WO2014076571A2 - Method for targeted modification of algae genomes - Google Patents
Method for targeted modification of algae genomes Download PDFInfo
- Publication number
- WO2014076571A2 WO2014076571A2 PCT/IB2013/002974 IB2013002974W WO2014076571A2 WO 2014076571 A2 WO2014076571 A2 WO 2014076571A2 IB 2013002974 W IB2013002974 W IB 2013002974W WO 2014076571 A2 WO2014076571 A2 WO 2014076571A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- tale
- gene
- seq
- nuclease
- genetically modified
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8213—Targeted insertion of genes into the plant genome by homologous recombination
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/12—Unicellular algae; Culture media therefor
- C12N1/125—Unicellular algae isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/52—Genes encoding for enzymes or proenzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1241—Nucleotidyltransferases (2.7.7)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/80—Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/89—Algae ; Processes using algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/07—Nucleotidyltransferases (2.7.7)
- C12Y207/07009—UTP-glucose-1-phosphate uridylyltransferase (2.7.7.9), i.e. UDP-glucose-pyrophosphorylase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y301/00—Hydrolases acting on ester bonds (3.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y301/00—Hydrolases acting on ester bonds (3.1)
- C12Y301/11—Exodeoxyribonucleases producing 5'-phosphomonoesters (3.1.11)
- C12Y301/11002—Exodeoxyribonuclease III (3.1.11.2)
Definitions
- the invention relates to a method for modifying genetic material in algal cells that includes the use of rare-cutting endonuclease to target specific sequence.
- the invention relates to a method for modifying genetic material in algal cells wherein rare-cutting endonuclease, especially a homing endonuclease or a TALE-Nuclease, is expressed over several generations to efficiently modify said target sequence.
- algal Although algae have been used as a food source by humans for centuries, the significance of their biotechnological interest, especially of microalgae, appeared only in recent decades. Applications of algal products range from simple biomass production for food, feed and fuels to valuable products such as cosmetics, pharmaceuticals, pigments, sugar polymers and food supplements.
- algal species such as Dunaliella bardawil, Haematococcus pluvialis and Chlorella vulgaris have already been exploited extensively in the past for biotechnological purposes, especially as feed, as a source of pigments like ⁇ - carotene or astaxanthin or as food supplements (Steinbrenner and Sandmann 2006; Mogedas, Casal et al. 2009).
- Most of these organisms are green algae that belonging to a group more related to land plants than other algal groups (Palmer, Soltis et al. 2004).
- Chromophytic algae on the other hand only recently moved into the forefront and their biochemistry and genetics have been studied just in the recent years.
- Diatoms are one of the most ecologically successful unicellular phytoplankton on the planet, being responsible for approximately 20% of global carbon fixation, representing a major participant in the marine food web.
- Diatoms are able to accumulate abundant amounts of lipid suitable for conversion to liquid fuels and because of their high potential to produce large quantities of lipids and good growth efficiencies, they are considered as one of the best classes of algae for renewable biofuel production.
- Diatoms have a cell wall consisting of silica (silica exoskeletons called frustules) with intricated and ornate structures on the nano- to micro-scale. These structures exceed the diversity and the complexity capable by man-made synthetic approaches, and Diatoms are being developed as a source of materials mainly for nanotechnological applications (Lusic, Radonic et al. 2006).
- diatoms are the only major group of eukaryotic phytoplankton with a diplontic life history, in which all vegetative cells are diploid and meiosis produces short-lived, haploid gametes, suggesting an ancestral selection for a life history dominated by a duplicated (diploid) genome. Therefore, in order to create algae, such as diatoms, with new properties, it is deemed necessary to target several alleles or homologous genes concomitantly to cause phenotype effect.
- the present invention relates to a method for targeted modification of the genetic material of an algal cell using rare-cutting endonucleases, especially by expressing homing endonucleases and TALE-Nuclease over several generations, in particular by stable integration of the transgenes encoding thereof on the chromosome.
- This method allows inducing targeted insertion (knock-in) or knock-out in several alleles or homologous genes in one experiment run and therefore is facilitating gene stacking.
- the present invention also encompasses genetically modified algae obtained by this method.
- Figure 1 Examples of mutagenic events induced by the PTRI20 meganuclease.
- Figure 2 Mutagenesis induced by PTRI20 meganuclease in the presence of single-chain TREX2 (SCTREX2).
- SCTREX2 single-chain TREX2
- Figure 3 Examples of mutagenic events induced by the PTRI20 meganuclease in the presence of SCTREX2.
- FIG. 4 Mutagenesis induced by PTRI02 meganuclease in the presence of single-chain TREX2 (SCTREX2). Characterization of mutagenesis events are characterized by deep sequencing. Genomic DNA of colony lysates from clones derived from the transformation with the PTRI02 meganuclease and SCTREX2 (1- 5), and clones resulting from the transformation with the empty vector alone (6-8) was analyzed. A PCR surrounding the PTRI02 specific target was performed and the percentage of mutagenesis frequency induced by the meganuclease in presence of SCTREX2 was determined by deep sequencing analysis of amplicons.
- SCTREX2 single-chain TREX2
- Figure 5 Examples of mutagenic events induced by the PTRI02 meganuclease in the presence of SCTREX2.
- Figure 6 Frequency of mutagenesis induced by YFP_TALE-Nuclease. Genomic DNA of the clones derived from transformations with TALE-Nuclease or from transformations with the empty vector was extracted. A PCR surrounding the YFP target was performed and the percentage of mutagenesis was determined by a deep sequencing analysis of amplicons centered on the specific target. A subclone resulting from clone n°2 was also analyzed.
- Figure 7 Examples of mutagenic events induced by YFP_TALE-Nuclease.
- Figure 8 Examples of a mutagenic event induced by TP07_TALE-Nuclease
- Figure 9 Example of a mutagenic event induced by TP15_TALE-Nuclease
- Figure 10 Characterization of homologous gene targeting (HGT) events by deep sequencing induced by PTRI02. Genomic DNA of 8 clones transformed with the PTRI02 meganuclease and the DNA matrix (1-8), and clones transformed with DNA matrix and the empty vector (9-10) was analyzed. The percentage of HGT frequency induced by the meganuclease in presence of a DNA matrix was determined by deep sequencing analysis of amplicons.
- HGT homologous gene targeting
- FIG 11 Characterization of homologous gene targeting (HGT) events by deep sequencing induced by PTRI20. Genomic DNA of clones transformed with the PTRI20 meganuclease and the DNA matrix (1-3), and clones transformed with DNA matrix and the empty vector (4-5) was analyzed. The percentage of HGT frequency induced by the meganuclease in presence of a DNA matrix was determined by deep sequencing analysis of amplicons.
- Figure 12 Molecular characterization of clones from the transformation of the Phaeodactylum tricornutum (Pt) strain with the TALE-Nuclease targeting the UGPase gene.
- Figure 13 Molecular characterization of clones from the transformation of the Phaeodactylum tricornutum (Pt) strain with the TALE-Nuclease targeting the UGPase gene (experiment 1 ).
- Figure 14 Molecular characterization of clones from the transformation of the Phaeodactylum tricornutum (Pt) strain with the TALE-Nuclease targeting the UGPase gene (experiment 2).
- Figure 15 Example of a mutagenic event induced by the TALE-Nuclease targeting the UDP glucose pyrophosphorylase gene.
- Figure 16 Phenotypic characterization of Phaeodactylum tricornutum (Pt) strain transformed with the TALE-Nuclease targeting the UGPase gene.
- Clone 37-7A1 100% mutated on the UGPase gene
- clone 37-3B1 from transformation with the empty vector and the Pt wild type strain were labeled with the lipid probe (Bodipy, Molecular Probe).
- the fluorescence intensity was measured by flow cytometry.
- the graphs represent the number of cells function of the fluorescence intensity for 3 independent experiments.
- FIG. 17 Mutagenesis induced by the TALE-Nuclease targeting the putative elongase gene.
- Left panel PCR realized on clone lysates from the transformations with the empty vector and the putative elongase TALE-Nuclease were performed.
- Right panel T7 assay was assessed on 4 clones resulting from the transformation with the putative elongase TALE-Nuclease and on 3 clones resulting from the transformation with the empty vector. The clone 2 is positive for the T7 assay.
- Figure 18 Example of a mutagenic event induced by the TALE-Nuclease targeting the putative elongase gene.
- Table 1 Mutagenesis induced by PTRI20 meganuclease.
- Table 2 Number of clones obtained after transformation, the number of clones that have integrated the PTRI020 meganuclease and SCTREX2 DNA sequences and the number of clones tested in the T7 assay and Deep sequencing analysis.
- the present invention concerns the use of rare-cutting endonucleases to allow efficient targeted genomic engineering of algal cells.
- the present invention relates to a method for targeted modification of the genetic material of an algal cell comprising one or several of the following steps: a) Selecting a nucleic acid target sequence in the genome of an algal cell;
- Said modified target sequence can result from NHEJ events or homologous recombination.
- the double strand breaks caused by said rare-cutting endonucleases are commonly repaired through the distinct mechanisms of homologous recombination or non-homologous end joining (NHEJ).
- NHEJ non-homologous end joining
- homologous recombination typically uses the sister chromatid of the damaged DNA as a donor matrix from which to perform perfect repair of the genetic lesion
- NHEJ is an imperfect repair process that often results in changes to the DNA sequence at the site of the double strand break.
- Mechanisms involve rejoining of what remains of the two DNA ends through direct re-ligation (Critchlow and Jackson 1998) or via the so-called microhomology-mediated end joining (Ma, Kim et al. 2003).
- the present invention relates to a method for targeted modification of the genetic material of an algal cell by expressing rare-cutting endonuclease into algal cell to induce either homologous recombination or NHEJ events.
- Said rare-cutting endonuclease according to the present invention refers to any wild type or variant enzyme capable of catalyzing the hydrolysis (cleavage) of bonds between nucleic acids within a DNA or RNA molecule, preferably a DNA molecule.
- a DNA or RNA molecule preferably a DNA molecule.
- the endonuclease according to the present invention recognizes and cleaves nucleic acid at specific polynucleotide sequences, further referred to as "nucleic acid target sequence".
- the rare-cutting endonuclease according to the invention can for example be a homing endonuclease also known as meganuclease (Paques and Duchateau 2007).
- homing endonucleases are well-known to the art (see e.g. (Stoddard, Monnat et al. 2007).
- Homing endonucleases recognize a nucleic acid target sequence and generate a single- or double-strand break.
- Homing endonucleases are highly specific, recognizing DNA target sites ranging from 12 to 45 base pairs (bp) in length, usually ranging from 14 to 40 bp in length.
- the homing endonuclease according to the invention may for example correspond to a LAGLIDADG endonuclease, to a HNH endonuclease, or to a GIY- YIG endonuclease.
- Examples of such endonuclease include l-Sce I, l-Chu I, l-Cre I, l-Csm I, Pl-Sce I, Pl-Tli I, Pl-Mtu I, l-Ceu I, l-Sce II, l-Sce III, HO, Pl-Civ I, Pl-Ctr I, Pl-Aae I, Pl-Bsu I, Pl-Dha I, Pl-Dra I, Pl-Mav I, Pl-Mch I, Pl-Mfu I, Pl-Mfl I, Pl- Mga I, Pl-Mgo I, Pl-Min I, Pl-Mka I, Pl-Mle I, Pl-Mma I, Pl-Msh I, Pl-Msm I, Pl-Mth I, Pl-Mtu I, Pl-Mxe I, Pl-Npu I, Pl-Pfu I, Pl-Rma I, Pl-Spb I, Pl-Ss
- the homing endonuclease according to the invention is a LAGLIDADG endonuclease such as l-Scel, l-Crel, l-Ceul, l-Msol, and l-Dmol.
- said LAGLIDADG endonuclease is I- Crel.
- Wild-type l-Crel is a homodimeric homing endonuclease that is capable of cleaving a 22 to 24 bp double-stranded target sequence.
- l-Crel variants may be homodimers (meganuclease comprising two identical monomers) or heterodimers (meganuclease comprising two non-identical monomers). It is understood that the scope of the present invention also encompasses the l-Crel variants per se, including heterodimers (WO2006097854), obligate heterodimers (WO2008093249) and single chain meganucleases (WO03078619 and WO2009095793) as non limiting examples, able to cleave one of the sequence targets in the algal genome. The invention also encompasses hybrid variant per se composed of two monomers from different origins (WO03078619).
- the invention encompasses both wild-type and variant endonucleases.
- the endonuclease according to the invention is a "variant" endonuclease, i.e. an endonuclease that does not naturally exist in nature and that is obtained by genetic engineering or by random mutagenesis.
