WO2014066851A1 - Oligonucléotides antisens c-myc et ses procédés d'utilisation pour le traitement de troubles de la prolifération cellulaire - Google Patents

Oligonucléotides antisens c-myc et ses procédés d'utilisation pour le traitement de troubles de la prolifération cellulaire Download PDF

Info

Publication number
WO2014066851A1
WO2014066851A1 PCT/US2013/066960 US2013066960W WO2014066851A1 WO 2014066851 A1 WO2014066851 A1 WO 2014066851A1 US 2013066960 W US2013066960 W US 2013066960W WO 2014066851 A1 WO2014066851 A1 WO 2014066851A1
Authority
WO
WIPO (PCT)
Prior art keywords
oligonucleotide
seq
linkages
myc
mrna
Prior art date
Application number
PCT/US2013/066960
Other languages
English (en)
Inventor
Sergei M. Gryaznov
Daria Zielinska
Ronald A. Pruzan
Jeffrey N. LINDQUIST
Original Assignee
Geron Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US13/829,594 external-priority patent/US9228189B2/en
Application filed by Geron Corporation filed Critical Geron Corporation
Priority to EP13849097.4A priority Critical patent/EP2912179A4/fr
Priority to CA2887702A priority patent/CA2887702C/fr
Publication of WO2014066851A1 publication Critical patent/WO2014066851A1/fr
Priority to HK16102007.9A priority patent/HK1214293A1/zh

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1135—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against oncogenes or tumor suppressor genes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7125—Nucleic acids or oligonucleotides having modified internucleoside linkage, i.e. other than 3'-5' phosphodiesters
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C12N2310/111—Antisense spanning the whole gene, or a large part of it
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/314—Phosphoramidates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/345—Spatial arrangement of the modifications having at least two different backbone modifications
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/351—Conjugate
    • C12N2310/3515—Lipophilic moiety, e.g. cholesterol
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/351—Conjugate
    • C12N2310/3517—Marker; Tag

Definitions

  • This invention relates to antisense c-myc oligonucleotides having specific
  • internucleoside subunit linkages and methods for using the same for the treatment of cancer and other cell proliferative disorders.
  • ODNs antisense oligodeoxynucleotides
  • the c-myc protein is a member of the helix- loop-helix/leucine zipper (HLH/LZ)1 family of transcription factors that forms heterodimers with Max (Ayer & Eisenman, Genes Devel. 7:2110-2119, 1993).
  • HHL/LZ helix- loop-helix/leucine zipper
  • trans-activating Myc:Max heterodimers are found in proliferating cells, while trans-repressing Mad:Max heterodimers are found in differentiated cells.
  • C-myc protein level influences cell proliferation, differentiation, and neoplastic transformation, presumably by affecting the balance between Myc:Max and Mad:Max heterodimers (Spencer & Groudine, Adv. Cancer. Res. 56: 1-48, 1991).
  • c-myc protein When c-myc protein is overexpressed or is induced at inappropriate times, this balance is perturbed, and cell proliferation and differentiation are disrupted. For example, c-myc overexpression prevents or delays cell differentiation (Coppola & Cole, Nature 320:760-763, 1986). It also blocks serum-starved cells from entering the Ga phase of the cell cycle and instead induces them to undergo apoptosis. Overexpression of c-myc has also been implicated in tumor formation in experimental animals and in human patients with Burkitt's lymphoma (Klein, Genes, Chromosomes, Cancer 1 :3-8, 1989). These and other deleterious consequences of aberrant c-myc expression highlight the importance of proper c-myc gene regulation and how unregulated expression of this gene can result in cell proliferative disorders.
  • antisense ODNs Given the specificity of antisense ODNs toward their mRNA targets and the role played by c-myc overexpression in cancer, what is needed, therefore, is an antisense ODN therapeutic capable of decreasing or eliminating c-myc protein expression in proliferating cells expressing c-myc mRNA and protein.
  • the invention provided herein discloses, inter alia, compositions and methods for the fabrication and use of c-myc antisense oligonucleotides for the treatment of cell proliferative disorders.
  • oligonucleotides comprising a sequence complementary to an mRNA from a c-myc gene, wherein the nucleoside subunits of the oligonucleotide are joined by intersubunit linkages, wherein at least one of the intersubunit linkages is a thiophosphoramidate linkage, wherein the oligonucleotide is about 6 to about 30 nucleotides, or about 6 to about 20 nucleotides in length, and wherein the oligonucleotide prevents translation of the mRNA by steric hindrance.
  • about 20% to about 90% of the intersubunit linkages are thiophosphoramidate linkages.
  • 100% of the intersubunit linkages are thiophosphoramidate linkages.
  • oligonucleotides comprising a sequence complementary to an mRNA from a c-myc gene, wherein the nucleoside subunits of the oligonucleotide are joined by intersubunit linkages, wherein the oligonucleotide comprises alternating thiophosphoramidate or phosphoramidate and thiophosphate or phosphate intersubunit linkages, wherein the oligonucleotide is about 6 to about 30 nucleotides, or about 6 to about 20 nucleotides in length, and wherein the oligonucleotide is a substrate for RNase-H- mediated degradation of the mRNA from a c-myc gene or wherein the oligonucleotide prevents translation of the mRNA by steric hindrance.
  • the oligonucleotide comprises alternating thiophosphoramidate and thiophosphate linkages. In some embodiments, the oligonucleotide comprises alternating thiophosphoramidate and phosphate linkages. In some embodiments, the oligonucleotide comprises alternating phosphoramidate and thiophosphate linkages. In some embodiments, the oligonucleotide comprises alternating phosphoramidate and phosphate linkages. In some embodiments, the oligonucleotide comprises at least about 45% to 55% thiophosphoramidate linkages.
  • the oligonucleotide comprises at least about 45% to 55% phosphoramidate linkages. In some embodiments of any of the embodiments herein, contacting the oligonucleotide with a proliferating cell decreases relative c-myc protein expression in the cell by at least about 50% in comparison to cells that have not been contacted with the oligonucleotide. In some
  • contacting any of the oligonucleotides disclosed herein with a population of proliferating cells decreases the relative cell growth rate of the population of cells by greater than 50% in comparison to cells that have not been contacted with the oligonucleotide.
  • oligonucleotides comprising a sequence complementary to an mRNA from a c-myc gene, wherein the nucleoside subunits of the oligonucleotide are joined by intersubunit linkages, wherein the oligonucleotide comprises two or more contiguous thiophosphoramidate linkages located on both the 5' and 3' ends of the oligonucleotide, wherein the oligonucleotide is about 6 to about 30 nucleotides, or about 6 to about 20 nucleotides in length, and wherein the oligonucleotide is a substrate for RNase-H- mediated degradation of the mRNA from a c-myc gene.
  • the nucleoside subunits of the oligonucleotide are joined by intersubunit linkages
  • the oligonucleotide comprises two or more contiguous thiophosphoramidate linkages located on both the 5' and 3' ends of the oligonu
  • oligonucleotide further comprises two or more contiguous thiophosphate or phosphate linkages located in between the two or more contiguous thiophosphoramidate linkages located on both the 5' and 3' ends of the oligonucleotide.
  • the oligonucleotide comprises four contiguous thiophosphoramidate linkages located on the 5' end of the oligonucleotide, five contiguous thiophosphoramidate linkages located on the 3' end of the oligonucleotide, and six contiguous thiophosphate or phosphate linkages located between the four contiguous thiophosphoramidate linkages located on the 5' end of the oligonucleotide and the five contiguous thiophosphoramidate linkages located on the 3' end of the oligonucleotide.
  • contacting the oligonucleotide with a proliferating cell decreases relative c-myc protein expression in the cell by at least about 50% in comparison to cells that have not been contacted with the oligonucleotide. In some embodiments of any of the embodiments herein, contacting any of the oligonucleotides disclosed herein with a population of proliferating cells decreases the relative cell growth rate of the population of cells by greater than 50% in comparison to cells that have not been contacted with the
  • the oligonucleotide is at least 95% complementary to an mRNA from a c-myc gene at the site of the mRNA's translation initiation region. In some embodiments of any of the embodiments herein, the oligonucleotide comprises the sequence ACGTTGAGGGGCAT (SEQ ID NO: 15). In some embodiments of any of the embodiments herein, the oligonucleotide comprises the sequence TCGTCGCGGGAGGCTG (SEQ ID NO: 16).
  • the oligonucleotide comprises the sequence AACGTTGAGGGGCAT (SEQ ID NO:l), UAACGTTGAGGGGCA (SEQ ID NO:2), T AACGTTGAGGGGCAT (SEQ ID NO:3), or TTTCATTGTTTTCCA (SEQ ID NO:4), CTCGTCGTTTCCGCAACAAG (SEQ ID NO:6), ACGTTGAGGGGCATCGTCGC (SEQ ID NO:7), AACGTTGAGGGGCATCGTCG (SEQ ID NO:8), CTGCTGTCGTTGAGAGGGTA (SEQ ID NO:9),
  • GGCATCGTCGCGGGAGGCTG SEQ ID NO: 11
  • TCGTCGCGGGAGGCTGCTGG SEQ ID NO: 12
  • CCGCCCGCTCGCTCCCTCTG SEQ ID NO: 13
  • oligonucleotides comprising a sequence complementary to an mRNA from a c-myc gene, wherein the nucleoside subunits of the oligonucleotide are joined by intersubunit linkages, wherein the oligonucleotide comprises two or more contiguous thiophosphoramidate linkages located on both the 5' and 3' ends of the oligonucleotide, wherein the oligonucleotide is about 6 to about 30 nucleotides, or about 6 to about 20 nucleotides in length, and wherein the oligonucleotide is a substrate for RNase-H- mediated degradation of the mRNA from a c-myc gene and/or prevents translation of the mRNA by steric hindrance.
  • the oligonucleotide further comprises two or more contiguous thiophosphate or phosphate linkages located in between the two or more contiguous thiophosphoramidate linkages located on both the 5' and 3' ends of the oligonucleotide.
