (one-way, unpaired).
  • Example 6 Experiments in vivo with a mouse model of SCC
  • DMBA-TPA chemical-induced carcinogeneis mouse model
  • hyperkeratosis are consistent with TRPV3 activation, as mutations that cause constitutive TRPV3 activation lead to hyperkeratotic lesions in humans (Olmsted syndrome; Danso- Abeam et al, 2013, PMID: 23692804) and hairlessness in mice (Xaio et al, 2008 PMID:
  • topical camphor oil treatment promotes regression of pre- malignant skin tumors.
  • mice treated with camphor oil displayed apparent regressions of a subset of early-stage SCCs (FIG. 14). Such regressions were never observed in vehicle-treated control mice.
  • advanced SCCs developed, they progressed to experimental endpoints in both treatment groups. Histopathological examination of regressed SCCs revealed microscopic areas of residual tumor that resembled SCC in situ. Residual lesions in camphor oil-treated mice displayed intact fascia and muscle layers (FIG. 15, right panel). By contrast, advanced SCCs invaded the fascia and muscle layers (FIG. 15 left and middle panels).
  • Endpoint curves (FIG. 17). After 13 weeks of treatment, 75% of control mice and 50% of camphor oil-treated mice had reached an experimental endpoint; however, Kaplan-Meier survival analysis indicated that endpoint curves did not differ significantly between treatment groups (P>0.53, Mantel-Cox and Gehan-Bresholw-Wilcoxon tests; FIG. 17). Specific allowances for a survival endpoint were not incorporated into initial experimental design.
  • the effects of camphor oil were tested on the progression of pre-established skin tumors. Relatively high doses of DMBA and TPA were used to increase overall skin tumor burden and the rate of malignant conversion (SCC formation). This approach was utilized in order to generate a large number pre-malignant tumor targets for camphor treatment.
  • camphor oil treatment is highly effective at reducing the rate of malignant conversion of benign epidermal lesions to SCCs in vivo. Strikingly, camphor oil treatment appears to lead to dramatic regression of pre-established neoplastic skin lesions and these changes in tumor regression could be observed on a daily basis (FIGs 12 & 14). These findings are consistent with in vitro results described herein, which show that camphor blocks proliferation and that 2-APB induces the expression of markers of terminal differentiation in cultured human keratinocytes. Therefore, the anti-tumor effects of camphor may be due to its ability to block neoplastic proliferation in vivo and shift transformed cells to commit to terminal differentiation.
  • Example 7 Topical Camphor Treatment Promotes Keratinocyte Differentiation In vivo
  • TRPs transient receptor potential proteins
  • PSPH L-3-Phosphoserine phosphatase
  • EGF receptor provides an essential survival signal for SOS- dependent skin tumor development. Cell 102:211-220.

Landscapes

  • Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Epidemiology (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)

Abstract

L'invention concerne des agonistes de TRPV3, par exemple, le camphre naturel, l'essence de camphre qui contient des constituants monoterpène, 2-APB et des dérivés de ceux-ci, qui arrêtent la prolifération des kératinocytes humains et favorisent la différentiation. L'invention concerne des méthodes de diagnostic et de traitement ou de prévention de lésions issues de kératinocytes, par exemple SCC (carcinome squameux) (comprenant des formes à haut risque), des cancers de la peau non-mélanome (comprenant des formes à haut risque) et une kératinose actinique (« AK ») par l'administration à un sujet atteint d'une quantité thérapeutiquement efficace d'un ou plusieurs agonistes de TRPV3 ou dérivés de ceux-ci. L'invention concerne également des compositions pharmaceutiques qui contiennent des quantités thérapeutiquement efficaces d'un ou plusieurs agonistes de TRPV3 ou des dérivés de ceux-ci.
PCT/US2013/070833 2012-11-19 2013-11-19 Méthodes de traitement de lésions issues de kératinocytes WO2014078868A1 (fr)

Priority Applications (2)

Application Number Priority Date Filing Date Title
EP13855655.0A EP2919773A4 (fr) 2012-11-19 2013-11-19 Méthodes de traitement de lésions issues de kératinocytes
US14/716,865 US20160051493A1 (en) 2012-11-19 2015-05-19 Methods of treatment of keratinocyte-derived lesions

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201261728210P 2012-11-19 2012-11-19
US61/728,210 2012-11-19

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US14/716,865 Continuation-In-Part US20160051493A1 (en) 2012-11-19 2015-05-19 Methods of treatment of keratinocyte-derived lesions

Publications (1)

Publication Number Publication Date
WO2014078868A1 true WO2014078868A1 (fr) 2014-05-22

Family

ID=50731774

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2013/070833 WO2014078868A1 (fr) 2012-11-19 2013-11-19 Méthodes de traitement de lésions issues de kératinocytes

Country Status (2)

Country Link
EP (1) EP2919773A4 (fr)
WO (1) WO2014078868A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20160128933A1 (en) * 2014-11-10 2016-05-12 Tiangang Shang Therapeutic Methods and Compositions