- the variant endonuclease according to the invention can for example be obtained by substitution of at least one residue in the amino acid sequence of a wild-type, endonuclease with a different amino acid. Said substitution(s) can for example be introduced by site-directed mutagenesis and/or by random mutagenesis. In the frame of the present invention, such variant endonucleases remain functional, i.e.
- nucleic acid encoding the homing endonucleases used in the present invention comprise a part of nucleic acid sequence selected from the group consisting of: SEQ ID NO: 1 and SEQ ID NO: 12.
- the variant endonuclease according to the invention cleaves a target sequence that is different from the target sequence of the corresponding wild-type endonuclease. Methods for obtaining such variant endonucleases with novel specificities are well-known in the art.
- the present invention is based on the finding that such variant endonucleases with novel specificities can be used to allow efficient targeted modification of the genetic material of an algal cell, thereby considerably increasing the usability of these organisms for various biotechnological applications.
- said rare-cutting endonuclease can be a "TALE-nuclease" (TALE-Nuclease) resulting from the fusion of DNA binding domain derived from a Transcription Activator like Effector (TALE) and one nuclease domain able to cleave a DNA target sequence.
- TALE-NucleaseS are used to stimulate gene targeting and gene modifications (Boch, Scholze et al. 2009; Moscou and Bogdanove 2009; Christian, Cermak et al. 2010, WO 2011/146121).
- Said Transcription Activator like Effector corresponds to an engineered TALE comprising a plurality of TALE repeat sequences, each repeat comprising a RVD specific to each nucleotide base of a TALE recognition site.
- each TALE repeat sequence of said TALE is made of 30 to 42 amino acids, more preferably 33 or 34 wherein two critical amino acids (the so- called repeat variable dipeptide, RVD) located at positions 12 and 13 mediates the recognition of one nucleotide of said TALE binding site sequence; equivalent two critical amino acids can be located at positions other than 12 and 13 specially in TALE repeat sequence taller than 33 or 34 amino acids long.
- RVDs associated with recognition of the different nucleotides are HD for recognizing C, NG for recognizing T, Nl for recognizing A, NN for recognizing G or A, NS for recognizing A, C, G or T, HG for recognizing T, IG for recognizing T, NK for recognizing G, HA for recognizing C, ND for recognizing C, HI for recognizing C, HN for recognizing G, NA for recognizing G, SN for recognizing G or A and YG for recognizing T, TL for recognizing A, VT for recognizing A or G and SW for recognizing A.
- critical amino acids 12 and 13 can be mutated towards other amino acid residues in order to modulate their specificity towards nucleotides A, T, C and G and in particular to enhance this specificity.
- other amino acid residues is intended any of the twenty natural amino acid residues or unnatural amino acids derivatives.
- said TALE of the present invention comprises between 8 and 30 TALE repeat sequences. More preferably, said TALE of the present invention comprises between 8 and 20 TALE repeat sequences; again more preferably 15 TALE repeat sequences.
- said TALE comprises an additional single truncated TALE repeat sequence made of 20 amino acids located at the C-terminus of said set of TALE repeat sequences, i.e. an additional C-terminal half- TALE repeat sequence.
- said TALE of the present invention comprises between 8.5 and 30.5 TALE repeat sequences, ".5" referring to previously mentioned half- TALE repeat sequence (or terminal RVD, or half-repeat). More preferably, said TALE of the present invention comprises between 8.5 and 20.5 TALE repeat sequences, again more preferably, 15.5 TALE repeat sequences.
- said half- TALE repeat sequence is in a TALE context which allows a lack of specificity of said half- TALE repeat sequence toward nucleotides A, C, G, T. In a more preferred embodiment, said half- TALE repeat sequence is absent.
- said TALE of the present invention comprises TALE like repeat sequences of different origins. In a preferred embodiment, said TALE comprises TALE like repeat sequences originating from different naturally occurring TAL effectors. In another preferred embodiment, internal structure of some TALE like repeat sequences of the TALE of the present invention are constituted by structures or sequences originated from different naturally occurring TAL effectors. In another embodiment, said TALE of the present invention comprises TALE like repeat sequences. TALE like repeat sequences have a sequence different from naturally occurring TALE repeat sequences but have the same function and / or global structure within said core scaffold of the present invention.
- TALE-nuclease have been already described and used to stimulate gene targeting and gene modifications (; Christian, Cermak et al. 2010).
- Such engineered TAL-nucleases are commercially available under the trade name TALENTM (Cellectis, 8 rue de la Croix Jarry, 75013 Paris, France).
- said TALE-Nuclease according to the invention targets a sequence within a UDP-glucose pyrophosphorylase or a putative elongase gene, preferably within sequence having at least 70%, more preferably 80%, 85%, 90%, 95% identity with SEQ ID NO: 41 or SEQ ID NO: 52. More preferably, the TALE-nuclease targets a sequence having at least 70%, preferably 75%, 80%, 85%, 90%, 95% with the SEQ ID NO: 44 or 55.
- the rare-cutting endonuclease according to the invention can also be for example a chimeric Zinc-Finger nuclease (ZFN) resulting from the fusion of engineered zinc-finger domains with the nuclease catalytic domain of a restriction enzyme such as Fokl (Porteus and Carroll 2005) or a chemical endonuclease (Eisenschmidt, Lanio et al. 2005 ; Arimondo, Thomas et al. 2006; Simon, Cannata et al. 2008; Cannata, Brunet et al. 2008 ).
- ZFN Zinc-Finger nuclease
- nuclease catalytic domain is intended the protein domain comprising the active site of an endonuclease enzyme.
- Such nuclease catalytic domain can be, for instance, a “cleavage domain” or a “nickase domain”.
- cleavage domain is intended a protein domain whose catalytic activity generates a Double Strand Break (DSB) in a DNA target.
- nickase domain is intended a protein domain whose catalytic activity generates a single strand break in a DNA target sequence.
- the catalytic domain is preferably a nuclease domain and more preferably a domain having endonuclease activity, like for instance l-Tev-l, Col E7, NucA and Fok-I.
- said rare-cutting endonuclease is a monomeric TALE-Nuclease.
- a monomeric TALE-Nuclease is a TALE-Nuclease that does not require dimerization for specific recognition and cleavage, such as the fusions of engineered TAL repeats with the catalytic domain of l-Tevl described in WO2012138927.
- the invention encompasses both wild-type and variant rare-cutting endonucleases. It is understood that, rare-cutting endonuclease according to the present invention can also comprise single or plural additional amino acid substitutions or amino acid insertion or amino acid deletion introduced by mutagenesis process well known in the art. In the frame of the present invention, such variant endonucleases remain functional, i.e. they retain the capacity of recognizing and specifically cleaving a target sequence.
- rare-cutting endonuclease variants which present a sequence with high percentage of identity or high percentage of homology with sequences of rare-cutting endonuclease described in the present application, at nucleotidic or polypeptidic levels.
- high percentage of identity or high percentage of homology it is intended 70%, more preferably 75%, more preferably 80%, more preferably 85%, more preferably 90%, more preferably 95, more preferably 97%, more preferably 99% or any integer comprised between 70% and 99%.
- said rare-cutting endonuclease is expressed in an algal cell over several generations, preferably, more than 10 2 , more preferably more than 10 4 , even more preferably more than 10 6 generations.
- said vectors encoding rare-cutting endonuclease continue to be expressed during different rounds of cell division.
- efficient transient gene expression can be realized using expression vectors which require for example codon optimization and recruitment of strong promoter.
- said vector encoding rare-cutting endonuclease can be integrated into algae genome and express rare-cutting endonuclease over several generations. Standard molecular biology techniques of recombinant DNA and cloning known to those skilled in the art can be applied to carry out the methods unless otherwise specified.
- the method according to the present invention further comprises selecting transfected algae in which said gene encoding said rare-cutting endonuclease has been integrated into the genome.
- Said modified target sequence or presence of integrated gene encoding rare-cutting endonuclease within genome can be for instance identified by PCR, sequencing, southern blot assays, Northern blot and Western blot.
- few days to few weeks after transfection cells are spread and grown on solid medium then different colonies are picked and analyzed for the presence of targeted modification by PCR, sequencing, southern blot assays, Northern blot and western blot as non limiting examples.
- the modification events within target sequence can also be selected by the extinction of phenotypes or by the identification of new phenotypes resulting from these modifications.
- the method according to the present invention further comprises selecting the algal cells that display modifications in multi-copy genes or in different alleles after one run of the method according to the present invention.
- Multi-copy gene or multiple allele disruptions events can be identified by PCR, sequencing, southern blot, northern blot and western blot assays as non limiting examples.
- Multi-copy gene or multiple allele modification can also be selected by the extinction of phenotypes or by the identification of new phenotypes these multiple gene or allele modifications.
- the present invention relates to a method comprising obtaining mosaic clones comprising cells in which said target sequence has undergone different modifications.
- mosaic clones are obtained after algal cell transfection with vectors encoding rare- cutting endonuclease and spread of said transfected algal cell on solid medium.
- Each clone comprises different populations of cells in which said target sequence has undergone NHEJ event or homologous recombination or is unmodified. These populations result from the rare-cutting endonuclease expression during growth of the colony. Therefore, different modifications of the target sequence can be segregated from a single clone.
- Transformation methods require effective selection markers to discriminate successful transformants cells.
- the majority of the selectable markers include genes with a resistance to antibiotics. Therefore, vectors according to the present invention can further comprise selectable markers and said transfected algal cells are selected under selective agent.
- selection markers usable in Diatoms. (Dunahay, Jarvis et al. 1995; Zaslavskaia, Lippmeier et al. 2001) report the use of the neomycin phosphotransferase II (nptll), which inactivates G418 by phosphorylation, in Cyclotella cryptica, Navicula saprophila and Phaeodactylum tricornutum species. Falciatore, Casotti et al.
- the vector encoding for selectable marker and the vector encoding for rare-cutting endonuclease are different vectors.
- the gene encoding a rare-cutting endonuclease according to the present invention is placed under the control of a promoter.
- Suitable promoters include tissue specific and/or inducible promoters. Tissue specific promoters control gene expression in a tissue-dependent manner and according to the developmental stage of the algae. The transgenes driven by these type of promoters will only be expressed in tissues where the transgene product is desired, leaving the rest of the tissues in the algae unmodified by transgene expression. Tissue-specific promoters may be induced by endogenous or exogenous factors, so they can be classified as inducible promoters as well.
- An inducible promoter is a promoter which initiates transcription only when it is exposed to some particular (typically external) stimulus.
- Particularly preferred for the present invention are: a light-regulated promoter, nitrate reductase promoter, eukaryotic metallothionine promoter, which is induced by increased levels of heavy metals, prokaryotic lacZ promoter which is induced in response to isopropyl- ⁇ - ⁇ - thiogalacto-pyranoside (IPTG), steroid-responsive promoter, tetracycline- dependent promoter and eukaryotic heat shock promoter which is induced by increased temperature.
- IPTG isopropyl- ⁇ - ⁇ - thiogalacto-pyranoside
- vectors can be introduced into algae nuclei by, for example without limitation, electroporation, magnetophoresis.
- magnetophoresis is a nucleic acid introduction technology using the processes of magnetophoresis and nanotechnology fabrication of micro-sized linear magnets (Kuehnle et al., U. S. Patent No. 6,706,394; 2004; Kuehnle et al., U. S. Patent No.
- the transformation methods can be coupled with one or more methods for visualization or quantification of nucleic acid introduction to one or more algae. Direct microinjection of purified endonucleases of the present invention in algae can be considered.
- any means known in the art to allow delivery inside cells or subcellular compartments of agents/chemicals and molecules (proteins) can be used to introduce endonucleases in algae according to the present invention including liposomal delivery means, polymeric carriers, chemical carriers, lipoplexes, polyplexes, dendrimers, nanoparticles, emulsion, natural endocytosis or phagocytose pathway as non-limiting examples.
- said transformation construct is introduced into host cell by particle inflow gun bombardment or electroporation.
- the present invention relates to a method to target sequence insertion (knock-in) into chosen loci of the genome.
- the knock-in algae is made by transfecting said algal cell with a rare-cutting endonuclease as described above, to induce a cleavage within or adjacent to a nucleic acid target sequence, and with a donor matrix containing a transgene to introduce said transgene by a knock-in event.
- Said donor matrix comprises a sequence homologous to at least a portion of the target nucleic acid sequence, such that homologous recombination occurs between the target DNA sequence and the donor matrix.
- said donor matrix comprises first and second portions which are homologous to region 5' and 3' of the target nucleic acid, respectively.
- Said donor matrix in these embodiments also comprises a third portion positioned between the first and the second portion which comprises no homology with the regions 5' and 3' of the target nucleic acid sequence.
- a homologous recombination event is stimulated between the genome containing the target nucleic acid sequence and the donor matrix.