  • the oligonucleotide comprises five contiguous thiophosphoramidate linkages located on the 5' end of the oligonucleotide, four contiguous thiophosphoramidate linkages located on the 3' end of the oligonucleotide, and six contiguous thiophosphate or phosphate linkages located between the five contiguous thiophosphoramidate linkages located on the 5' end of the oligonucleotide and the four contiguous thiophosphoramidate linkages located on the 3' end of the oligonucleotide.
  • the oligonucleotide is at least 95% complementary to an mRNA from a c-myc gene at the site of the mRNA's translation initiation region. In some embodiments of any of the embodiments herein, the oligonucleotide comprises the sequence ACGTTGAGGGGCAT (SEQ ID NO: 15). In some embodiments of any of the embodiments herein, the oligonucleotide comprises the sequence TCGTCGCGGGAGGCTG (SEQ ID NO: 16).
  • the oligonucleotide comprises the sequence AACGTTGAGGGGCAT (SEQ ID NO:l), UAACGTTGAGGGGCA (SEQ ID NO:2), T AACGTTGAGGGGCAT (SEQ ID NO:3), or TTTCATTGTTTTCCA (SEQ ID NO:4), CTCGTCGTTTCCGCAACAAG (SEQ ID NO:6), ACGTTGAGGGGCATCGTCGC (SEQ ID NO:7), AACGTTGAGGGGCATCGTCG (SEQ ID NO:8), CTGCTGTCGTTGAGAGGGTA (SEQ ID NO:9),
  • GGCATCGTCGCGGGAGGCTG SEQ ID NO: 11
  • TCGTCGCGGGAGGCTGCTGG SEQ ID NO: 12
  • CCGCCCGCTCGCTCCCTCTG SEQ ID NO: 13
  • oligonucleotides comprising a sequence complementary to an mRNA from a c-myc gene, wherein the nucleoside subunits of the oligonucleotide are joined by intersubunit linkages, wherein the oligonucleotide is a substrate for RNase-H-mediated degradation of the mRNA from a c-myc gene, and wherein the oligonucleotide comprises at least two contiguous phosphoramidate intersubunit linkages located on the 5' end of the oligonucleotide; wherein the oligonucleotide comprises at least two contiguous phosphoramidate intersubunit linkages located on the 3' end of the oligonucleotide; wherein the oligonucleotide comprises 2-11 contiguous thiophosphate or phosphate linkages located in between said at least two contiguous phosphoramidate linkages located on the 5' end and said at least two
  • oligonucleotide with a proliferating cell decreases relative c-myc protein expression in the cell by at least about 50% in comparison to cells that have not been contacted with the
  • oligonucleotide In some embodiments, contacting any of the oligonucleotides disclosed herein with a population of proliferating cells decreases the relative cell growth rate of the population of cells by greater than 50% in comparison to cells that have not been contacted with the oligonucleotide.
  • the oligonucleotide further comprises one or more lipid or cholesterol moieties. In some embodiments of any of the embodiments herein, the one or more lipid or cholesterol moieties are connected to the oligonucleotide via a linker.
  • the one or more lipid or cholesterol moieties is/are located on the 5' end of the oligonucleotide, the 3' end of the oligonucleotide, or both the 5' and 3' ends of the oligonucleotide.
  • the lipid or the cholesterol moiety is located on the 5' end of the oligonucleotide.
  • the lipid moiety comprises a Caprylic acid, a Capric acid, a Erasmus acid, a Myristic acid, a Palmitic acid, a Stearic acid, a Arachidic acid, a Behenic acid, a Lignoceric acid, or a Cerotic acid.
  • the lipid moiety comprises a Palmitic acid.
  • the oligonucleotide further comprises a fluorescent dye label.
  • the fluorescent dye label is tetramethylrhodamine (TAMRA).
  • compositions comprising one or more of any of the oligonucleotides disclosed herein.
  • the pharmaceutical compositions further comprise a pharmaceutically acceptable carrier.
  • the composition is formulated for oral, intravenous, subcutaneous, intramuscular, topical, intraperitoneal, intranasal, inhalation, intratumor, or intraocular administration.
  • a cell proliferative disorder in an individual in need thereof comprising: administering to the individual a therapeutically effective amount of one or more of the oligonucleotides disclosed herein or a pharmaceutical composition disclosed herein, wherein administration of one or more of the oligonucleotides relieves at least one symptom of the cell proliferative disorder.
  • the cell proliferative disorder is cancer.
  • the cancer is liver cancer or a cancer resulting from B-cell proliferation.
  • administration of the therapeutically effective amount of one or more of the oligonucleotides comprises contacting one or more cancer cells with the oligonucleotides. In some embodiments of any of the embodiments herein, administration of the therapeutically effective amount of one or more of the oligonucleotides results in one or more of reduced cellular proliferation, increased apoptosis, or cellular senescence. In some embodiments of any of the embodiments herein, administration of the therapeutically effective amount of one or more of the oligonucleotides does not result in significant toxicity or morbidity in the individual.
  • the method further comprises administering to the individual a therapeutically effective amount of one or more additional cancer therapeutic agents.
  • the oligonucleotides or the pharmaceutical composition is/are administered orally, intravenously, subcutaneously, intramuscularly, topically, intraperitoneally, intranasaly, intradermally, by inhalation, intratumorally, or intraocularly.
  • the individual is human.
  • kits comprising: one or more of the
  • oligonucleotides disclosed herein and/or one or more of the pharmaceutical compositions disclosed herein.
  • Figure 1 depicts inhibition of proliferation of HepG2 liver cancer cells due to anti-c- myc oligonucleotides in vitro.
  • A Percentage of relative growth of HepG2 cells treated with AS ODNs for four or six days.
  • B Percentage of relative growth of HepG2 cells treated with AS ODNs for four, six, or eight days. Cell growth is normalized to untreated controls.
  • Figure 2 depicts Western blot analyses of c-myc protein levels in HepG2 cells treated in vitro with antisense c-myc oligonucleotides, sense controls, or untreated controls for one (A), two (B), and three (C) days at 1 ⁇ versus untreated controls.
  • the three day experiment depicted in (C) also utilized the HepG2-Luc cells utilized in the in vivo tumor regression and prevention experiments for determining c-myc protein level following treatment with antisense c-myc oligonucleotides (see Example 3).
  • HSP90 was utilized as a loading control and relative protein expression was normalized versus untreated (Unt) controls.
  • D c-myc protein expression in cells treated with AS ODNs 16, 18, 20 at 5 ⁇ for four and five days in comparison to untreated controls.
  • Figure 3 depicts inhibition of proliferation and Western blot analyses of c-myc protein levels in VAL follicular lymphoma cells treated with anti-c-myc oligonucleotides in vitro.
  • A Percentage of relative growth of VAL cells treated with AS ODNs for four days. Cell growth is normalized to untreated controls.
  • B Western blot analyses of c-myc protein levels in HepG2 cells treated in vitro with antisense c-myc oligonucleotides, sense controls, or untreated controls for four days versus untreated (Unt) controls. HSP90 was utilized as a loading control and relative protein expression was normalized versus untreated controls.
  • FIG. 4 depicts c-myc antisense ODN effects on HepG2 tumor cell growth in an in vivo tumor prevention model.
  • Tumor volumes (A) at indicated times and tumor weight (B) at 63 days following 2 weeks treatment initiated at day 47 of the experiment are shown for mice treated with c-myc antisense ODN, sense ODN control, or PBS-treated controls.
  • Figure 5 depicts c-myc antisense ODN effects on VAL tumor cell growth in an in vivo tumor regression model.
  • Figure 6 depicts the effects of overexpressing c-myc in the livers of the transgenic mice used in this study.
  • c-myc When mice are deprived of a dietary source of the antibiotic doxycycline, c-myc is overexpressed in hepatic cells resulting in the formation of liver tumors.
  • Figure 7 depicts the gross histological effects of three times weekly 30 mg/kg/day c- myc antisense oligonucleotide treatment on the livers of transgenic mice overexpressing c-myc in hepatocytes versus control transgenic animals treated with vehicle (PBS) or sense oligonucleotide.
  • PBS vehicle
  • sense oligonucleotide sense oligonucleotide
  • Figure 8 depicts histological analysis of Ki67 expression, cleaved caspase 3, and SA- gal in tissue sections of primary tumors from antisense, sense, and vehicle-treated transgenic animals overexpressing c-myc in liver cells.
  • Figure 9 depicts MRI imaging of tumor growth at days 0, 18, and 30 post initiation of treatment. The images show size and growth of liver tumors in transgenic mice overexpressing c-myc in liver cells that have been treated with antisense c-myc oligonucleotides, sense oligonucleotides, or PBS.
  • Figure 10 depicts total tumor burden in the livers of transgenic mice as determined by MRI at days 0, 18, and 30 days post initiation of treatment.
  • Figure 11 depicts tumor volume for individual animals in the study treated with PBS c-myc antisense oligonucleotide 20 or c-myc antisense oligonucleotide 16.
  • Figure 12 depicts Western blot analyses of c-myc protein levels in HepG2 cells treated in vitro with antisense c-myc oligonucleotide AS20 (Palm-AACGTTGAGGGGCAT)
  • NP/PS/NP SEQ ID NO:l
  • NON50 non-silencing control nucleotide
  • Figure 13 depicts immunofluorescence levels of c-myc protein in HepG2 cells treated in vitro with antisense c-myc oligonucleotides and a non-silencing control (NC) from Example 5.
  • This invention provides, inter alia, antisense oligonucleotides that can effectively prevent or decrease c-myc protein expression as well as decrease overall rates of cell proliferation in in vitro and mammalian in vivo models of cell proliferative disorders as well as methods for using the same.
  • antisense oligonucleotides having specific internucleoside linkages arrayed within the oligonucleotides can effectively prevent or decrease c-myc mRNA translation into protein within cells by sterically inhibiting the translation of the c-myc message into protein, by causing RNAse H- mediated degradation of the c-myc mRNA, or through steric inhibition and/or causing RNAse H-mediated degradation of the c-myc mRNA.