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5476853A (en) * 1992-03-23 1995-12-19 Janssen Pharmaceutica N.V. Agent for use as an anti-irritant
US20100136533A1 (en) * 2008-12-02 2010-06-03 Korea University Industry And Academic Collaboration Foundation Compound containing farnesyl diphosphate for modulating trpv3 function and use thereof
US20110098316A1 (en) * 2008-06-17 2011-04-28 Glenmark Pharmaceuticals S.A. Chromane derivatives as trpv3 modulators
US20110196043A1 (en) * 2003-04-10 2011-08-11 Neurogesx, Inc. Methods and compositions for administration of trpv1 agonists

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2521666T3 (es) * 2006-11-29 2014-11-13 Yissum Research Development Company Of The Hebrew University Of Jerusalem, Ltd. Uso de incensol y de derivados del mismo para neuroprotección y para el tratamiento de la depresión y la ansiedad
WO2011050095A2 (fr) * 2009-10-20 2011-04-28 The General Hospital Corporation Prévention et traitement des dysfonctions cognitives postopératoires (pocd)
WO2011163308A2 (fr) * 2010-06-22 2011-12-29 The General Hospital Corporation Compositions et méthodes de prévention et de traitement de lésion et/ou de dysfonctionnement d'organe

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5476853A (en) * 1992-03-23 1995-12-19 Janssen Pharmaceutica N.V. Agent for use as an anti-irritant
US20110196043A1 (en) * 2003-04-10 2011-08-11 Neurogesx, Inc. Methods and compositions for administration of trpv1 agonists
US20110098316A1 (en) * 2008-06-17 2011-04-28 Glenmark Pharmaceuticals S.A. Chromane derivatives as trpv3 modulators
US20100136533A1 (en) * 2008-12-02 2010-06-03 Korea University Industry And Academic Collaboration Foundation Compound containing farnesyl diphosphate for modulating trpv3 function and use thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
See also references of EP2919773A4 *
YE ET AL: "DETERMINATION OF CAMPHOR AND BORMEOL IN TRADITIONAL CHINESE MEDICINES BY MICROWAVE-ASSISTED EXTRACTION AND GAS CHROMATOGRAPHY WITH FLAME IONIZATION DETECTOR ANALYTICAL LETTERS", vol. 41, pages 2387 - 2401, XP055254173 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20160128933A1 (en) * 2014-11-10 2016-05-12 Tiangang Shang Therapeutic Methods and Compositions

Also Published As

Publication number Publication date
EP2919773A1 (fr) 2015-09-23
EP2919773A4 (fr) 2016-11-02

Similar Documents

Publication Publication Date Title
US20160051493A1 (en) Methods of treatment of keratinocyte-derived lesions
US7745494B2 (en) Vitamin K for prevention and treatment of skin rash secondary to anti-EGFR therapy
JP2009079038A (ja) 表皮成長因子受容体を活性化するレチノイド療法、石鹸および他の刺激物による副作用を防止する目的での天然ｅｇｆｒ阻害剤の使用
US20140242012A1 (en) Methods for treating uv-damaged skin and scc tumors and for removing tattoos with topical ingenol mebutate
US8029770B2 (en) Caffeine salt complexes and methods for using the same in the prevention or treatment of cancer
Giacomelli et al. New insights into the anticancer activity of carnosol: p53 reactivation in the U87MG human glioblastoma cell line
EP2958549A1 (fr) Combinaisons d'indigo naturalis et de berbérine et leurs utilisations correspondantes
WO2020070239A1 (fr) Inhibiteurs de l'egfr pour traiter les kératodermies
Menezes et al. Prevention of Photocarcinogenesis by Agonists of 5-HT1A and Antagonists of 5-HT2A Receptors
EP2986983B1 (fr) Utilisation de biomarqueurs de la barrière pour l'évaluation de l'efficacité d'actifs
Gadzhigoroeva et al. COVID-19 can exacerbate pattern hair loss and trigger telogen effluvium-the role of proteoglycan replacement therapy with nourkrin® in clinical treatment of covid-19 associated hair loss
JP2018505883A (ja) 化粧品におけるペパーミント抽出物の使用
EP2919773A1 (fr) Méthodes de traitement de lésions issues de kératinocytes
US20130289023A1 (en) Method for treating brain tumor
KR20230007796A (ko) 노화 관련 질환의 예방 또는 치료용 약학 조성물
KR20200028897A (ko) Uv-유도 손상 관련 질병의 치료에서의 술포닐우레아 화합물
CN104394867A (zh) 含有嘌呤衍生物或其盐的用于预防或治疗过敏性皮肤炎的组合物
KR100571886B1 (ko) 아시아틱산을 포함하는 피부암 예방 또는 치료용 조성물
Sharquie et al. Treatment of Tinea Corporis by Topical 10% Zinc Sulfate Solution
JP6716130B2 (ja) 抗アレルギー剤
Tirado-Sánchez et al. Recurrent pityriasis versicolor: A short review of clinical features and antifungal and non-antifungal treatment options.
Gopaiah et al. Comprehensive analysis of nizatidine: Pharmacodynamics and pharmacokinetics in anti-ulcer treatment
Mohamed et al. Vitiligo: Highlights on Pathogenesis, Clinical Presentation and Treatment
WO2020101977A1 (fr) Composés d'amine éther lipidique pour le traitement topique de maladies cutanées
KR20200042283A (ko) 미네랄코티코이드 수용체 활성 저해용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13855655

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

REEP Request for entry into the european phase

Ref document number: 2013855655

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2013855655

Country of ref document: EP