- homologous sequences of at least 50 bp, preferably more than 100 bp and more preferably more than 200 bp are used within said donor matrix. Therefore, the donor matrix is preferably from 200 bp to 6000 bp, more preferably from 1000 bp to 2000 bp. Indeed, shared DNA homologies are located in regions flanking upstream and downstream the site of the break and the DNA sequence to be introduced should be located between the two arms.
- said donor matrix can comprise a positive selection marker between the two homology arms and eventually a negative selection marker upstream of the first homology arm or downstream of the second homology arm.
- the marker(s) allow(s) the selection of algae having inserted the sequence of interest by homologous recombination at the target site.
- such template can be used to knock-out a gene, e.g. when the template is located within the open reading frame of said gene, or to introduce new sequences or genes of interest. This technology further increases the exploitation potential of algae by conferring them commercially desirable traits for various biotechnological applications.
- Sequence insertions by using such templates can be used to modify a targeted existing gene, by correction or replacement of said gene (allele swap as a non-limiting example), or to up- or down-regulate the expression of the targeted gene (promoter swap as non-limiting example), said targeted gene correction or replacement conferring one or several commercially desirable traits.
- the donor matrix comprising sequences sharing homologies with the regions surrounding the targeted genomic nucleic acid cleavage site in algae as defined above is included in the vector encoding said rare-cutting endonuclease.
- homologous sequences of at least 50 bp, preferably more than 100 bp and more preferably more than 200 bp are used within said donor matrix. Therefore, the donor matrix is preferably from 200 bp to 6000 bp, more preferably from 1000 bp to 2000 bp.
- the vector encoding for a rare-cutting endonuclease and the vector comprising the donor matrix are different vectors.
- the mutagenesis is increased by transfecting the cell with a further transgene coding for a catalytic domain.
- the present invention provides improved methods for ensuring targeted modification in the genetic modification of an algal cell and provides a method for increasing mutagenesis at the target nucleic acid sequence to generate at least one DNA cleavage and a loss of genetic information around said target nucleic acid sequence thus preventing any scarless re-ligation by NHEJ.
- said catalytic domain is a DNA end-processing enzyme.
- Non limiting examples of DNA end- processing enzymes include 5-3' exonucleases, 3-5' exonucleases, 5-3' alkaline exonucleases, 5' flap endonucleases, helicases, hosphatase, hydrolases and template-independent DNA polymerases.
- Non limiting examples of such catalytic domain comprise a protein domain or catalytically active derivate of the protein domain selected from the group consisting of hExol (EX01_HUMAN), Yeast Exol (EX01_YEAST), E.coli Exol, Human TREX2, Mouse TREX1 , Human TREX1 , Bovine TREX1 , Rat TREX1 , TdT (terminal deoxynucleotidyl transferase) Human DNA2, Yeast DNA2 (DNA2_YEAST).
- said catalytic domain has an exonuclease activity, in particular a 3'-5' exonuclease activity.
- said catalytic domain has TREX exonuclease activity, more preferably TREX2 activity.
- said catalytic domain is encoded by a single chain TREX polypeptide.
- said catalytic domain is fused to the N- terminus or C-terminus of said rare-cutting endonuclease.
- said catalytic domain is fused to said rare-cutting endonuclease by a peptide linker.
- Said peptide linker is a peptide sequence which allows the connection of different monomers in a fusion protein and the adoption of the correct conformation for said fusion protein activity and which does not alter the specificity of either of the monomers for their targets.
- Peptide linkers can be of various sizes, from 3 amino acids to 50 amino acids as a non limiting indicative range. Peptide linkers can also be structured or unstructured. It has been found that the coupling of the enzyme SCTREX2 with an endonuclease such as a meganuclease ensures high frequency of targeted mutagenesis in algal cells, such as diatoms.
- the present invention relates to a method for modifying target nucleic acid sequence in the plastid genome of an algal cell, comprising expressing in said algal cell, a gene encoding a rare-cutting endonuclease fused to a plastid targeting sequence required for targeting the gene product into plastid compartment.
- Plastid targeting sequences correspond to presequences consisting of a signal peptide followed by a transit peptide-like domain as described in Gruber, Vugrinec et al. 2007.
- said plastid targeting sequences comprise a conserved motif namely ASAF or AFAP (Kilian and Kroth 2005).
- said plastid targeting sequences are selected from the group consisting of SEQ ID NO: 60 to SEQ ID NO: 140.
- the present invention also encompasses a method to generate a safe algal cell that no longer carries rare-cutting endonuclease transgene in its genome after gene targeting. More particularly, in certain embodiments, the method according to the present invention comprises a further step of inactivating the gene encoding the rare-cutting endonuclease present in the genome of the modified progeny cells, in particular by cultivation of the cells without selection pressure. This loss of gene function can be correlated to loss, rearrangement, or modification of the foreign DNA sequences in the genome.
- algae or “algae cells” refer to different species of algae that can be used as host for genomic modification using the rare-cutting endonuclease of the present invention.
- Algae are mainly photoautotrophs unified primarily by their lack of roots, leaves and other organs that characterize higher plants.
- Term “algae” groups without limitation, several eukaryotic phyla, including the Rhodophyta (red algae), Chlorophyta (green algae), Phaeophyta (brown algae), Bacillariophyta (diatoms), Eustigmatophyta and dinoflagellates as well as the prokaryotic phylum Cyanobacteria (blue-green algae).
- algae includes for example algae selected from : Amphora, Anabaena, Anikstrodesmis, Botryococcus, Chaetoceros, Chlamydomonas, Chlorella, Chlorococcum, Cyclotella, Cylindrotheca, Dunaliella, Emiliana, Euglena, Hematococcus, Isochrysis, Monochrysis, Monoraphidium, Nannochloris, Nannnochloropsis, Navicula, Nephrochloris, Nephroselmis, Nitzschia, Nodularia, Nostoc, Oochromonas, Oocystis, Oscillartoria, Pavlova, Phaeodactylum, Playtmonas, Pleurochrysis, Porhyra, Pseudoanabaena, Pyramimonas, Stichococcus, Synechococcus, Synechocystis, Tetrasel
- algae are diatoms.
- Diatoms are unicellular phototrophs identified by their species-specific morphology of their amorphous silica cell wall, which vary from each other at the nanometer scale.
- Diatoms includes as non limiting examples: Phaeodactylum, Fragilariopsis, Thalassiosira, Coscinodiscus, Arachnoidiscusm, Aster omphalus, Navicula, Chaetoceros, Chorethron, Cylindrotheca fusiformis, Cyclotella, Lampriscus, Gyrosigma, Achnanthes, Cocconeis, Nitzschia, Amphora, and Odontella.
- a genetically modified algal cell obtained or obtainable by the methods described above.
- such genetically modified algal cells are characterized by the presence of a sequence encoding a rare-cutting endonuclease transgene and a modification in a targeted gene.
- a genetically modified algal cell characterized in that its genome comprise a targeted modification in more than one allele and/or in multiple copy or homologous genes. More particularly, is comprised in the scope of the present invention, a genetically modified algal cell characterized in that its genome comprise transgenes encoding a TALE-Nuclease, a TALE-Nuclease and a TREX exonuclease or a meganuclease and a TREX exonuclease. The present invention also relates a genetically modified algal cell characterized in that its genome comprises a TALE- Nuclease-induced targeted modification. In a particular embodiment, genetically modified algal cells are provided of which the genome includes a gene encoding a rare-cutting endonuclease which expression is under control of inducible promoter.
- inactivated it is meant, that the gene encodes a non-functional protein or does not express the protein.
- Inactivating a gene can be the consequence of a mutation in the gene, for instance a deletion, a substitution, or an addition of at least one nucleotide.
- the gene can also be inactivated by the insertion of a transgene in the gene of interest, particularly, by homologous recombination.
- the transgene can encode for a non functional form of the protein.
- UDP-glucose pyrophosphorylase UDP-glucose pyrophosphorylase
- putative elongase gene were inactivated in diatom strains using specific TALE-nuclease to increase lipid content.
- the UDP-glucose pyrophosphorylase gene encodes for an enzyme involved in lipid metabolism, particularly in the metabolic pathway leading to the accumulation of energy-rich storage compounds, such as chrysolaminarin ( ⁇ -1 , 3-glucan).
- the putative elongase gene is an enzyme involved in the carbon length of the fatty acids.
- the present invention relates to a genetically modified algal cell in which UDP-glucose pyrophosphorylase (UGPase) gene is inactivated, particularly the UDP-glucose pyrophosphorylase gene has at least 70%, preferably 75%, 80%, 85%, 90%, 95% identity with the sequence SEQ ID NO: 41.
- the genetically modified algal cell in which UGPase is inactivated has been obtained using TALE-nuclease, preferably TALE-nuclease which targets a sequence within the UGPase gene, more particularly a target sequence SEQ ID NO: 44.
- the present invention relates to a genetically modified algal cell in which putative elongase gene is inactivated, particularly the putative elongase gene has at least 70%, preferably 75%, 80%, 85%, 90%, 95% identity with the sequence SEQ ID NO: 52.
- the genetically modified algal cell in which putative elongase is inactivated has been obtained using TALE-nuclease, preferably TALE-nuclease which targets a sequence within the putative elongase gene, more particularly a target sequence SEQ ID NO: 55.
- said genetically modified algal cell is a diatom, more preferably a Phaeodactylum tricornutum or a Thalassiosira pseudonana.
- said genetically modified diatoms are Phaeodactylum tricornutum strains deposited within the Culture Collection of Algae and Protozoa (CCAP, Scottish Marine Institute, Oban, Argyll PA34 1QA, Scotland), on May 29 th , 2013, under depositor's strain numbers pt-37-7A1 and pt-42-1 1 B5. These strains have received acceptance numbers CCAP 1055/12 with respect to pt-37-7A1 and CCAP 1055/13 with respect to pt-42-11 B5.
- gene it is meant the basic unit of heredity, consisting of a segment of DNA arranged in a linear manner along a chromosome, which codes for a specific protein or segment of protein.
- a gene typically includes a promoter, a 5' untranslated region, one or more coding sequences (exons), optionally introns and a 3' untranslated region.
- the gene may further be comprised of terminators, enhancers and/or silencers.
- gene it is meant the entire genetic material contained in a cell such as nuclear genome, chloroplastic genome, mitochondrial genome.
- locus is the specific physical location of a DNA sequence (e.g. of a gene) on a nuclear, mitochondria or choloroplast genome.
- locus usually refers to the specific physical location of an endonuclease's target sequence.
- locus which comprises a target sequence that is recognized and cleaved by an endonuclease according to the invention, is referred to as “locus according to the invention”.
- target sequence is intended a polynucleotide sequence that can be processed by a rare-cutting endonuclease according to the present invention.
- nucleic acid target sequence is defined by the 5' to 3' sequence of one strand of said target.
- the term "transgene” refers to a sequence inserted at in an algal genome. Preferably, it refers to a sequence encoding a polypeptide. Preferably, the polypeptide encoded by the transgene is either not expressed, or expressed but not biologically active, in the algae or algal cells in which the transgene is inserted. Most preferably, the transgene encodes a polypeptide useful for increasing the usability and the commercial value of algae. Also, the transgene can be a sequence inserted in an algae genome for producing an interfering RNA.
- homologous it is meant a sequence with enough identity to another one to lead to homologous recombination between sequences, more particularly having at least 95% identity, preferably 97% identity and more preferably 99%.
- Identity refers to sequence identity between two nucleic acid molecules or polypeptides. Identity can be determined by comparing a position in each sequence which may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same base, then the molecules are identical at that position. A degree of similarity or identity between nucleic acid or amino acid sequences is a function of the number of identical or matching nucleotides at positions shared by the nucleic acid sequences. Various alignment algorithms and/or programs may be used to calculate the identity between two sequences, including FASTA, or BLAST which are available as a part of the GCG sequence analysis package (University of Wisconsin, Madison, Wis.), and can be used with, e.g., default setting.
- phenotype it is meant an algae's or a algae cell's observable traits. The phenotype includes viability, growth, resistance or sensitivity to various marker genes, environmental and chemical signals, etc...
- vector is intended to mean a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
- a vector which can be used in the present invention includes, but is not limited to, a viral vector, a plasmid, a RNA vector or a linear or circular DNA or RNA molecule which may consists of a chromosomal, non chromosomal, semi-synthetic or synthetic nucleic acids.
- Preferred vectors are those capable of autonomous replication (episomal vector) and/or expression of nucleic acids to which they are linked (expression vectors). Large numbers of suitable vectors are known to those skilled in the art and commercially available. Some useful vectors include, for example without limitation, pGEM13z.