  • Nucleic acids can be synthesized in vitro by well-known chemical synthesis techniques, as described in, e.g. , Carruthers (1982) Cold Spring Harbor Symp. Quant. Biol. 47:411-418; Adams (1983) J. Am. Chem. Soc. 105:661 ; Belousov (1997) Nucleic Acids Res. 5 25:3440-3444; Frenkel (1995) Free Radic. Biol. Med.
  • nucleoside refers to a moiety having the general structure represented below, where B represents a nucleobase and the 2' carbon can be substituted as described below. When incorporated into an oligomer or polymer, the 3' carbon is further linked to an oxygen or nitrogen atom.
  • This structure includes 2'-deoxy and 2'-hydroxyl (i.e. deoxyribose and ribose) forms, and analogs. Less commonly, a 5'-NH group can be substituted for the 5'-oxygen.
  • "Analogs" in reference to nucleosides includes synthetic nucleosides having modified nucleobase moieties (see definition of "nucleobase” below) and/or modified sugar moieties, such as 2'-fluoro sugars, and further analogs. Such analogs are typically designed to affect binding properties, e.g., stability, specificity, or the like.
  • a "polynucleoside,” “oligonucleoside,” “polynucleotide,” or “oligonucleotide” can be used interchangeably herein to refer to an oligomer or polymer of the above-referenced nucleoside moieties, having between about 6 and about 20 such moieties, joined by specific internucleoside linkages between their 5' and 3' positions.
  • oligonucleotide and oligonucleoside also include such polymers or oligomers having modifications, known to one skilled in the art, to the sugar (e.g., 2' substitutions), the base (see the definition of "nucleobase” below), as well as the 3' and 5' termini.
  • internucleoside linkage refers to phosphorus-based linkages two atoms in length between the 5' oxygen and 3' carbon in the structure above, with phosphorus linking the 5' oxygen to a nitrogen or oxygen atom on the 3' carbon.
  • Such linkages include, but are not limited to, phosphodiester or phosphate (i.e. a "native” linkage), phosphotriester, methylphosphonate, P3'- ⁇ N5' phosphoramidate, N3'- ⁇ P5' phosphoramidate (NP), N3'- ⁇ P5' thiophosphoramidate (NPS), and phosphorothioate linkages.
  • Such linkages can be the same or different within a molecule.
  • NPS linkage in the compounds of the invention is the group 3'-NH-P(0)(S>- 5'; an "NP linkage” is the group 3'-NH-P(0)(0 " )-5'.
  • a “nucleobase” includes (i) native DNA and RNA nucleobases (uracil, thymine, adenine, guanine, and cytosine), (ii) modified nucleobases or nucleobase analogs (for example, but not limited to, 5-methylcytosine, 5-bromouracil, or inosine) and (iii) nucleobase analogs.
  • a “nucleobase analog” is a compound whose molecular structure is similar that of a typical DNA or RNA nucleobase.
  • lipid encompasses substances that are soluble in organic solvents, but sparingly soluble, if at all, in water.
  • the term lipid includes, but is not limited to, hydrocarbons, oils, fats (such as fatty acids and glycerides), sterols (for example, cholesterol), steroids and derivative forms of these compounds.
  • lipids are hydrocarbons, fatty acids and their derivatives.
  • Fatty acids usually contain even numbers of carbon atoms in a straight chain (commonly 12-24 carbons) and can be saturated or unsaturated, and can contain, or be modified to contain, a variety of substituent groups.
  • the term "fatty acid” also encompasses fatty acid derivatives, such as fatty acid esters.
  • substituted refers to a compound which has been modified by the exchange of one atom or moiety for another, typically substitution of hydrogen by a different atom or moiety.
  • RNA target refers to an RNA transcript to which an antisense
  • RNA target is one or more c-myc mRNA molecules.
  • RNAse H-mediated degradation refers to the specific cleavage of the 3'-0-P bond of an RNA in a DNA/RNA duplex to produce 3'-hydroxyl and 5 '-phosphate terminated products by the nonspecific endogenous cellular ribonuclease RNAse H.
  • the term “gapmer” refers to an oligonucleotide comprising two end regions (the "5' end” and the “3' end") and a central region (a "gap"), wherein the 5' end and the 3' end regions comprise at least one modification difference compared to the gap region.
  • modifications include monomeric linkage and sugar modifications as well as the absence of modification (unmodified RNA or DNA).
  • the nucleotide linkages in each of the 5' and 3' ends are different than the nucleotide linkages in the gap.
  • the modifications in the 5' and 3' ends are the same as one another.
  • the modifications in the 5' and 3' ends are different from each other.
  • nucleotides in the gap are unmodified and nucleotides in the 5' and 3' ends are modified.
  • the modification(s) within each 5' and 3' end are the same.
  • the modification(s) in one of the 5' or 3' ends are different from the modification(s) in the other end.
  • gapmer oligonucleotide hybridization to a target mRNA molecule results in the RNAse H-mediated degradation of the target mRNA molecule.
  • an antisense oligonucleotide that prevents target mRNA translation by "steric hindrance” is an oligonucleotide that interferes with gene expression or other mRNA-dependent cellular processes (for example, mRNA splicing or initiation of translation at the level of the ribosome) by binding to a target mRNA.
  • Such an oligonucleotide may or may not be RNase-H independent in functionality.
  • An "individual” can be a mammal, such as any common laboratory model organism, or a mammal. Mammals include, but are not limited to, humans and non-human primates, farm animals, sport animals, pets, mice, rats, and other rodents. In some embodiments, an individual is a human.
  • treatment refers to clinical intervention designed to alter the natural course of the individual or cell being treated during the course of clinical pathology. Desirable effects of treatment include, but are not limited to, decreasing the rate of disease progression, amelioration or palliation of the disease state, and remission or improved prognosis.
  • prevention includes providing prophylaxis with respect to occurrence or recurrence of a disease or the symptoms associated with a disease in an individual.
  • An individual may be predisposed to, susceptible to, or at risk of developing a disease, but has not yet been diagnosed with the disease.
  • an "effective amount” or “therapeutically effective amount” refers to an amount of therapeutic compound, such as an antisense oligomer, administered to a mammalian subject, either as a single dose or as part of a series of doses, which is effective to produce a desired therapeutic effect.
  • an antisense oligomer this effect is typically brought about by inhibiting translation or natural splice-processing of a selected target sequence.
  • the principle underlying antisense technology lies in the ability of an antisense oligonucleotide to hybridize to a target nucleic acid and modulate gene expression, such as by affecting transcription, translation, or splicing.
  • This modulation of gene expression can specifically be achieved by, for example, target degradation, occupancy-based inhibition ⁇ i.e. sterics), or a combination of both.
  • An example of modulation of RNA target function by degradation is RNase H-based degradation of the target RNA upon hybridization with a DNA- like antisense compound.
  • Another example is interference with mRNA translation due to steric hindrance.
  • Antisense technology is an effective means for reducing the expression of one or more specific gene products and can therefore prove to be uniquely useful in a number of therapeutic applications.
  • sequence of any of the antisense oligonucleotides disclosed herein can be, but need not necessarily be, 100% complementary to an mRNA from a c-myc gene to be specifically hybridizable.
  • the antisense oligonucleotides of the present invention comprise at least 70%, or at least 75%, or at least 80%, or at least 85% sequence
  • the antisense oligonucleotides of the present invention comprise at least 90% sequence complementarity and even comprise at least 95% or at least 99% sequence complementarity to an mRNA from a c- myc gene to which they are targeted.
  • an antisense oligonucleotide in which 18 of 20 nucleobases of the antisense oligonucleotide are complementary to an mRNA from a c-myc gene would specifically hybridize and would represent 90 percent complementarity.
  • the remaining noncomplementary nucleobases can be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases.
  • Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol, 1990, 215, 403-410; Zhang & Madden, Genome Res., 1997, 7, 649-656).
  • antisense c-myc oligonucleotides having specific internucleoside subunit linkages wherein the oligonucleotides effectively decrease or prevent c-myc protein expression within proliferating cells.
  • the c-myc antisense oligonucleotides decrease or prevent translation of an mRNA from a c-myc gene by steric hindrance.
  • the c-myc antisense oligonucleotides decrease or prevent translation of an mRNA from a c-myc gene by RNase-H-mediated degradation of the mRNA from a c-myc gene.
  • the c-myc antisense oligonucleotides decrease or prevent translation of an mRNA from a c-myc gene by steric hindrance and/or by RNase-H-mediated degradation of the mRNA from a c-myc gene.
  • contacting any of the oligonucleotides disclosed herein with a proliferating cell decreases relative c-myc protein expression in the cell by greater than at least about 35% (such as at least about 40%, 45%, 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, inclusive, including any percentages in between these values) in comparison to cells that have not been contacted with the oligonucleotide.
  • contacting any of the oligonucleotides disclosed herein with a proliferating cell decreases relative c-myc protein expression in the cell by greater than at least about 35%-45%, 40%-50%, 45%-55%, 50%-60%, 55%-65%, 60%-70%, 65%-75%, 70%-80%, 75%-85%, 80%-90%, 85%-95%, or 90%-100% in comparison to cells that have not been contacted with the oligonucleotide.
  • contacting any of the oligonucleotides disclosed herein with a population of proliferating cells decreases the relative cell growth rate of the population of cells by greater than at least about 35% (such as at least 40%, 45%, 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, inclusive, including any percentages in between these values) in comparison to cells that have not been contacted with the oligonucleotide.
  • at least about 35% such as at least 40%, 45%, 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, inclusive, including any percentages in between these values
  • contacting any of the oligonucleotides disclosed herein with a population of proliferating cells decreases the relative cell growth rate of the population of cells by greater than at least about 35%-45%, 40%-50%, 45%-55%, 50%-60%, 55%-65%, 60%-70%, 65%-75%, 70%-80%, 75%-85%, 80%-90%, 85%-95%, or 90%-100% in comparison to cells that have not been contacted with the oligonucleotide.