- said vectors are expression vectors, wherein the sequence(s) encoding the rare-cutting endonuclease of the invention is placed under control of appropriate transcriptional and translational control elements to permit production or synthesis of said rare- cutting endonuclease. Therefore, said polynucleotide is comprised in an expression cassette.
- the vector comprises a replication origin, a promoter operatively linked to said polynucleotide, a ribosome-binding site, an RNA-splicing site (when genomic DNA is used), a polyadenylation site and a transcription termination site. It also can comprise an enhancer. Selection of the promoter will depend upon the cell in which the polypeptide is expressed. Preferably, when said rare-cutting endonuclease is a heterodimer, the two polynucleotides encoding each of the monomers are included in two vectors to avoid intraplasmidic recombination events.
- the two polynucleotides encoding each of the monomers are included in one vector which is able to drive the expression of both polynucleotides, simultaneously.
- the vector for the expression of the rare-cutting endonucleases according to the invention can be operably linked to an algal-specific promoter.
- the algal-specific promoter is an inducible promoter.
- the algal-specific promoter is a constitutive promoter. Promoters that can be used include, for example without limitation, a Pptcal promoter (the C02 responsive promoter of the chloroplastic carbonic anyhydrase gene, ptcal , from P.
- the vector is a shuttle vector, which can both propagate in E. coli (the construct containing an appropriate selectable marker and origin of replication) and be compatible for propagation or integration in the genome of the selected algae.
- promoter refers to a minimal nucleic acid sequence sufficient to direct transcription of a nucleic acid sequence to which it is operably linked.
- promoter is also meant to encompass those promoter elements sufficient for promoter-dependent gene expression controllable for cell- type specific expression, tissue specific expression, or inducible by external signals or agents; such elements may be located in the 5' or 3' regions of the naturally-occurring gene.
- inducible promoter it is mean a promoter that is transcriptionally active when bound to a transcriptional activator, which in turn is activated under a specific condition(s), e.g., in the presence of a particular chemical signal or combination of chemical signals that affect binding of the transcriptional activator, e.g., CO2 or N0 2 , to the inducible promoter and/or affect function of the transcriptional activator itself.
- transfection or “transformation” as used herein refer to a permanent or transient genetic change, preferably a permanent genetic change, induced in a cell following incorporation of non-host nucleic acid sequences.
- host cell refers to a cell that is transformed using the methods of the invention. In general, host cell as used herein means an algal cell into which a nucleic acid target sequence has been modified.
- catalytic domain is intended the protein domain or module of an enzyme containing the active site of said enzyme; by active site is intended the part of said enzyme at which catalysis of the substrate occurs.
- Enzymes, but also their catalytic domains are classified and named according to the reaction they catalyze.
- the Enzyme Commission number (EC number) is a numerical classification scheme for enzymes, based on the chemical reactions they catalyze (http://www.chem.qmul.ac.uk/iubmb/enzyme/).
- mutagenesis is understood the elimination or addition of at least one given DNA fragment (at least one nucleotide) or sequence, bordering the recognition sites of rare-cutting endonuclease.
- NHEJ non-homologous end joining
- NHEJ comprises at least two different processes. Mechanisms involve rejoining of what remains of the two DNA ends through direct re-ligation (Critchlow and Jackson 1998) or via the so-called microhomology-mediated end joining (Ma, Kim et al. 2003) that results in small insertions or deletions and can be used for the creation of specific gene knockouts.
- homologous recombination refers to the conserved DNA maintenance pathway involved in the repair of DSBs and other DNA lesions.
- gene targeting experiments the exchange of genetic information is promoted between an endogenous chromosomal sequence and an exogenous DNA construct.
- genes could be knocked out, knocked in, replaced, corrected or mutated, in a rational, precise and efficient manner.
- the process requires homology between the targeting construct and the targeted locus.
- homologous recombination is performed using two flanking sequences having identity with the endogenous sequence in order to make more precise integration as described in WO9011354.
- Mosaic clone is intended clone that comprises cells in which said target sequence has undergone different modifications.
- Each clone comprises different populations of cells in which said target sequence has undergone NHEJ event or homologous recombination or is unmodified. These populations result from the rare-cutting endonuclease expression during growth of the colony. Therefore, different modifications of the target sequence can be segregated from a single clone.
- Example 1 Increase of targeted mutagenesis frequency at endogenous locus using the PTRI20 meganuclease.
- one engineered meganuclease called PTRI20 encoded by the pCLS17038 plasmid (SEQ ID NO: 1) designed to cleave the DNA sequence 5'- GTTTTACGTTGTACGACGTCTAGC - 3' (SEQ ID NO: 2) was created.
- the meganuclease encoding plasmid was co- transformed with plasmid encoding selection gene (Natl) (SEQ ID NO: 3) into diatoms.
- the mutagenesis rate was measured by deep sequencing on individual clones resulting from transformations.
- Phaeodactylum tricornutum Bohlin clone CCMP2561 was grown in filtered Guillard's f/2 medium without silica (40 °° w/v Sigma Sea Salts S9883), supplemented with 1X Guillard's f/2 marine water enrichment solution (Sigma G0154) in a Sanyo incubator (model MLR-351 ) at a constant temperature (20 +/- 0.5 °C).
- the incubator is equipped with white cold neon light tubes that produce an illumination of about 120 ⁇ photons m "2 s "1 and a photoperiod of 12h light : 12h darkness (illumination period from 9AM to 9PM).
- Liquid cultures were made in ventilated cap flasks put on an orbital shaker (Polymax 1040) at a frequency of 30 revolutions min "1 and an angle of 5°.
- M17 tungstene particles (1.1 pm diameter, BioRad) were coated with 9pg of total amount of DNA containing 3pg of meganuclease encoding plasmid (pCLS17038), 3 ⁇ g natl selection plasmid (PCLS16604) (SEQ ID NO: 3) and 3pg of empty vector (pCLS0003) (SEQ ID NO: 4) using 1.25M CaCI2 and 20mM spermidine according to the manufacturer's instructions.
- beads were coated with a DNA mixture containing 3pg Natl selection plasmid (pCLS16604) and 6pg empty vector (pCLS0003).
- Agar plates with the diatoms to be transformed were positioned at 7.5cm from the stopping screen within the bombardment chamber (target shelf on position two). A burst pressure of 1550 psi and a vacuum of 25Hg/in were used. After bombardment, plates were incubated for 48 hours with a 12h light: 12h dark photoperiod.
- Resistant colonies were picked and dissociated in 20 ⁇ of lysis buffer (1 % TritonX- 100, 20mM Tris-HCI pH8, 2mM EDTA) in an eppendorf tube. Tubes were vortexed for at least 30 sec and then kept on ice for 15 min. After heating for 10 min at 85°C, tubes were cooled down at RT and briefly centrifuged to pellet cells debris. Supernatants were used immediately or stocked at 4°C. 5 ⁇ of a 1 :5 dilution in milliQ H20 of the supernatant, were used for PCR reactions.
- the PTRI20 target was amplified using specific primers flanked by adaptators needed for HTS sequencing on the 454 sequencing system (454 Life Sciences) using the primer PTRI20_For1 5'- CCATCTCATCCCTGCGTGTCTCCGACTCAG-TAG- CGGTTGTCATGGATAGCGGAGC -3' (SEQ ID NO: 5) and PTRI20_Rev1 5'- CCTATCCCCTGTGTGCCTTGGCAGTCTCAG-
- Table 1 Mutagenesis-induced by PTRI20 meganuclease.
- a lysis of the clones resulting from the transformation with the meganuclease (condition 1) or from transformation with the empty vector (condition 2) was done.
- a PCR surrounding the PTRI20 target was performed and the percentage of the mutagenesis frequency induced by the PTRI20 meganuclease was determined by deep sequencing analysis of amplicons surrounding the specific target.
- Example 2 High targeted mutagenesis frequency at endogenous locus of diatoms using the combination of SCTREX2 and PTRI20 meganuclease.
- SCTREX2 single chain TREX2
- PTRI20 encoded by the pCLS17038 plasmid (SEQ ID NO: 1) designed to cleave the DNA 5'- GTTTTACGTTGTACGACGTCTAGC - 3' (SEQ ID NO: 2) was used.
- This meganuclease was co-transformed with a plasmid encoding selection gene (Natl ) (NAT) (SEQ ID NO: 3) and with a plasmid encoding a DNA processing enzyme, called SCTREX2 encoded by the pCLS18296 (SEQ ID NO: 7).
- the mutagenesis rate was visualized by T7 assay and measured by Deep sequencing on individual clones resulting from transformation. Materials and methods
- Phaeodactylum tricornutum Bohlin clone CCMP2561 was grown and transformed according to the method described in example 1 with M17 tungstene particles (1.1 pm diameter, BioRad) coated with 9pg of total amount of DNA containing 3pg of meganuclease encoding plasmid (pCLS 17038), 3pg SCTREX2 (pCLS 18296) and 3pg Natl selection plasmid (pCLS16604) (SEQ ID NO: 3) (Condition 1 ) using 1.25M CaCI2 and 20mM spermidine according to the manufacturer's instructions.
- beads were coated with a DNA mixture containing 3pg of meganuclease encoding plasmid pCLS17038, 3pg Nat selection plasmid (pCLS16604) and 3pg empty vector (pCLS0003) (Condition 2) or 3 ⁇ ig Natl selection plasmid (pCLS16604) and 6pg empty vector (pCLS0003) (SEQ ID NO: 4) (Condition 3).
- meganuclease_For1 5'- TTAACAATTGAATCTCGCCTATTCATGGTG-3' SEQ ID NO: 8
- meganuclease_Rev1 5'- TAGCGCTCGAGTTACTAAGGAGAGGACTTTTTCTT- 3' SEQ ID NO: 9
- SCTREX2 screen SCTREX2_For1 5'- AATCTCGCCTATTCATGGTG - 3' (SEQ ID NO: 10) and SCTREX2_Rev1 5 - CCAGACCGGTCTGTGGAGGAG - 3' (SEQ ID NO: 1 1).
- PCR amplification of the PTRI20 locus was obtained with Deep sequencing primers (see list of forward and reverse primer sequences below) and genomic DNA from the colony extracts. PCR amplicons were centered on the nuclease targets and 400-500bp long, on average. The PCR products were purified on magnetic beads (Agencourt AMPure XP, Beckman Coulter) and quantified with a NanoDrop 1000 spectrophotometer (Thermo Scientific). 50ng of the amplicons were denatured and then annealed in 10 ⁇ of annealing buffer (10mM Tris-HCI pH8, 100mM NaCI, 1 mM EDTA) using an Eppendorf MasterCycle gradient PCR machine.
- annealing buffer 10mM Tris-HCI pH8, 100mM NaCI, 1 mM EDTA
- the annealing program is as follows: 95°C for 10 min; fast cooling to 85°C at 3°C/sec; and slow cooling to 25°C at 0.3°C/sec.
- the totality of the annealed DNA was digested for 15 min at 37°C with 0.5 ⁇ of the T7 Endonuclease I (I OU/ ⁇ ) (M0302 Biolabs) in a final volume of 20 ⁇ (1X NEB buffer 2, Biolabs). 10 ⁇ of the digestion were then loaded on a 10% polyacrylamide MiniProtean TBE precast gel (BioRad). After migration the gel was stained with SYBRgreen and scanned on a Gel Doc XR+ apparatus (BioRad).
- the PTRI20 target was amplified with specific primers flanked by adaptator needed for HTS sequencing on the 454 sequencing system (454 Life Sciences) using the primer PTRI20_For1 5'- CCATCTCATCCCTGCGTGTCTCCGACTCAG- TAG-CGGTTGTCATGGATAGCGGAGC -3' (SEQ ID NO: 5) and PTRI20_Rev1 5'- CCTATCCCCTGTGTGCCTTGGCAGTCTCAG-
- the clone (A) corresponding to the positive clone for both meganuclease and SCTREX2 DNA sequences was tested in T7 assay.
- Phaeodactylum tricornutum strain as well as the unique clone resulting from the transformation with the empty vector were also tested ( Figure2).
- the clone A was positive in T7 assay which reflects the presence of mutagenic events. Due to the lack of the sensitivity of the T7 assay, no signal could be detected in the 2 clones corresponding to the diatoms transformed with the PTRI20 meganuclease alone.
- the mutagenesis frequency in the clone (A) was quantified by Deep sequencing analysis.
- the coupling of the DNA processing enzyme SCTREX2 with a meganuclease is able to cleave an endogenous target (see examplel), enhances the targeted mutagenesis frequency in diatoms (up to 6.9%).
- Table2 Number of clones obtained after transformation, number of clones that have integrated the PTRI020 meganuclease and SCTREX2 DNA sequences and the number of clones tested in the T7 assay and
- Example 3 High targeted mutagenesis frequency at diatom endogenous locus using the combination SCTREX2 and PTRI02 meganuclease.
- PTRI02 encoded by the pCLS17181 plasmid (SEQ ID NO: 12) designed to cleave the DNA sequence 5' - TTTTGACGTCGTACGGTGTCTCCG- 3' (SEQ ID NO: 13) was used.
- This meganuclease encoding plasmid was co-transformed with plasmid encoding selection gene (Natl) (SEQ ID NO: 3) and with a plasmid encoding the DNA processing enzyme, SCTREX2 encoded by the pCLS18296 (SEQ ID NO: 7).
- the mutagenesis rate was measured by Deep sequencing on individual clones resulting from transformations. Materials and methods
- Phaeodactylum tricornutum Bohlin clone CCMP2561 was grown and transformed according to the method described in example 1 with M17 tungstene particles (1 .1 ⁇ diameter, BioRad) coated with 9pg of total amount of DNA containing 3pg of meganuclease encoding plasmid (pCLS17181 ), 3 ⁇ ig SCTREX2 (pCLS18296) and 3 ⁇ g Natl selection plasmid (pCLS16604) (SEQ ID NO: 3) using 1.25M CaCI2 and 20mM spermidine according to the manufacturer's instructions.
- beads were coated with a DNA mixture containing 3 g Natl selection plasmid (pCLS16604) and 6pg empty vector (pCLS0003) (SEQ ID NO: 4).
- meganuclease_For1 5'- TTAACAATTGAATCTCGCCTATTCATGGTG-3' SEQ ID NO: 8
- meganuclease_Rev1 5'- TAGCGCTCGAGTTACTAAGGAGAGGACTTTTTCTT- 3' SEQ ID NO: 9
- SCTREX2 screen SCTREX2_For1 5'- AATCTCGCCTATTCATGGTG - 3' (SEQ ID NO: 10) and SCTREX2_Rev1 5'- CCAGACCGGTCTGTGGAGGAG - 3' (SEQ ID NO: 1 1 ).
- the PTRI02 target was amplified using a 1 :5 dilution of the lysis colony with specific primers flanked by specific adaptator needed for HTS sequencing on the 454 sequencing system (454 Life Sciences) using the primer PTRI02_For1 5'- CCATCTCATCCCTGCGTGTCTCCGACTCAG-TAG-
- Example 4 High targeted mutagenesis frequency induced using TALE- Nuclease targeting reporter gene stably integrated in diatom genome.
- TALE-Nuclease To investigate the ability of a TALE-Nuclease to induce targeted mutagenesis in diatoms, one engineered TALE-Nuclease, called YFP_TALE-Nuclease encoded by the pCLS17205 (SEQ ID NO: 16) and pCLS17208 (SEQ ID NO: 17) plasmids designed to cleave the DNA sequence 5' TGAACCGCATCGAGCTGaagggcatcgacTTCAAGGAGGACGGCAA- 3' (SEQ ID NO: 18) were used.
- TALE-Nuclease encoding plasmids were co- transformed with a plasmid encoding selection gene (Natl ) into a diatom strain carrying the YFP reporter gene integrated stably in multiple copies in the genome.
- the mutagenesis frequency induced by the designated TALE-Nuclease was measured by Deep sequencing on individual clones resulting from transformations.
- Phaeodactylum tricornutum Bohlin clone CCMP2561 was grown and transformed according to the method described in example 1 with M17 tungstene particles (1.1 ⁇ diameter, BioRad) coated with 9 g of total amount of DNA containing 3 g of each monomer of TALE-Nucleases (pCLS17205 and pCLS17208) and 3Mg Natl (pCLS16604) (SEQ ID NO: 3) selection plasmid using 1.25M CaCI2 and 20mM spermidine according to the manufacturer's instructions. As negative control, beads were coated with a DNA mixture containing 3pg Natl selection plasmid (pCLS16604) and 6pg empty vector (pCLS0003) (SEQ ID NO: 4).
- the genomic DNA was extracted using ZR genomic DNA (Zymo Research) Kit and the mutagenesis frequency was determined by Deep sequencing.
- the YFP target was amplified using a 1 :7 dilution of genomic DNA, with specific primers flanked by adaptators needed for HTS sequencing on the 454 sequencing system (454 Life Sciences) using the primers YFP_For 5'- CCATCTCATCCCTGCGTGTCTCCGACTCAG-Tag-
- CTGCACCACCGGCAAGCTGCC-3' (SEQ ID NO: 19) and YFP_Rev 5'- CCTATCCCCTGTGTGCCTTGGCAGTCTCAG-CCTCGATGTTGTGGCGG-3' (SEQ ID NO: 20).
- the PCR products were purified on magnetic beads (Agencourt AMPure XP, Beckman Coulter). 5000 to 10 000 sequences per sample were analyzed. Results
- TALE nuclease induces high frequency targeted mutagenesis (up to 23%).
- TALE-Nuclease induces mutagenesis on multiple copies of the YFP reporter gene stably integrated into the diatom genome.
- Example 5 High targeted mutagenesis frequency induced using TALE- Nuclease targeting endogenous locus in the diatom Thalassiosira pseudonana
- TALE-Nuclease To investigate the ability of a TALE-Nuclease to induce targeted mutagenesis in diatoms, one engineered TALE-Nuclease, called TP07 TALE-Nuclease encoded by the pCLS20885 (SEQ ID NO: 21 ) and pCLS20886 (SEQ ID NO: 22) plasmids designed to cleave the DNA sequence 5' TGACTTTCCTCCCATGTTAGGTCCAGTGACAAGAAGGAATGAGGATGCA- 3' (SEQ ID NO: 23) witin a gene encoding for the protein ID: 21 1853 were used.
- TALE-Nuclease encoding plasmids were co-transformed with a plasmid conferring resistance to nourseothricin (NAT) in the diatom Thalassiosira pseudonana.
- NAT nourseothricin
- the mutagenesis frequency induced by the designated TALE- Nuclease was measured by Deep sequencing on individual clones resulting from the transformations.
- Thalassiosira pseudonana clone CCMP1335 was grown in filtered Guillard's f/2 medium with silica [407°° w/v Sigma Sea Salts S9883, supplemented with 1X Guillard's f/2 marine water enrichment solution (Sigma G9903, 0.03 00 w/v Na 2 Si0 3 .9H 2 0)], in a Sanyo incubator (model MLR-351) at a constant temperature (20 +/- 0.5 °C).
- the incubator is equipped with white cold neon light tubes that produce an illumination of about 120 ⁇ photons m "2 s "1 and a photoperiod of 16h light : 8h darkness (illumination period from 9AM to 1AM).
- Liquid cultures were made in vented cap flasks put on an orbital shaker (Polymax 1040, Heidolph) with a rotation speed of 30 revolutions min "1 and an angle of 5°.
- 10 8 cells were collected from exponentially growing liquid cultures (concentration about 10 6 cells/ ml) by centrifugation (3000 rpm for 10 minutes at 20°C). The supernatant was discarded and the cell pellet resuspended in 500 ⁇ of fresh f/2 medium with silica. The cell suspension was then spread on the center one-third of a 10 cm 1 % agar plate containing 40°/°° sea salts supplemented with f/2 solution with silica. Two hours later, transformation was carried out using microparticle bombardment (Biolistic PDS-1000/He Particle Delivery System, BioRad). The protocol is adapted from Falciatore et al., (1999) and Apt et al., (1999) with minor modifications.
- M17 tungsten particles (1.1 ⁇ diameter, BioRad) were coated with 9pg of a total amount of DNA composed of 3pg of each monomer of TALE-Nucleases (pCLS20885 and pCLS20886) and 3pg of the NAT (pCLS17714) (SEQ ID NO: 24) selection plasmid using 1.25M CaCI2 and 20mM spermidin according to the manufacturer's instructions.
- beads were coated with a DNA mixture containing 3pg of the NAT selection plasmid (pCLS17714) and 6pg of an empty vector (pCLS0003) (SEQ ID NO: 4).
- Agar plates with the diatoms to be transformed were positioned at 7.5cm from the stopping screen within the bombardment chamber (target shelf on position two). A burst pressure of 1550 psi and a vacuum of 20Hg/in were used. Just after bombardment, cells were gently scrapped with 1 ml of f/2 medium supplemented with silica and directly seeded in vented cap flasks containing 100ml of f/2 medium with silica. The resulting cell cultures were placed for 24h in the incubator under a 16h light: 8h darkness cycle.
- Resistant colonies were picked and dissociated in 20 ⁇ of lysis buffer (1 % TritonX- 100, 20mM Tris-HCI pH8, 2mM EDTA) in an eppendorf tube. Tubes were vortexed for at least 30 sec and then kept on ice for 15 min. After heating for 10 min at 85°C, tubes were cooled down at RT and briefly centrifuged to pellet cells debris. Supernatants were used immediately or stocked at 4°C. 5 ⁇ of a 1 :5 dilution in milliQ H2O of the supernatants, were used for each PCR reaction.
- the TP07 target was amplified using 1 :5 dilution of the lysis colony, with specific primers flanked by specific adaptator needed for HTS sequencing on the 454 sequencing system (454 Life Sciences) using the primer TP07_For 5'- CCATCTCATCCCTGCGTGTCTCCGACTCAG-Tag-GGAAGTGAGTTGCAAACAC 3' (SEQ ID NO: 25) and TP07_Rev 5'- CCTATCCCCTGTGTGCCTTGGCAGTCTCAG-CTTCAAGATGATATGAACTT -3' (SEQ ID NO: 26).
- the PCR products were purified on magnetic beads (Agencourt AMPure XP, Beckman Coulter). 5000 to 10 000 sequences per sample were analyzed.
- TALE nuclease induces targeted mutagenesis at an endogenous locus (0.05%).
- Example 6 High targeted mutagenesis frequency induced using TALE- Nuclease (TP15) targeting endogenous locus in the diatom Thalassiosira pseudonana.
- TALE-Nuclease To investigate the ability of a TALE-Nuclease to induce targeted mutagenesis in diatoms, one engineered TALE-Nuclease, called TP15_TALE-Nuclease encoded by the pCLS20726 (SEQ ID NO: 27) and pCLS20727 (SEQ ID NO: 28) plasmids designed to cleave the DNA sequence 5' TTGGGTCTTGAAGGGATGTTGTCGGGAACCACGTTGGCCATGGAGTGGA- 3' (SEQ ID NO: 29) were used.
- TALE-Nuclease encoding plasmids were co- transformed with a plasmid conferring resistance to nourseothricin (NAT) in the diatom Thalassiosira pseudonana.
- NAT nourseothricin
- the mutagenesis frequency induced by the designated TALE-Nuclease was measured by Deep sequencing on individual clones resulting from the transformations.
- Thalassiosira pseudonana clone CCMP1335 was grown and transformed according to the method described in example 5 with M17 tungstene particles (1.1 m diameter, BioRad) coated with 9pg of a total amount of DNA composed of 3pg of each monomer of TALE-Nucleases (pCLS20726 and pCLS20727) and 3pg of the NAT (pCLS17714) (SEQ ID NO: 24) selection plasmid using 1 .25M CaCI2 and 20mM spermidin according to the manufacturer's instructions.
- TP15 target was amplified using 1 :5 dilution of the lysis colony, with specific primers flanked by specific adaptator needed for HTS sequencing on the 454 sequencing system (454 Life Sciences) using the primer TP15_For 5'- CCATCTCATCCCTGCGTGTCTCCGACTCAG -Tag- AATGCCCAAAGTATACACTGT-3' (SEQ ID NO: 30) and TP15_Rev 5' CCTATCCCCTGTGTGCCTTGGCAGTCTCAG -AATTCATTATCTCCGACTCTC - 3' (SEQ ID NO: 31).
- the PCR products were purified on magnetic beads (Agencourt AMPure XP, Beckman Coulter). 5000 to 10 000 sequences per sample were analyzed. Results
- TALE nuclease induces targeted mutagenesis at an endogenous locus (0.014%).
- Example 7 Gene targeting induced by an engineered meganuclease (PTRI02) in Phaeodactylum tricornutum
- PTRI02 encoded by the pCLS17181 (SEQ ID NO: 12) plasmids designed to cleave the DNA sequence 5' -TTTTGACGTCGTACGGTGTCTCCG- 3' (SEQ ID NO: 13) was used.
- This meganuclease was co-transformed with a plasmid conferring resistance to nourseothricin (NAT) and a DNA matrix plasmid pCLS19635 (SEQ ID NO: 32) composed of two arms homologous to the targeted sequence separated by a heterologous fragment, in a wild type diatom strain.
- the individual clones resulting from the transformation were screened by PCR for the presence of gene targeting events and the homologous recombination frequency was measured by Deep sequencing.