  • the oligonucleotide is from about any of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length, up to any of 25, or 30, or 50 nucleotides in length.
  • the oligonucleotide comprises 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length.
  • the c-myc antisense is from about any of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length, up to any of 25, or 30, or 50 nucleotides in length.
  • the oligonucleotide comprises 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length.
  • the c-myc antisense is from about any of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length.
  • oligonucleotides is at least about 6 to at least about 50, including at least about 8 to at least about 30, is about 6 to about 30 nucleotides, or is about 6 to about 20, or at least about 10 to at least about 20, and at least about 12 to at least about 16 nucleotides in length.
  • any of the c-myc antisense oligonucleotides disclosed herein are modified with one or more lipid and/or cholesterol moieties.
  • the cholesterol and/or lipid moiety is attached to the oligonucleotide via a linking group.
  • the oligonucleotide is complementary (such as at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%%, 96%, 97%, 98%, 99%, or 100%, including any percentages in between these values, complementary) to an mRNA from a c-myc gene at the site of the mRNA's translation initiation region.
  • the oligonucleotide is complementary (such as at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%%, 96%, 97%, 98%, 99%, or 100%, including any percentages in between these values, complementary) to an mRNA from a c-myc gene at a site on the mRNA where two exons are spliced together.
  • the oligonucleotide comprises the sequence ACGTTGAGGGGCAT (SEQ ID NO: 15).
  • the oligonucleotide comprises the sequence TCGTCGCGGGAGGCTG (SEQ ID NO:16). In some embodiments of any of the embodiments herein, the oligonucleotide has the sequence selected from the group consisting of AACGTTGAGGGGCAT (SEQ ID NO: l), UAACGTTGAGGGGCA (SEQ ID NO:2), T AACGTTGAGGGGCAT (SEQ ID NO:3), or TTTCATTGTTTTCCA (SEQ ID NO:4), CTCGTCGTTTCCGCAACAAG (SEQ ID NO:6), ACGTTGAGGGGCATCGTCGC (SEQ ID NO:7), AACGTTGAGGGGCATCGTCG (SEQ ID NO:8), CTGCTGTCGTTGAGAGGGTA (SEQ ID NO:9), GGCATCGTCGCGGGAGGCTGCTGGAGCG (SEQ ID NO: 10),
  • GGCATCGTCGCGGGAGGCTG SEQ ID NO: 11
  • TCGTCGCGGGAGGCTGCTGG SEQ ID NO: 12
  • CCGCCCGCTCGCTCCCTCTG SEQ ID NO: 13
  • the oligonucleotide comprises the sequence AACGTTGAGGGGCAT (SEQ ID NO: l). In another embodiment, the oligonucleotide comprises the sequence UAACGTTGAGGGGCA (SEQ ID NO:2). In one embodiment, when the oligonucleotide comprises UAACGTTGAGGGGCA (SEQ ID NO:2), the 5 'uridine can be 3 '-amino-2' -hydroxy- uridine or 3 '-oxy-2' -hydroxy-uridine. In a further embodiment, the oligonucleotide comprises the sequence TAACGTTGAGGGGCAT (SEQ ID NO: 3). In yet another embodiment, the oligonucleotide comprises the sequence
  • Methods known in the art can be used to determine whether a c-myc antisense oligonucleotide is effective in preventing or decreasing expression of c-myc in a proliferating cell. These include, without limitation, methods to assess mRNA such as reverse transcription- quantitative PCT (RT-qPCR), Northern Blot, in situ hybridization, microarray, serial analysis of gene expression (SAGE), or RNA-Seq.
  • RT-qPCR reverse transcription- quantitative PCT
  • Northern Blot Northern Blot
  • in situ hybridization in situ hybridization
  • microarray microarray
  • SAGE serial analysis of gene expression
  • RNA-Seq RNA-Seq.
  • c-myc protein levels in proliferating cells such as, but not limited to, Western Blot, immunohistochemistry, enzyme-linked immunosorbant assay (ELISA), radioimmunoassay (RIA), or 2D gel electrophoresis followed by quantitative mass spectrometry.
  • Western Blot immunohistochemistry
  • ELISA enzyme-linked immunosorbant assay
  • RIA radioimmunoassay
  • 2D gel electrophoresis followed by quantitative mass spectrometry.
  • any of the c-myc antisense oligonucleotides useful in this invention include oligonucleotides containing modified backbones or non-natural internucleoside linkages.
  • oligonucleotides having modified backbones include, inter alia, those that retain a phosphorus atom in the backbone of the oligonucleotide.
  • the modified intersubunit linkages found in any of the c-myc antisense oligonucleotides disclosed herein include, but are not limited to, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates, 5'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thiophosphoramidates,
  • thionoalkylphosphonates thionoalkylphosphotriesters, thiophosphates, selenophosphates and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3' to 3', 5' to 5' or 2' to 2' linkage.
  • the modified intersubunit linkages found in any of the c-myc antisense oligonucleotides disclosed herein are thiophosphoramidate (NPS), phosphoramidate (NP), thiophosphate (PS) linkages, and phosphodiester (i.e. a phosphate) (PO).
  • NPS linkage in the oligonucleotides of the present invention is the group 3'-NH— P(0)(S-)-5'.
  • An NP linkage is the group 3'-NH-P(0)(0-)-5'.
  • a PS linkage is the group 3'-0— P(0)(S-)-5'.
  • NPS and NP linkages have the benefits of high hydrolytic stability and resistance to cellular nucleases. In addition, they show much less nonspecific protein binding than exhibited by PS linkages.
  • Methods for synthesizing NP intersubunit linkages can be found in U.S. Patent Nos. 5,837,835; and 5,824,793; and NPS intersubunit linkages in US Patent Nos 5,824,793;and 5,859,233, the disclosures of which are incorporated by reference herein in their entirety.
  • oligonucleotide-target mRNA heteroduplex formation does not lead to RNA turnover (as is the case with RNAse-H mediated degradation), but results instead in the hindrance of RNA processing, nucleocytoplasmic transport or translation of the mRNA itself at the level of the ribosome. This is particularly the case when the antisense oligonucleotide is targeted to the translation initiation region of the target mRNA (i.e. the region on and surrounding the START codon).
  • oligonucleotides comprising a sequence complementary to an mRNA from a c-myc gene, wherein the nucleoside subunits of the oligonucleotide are joined by intersubunit linkages, wherein at least one of the intersubunit linkages is a thiophosphoramidate linkage, wherein the oligonucleotide is about 6 to about 25 nucleotides in length, and wherein the oligonucleotide prevents translation of the mRNA by steric hindrance.
  • the oligonucleotide is about 6 to about 20 nucleotides or is about 6 to about 30 nucleotides in length.
  • the c-myc antisense oligonucleotide that prevents translation of an mRNA from a c-myc gene due to steric hindrance contains at least one thiophosphoramidate (NPS) intersubunit linkage.
  • NPS thiophosphoramidate
  • the oligonucleotide contains any of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 NPS intersubunit linkages, or up to about 25, or 30, or 50 NPS intersubunit linkages.
  • the oligonucleotide comprises 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 NPS intersubunit linkages.
  • the oligonucleotide contains at least about 10%, 20%, 30%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, inclusive, including any percentages in between these values, NPS intersubunit linkages.
  • about 10% to about 95%, about 20% to about 90%, about 30% to about 80%, about 40% to about 70%, or about 50% of the intersubunit linkages are thiophosphoramidate linkages.
  • about 10% to about 90% of the intersubunit linkages are thiophosphoramidate linkages.
  • the oligonucleotide is complementary to an mRNA from a c-myc gene at the site of the mRNA's translation initiation region. In other embodiments, the oligonucleotide is at least 80% complementary (such as at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary) to an mRNA from a c-myc gene at the site of the mRNA's translation initiation region. In other embodiments of any of the c-myc antisense
  • the oligonucleotide is complementary (such as at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%%, 96%, 97%, 98%, 99%, or 100%, including any percentages in between these values, complementary) to an mRNA from a c-myc gene at a site on the mRNA where two exons are spliced together.
  • contacting any of the oligonucleotides disclosed herein with a proliferating cell decreases relative c-myc protein expression in the cell by greater than at least about 35% (such as at least about 40%, 45%, 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, inclusive, including any percentages in between these values) in comparison to cells that have not been contacted with the
  • contacting any of the oligonucleotides disclosed herein with a proliferating cell decreases relative c-myc protein expression in the cell by greater than at least about 35%-45%, 40%-50%, 45%-55%, 50%-60%, 55%-65%, 60%-70%, 65%-75%, 70%- 80%, 75%-85%, 80%-90%, 85%-95%, or 90%-100% in comparison to cells that have not been contacted with the oligonucleotide. In other embodiments, contacting any of the
  • oligonucleotides disclosed herein with a population of proliferating cells decreases the relative cell growth rate of the population of cells by greater than at least about 35% (such as at least 40%, 45%, 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, inclusive, including any percentages in between these values) in comparison to cells that have not been contacted with the oligonucleotide.
  • contacting any of the oligonucleotides disclosed herein with a population of proliferating cells decreases the relative cell growth rate of the population of cells by greater than at least about 35%-45%, 40%-50%, 45%-55%, 50%-60%, 55%-65%, 60%-70%, 65%-75%, 70%-80%, 75%-85%, 80%-90%, 85%-95%, or 90%-100% in comparison to cells that have not been contacted with the oligonucleotide.
  • the oligonucleotide has a sequence selected from the group consisting of AACGTTGAGGGGCAT (SEQ ID NO: l), UAACGTTGAGGGGCA,
  • the oligonucleotide comprises the sequence AACGTTGAGGGGCAT (SEQ ID NO:l). In another embodiment, the oligonucleotide comprises the sequence UAACGTTGAGGGGCA. In one embodiment, when the oligonucleotide comprises UAACGTTGAGGGGCA, the 5 'uridine can be 3 '-amino-2' -hydroxy- uridine or 3 '-oxy-2' -hydroxy-uridine. In a further embodiment, the oligonucleotide comprises the sequence TAACGTTGAGGGGCAT. In yet another embodiment, the oligonucleotide comprises the sequence TTTCATTGTTTTCCA.