- Phaeodactylum tricornutum Bohlin clone CCMP2561 was grown and transformed according to the methods described in example 1 with M17 tungstene particles (1.1 ⁇ diameter, BioRad) coated with 9 g of a total amount of DNA composed of 3pg of meganuclease pCLS17181 (SEQ ID NO: 12), 3pg of the NAT selection plasmid (pCLS16604) (SEQ ID NO: 3) and 3 g of the DNA matrix plasmid (pCLS19635) (SEQ ID NO: 32) using 1.25M CaCI2 and 20mM spermidin according to the manufacturer's instructions.
- beads were coated with a DNA mixture containing 3 g of the NAT selection plasmid (pCLS16604), 3pg of the DNA matrix plasmid (pCLS19635) (SEQ ID NO: 32) and 3pg of an empty vector (pCLS0003) (SEQ ID NO: 4).
- the detection of targeted integration is performed by specific PCR amplification using a primer located within the heterologous insert of the DNA repair matrix and one located on genomic sequence outside of the homology arm. 1/20 of the lysis colony was used for PCR screening.
- PTRI02_HGT_Left_For (located outside of the homology): 5'- CCGGCCAGAGTCGAATTGGCCACGTGG-3' (SEQ ID NO: 33) and lnsert_HGT_Left_Rev (located in the heterologous insert): 5'-
- PTRI02_HGT_Right_Rev (located outside of the homology): 5'- GACGACGACGAAAACGTCTTGCGTCCG -3' (SEQ ID NO: 36).
- the first PCR was performed using the primers PTRI02_HGT_Left_For: 5'- CCGGCCAGAGTCGAATTGGCCACGTGG-3'(SEQ ID NO: 33) and PTRI02_HGT_Right_Rev: 5'-GACGACGACGAAAACGTCTTGCGTCCG -3' (SEQ ID NO: 36).
- PCR product was then purified on gel and an aliquot (1/60 of the elution) was used for the nested PCR using the primers PTRI02_For 5'- CCATCTCATCCCTGCGTGTCTCCGACTCAG-TAG-
- PTRI02_For and PTRI02_Rev2 are flanked by specific adaptator needed for HTS sequencing on the 454 sequencing system (454 Life Sciences).
- the PCR products were purified on magnetic beads (Agencourt AMPure XP, Beckman Coulter).5000 to 10 000 sequences per sample were analyzed.
- Example 8 Gene targeting induced by an engineered meganuclease (PTRI20) in Phaeodactylum tricornutum
- PTRI20 encoded by the pCLS17038 (SEQ ID NO: 1) plasmids designed to cleave the DNA sequence 5' -GTTTTAC GTTGTAC G AC GTCTAG C- 3' (SEQ ID NO: 2) was used.
- This meganuclease was co-transformed with a plasmid conferring resistance to nourseothricin (NAT) and a DNA matrix plasmid pCLS19773 (SEQ ID NO: 37) composed of two arms homologous to the targeted sequence separated by a heterologous fragment, in a wild type diatom strain.
- the individual clones resulting from the transformation were screened by PCR for the presence of gene targeting events and the homologous recombination frequency was measured by Deep sequencing.
- Phaeodactylum tricornutum Bohlin clone CCMP2561 was grown CCMP2561 was grown and transformed according to the methods described in example 1 with M17 tungstene particles (1.1 pm diameter, BioRad) coated with 9pg of a total amount of DNA composed of 3 ⁇ g of meganuclease pCLS17038 (SEQ ID NO: 1), 3pg of the NAT selection plasmid (pCLS16604) (SEQ ID NO: 3) and 3pg of the DNA matrix plasmid (pCLS19773) (SEQ ID NO: 37) using 1.25M CaCI2 and 20mM spermidin according to the manufacturer's instructions.
- beads were coated with a DNA mixture containing 3 g of the NAT selection plasmid (pCLS16604), 3pg of the DNA matrix plasmid (pCLS19773) (SEQ ID NO: 37) and 3[ig of an empty vector (pCLS0003) (SEQ ID NO: 4).
- the detection of targeted integration is performed by specific PCR amplification using a primer located within the heterologous insert of the DNA repair matrix and one located on genomic sequence outside of the homology arm. 1/20 of the lysis colony was used for PCR screening.
- PTRI20_HGT_Left_For (located outside of the homology): 5'- GCAGCGTACGCAGCCATAGTCCGGAACG -3' (SEQ ID NO: 38) and lnsert_HGT_Left_Rev (located in the heterologous insert): 5'- AATTGCGGCCGCGGTCCGGCGC -3' (SEQ ID NO: 34).
- PTRI20_HGT_Right_For (located in the heterologous insert): 5'- TGTTTTACGTTGTTTAAGGCGCGCCG -3' (SEQ ID NO: 39) and PTRI20_HGT_Right_Rev (located outside of the homology): 5'- CCGCATCTCAATCACGTCTTGTTGAAGC -3' (SEQ ID NO: 40).
- the PCR product was then purified on gel and an aliquot (1/60 of the elution) was used for the nested PCR using the primers PTRI20_For 5'- CGGTTGTCATGGATAGCGGAGC -TAG-TCAGCTCCATTGGAATGTTGGC -3' (SEQ ID NO: 5) and PTRI20_Rev 5'- CCCCAGACGATTCGAAGTCGTCC - CCCTCCGACCAGGGAACTTACTC -3' (SEQ ID NO: 6).
- PTRI20_For and PTRI20_Rev are flanked by specific adaptator needed for HTS sequencing on the 454 sequencing system (454 Life Sciences).
- the PCR products were purified on magnetic beads (Agencourt AMPure XP, Beckman Coulter).5000 to 10 000 sequences per sample were analyzed.
- the homologous gene targeting frequency was determined by Deep sequencing on the 3 clones positive for HGT events and 2 clones from condition 2 negative for HGT, used here as negative control. Whereas the samples corresponding to the 3 positive clones (condition 1) present 0; 0.06 and 0.197% of HGT positive PCR fragments, this percentage is zero in the 2 samples corresponding to the condition 2, negative for HGT event screening ( Figure 1). To conclude, the use of one meganuclease able to cleave an endogenous target in combination with a DNA matrix homologous to the targeted sequence allows homologous gene targeting events in diatoms (up to 0.19%).
- Example 9 Targeted mutagenesis induced by a TALE-Nuclease targeting UDP-glucose pyrophosporylase (UGPase) gene.
- UDP-glucose pyrophosporylase UDP-glucose pyrophosporylase
- UGP TALE-Nuclease encoded by the pCLS19745 (SEQ ID NO: 42) and pCLS19749 (SEQ ID NO: 43) plasmids designed to cleave the DNA sequence 5'
- TGCCGCCTTCGAGTCGACCTATGGTAGTCTCGTCTCGGGTGATTCCGGAA- 3' SEQ ID NO: 44
- TALE-Nuclease encoding plasmids were co- transformed with a plasmid conferring resistance to nourseothricin (NAT) in a wild type diatom strain.
- NAT nourseothricin
- the individual clones resulting from the transformation were screened for the presence of mutagenic events which lead to UGPase gene inactivation.
- Phaeodactylum tricornutum Bohlin clone CCMP2561 was grown and transformed according to the method described in example 1 with M17 tungstene particles (1.1 pm diameter, BioRad) coated with 9pg of a total amount of DNA composed of 1.5pg (experiment 2) or 3pg (experiment 1) of each monomer of TALE-Nucleases (pCLS19745 and pCLS19749), 3[ig of the NAT selection plasmid (pCLS16604) (SEQ ID NO: 3) and 3pg of an empty vector (pCLS0003) (SEQ ID NO: 4) using 1.25M CaCI2 and 20mM spermidin according to the manufacturer's instructions.
- beads were coated with a DNA mixture containing 3 ⁇ g of the NAT selection plasmid (pCLS16604) and 6pg of an empty vector (pCLS0003) (SEQ ID NO: 4).
- TALE-Nuclease screens TALE-Nuclease_For 5'- AATCTCGCCTATTCATGGTG-3' (SEQ ID NO: 49) and HA_Rev 5'- TAATCTGGAACATCGTATGGG-3' (SEQ ID NO: 50) and TALE-Nuclease_For 5 - AATCTCGCCTATTCATGGTG - 3' (SEQ ID NO: 49) and STag_Rev 5'- TGTCTCTCGAACTTGGCAGCG - 3' (SEQ ID NO: 51 ).
- the UGPase target was amplified using a 1 :5 dilution of the colony lysates with sequence specific primers flanked by adaptators needed for HTS sequencing on a 454 sequencing system (454 Life Sciences) and the two following primers: UGP_For 5'- CCATCTCATCCCTGCGTGTCTCCGACTCAG-Tag-
- the PCR products were purified on magnetic beads (Agencourt AMPure XP, Beckman Coulter) and quantified with a NanoDrop 1000 spectrophotometer (Thermo Scientifioc). 50ng of the amplicons were denatured and then annealed in 10 ⁇ of the annealing buffer (10mM Tris-HCI pH8, 100mM NaCI, 1 mM EDTA) using an Eppendorf MasterCycle gradient PCR machine. The annealing program is as follows: 95°C for 10 min; fast cooling to 85°C at 3°C/sec; and slow cooling to 25°C at 0.3°C/sec.
- the totality of the annealed DNA was digested for 15 min at 37°C with 0.5 ⁇ of the T7 Endonuclease I (IOU/ ⁇ ) (M0302, Biolabs) in a final volume of 20 ⁇ (1X NEB buffer 2, Biolabs). 10 ⁇ of the digestion were then loaded on a 10% polyacrylamide MiniProtean TBE precast gel (BioRad). After migration the gel was stained with SYBRgreen and scanned on a Gel Doc XR+ apparatus (BioRad). C-Measure of the mutagenesis frequency by Deep sequencing
- the UGPase target was amplified with specific primers flanked by adaptators needed for HTS sequencing on the 454 sequencing system (454 Life Sciences) using the primer UGP_For 5'- GTTGAATCGGAATCGCTAACTCG-3' (SEQ ID NO: 47) and UGP_Rev 5'- GACTTGTTTGGCGGTCAAATCC -3' (SEQ ID NO: 48). 5000 to 10 000 sequences per sample were analyzed.
- the UGPase target amplification was performed on 1 clones obtained in the condition 1 and 2 clones obtained in the condition 2. On the 11 clones tested, 5 present no amplification of the UGPase target, 6 present a band at the wild type size ( Figure 14).
- Example 10 Targeted mutagenesis induced by a TALE-Nuclease targeting a putative elongase gene.
- elongase_TALE-Nuclease encoded by the PCLS19746 (SEQ ID NO: 53) and pCLS19750 (SEQ ID NO: 54) plasmids designed to cleave the DNA sequence 5' TCTTTTCCCTCGTCGGCatgctccggacctttCCCCAGCTTGTACACAA - 3' (SEQ ID NO: 55) was used.
- this TALE-nuclease targets a sequence coding a protein with unknown function
- this target present 86% of sequence identity with the mRNA of the fatty acid elongase 6 (ELOVL6) in Taeniopygia guttata, and 86% of sequence identity with the elongation of very long chain fatty acids protein 6-like (LOC 100542840) in meleagris gallopavo.
- ELOVL6 fatty acid elongase 6
- LOC 100542840 very long chain fatty acids protein 6-like
- TALE-Nuclease encoding plasmids were co-transformed with a plasmid conferring resistance to nourseothricin (NAT) in a wild type diatom strain.
- NAT nourseothricin
- the individual clones resulting from the transformation were screened for the presence of mutagenic events which lead to elongase gene inactivation.
- Phaeodactylum tricornutum Bohlin clone CCMP2561 was grown and transformed according to the methods described in example 1 with M17 tungstene particles (1.1 m diameter, BioRad) coated with 9[ig of a total amount of DNA composed of 1.5 g of each monomer of TALE-Nucleases (pCLS19746 (SEQ ID NO: 53) and pCLS19750 (SEQ ID NO: 54)), 3pg of the NAT selection plasmid (pCLS16604) (SEQ ID NO: 3) and 3pg of an empty vector (pCLS0003) (SEQ ID NO: 4) using 1.25M CaCI2 and 20mM spermidin according to the manufacturer's instructions.
- TALE-Nuclease screens TALE-Nuclease_For 5'- AATCTCGCCTATTCATGGTG-3' (SEQ ID NO: 49) and HA_Rev 5'- TAATCTGGAACATCGTATGGG-3' (SEQ ID NO: 50).
- the elongase target was amplified using a 1 :5 dilution of the lysis colony with sequence specific primers flanked by adaptators needed for HTS sequencing on the 454 sequencing system (454 Life Sciences) and the two following primers: elongase_For 5'- CCATCTCATCCCTGCGTGTCTCCGACTCAG-Tag- AAGCGCATCCGTTGGTTCC-3' (SEQ ID NO: 56) and elongase_Rev 5'- CCTATCCCCTGTGTGCCTTGGCAGTCTCAG TCAATGAGTTCACTGGAAAGGG -3' (SEQ ID NO: 57).
- PCR products were purified on magnetic beads (Agencourt AMPure XP, Beckman Coulter) and quantified with a NanoDrop 1000 spectrophotometer (Thermo Scientifioc). 50ng of the amplicons were denatured and then annealed in 10 ⁇ of annealing buffer (10mM Tris-HCI pH8, 100mM NaCI, 1 mM EDTA) using an Eppendorf MasterCycle gradient PCR machine. The annealing program is as follows: 95°C for 10 min; fast cooling to 85°C at 3°C/sec; and slow cooling to 25°C at 0.3°C/sec.
- the totality of the annealed DNA was digested for 15 min at 37°C with 0.5 ⁇ of the T7 Endonuclease I (IOU/ ⁇ ) (M0302 Biolabs) in a final volume of 20 ⁇ (1X NEB buffer 2, Biolabs). 10 ⁇ of the digestion were then loaded on a 10% polyacrylamide MiniProtean TBE precast gel (BioRad). After migration the gel was stained with SYBRgreen and scanned on a Gel Doc XR+ apparatus (BioRad).
- the elongase target was amplified with sequence specific primers flanked by adaptators needed for HTS sequencing on the 454 sequencing system (454 Life Sciences) using the primer elongase_For 5'- AAGCGCATCCGTTGGTTCC -3' (SEQ ID NO: 58) and Delta 6 elongase_Rev 5'- TCAATGAGTTCACTGGAAAGGG -3' (SEQ ID NO: 59). 5000 to 10 000 sequences per sample were analyzed.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Virology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Botany (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Priority Applications (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US14/442,323 US20160272980A1 (en) | 2012-11-16 | 2013-11-18 | Method for targeted modification of algae genomes |
| BR112015011190A BR112015011190A2 (pt) | 2012-11-16 | 2013-11-18 | Método de modificação dirigida e célula de alga geneticamente modificada |
| IN4148DEN2015 IN2015DN04148A (OSRAM) | 2012-11-16 | 2013-11-18 | |
| AU2013346504A AU2013346504A1 (en) | 2012-11-16 | 2013-11-18 | Method for targeted modification of algae genomes |
| CN201380070530.7A CN105121649A (zh) | 2012-11-16 | 2013-11-18 | 靶向修饰藻基因组的方法 |
| EP13834373.6A EP2920310A2 (en) | 2012-11-16 | 2013-11-18 | Method for targeted modification of algae genomes |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201261727444P | 2012-11-16 | 2012-11-16 | |
| US61/727,444 | 2012-11-16 | ||
| US201361839165P | 2013-06-25 | 2013-06-25 | |
| US61/839,165 | 2013-06-25 |
Publications (4)
| Publication Number | Publication Date |
|---|---|
| WO2014076571A2 true WO2014076571A2 (en) | 2014-05-22 |
| WO2014076571A8 WO2014076571A8 (en) | 2014-07-10 |
| WO2014076571A3 WO2014076571A3 (en) | 2014-11-06 |
| WO2014076571A9 WO2014076571A9 (en) | 2015-04-02 |
Family
ID=50231458
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IB2013/002974 Ceased WO2014076571A2 (en) | 2012-11-16 | 2013-11-18 | Method for targeted modification of algae genomes |
Country Status (7)
| Country | Link |
|---|---|
| US (1) | US20160272980A1 (OSRAM) |
| EP (1) | EP2920310A2 (OSRAM) |
| CN (1) | CN105121649A (OSRAM) |
| AU (1) | AU2013346504A1 (OSRAM) |
| BR (1) | BR112015011190A2 (OSRAM) |
| IN (1) | IN2015DN04148A (OSRAM) |
| WO (1) | WO2014076571A2 (OSRAM) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014207043A1 (en) * | 2013-06-25 | 2014-12-31 | Cellectis | Modified diatoms for biofuel production |
| WO2016168756A1 (en) | 2015-04-15 | 2016-10-20 | Synthetic Genomics, Inc. | Algal chloroplastic srp54 mutants |
| WO2019113463A1 (en) | 2017-12-08 | 2019-06-13 | Synthetic Genomics, Inc. | Improving algal lipid productivity via genetic modification of a tpr domain containing protein |
| WO2019133726A1 (en) | 2017-12-29 | 2019-07-04 | Synthetic Genomics, Inc. | Genetic modulation of photosynthetic organisms for improved growth |
| WO2023198774A1 (en) | 2022-04-14 | 2023-10-19 | Institute Of Agricultural Resources And Regional Planning Of The Chinese Academy Of Agricultural Sciences | Modified microalgae for enhanced phosphate uptade involving overexpression of psr1 and optionally underexpression of ptc1 |
| WO2024132882A1 (en) | 2022-12-19 | 2024-06-27 | Hutanbio Ltd. | Lipid producing marine microalga |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105567681B (zh) * | 2015-12-31 | 2018-08-31 | 广州赛哲生物科技股份有限公司 | 一种基于高通量基因测序无创活检病毒的方法及标签接头 |
| WO2018219619A1 (en) * | 2017-05-09 | 2018-12-06 | Cyano Biotech Gmbh | Method for modifying microcystins and nodularins |
| US11352618B2 (en) | 2018-03-23 | 2022-06-07 | Sean Raspet | Modified organisms for improved flavor and aroma |
| WO2019200318A1 (en) * | 2018-04-13 | 2019-10-17 | Sean Raspet | Modified organisms for improved flavor and aroma |
| CN112813091A (zh) * | 2021-02-03 | 2021-05-18 | 山东农业大学 | Nat1基因作为筛选标记在卵菌遗传转化中的应用 |
Citations (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4683195A (en) | 1986-01-30 | 1987-07-28 | Cetus Corporation | Process for amplifying, detecting, and/or-cloning nucleic acid sequences |
| WO1990011354A1 (fr) | 1989-03-20 | 1990-10-04 | Institut Pasteur | Procede de remplacement specifique d'une copie d'un gene present dans le genome receveur par l'integration d'un gene different de celui ou se fait l'integration |
| US5516670A (en) | 1991-09-30 | 1996-05-14 | Kuehnle; Adelheid R. | Magnetophoretic particle delivery method and apparatus for the treatment of cells |
| WO2003078619A1 (en) | 2002-03-15 | 2003-09-25 | Cellectis | Hybrid and single chain meganucleases and use thereof |
| US6706394B2 (en) | 2000-05-02 | 2004-03-16 | Manfred R. Kuehnle | Method and apparatus for manufacture of magnetizable microparticles |
| WO2006097854A1 (en) | 2005-03-15 | 2006-09-21 | Cellectis | Heterodimeric meganucleases and use thereof |
| WO2008093249A2 (en) | 2007-02-01 | 2008-08-07 | Cellectis | Obligate heterodimer meganucleases and uses thereof |
| WO2009095793A1 (en) | 2008-01-31 | 2009-08-06 | Cellectis | New i-crei derived single-chain meganuclease and uses thereof |
| WO2011064736A1 (en) | 2009-11-27 | 2011-06-03 | Basf Plant Science Company Gmbh | Optimized endonucleases and uses thereof |
| WO2011146121A1 (en) | 2010-05-17 | 2011-11-24 | Sangamo Biosciences, Inc. | Novel dna-binding proteins and uses thereof |
| WO2012017329A2 (en) | 2010-08-02 | 2012-02-09 | Cellectis S.A. | Method for targeted genomic events in algae |
| WO2012138927A2 (en) | 2011-04-05 | 2012-10-11 | Philippe Duchateau | Method for the generation of compact tale-nucleases and uses thereof |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1997039106A1 (en) * | 1996-04-12 | 1997-10-23 | Martek Biosciences Corporation | Methods and tools for transformation of eukaryotic algae |
| CN102762726A (zh) * | 2009-11-27 | 2012-10-31 | 巴斯夫植物科学有限公司 | 嵌合内切核酸酶及其用途 |
| US8608877B2 (en) * | 2010-07-27 | 2013-12-17 | General Electric Company | Nickel alloy and articles |
| US8673557B2 (en) * | 2011-02-28 | 2014-03-18 | Seattle Children's Research Institute | Coupling endonucleases with end-processing enzymes drives high efficiency gene disruption |
-
2013
- 2013-11-18 CN CN201380070530.7A patent/CN105121649A/zh active Pending
- 2013-11-18 AU AU2013346504A patent/AU2013346504A1/en not_active Abandoned
- 2013-11-18 BR BR112015011190A patent/BR112015011190A2/pt not_active Application Discontinuation
- 2013-11-18 IN IN4148DEN2015 patent/IN2015DN04148A/en unknown
- 2013-11-18 EP EP13834373.6A patent/EP2920310A2/en not_active Withdrawn
- 2013-11-18 US US14/442,323 patent/US20160272980A1/en not_active Abandoned
- 2013-11-18 WO PCT/IB2013/002974 patent/WO2014076571A2/en not_active Ceased
Patent Citations (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4683195A (en) | 1986-01-30 | 1987-07-28 | Cetus Corporation | Process for amplifying, detecting, and/or-cloning nucleic acid sequences |
| US4683195B1 (OSRAM) | 1986-01-30 | 1990-11-27 | Cetus Corp | |
| WO1990011354A1 (fr) | 1989-03-20 | 1990-10-04 | Institut Pasteur | Procede de remplacement specifique d'une copie d'un gene present dans le genome receveur par l'integration d'un gene different de celui ou se fait l'integration |
| US5516670A (en) | 1991-09-30 | 1996-05-14 | Kuehnle; Adelheid R. | Magnetophoretic particle delivery method and apparatus for the treatment of cells |
| US6706394B2 (en) | 2000-05-02 | 2004-03-16 | Manfred R. Kuehnle | Method and apparatus for manufacture of magnetizable microparticles |
| WO2003078619A1 (en) | 2002-03-15 | 2003-09-25 | Cellectis | Hybrid and single chain meganucleases and use thereof |
| WO2006097854A1 (en) | 2005-03-15 | 2006-09-21 | Cellectis | Heterodimeric meganucleases and use thereof |
| WO2008093249A2 (en) | 2007-02-01 | 2008-08-07 | Cellectis | Obligate heterodimer meganucleases and uses thereof |
| WO2009095793A1 (en) | 2008-01-31 | 2009-08-06 | Cellectis | New i-crei derived single-chain meganuclease and uses thereof |
| WO2011064736A1 (en) | 2009-11-27 | 2011-06-03 | Basf Plant Science Company Gmbh | Optimized endonucleases and uses thereof |
| WO2011146121A1 (en) | 2010-05-17 | 2011-11-24 | Sangamo Biosciences, Inc. | Novel dna-binding proteins and uses thereof |
| WO2012017329A2 (en) | 2010-08-02 | 2012-02-09 | Cellectis S.A. | Method for targeted genomic events in algae |
| WO2012138927A2 (en) | 2011-04-05 | 2012-10-11 | Philippe Duchateau | Method for the generation of compact tale-nucleases and uses thereof |
Non-Patent Citations (50)
| Title |
|---|
| "Immobilized Cells And Enzymes", 1986, IRL PRESS |
| "Manipulating the Mouse Embryo", 1986, COLD SPRING HARBOR LABORATORY PRESS |
| APT, K. E.; P. G. KROTH-PANCIC ET AL.: "Stable nuclear transformation of the diatom Phaeodactylum tricornutum", MOL GEN GENET, vol. 252, no. 5, 1996, pages 572 - 9, XP009179486 |
| ARIMONDO, P. B.; C. J. THOMAS ET AL.: "Exploring the cellular activity of camptothecin-triple-helix-forming oligonucleotide conjugates", MOL CELL BIOL, vol. 26, no. 1, 2006, pages 324 - 33, XP055108516, DOI: doi:10.1128/MCB.26.1.324-333.2006 |
| ARMBRUST, E. V.; J. A. BERGES ET AL.: "The genome of the diatom Thalassiosira pseudonana: ecology, evolution, and metabolism", SCIENCE, vol. 306, no. 5693, 2004, pages 79 - 86, XP055302056, DOI: doi:10.1126/science.1101156 |
| ARNOULD, S.; C. DELENDA ET AL.: "The I-Crel meganuclease and its engineered derivatives: applications from cell modification to gene therapy", PROTEIN ENG DES SEL, vol. 24, no. 1-2, 2011, pages 27 - 31, XP002640490, DOI: doi:10.1093/PROTEIN/GZQ083 |
| B. D. HARRIES & S. J. HIGGINS: "Nucleic Acid Hybridization", 1984 |
| B. D. HARRIES & S. J. HIGGINS: "Transcription And Translation", 1984 |