  • oligonucleotides comprising a sequence complementary to an mRNA from a c-myc gene, wherein the nucleoside subunits of the oligonucleotide are joined by intersubunit linkages, wherein at least one of the intersubunit linkages is a phosphoramidate linkage, wherein the oligonucleotide is about 6 to about 25 nucleotides in length, and wherein the oligonucleotide prevents translation of the mRNA by steric hindrance.
  • the oligonucleotide is about 6 to about 20 nucleotides or is about 6 to about 30 nucleotides in length.
  • the oligonucleotide is from about any of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length, up to any of 25, or 30, or 50 nucleotides in length. In another embodiment, the oligonucleotide comprises 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length.
  • the c-myc antisense oligonucleotide is at least about 6 to at least about 50, including at least about 8 to at least about 30, about 6 to about 20 nucleotides or about 6 to about 30 nucleotides or at least about 10 to at least about 20, and at least about 12 to at least about 16 nucleotides in length.
  • the c-myc antisense oligonucleotide that prevents translation of an mRNA from a c-myc gene due to steric hindrance contains at least one phosphoramidate (NP) intersubunit linkage.
  • the oligonucleotide contains any of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 NP intersubunit linkages, or up to about 25, or 30, or 50 NP intersubunit linkages.
  • the oligonucleotide comprises 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 NP intersubunit linkages.
  • the oligonucleotide contains at least about 10%, 20%, 30%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, inclusive, including any percentages in between these values, NP intersubunit linkages.
  • about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, about 40% to about 60%, or about 50% of the intersubunit linkages are phosphoramidate linkages.
  • about 10% to about 90% of the intersubunit linkages are phosphoramidate linkages.
  • the oligonucleotide is complementary to an mRNA from a c-myc gene at the site of the mRNA's translation initiation region. In some embodiments, the oligonucleotide is complementary to an mRNA from a c-myc gene at the site of the mRNA's translation initiation region. In other embodiments, the oligonucleotide is at least 80% complementary (such as at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary) to an mRNA from a c-myc gene at the site of the mRNA's translation initiation region. In other embodiments of any of the c-myc antisense oligonucleotides disclosed herein, the oligonucleotide is
  • complementary (such as at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%%, 96%, 97%, 98%, 99%, or 100%, including any percentages in between these values, complementary) to an mRNA from a c-myc gene at a site on the mRNA where two exons are spliced together.
  • contacting any of the oligonucleotides disclosed herein with a proliferating cell decreases relative c-myc protein expression in the cell by greater than at least about 35% (such as at least about 40%, 45%, 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, inclusive, including any percentages in between these values) in comparison to cells that have not been contacted with the oligonucleotide.
  • contacting any of the oligonucleotides disclosed herein with a proliferating cell decreases relative c-myc protein expression in the cell by greater than at least about 35%-45%, 40%-50%, 45%-55%, 50%-60%, 55%-65%, 60%-70%, 65%-75%, 70%-80%, 75%-85%, 80%-90%, 85%-95%, or 90%-100% in comparison to cells that have not been contacted with the oligonucleotide.
  • 40%-50%, 45%-55% 50%-60%, 55%-65%, 60%-70%, 65%-75%, 70%-80%, 75%-85%, 80%-90%, 85%-95%, or 90%-100% in comparison to cells that have not been contacted with the oligonucleotide.
  • contacting any of the oligonucleotides disclosed herein with a population of proliferating cells decreases the relative cell growth rate of the population of cells by greater than at least about 35% (such as at least 40%, 45%, 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, inclusive, including any percentages in between these values) in comparison to cells that have not been contacted with the oligonucleotide.
  • at least about 35% such as at least 40%, 45%, 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, inclusive, including any percentages in between these values
  • contacting any of the oligonucleotides disclosed herein with a population of proliferating cells decreases the relative cell growth rate of the population of cells by greater than at least about 35%-45%, 40%-50%, 45%-55%, 50%-60%, 55%-65%, 60%-70%, 65%-75%, 70%-80%, 75%-85%, 80%-90%, 85%-95%, or 90%-100% in comparison to cells that have not been contacted with the oligonucleotide.
  • the oligonucleotide comprises the sequence ACGTTGAGGGGCAT (SEQ ID NO: 15).
  • the oligonucleotide comprises the sequence TCGTCGCGGGAGGCTG (SEQ ID NO: 16). In some embodiments of any of the embodiments herein, the oligonucleotide has the sequence selected from the group consisting of AACGTTGAGGGGCAT (SEQ ID NO: l), UAACGTTGAGGGGCA (SEQ ID NO:2),
  • GGCATCGTCGCGGGAGGCTG SEQ ID NO: 11
  • TCGTCGCGGGAGGCTGCTGG SEQ ID NO: 12
  • CCGCCCGCTCGCTCCCTCTG SEQ ID NO: 13
  • the oligonucleotide comprises the sequence AACGTTGAGGGGCAT (SEQ ID NO: l). In another embodiment, the oligonucleotide comprises the sequence UAACGTTGAGGGGCA (SEQ ID NO:2). In one embodiment, when the oligonucleotide comprises UAACGTTGAGGGGCA (SEQ ID NO:2), the 5 'uridine can be 3 '-amino-2' -hydroxy- uridine or 3 '-oxy-2' -hydroxy-uridine. In a further embodiment, the oligonucleotide comprises the sequence TAACGTTGAGGGGCAT (SEQ ID NO: 3). In yet another embodiment, the oligonucleotide comprises the sequence
  • the c-myc antisense oligonucleotide that prevents translation of an mRNA from a c-myc gene due to RNase-H-mediated degradation of the mRNA from a c-myc gene and/or steric hindrance is fluorescently labeled.
  • fluorescent labels include fluorescein, phosphor, rhodamine, and polymethine dye derivative.
  • fluorescent dyes examples include BODIPY FL (brand name, manufactured by Molecular Probe Inc.), FluorePrime (trade name, manufactured by Amersham Pharmacia), Fluoredite (trade name, manufactured by Millipore Corporation), FAIL (manufactured by ABI), Cy3 and Cy5 (manufactured by Amersham Pharmacia), and tetramethylrhodamine (TAMRA; manufactured by Molecular Probe Inc.).
  • the c-myc antisense oligonucleotide that prevents translation of an mRNA from a c-myc gene due to steric hindrance is an oligonucleotide shown in Table 1.
  • oligonucleotides can serve as a substrate for the intracellular ribonuclease RNase H, which leads to cleavage of the target mRNA component of the heteroduplex. While not intending to be bound by theory, it is thought that once the target mRNA is cleaved, the gapmer oligonucleotides can target additional copies of the target mRNA.
  • Gapmers are chimeric oligonucleotides comprising a central region (a "gap") and a region on either side of the central region (the "5' end” and the “3' end”), wherein the nucleoside subunits contained within the gap comprise at least one modification difference in comparison to the nucleoside subunits that make up the 5' and "3' ends.
  • oligonucleotide comprising a sequence complementary to an mRNA from a c-myc gene, wherein the nucleoside subunits of the oligonucleotide are joined by intersubunit linkages, wherein the oligonucleotide comprises two or more contiguous thiophosphoramidate or phosphoramidate linkages located on both the 5' and 3' ends of the oligonucleotide, wherein the oligonucleotide is about 6 to about 25 nucleotides in length, and wherein the oligonucleotide is a substrate for RNase-H-mediated degradation of the mRNA from a c-myc gene
  • the oligonucleotide is about 6 to about 20 nucleotides or is about 6 to about 30 nucleotides in length.
  • the oligonucleotide is from about any of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length, up to any of 25, or 30, or 50 nucleotides in length. In another embodiment, the oligonucleotide comprises 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length.
  • the c-myc antisense oligonucleotide is at least about 6 to at least about 50, including at least about 8 to at least about 30, is about 6 to about 20 nucleotides or is about 6 to about 30 nucleotides or at least about 10 to at least about 20, and at least about 12 to at least about 16 nucleotides in length.
  • the oligonucleotide comprises two or more contiguous thiophosphoramidate linkages located on both the 5' and 3' ends of the oligonucleotide.
  • the oligonucleotide comprises two or more contiguous phosphoramidate linkages located on both the 5' and 3' ends of the oligonucleotide. In still a further embodiment, the oligonucleotide further comprises two or more contiguous thiophosphate or phosphate linkages located in between (i.e., in the gap between) the two or more contiguous thiophosphoramidate linkages located on both the 5' and 3' ends of the oligonucleotide.
  • the c-myc antisense oligonucleotides that prevent translation of an mRNA from a c-myc gene due to RNase-H-mediated degradation of the mRNA from a c-myc gene comprise at least about 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length having a gap of about 2 to 16 nucleotides in length and having 5' and 3' end regions that are independently at least 2 to 16 nucleotides in length.
  • Exemplary 5' end-gap-3'end configurations for the c-myc antisense gapmer oligonucleotides disclosed herein are 2-4-2, 2-5-2, 4-6-4, 3-6-3, 2-6-2, 4-7-4, 3-7-3, 2-7-2, 4-8-4, 3-8-3, 2-8-2, , 2- 9-2, 2-10-2, 2-14-2, 2-13-3, 3-13-2, 2-12-4, 4-12-2, 3-12-3, 2-11-5, 5-11-2, 3-11-4, 4-11-3, 2-15-
  • the c-myc antisense oligonucleotide that prevents translation of an mRNA from a c-myc gene due to RNase-H-mediated degradation of the mRNA from a c-myc gene comprises four contiguous thiophosphoramidate linkages located on the 5' end of the oligonucleotide, five contiguous thiophosphoramidate linkages located on the 3' end of the oligonucleotide, and six contiguous thiophosphate or phosphate linkages located between the four contiguous thiophosphoramidate linkages located on the 5' end of the oligonucleotide and the five contiguous thiophosphoramidate linkages located on the 3' end of the oligonucleotide.
  • the c-myc antisense oligonucleotide comprises four contiguous phosphoramidate linkages located on the 5' end of the oligonucleotide, five contiguous phosphoramidate linkages located on the 3' end of the oligonucleotide, and six contiguous thiophosphate or phosphate linkages located between the four contiguous phosphoramidate linkages located on the 5' end of the oligonucleotide and the five contiguous phosphoramidate linkages located on the 3' end of the oligonucleotide.
  • contacting any of the oligonucleotides disclosed herein with a proliferating cell decreases relative c-myc protein expression in the cell by greater than at least about 35% (such as at least about 40%, 45%, 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, inclusive, including any percentages in between these values) in comparison to cells that have not been contacted with the
  • contacting any of the oligonucleotides disclosed herein with a proliferating cell decreases relative c-myc protein expression in the cell by greater than at least about 35%-45%, 40%-50%, 45%-55%, 50%-60%, 55%-65%, 60%-70%, 65%-75%, 70%- 80%, 75%-85%, 80%-90%, 85%-95%, or 90%-100% in comparison to cells that have not been contacted with the oligonucleotide. In other embodiments, contacting any of the
  • oligonucleotides disclosed herein with a population of proliferating cells decreases the relative cell growth rate of the population of cells by greater than at least about 35% (such as at least 40%, 45%, 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, inclusive, including any percentages in between these values) in comparison to cells that have not been contacted with the oligonucleotide.
  • contacting any of the oligonucleotides disclosed herein with a population of proliferating cells decreases the relative cell growth rate of the population of cells by greater than at least about 35%-45%, 40%-50%, 45%-55%, 50%-60%, 55%-65%, 60%-70%, 65%-75%, 70%-80%, 75%-85%, 80%-90%, 85%-95%, or 90%-100% in comparison to cells that have not been contacted with the oligonucleotide.
  • the oligonucleotide is complementary to an mRNA from a c-myc gene at the site of the mRNA's translation initiation region. In some embodiments, the oligonucleotide is complementary to an mRNA from a c-myc gene at the site of the mRNA' s translation initiation region. In other embodiments, the oligonucleotide is at least 80% complementary (such as at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary) to an mRNA from a c-myc gene at the site of the mRNA's translation initiation region. In other embodiments of any of the c-myc antisense oligonucleotides disclosed herein, the
  • oligonucleotide is complementary (such as at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%%, 96%, 97%, 98%, 99%, or 100%, including any percentages in between these values, complementary) to an mRNA from a c-myc gene at a site on the mRNA where two exons are spliced together.
  • the oligonucleotide comprises the sequence ACGTTGAGGGGCAT (SEQ ID NO:15).
  • the oligonucleotide comprises the sequence ACGTTGAGGGGCAT (SEQ ID NO:15).
  • the oligonucleotide has the sequence selected from the group consisting of
  • AACGTTGAGGGGCAT (SEQ ID NO: l), UAACGTTGAGGGGCA (SEQ ID NO:2), TAACGTTGAGGGGCAT (SEQ ID NO:3), or TTTCATTGTTTTCCA (SEQ ID NO:4), CTCGTCGTTTCCGCAACAAG (SEQ ID NO:6), ACGTTGAGGGGCATCGTCGC (SEQ ID NO:7), AACGTTGAGGGGCATCGTCG (SEQ ID NO:8), CTGCTGTCGTTGAGAGGGTA (SEQ ID NO:9), GGCATCGTCGCGGGAGGCTGCTGGAGCG (SEQ ID NO: 10),
  • GGCATCGTCGCGGGAGGCTG SEQ ID NO: 11
  • TCGTCGCGGGAGGCTGCTGG SEQ ID NO: 12
  • CCGCCCGCTCGCTCCCTCTG SEQ ID NO: 13
  • the oligonucleotide comprises the sequence AACGTTGAGGGGCAT (SEQ ID NO: l). In another embodiment, the oligonucleotide comprises the sequence UAACGTTGAGGGGCA (SEQ ID NO:2). In one embodiment, when the oligonucleotide comprises UAACGTTGAGGGGCA (SEQ ID NO:2), the 5 'uridine can be 3 '-amino-2' -hydroxy- uridine or 3 '-oxy-2' -hydroxy-uridine. In a further embodiment, the oligonucleotide comprises the sequence TAACGTTGAGGGGCAT (SEQ ID NO: 3). In yet another embodiment, the oligonucleotide comprises the sequence
  • oligonucleotides comprising a sequence complementary to an mRNA from a c-myc gene, wherein the nucleoside subunits of the oligonucleotide are joined by intersubunit linkages, wherein the oligonucleotide is a substrate for RNase-H-mediated degradation of the mRNA from a c-myc gene, and wherein the
  • oligonucleotide comprises at least two contiguous phosphoramidate intersubunit linkages located on the 5' end of the oligonucleotide; wherein the oligonucleotide comprises at least two contiguous phosphoramidate intersubunit linkages located on the 3' end of the oligonucleotide; wherein the oligonucleotide comprises 2-11 contiguous thiophosphate or phosphate linkages located in between said at least two contiguous phosphoramidate linkages located on the 5' end and said at least two contiguous phosphoramidate linkages located on the 3' end of the oligonucleotide; and wherein the oligonucleotide comprises the sequence
  • the oligonucleotide comprises the sequence ACGTTGAGGGGCAT (SEQ ID NO: 15). In some embodiments of any of the embodiments herein, the oligonucleotide comprises the sequence TCGTCGCGGGAGGCTG (SEQ ID NO: 16).
  • the oligonucleotide has the sequence selected from the group consisting of AACGTTGAGGGGCAT (SEQ ID NO: l), UAACGTTGAGGGGCA (SEQ ID NO:2), T AACGTTGAGGGGCAT (SEQ ID NO:3), or TTTCATTGTTTTCCA (SEQ ID NO:4), CTCGTCGTTTCCGCAACAAG (SEQ ID NO:6), ACGTTGAGGGGCATCGTCGC (SEQ ID NO:7), AACGTTGAGGGGCATCGTCG (SEQ ID NO:8), CTGCTGTCGTTGAGAGGGTA (SEQ ID NO:9), GGCATCGTCGCGGGAGGCTGCTGGAGCG (SEQ ID NO: 10),
  • GGCATCGTCGCGGGAGGCTG SEQ ID NO: 11
  • TCGTCGCGGGAGGCTGCTGG SEQ ID NO: 12
  • CCGCCCGCTCGCTCCCTCTG SEQ ID NO: 13
  • the oligonucleotide comprises the sequence AACGTTGAGGGGCAT(SEQ ID NO: l). In another embodiment, the oligonucleotide comprises the sequence UAACGTTGAGGGGCA (SEQ ID NO:2). In one embodiment, when the oligonucleotide comprises UAACGTTGAGGGGCA (SEQ ID NO:2), the 5 'uridine can be 3 '-amino-2' -hydroxy- uridine or 3 '-oxy-2' -hydroxy-uridine. In a further embodiment, the oligonucleotide comprises the sequence TAACGTTGAGGGGCAT (SEQ ID NO: 3). In yet another embodiment, the oligonucleotide comprises the sequence
  • the c-myc antisense oligonucleotide that prevents translation of an mRNA from a c-myc gene due to RNase-H-mediated degradation of the mRNA from a c-myc gene and/or steric hindrance is fluorescently labeled.
  • fluorescent labels include fluorescein, phosphor, rhodamine, and polymethine dye derivative.
  • fluorescent dyes examples include BODIPY FL (brand name, manufactured by Molecular Probe Inc.), FluorePrime (trade name, manufactured by Amersham Pharmacia), Fluoredite (trade name, manufactured by Millipore Corporation), FAIL (manufactured by ABI), Cy3 and Cy5 (manufactured by Amersham Pharmacia), and tetramethylrhodamine (TAMRA; manufactured by Molecular Probe Inc.).
  • the c-myc antisense oligonucleotide that prevents translation of an mRNA from a c-myc gene due to RNAse H-mediated degradation of the mRNA is an oligonucleotide shown in Table 2.
  • c-myc antisense oligonucleotides that can effectively prevent or decrease c-myc mRNA translation into protein within cells through steric inhibition and/or RNAse H-mediated degradation. These oligonucleotides possess characteristics of both traditional steric-blocking antisense oligonucleotides as well as gapmers, which cause RNAse H- mediated degradation of target mRNA.
  • antisense oligonucleotides comprising a sequence complementary to an mRNA from a c-myc gene, wherein the nucleoside subunits of the oligonucleotide are joined by intersubunit linkages, wherein the oligonucleotide comprises alternating thiophosphoramidate or phosphoramidate and thiophosphate or phosphate intersubunit linkages, wherein the oligonucleotide is about 6 to about 25 nucleotides in length, and wherein the oligonucleotide is a substrate for RNase-H-mediated degradation of the mRNA from a c-myc gene and/or wherein the oligonucleotide prevents translation of the mRNA by steric hindrance.
  • the oligonucleotide is about 6 to about 20 nucleotides or is about 6 to about 30 nucleotides in length. In some embodiments, the oligonucleotide is from about any of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length, up to any of 25, or 30, or 50 nucleotides in length. In another embodiment, the oligonucleotide comprises 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length.
  • the c-myc antisense oligonucleotide is at least about 6 to at least about 50, including at least about 8 to at least about 30, or is about 6 to about 20 nucleotides or is about 6 to about 30 nucleotides or at least about 10 to at least about 20, and at least about 12 to at least about 16 nucleotides in length.
  • the c-myc antisense oligonucleotides that prevent translation of an mRNA from a c-myc gene due to RNase-H-mediated degradation of the mRNA and/or steric hindrance are at least about 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length and comprise the sequence (A n B y ) q A n .