| B. PERBAL: "A Practical Guide To Molecular Cloning", 1984 |
| BAULCOMBE, D.: "RNA silencing in plants", NATURE, vol. 431, no. 7006, 2004, pages 356 - 63, XP000962079, DOI: doi:10.1038/nature02874 |
| BOCH, J.; H. SCHOLZE ET AL.: "Breaking the code of DNA binding specificity of TAL-type III effectors", SCIENCE, vol. 326, no. 5959, 2009, pages 1509 - 12 |
| BOWLER, C.; A. E. ALLEN ET AL.: "The Phaeodactylum genome reveals the evolutionary history of diatom genomes", NATURE, vol. 456, no. 7219, 2008, pages 239 - 44, XP002616144 |
| CANNATA, F.; E. BRUNET ET AL.: "Triplex-forming oligonucleotide- orthophenanthroline conjugates for efficient targeted genome modification", PROC NATL ACAD SCI U S A, vol. 105, no. 28, 2008, pages 9576 - 81 |
| CHAMPAGNE ET AL., MAGNETOPHORESIS FOR PATHWAY ENGINEERING IN GREEN CELLS. METABOLIC ENGINEERING V: GENOME TO PRODUCT, ENGINEERING CONFERENCES INTERNATIONAL LAKE TAHOE CA, 2004, pages 76 |
| CHRISTIAN, M.; T. CERMAK ET AL.: "Targeting DNA double-strand breaks with TAL effector nucleases", GENETICS, vol. 186, no. 2, 2010, pages 757 - 61, XP002632806, DOI: doi:10.1534/GENETICS.110.120717 |
| CRITCHLOW, S. E.; S. P. JACKSON: "DNA end-joining: from yeast to man", TRENDS BIOCHEM SCI, vol. 23, no. 10, 1998, pages 394 - 8, XP004146845, DOI: doi:10.1016/S0968-0004(98)01284-5 |
| D. GOEDDEL,: "Gene Expression Technology", vol. 185 |
| D. M. WEIR AND C. C. BLACKWELL: "Handbook Of Experimental Immunology", vol. I-IV, 1986 |
| DEPICKER, A.; M. V. MONTAGU: "Post-transcriptional gene silencing in plants", CURR OPIN CELL BIOL, vol. 9, no. 3, 1997, pages 373 - 82 |
| DUNAHAY, T. G.; E. E. JARVIS ET AL.: "Genetic transformation of the diatoms Cyclotella Cryptica and Navicula Saprophila", JOURNAL OF PHYCOLOQV, vol. 31, no. 6, 1995, pages 1004 - 1012, XP055012859, DOI: doi:10.1111/j.0022-3646.1995.01004.x |
| EISENSCHMIDT, K.; T. LANIO ET AL.: "Developing a programmed restriction endonuclease for highly specific DNA cleavage", NUCLEIC ACIDS RES, vol. 33, no. 22, 2005, pages 7039 - 47, XP002383230, DOI: doi:10.1093/nar/gki1009 |
| FALCIATORE, A.; R. CASOTTI ET AL.: "Transformation of Nonselectable Reporter Genes in Marine Diatoms", MAR BIOTECHNOL (NY), vol. 1, no. 3, 1999, pages 239 - 251 |
| FREDERICK M. AUSUBEL: "Current Protocols in Molecular Biology", 2000, WILEY AND SON INC |
| GALETTO, R.; P. DUCHATEAU ET AL.: "Targeted approaches for gene therapy and the emergence of engineered meganucleases", EXPERT OPIN BIOL THER, vol. 9, no. 10, 2009, pages 1289 - 303, XP009137203, DOI: doi:10.1517/14712590903213669 |
| GRUBER, A.; S. VUGRINEC ET AL.: "Protein targeting into complex diatom plastids: functional characterisation of a specific targeting motif", PLANT MOL BIOL, vol. 64, no. 5, 2007, pages 519 - 30, XP002769910, DOI: doi:10.1007/s11103-007-9171-x |
| HALLMANN, A.: "Algal transgenics and biotechnology", TRANSGENIC PLANT JOURNAL, GLOBAL SCIENCE BOKS, 2007 |
| J. ABELSON AND M. SIMON,: "Methods In ENZYMOLOGY", ACADEMIC PRESS, INC. |
| J. H. MILLER AND M. P. CALOS: "Gene Transfer Vectors For Mammalian Cells", 1987, COLD SPRING HARBOR LABORATORY |
| KILIAN, O.; P. G. KROTH: "Identification and characterization of a new conserved motif within the presequence of proteins targeted into complex diatom plastids", PLANT J, vol. 41, no. 2, 2005, pages 175 - 83 |
| LUSIC, I.; V. RADONIC ET AL.: "Is C-reactive protein a better predictor of recurrent carotid disease following carotid endarterectomy than established risk factors for atherosclerosis?", VASA, vol. 35, no. 4, 2006, pages 221 - 5 |
| M. J. GAIT: "Oligonucleotide Synthesis", 1984 |
| MA, J. L.; E. M. KIM ET AL.: "Yeast Mre11 and Rad1 proteins define a Ku- independent mechanism to repair double-strand breaks lacking overlapping end sequences", MOL CELL BIOL, vol. 23, no. 23, 2003, pages 8820 - 8 |
| MALIGA, P.: "Plastid transformation in higher plants", ANNU REV PLANT BIOL, vol. 55, 2004, pages 289 - 313, XP002321369, DOI: doi:10.1146/annurev.arplant.55.031903.141633 |
| MARCAIDA, M. J.; J. PRIETO ET AL.: "Crystal structure of I-Dmol in complex with its target DNA provides new insights into meganuclease engineering", PROC NATL ACAD SCI U S A, vol. 105, no. 44, 2008, pages 16888 - 93, XP002516753, DOI: doi:10.1073/PNAS.0804795105 |
| MARENKOVA, T. V.; E. V. DEINEKO: "Transcriptional gene silencing in plants", GENETIKA, vol. 46, no. 5, 2010, pages 581 - 92 |
| MAYER AND WALKER,: "Immunochemical Methods In Cell And Molecular Biology", 1987, ACADEMIC PRESS |
| MOGEDAS, B.; C. CASAL ET AL.: "beta-carotene production enhancement by UV-A radiation in Dunaliella bardawil cultivated in laboratory reactors", J BIOSCI BIOENG, vol. 108, no. 1, 2009, pages 47 - 51, XP026252910, DOI: doi:10.1016/j.jbiosc.2009.02.022 |
| MOSCOU, M. J.; A. J. BOGDANOVE: "A simple cipher governs DNA recognition by TAL effectors", SCIENCE, vol. 326, no. 5959, 2009, pages 1501, XP002599998 |
| PALMER, J. D.; D. E. SOLTIS ET AL.: "The plant tree of life: an overview and some points of view", AM J BOT, vol. 91, no. 10, 2004, pages 1437 - 45 |
| PAQUES, F.; P. DUCHATEAU: "Meganucleases and DNA double-strand break-induced recombination: perspectives for gene therapy", CURR GENE THER, vol. 7, no. 1, 2007, pages 49 - 66, XP002493370, DOI: doi:10.2174/156652307779940216 |
| PORTEUS, M. H.; D. CARROLL: "Gene targeting using zinc finger nucleases", NAT BIOTECHNOL, vol. 23, no. 8, 2005, pages 967 - 73, XP002467422, DOI: doi:10.1038/nbt1125 |
| POTVIN, G.; Z. ZHANG: "Strategies for high-level recombinant protein expression in transgenic microalgae: a review", BIOTECHNOL ADV, vol. 28, no. 6, 2010, pages 910 - 8, XP027331828 |
| R. I. FRESHNEY: "Culture Of Animal Cells", 1987, ALAN R. LISS, INC. |
| SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual Third Edition,", 2001, COLD SPRING HARBOR LABORATORY PRESS |
| See also references of EP2920310A2 |
| SIMON, P.; F. CANNATA ET AL.: "Sequence-specific DNA cleavage mediated by bipyridine polyamide conjugates", NUCLEIC ACIDS RES, vol. 36, no. 11, 2008, pages 3531 - 8 |
| STEINBRENNER, J.; G. SANDMANN: "Transformation of the green alga Haematococcus pluvialis with a phytoene desaturase for accelerated astaxanthin biosynthesis", APPL ENVIRON MICROBIOL, vol. 72, no. 12, 2006, pages 7477 - 84, XP008076283, DOI: doi:10.1128/AEM.01461-06 |
| STODDARD, B. L.; R. J. MONNAT ET AL.: "Advances in engineering homing endonucleases for gene targeting : ten years after structures", PROGRESS IN GENE THERAPY: AUTOLOQOUS, 2007, pages 135 - 167 |
| TYLER, B. M.; S. TRIPATHY ET AL.: "Phytophthora genome sequences uncover evolutionary origins and mechanisms of pathogenesis", SCIENCE, vol. 313, no. 5791, 2006, pages 1261 - 6, XP002735767, DOI: doi:10.1126/science.1128796 |
| ZASLAVSKAIA, L. A.; J. C. LIPPMEIER ET AL.: "Trophic conversion of an obligate photoautotrophic organism through metabolic engineering", SCIENCE, vol. 292, no. 5524, 2001, pages 2073 - 5, XP002184007, DOI: doi:10.1126/science.160015 |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014207043A1 (en) * | 2013-06-25 | 2014-12-31 | Cellectis | Modified diatoms for biofuel production |
| US10087453B2 (en) | 2013-06-25 | 2018-10-02 | Cellectis | Modified diatoms for biofuel production |
| AU2014301147B2 (en) * | 2013-06-25 | 2020-07-30 | Cellectis | Modified diatoms for biofuel production |
| WO2016168756A1 (en) | 2015-04-15 | 2016-10-20 | Synthetic Genomics, Inc. | Algal chloroplastic srp54 mutants |
| WO2019113463A1 (en) | 2017-12-08 | 2019-06-13 | Synthetic Genomics, Inc. | Improving algal lipid productivity via genetic modification of a tpr domain containing protein |
| WO2019133726A1 (en) | 2017-12-29 | 2019-07-04 | Synthetic Genomics, Inc. | Genetic modulation of photosynthetic organisms for improved growth |
| WO2023198774A1 (en) | 2022-04-14 | 2023-10-19 | Institute Of Agricultural Resources And Regional Planning Of The Chinese Academy Of Agricultural Sciences | Modified microalgae for enhanced phosphate uptade involving overexpression of psr1 and optionally underexpression of ptc1 |
| WO2024132882A1 (en) | 2022-12-19 | 2024-06-27 | Hutanbio Ltd. | Lipid producing marine microalga |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2014076571A9 (en) | 2015-04-02 |
| IN2015DN04148A (OSRAM) | 2015-10-16 |
| CN105121649A (zh) | 2015-12-02 |
| WO2014076571A8 (en) | 2014-07-10 |
| WO2014076571A3 (en) | 2014-11-06 |
| BR112015011190A2 (pt) | 2017-10-03 |
| EP2920310A2 (en) | 2015-09-23 |
| US20160272980A1 (en) | 2016-09-22 |
| AU2013346504A1 (en) | 2015-06-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20160272980A1 (en) | Method for targeted modification of algae genomes | |
| EP3080275B1 (en) | Method of selection of transformed diatoms using nuclease | |
| US10087453B2 (en) | Modified diatoms for biofuel production | |
| JP2018530352A (ja) | 細胞内での遺伝子組換えおよび相同組換えの増加のための保護dna鋳型および使用方法 | |
| KR20180002852A (ko) | 가이드 RNA/Cas 엔도뉴클레아제 시스템 | |
| AU2011287293B2 (en) | Method for targeted genomic events in algae | |
| US11332764B2 (en) | Microorganisms having increased lipid productivity | |
| US20170121742A1 (en) | Algal mutants with increased lipid productivity | |
| US11124798B2 (en) | Algal lipid productivity via genetic modification of a TPR domain containing protein | |
| JP2021505144A (ja) | シグナル伝達タンパク質の遺伝子改変を介した藻類脂質生産性の改善方法 | |
| WO2012158778A1 (en) | Doubly secure transgenic algae or cyanobacteria strains to prevent their establishment and spread in natural ecosystems |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 13834373 Country of ref document: EP Kind code of ref document: A2 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 14442323 Country of ref document: US |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2013834373 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2013346504 Country of ref document: AU Date of ref document: 20131118 Kind code of ref document: A |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112015011190 Country of ref document: BR |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01E Ref document number: 112015011190 Country of ref document: BR |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01Y Ref document number: 112015011190 Country of ref document: BR Kind code of ref document: A2 |
|
| ENP | Entry into the national phase |
Ref document number: 112015011190 Country of ref document: BR Kind code of ref document: A2 Effective date: 20150515 |