  • A comprises a thiophosphoramidate or
  • B comprises a thiophosphate or phosphate intersubunit linkage
  • n and y indicate independently the number of contiguous intersubunit linkages represented by A and B, respectively, and q is any number from 1-10.
  • n and y are both l and the oligonucleotide is any of at least about 7, 9, 11, 13, 15 nucleotides in length.
  • n is 1 and y is 2 and the oligonucleotide is any of at least about 7, 10, 13, 16, 19, 22, 25 nucleotides in length.
  • n is 1 and y is 3 and the oligonucleotide is any of at least about 5, 9, 13, 17, nucleotides in length. In another embodiment, n is 1 and y is 4 and the oligonucleotide is any of at least about 6, 12, 18, or 24 nucleotides in length. In another embodiment, n is 1 and y is 5 and the oligonucleotide is any of at least about 7, 14, or 21 nucleotides in length. In another embodiment, n is 1 and y is 6 and the oligonucleotide is any of at least about 8, 16, 24 nucleotides in length.
  • n is 1 and y is 7 and the oligonucleotide is any of at least about 9 or 17 nucleotides in length. In another embodiment, n is 1 and y is 8 and the oligonucleotide is any of at least about 10 or 20 nucleotides in length. In another embodiment, n is 2 and y is 1 and the oligonucleotide is any of at least about 8, 11, 14, 17, nucleotides in length. In another embodiment, n is 3 and y is 1 and the oligonucleotide is any of at least about 7, 11, 15, nucleotides in length.
  • n and y are both 2 and the oligonucleotide is any of at least about 6, 12, 18, or 24 nucleotides in length. In another embodiment, n is 2 and y is 3 and the
  • oligonucleotide is any of at least about 7, 14, or 21 nucleotides in length.
  • n is 2 and y is 4 and the oligonucleotide is any of at least about 8, 16, or 24 nucleotides in length.
  • n is 2 and y is 5 and the oligonucleotide is any of at least about 9 or 18 nucleotides in length.
  • n is 2 and y is 6 and the oligonucleotide is any of at least about 10 or 20 nucleotides in length.
  • n is 2 and y is 7 and the oligonucleotide is any of at least about 11 or 22 nucleotides in length.
  • n is 3 and y is 2 and the oligonucleotide is any of at least about 8, 16, or 24 nucleotides in length. In another embodiment, n is 4 and y is 2 and the oligonucleotide is any of at least about 10 or 20 nucleotides in length. In another embodiment, n is 5 and y is 2 and the oligonucleotide is any of at least about 11 or 22 nucleotides in length.
  • n and y are both 3 and the oligonucleotide is any of at least about 9 or 18 nucleotides in length. In another embodiment, n is 3 and y is 4 and the oligonucleotide is any of at least about 10 or 20 nucleotides in length. In another embodiment, n is 3 and y is 5 and the oligonucleotide is any of at least about 11 or 22 nucleotides in length. In another embodiment, n is 3 and y is 6 and the oligonucleotide is any of at least about 12 or 24 nucleotides in length. In another embodiment, n is 4 and y is 3 and the oligonucleotide is any of at least about 11 or 22 nucleotides in length.
  • the c-myc antisense oligonucleotides that prevent translation of an mRNA from a c-myc gene due to RNase-H-mediated degradation of the mRNA from a c-myc gene and/or steric hindrance comprise alternating thiophosphoramidate and thiophosphate linkages.
  • the oligonucleotide comprises alternating phosphoramidate and thiophosphate linkages.
  • the oligonucleotide comprises alternating phosphoramidate and phosphate linkages.
  • the oligonucleotide comprises alternating thiophosphoramidate and phosphate linkages.
  • the oligonucleotide with alternating thiophosphoramidate and thiophosphate linkages comprises at least about any of 25%-35%, 30%-40%, 35%-45%, 45%-55%, 50%-60%, 55%-65%, or 60-70% thiophosphoramidate linkages. In another embodiment, the oligonucleotide with alternating phosphoramidate and thiophosphate comprises at least about any of 25%-35%, 30%-40%, 35%- 45%, 45%-55%, 50%-60%, 55%-65%, or 60-70% phosphoramidate linkages.
  • the oligonucleotide with alternating thiophosphoramidate and phosphate linkages comprises at least about any of 25%-35%, 30%-40%, 35%-45%, 45%-55%, 50%-60%, 55%- 65%, or 60-70% thiophosphoramidate linkages. In another embodiment, the oligonucleotide with alternating phosphoramidate and phosphate comprises at least about any of 25%-35%, 30%-40%, 35%-45%, 45%-55%, 50%-60%, 55%-65%, or 60-70% phosphoramidate linkages.
  • contacting any of the oligonucleotides disclosed herein with a proliferating cell decreases relative c-myc protein expression in the cell by greater than at least about 35% (such as at least about 40%, 45%, 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, inclusive, including any percentages in between these values) in comparison to cells that have not been contacted with the oligonucleotide.
  • contacting any of the oligonucleotides disclosed herein with a proliferating cell decreases relative c-myc protein expression in the cell by greater than at least about 35%-45%, 40%-50%, 45%-55%, 50%-60%, 55%-65%, 60%-70%, 65%-75%, 70%-80%, 75%-85%, 80%-90%, 85%-95%, or 90%-100% in comparison to cells that have not been contacted with the oligonucleotide.
  • 40%-50%, 45%-55% 50%-60%, 55%-65%, 60%-70%, 65%-75%, 70%-80%, 75%-85%, 80%-90%, 85%-95%, or 90%-100% in comparison to cells that have not been contacted with the oligonucleotide.
  • contacting any of the oligonucleotides disclosed herein with a population of proliferating cells decreases the relative cell growth rate of the population of cells by greater than at least about 35% (such as at least 40%, 45%, 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, inclusive, including any percentages in between these values) in comparison to cells that have not been contacted with the oligonucleotide.
  • at least about 35% such as at least 40%, 45%, 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, inclusive, including any percentages in between these values
  • contacting any of the oligonucleotides disclosed herein with a population of proliferating cells decreases the relative cell growth rate of the population of cells by greater than at least about 35%-45%, 40%-50%, 45%-55%, 50%-60%, 55%-65%, 60%-70%, 65%-75%, 70%-80%, 75%-85%, 80%-90%, 85%-95%, or 90%-100% in comparison to cells that have not been contacted with the oligonucleotide.
  • the oligonucleotide is complementary to an mRNA from a c-myc gene at the site of the mRNA' s translation initiation region.
  • the oligonucleotide is at least 80% complementary (such as at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary) to an mRNA from a c-myc gene at the site of the mRNA's translation initiation region.
  • the c-myc antisense oligonucleotides disclosed herein the
  • oligonucleotide is complementary (such as at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%%, 96%, 97%, 98%, 99%, or 100%, including any percentages in between these values, complementary) to an mRNA from a c-myc gene at a site on the mRNA where two exons are spliced together.
  • the oligonucleotide comprises the sequence ACGTTGAGGGGCAT (SEQ ID NO:15).
  • the oligonucleotide comprises the sequence ACGTTGAGGGGCAT (SEQ ID NO:15).
  • the oligonucleotide has the sequence selected from the group consisting of
  • AACGTTGAGGGGCAT (SEQ ID NO: l), UAACGTTGAGGGGCA (SEQ ID NO:2), TAACGTTGAGGGGCAT (SEQ ID NO:3), or TTTCATTGTTTTCCA (SEQ ID NO:4), CTCGTCGTTTCCGCAACAAG (SEQ ID NO:6), ACGTTGAGGGGCATCGTCGC (SEQ ID NO:7), AACGTTGAGGGGCATCGTCG (SEQ ID NO:8), CTGCTGTCGTTGAGAGGGTA (SEQ ID NO:9), GGCATCGTCGCGGGAGGCTGCTGGAGCG (SEQ ID NO: 10),
  • GGCATCGTCGCGGGAGGCTG SEQ ID NO: 11
  • TCGTCGCGGGAGGCTGCTGG SEQ ID NO: 12
  • CCGCCCGCTCGCTCCCTCTG SEQ ID NO: 13
  • the oligonucleotide comprises the sequence AACGTTGAGGGGCAT(SEQ ID NO: l). In another embodiment, the oligonucleotide comprises the sequence UAACGTTGAGGGGCA (SEQ ID NO:2). In one embodiment, when the oligonucleotide comprises UAACGTTGAGGGGCA (SEQ ID NO:2), the 5 'uridine can be 3 '-amino-2' -hydroxy- uridine or 3 '-oxy-2' -hydroxy-uridine. In a further embodiment, the oligonucleotide comprises the sequence TAACGTTGAGGGGCAT (SEQ ID NO: 3). In yet another embodiment, the oligonucleotide comprises the sequence
  • oligonucleotides comprising a sequence complementary to an mRNA from a c-myc gene, wherein the nucleoside subunits of the oligonucleotide are joined by intersubunit linkages, wherein the oligonucleotide comprises two or more contiguous thiophosphoramidate linkages located on both the 5' and 3' ends of the oligonucleotide, wherein the oligonucleotide is about 6 to about 25 nucleotides in length, and wherein the oligonucleotide is a substrate for RNase-H-mediated degradation of the mRNA from a c-myc gene and/or prevents translation of the mRNA by steric hindrance.
  • the oligonucleotide is a substrate for RNase-H-mediated degradation of the mRNA from a c-myc gene and/or prevents translation of the mRNA by steric hindrance.
  • the oligonucleotide is about 6 to about 20 nucleotides or is about 6 to about 30 nucleotides in length. In some embodiments, the oligonucleotide is from about any of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length, up to any of 25, or 30, or 50 nucleotides in length. In another embodiment, the oligonucleotide comprises 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length.
  • the c-myc antisense oligonucleotide is at least about 6 to at least about 50, including at least about 8 to at least about 30, or is about 6 to about 20 nucleotides or is about 6 to about 30 nucleotides or at least about 10 to at least about 20, and at least about 12 to at least about 16 nucleotides in length.
  • the c-myc antisense oligonucleotides that prevent translation of an mRNA from a c-myc gene due to RNase-H-mediated degradation of the mRNA from a c-myc gene and/or steric hindrance provided herein comprise at least about 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length having a gap of about 2 to 16 nucleotides in length and having 5' and "3' end regions that are independently at least 2 to 16.
  • exemplary 5' end-gap-3'end configurations for the c-myc antisense gapmer oligonucleotides can be any of the exemplary configurations disclosed above.
  • the c-myc antisense oligonucleotide that prevents translation of an mRNA from a c-myc gene due to RNase-H-mediated degradation of the mRNA from a c-myc gene and/or steric hindrance further comprises two or more contiguous thiophosphate or phosphate linkages located in between the two or more contiguous thiophosphoramidate linkages located on both the 5' and 3' ends of the oligonucleotide.
  • the oligonucleotide comprises five contiguous thiophosphoramidate linkages located on the 5' end of the oligonucleotide, four contiguous thiophosphoramidate linkages located on the 3' end of the oligonucleotide, and six contiguous thiophosphate or phosphate linkages located between the five contiguous thiophosphoramidate linkages located on the 5' end of the oligonucleotide and the four contiguous thiophosphoramidate linkages located on the 3' end of the oligonucleotide.
  • contacting any of the oligonucleotides disclosed herein with a proliferating cell decreases relative c-myc protein expression in the cell by greater than at least about 35% (such as at least about 40%, 45%, 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, inclusive, including any percentages in between these values) in comparison to cells that have not been contacted with the oligonucleotide.
  • contacting any of the oligonucleotides disclosed herein with a proliferating cell decreases relative c-myc protein expression in the cell by greater than at least about 35%-45%, 40%-50%, 45%-55%, 50%-60%, 55%-65%, 60%-70%, 65%-75%, 70%-80%, 75%-85%, 80%-90%, 85%-95%, or 90%-100% in comparison to cells that have not been contacted with the oligonucleotide.
  • contacting any of the oligonucleotides disclosed herein with a population of proliferating cells decreases the relative cell growth rate of the population of cells by greater than at least about 35% (such as at least 40%, 45%, 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, inclusive, including any percentages in between these values) in comparison to cells that have not been contacted with the oligonucleotide.
  • at least about 35% such as at least 40%, 45%, 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, inclusive, including any percentages in between these values
  • contacting any of the oligonucleotides disclosed herein with a population of proliferating cells decreases the relative cell growth rate of the population of cells by greater than at least about 35%-45%, 40%-50%, 45%-55%, 50%-60%, 55%-65%, 60%-70%, 65%-75%, 70%-80%, 75%-85%, 80%-90%, 85%-95%, or 90%-100% in comparison to cells that have not been contacted with the oligonucleotide.
  • the oligonucleotide is complementary to an mRNA from a c-myc gene at the site of the mRNA' s translation initiation region.
  • the oligonucleotide is at least 80% complementary (such as at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary) to an mRNA from a c-myc gene at the site of the mRNA's translation initiation region.
  • the c-myc antisense oligonucleotides disclosed herein the
  • oligonucleotide is complementary (such as at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%%, 96%, 97%, 98%, 99%, or 100%, including any percentages in between these values, complementary) to an mRNA from a c-myc gene at a site on the mRNA where two exons are spliced together.
  • the oligonucleotide comprises the sequence ACGTTGAGGGGCAT (SEQ ID NO:15).
  • the oligonucleotide comprises the sequence ACGTTGAGGGGCAT (SEQ ID NO:15).
  • the oligonucleotide has the sequence selected from the group consisting of
  • AACGTTGAGGGGCAT (SEQ ID NO: l), UAACGTTGAGGGGCA (SEQ ID NO:2), TAACGTTGAGGGGCAT (SEQ ID NO:3), or TTTCATTGTTTTCCA (SEQ ID NO:4), CTCGTCGTTTCCGCAACAAG (SEQ ID NO:6), ACGTTGAGGGGCATCGTCGC (SEQ ID NO:7), AACGTTGAGGGGCATCGTCG (SEQ ID NO:8), CTGCTGTCGTTGAGAGGGTA (SEQ ID NO:9), GGCATCGTCGCGGGAGGCTGCTGGAGCG (SEQ ID NO: 10),
  • GGCATCGTCGCGGGAGGCTG SEQ ID NO: 11
  • TCGTCGCGGGAGGCTGCTGG SEQ ID NO: 12
  • CCGCCCGCTCGCTCCCTCTG SEQ ID NO: 13
  • the oligonucleotide comprises the sequence AACGTTGAGGGGCAT(SEQ ID NO: l). In another embodiment, the oligonucleotide comprises the sequence UAACGTTGAGGGGCA (SEQ ID NO:2). In one embodiment, when the oligonucleotide comprises UAACGTTGAGGGGCA (SEQ ID NO:2), the 5 'uridine can be 3 '-amino-2' -hydroxy- uridine or 3 '-oxy-2' -hydroxy-uridine. In a further embodiment, the oligonucleotide comprises the sequence TAACGTTGAGGGGCAT (SEQ ID NO: 3). In yet another embodiment, the oligonucleotide comprises the sequence
  • the c-myc antisense oligonucleotide that prevents translation of an mRNA from a c-myc gene due to RNase-H-mediated degradation of the mRNA from a c-myc gene and/or steric hindrance is fluorescently labeled.
  • fluorescent labels include fluorescein, phosphor, rhodamine, and polymethine dye derivative.
  • fluorescent dyes examples include BODIPY FL (brand name, manufactured by Molecular Probe Inc.), FluorePrime (trade name, manufactured by Amersham Pharmacia), Fluoredite (trade name, manufactured by Millipore Corporation), FAIL (manufactured by ABI), Cy3 and Cy5 (manufactured by Amersham Pharmacia), and tetramethylrhodamine (TAMRA; manufactured by Molecular Probe Inc.).
  • the c-myc antisense oligonucleotide that prevents translation of an mRNA from a c-myc gene due to RNAse H-mediated degradation of the mRNA and/or steric hindrance is an oligonucleotide shown in Table 3.
  • Table 3 Mixed-action antisense oligonucleotides
  • any of the c-myc antisense oligonucleotides described herein can be conjugated to a cholesterol or lipid moiety. Conjugation of antisense oligonucleotide have been associated with increased cellular uptake as well as other improved properties for delivering nucleic acids to cells such as, but not limited to, improved pharmacokinetics (see, e.g., U.S. Patent Application Publication No. 2005/0113325, the disclosure of which is incorporated herein by reference).
  • any of the c-myc antisense oligonucleotides described herein can be conjugated to a cholesterol moiety to facilitate oligonucleotide delivery into a target cell or tissue (such as, but not limited to, a cancer cell or a tumor).
  • a cholesterol moiety is a cholesterol molecule, sterol or any compound derived from cholesterol including chlolestanol, ergosterol, stimastanol, stigmasterol, methyl-lithocholic acid, Cortisol, corticosterone, A5-pregnenolone, progesterone, deoxycorticosterone, 17-OH-pregnenolone, 17- OH-progesterone, 11-dioxy Cortisol, dehydroepiandrosterone, dehydroepiandrosterone sulfate, androstenedione, aldosterone, 18-hydroxycorticosterone, tetrahydrocortisol, tetrahydrocortisone, cortisone, prednisone, 6a-methylpredisone, 9a -fluoro-16a-hydroxyprednisolone, 9 a -fluoro- 16amethylprednisolone, 9
  • any of the c-myc antisense oligonucleotides described herein can be conjugated to a lipid moiety to facilitate oligonucleotide delivery into a target cell or tissue (such as, but not limited to, a cancer cell or a tumor).
  • the conjugated lipid moiety can be any lipid or lipid derivative that provides enhanced cellular uptake compared to the unmodified oligonucleoside.
  • the lipids are linear hydrocarbons, saturated or unsaturated, fatty acids, or fatty acid derivatives, such as fatty amides.
  • the length of the hydrocarbon chain can be from C8-C22.
  • saturated hydrocarbons include, but are not limited to, octane (CsEbo), nonane (C 9 H 2 0), decane (C10H 22 ), undecane (C11H 24 ), dodecane (C1 2 H 26 ), and tridecane (C1 3 H 28 ).
  • CsEbo octane
  • nonane C 9 H 2 0
  • decane C10H 22
  • undecane C11H 24
  • dodecane C1 2 H 26
  • tridecane C1 3 H 28
  • mono- and poly-unsaturated forms (alkenes and polyenes, such as alkadienes and alkatrienes) of hydrocarbons can also be selected.
  • mono- and poly-unsaturated lipid moieties having one to three double bonds can be utilized, although moities having more double bonds can also be employed.
  • alkynes (containing one or more triple bonds) and alkenynes (containing triple bond(s) and double bond(s)) can also be utilized.
  • a fatty alcohol can be selected.
  • the fatty alcohol is from Cie to C 20 , for example, batyl (1-O-Octadecylglycerol (Cis)).
  • Suitable lipid components include simple fatty acids and fatty acid derivatives can be conjugated to any of the c-myc antisense oligonucleotides disclosed herein.
  • fatty acids and their derivatives can be fully saturated or mono- or polyunsaturated.
  • the length of the fatty acid or fatty acid derivative chain can be from C8-C 22 .
  • saturated fatty acids include, but are not limited to, caprylic acid, capric acid, lauric acid, behenic acid, lignoceric acid, or cerotic acid. Other nonlimiting examples of saturated fatty acids are depicted in Table 5.
  • Mono- and poly-unsaturated forms of fatty acids can also be employed.
  • mono- and poly-unsaturated lipid moieties having one to three double bonds can be employed, although compounds having more double bonds can also be conjugated to the c- myc antisense oligonucleotides.
  • Fatty acids with one or more triple bonds in the carbon chain, as well as branched fatty acids, can also be used in the compounds of the invention.
  • Non-limiting examples of common mono- and poly-unsaturated fatty acids that can be employed include those depicted in Table 6.
  • the linkage between the oligonucleotide and the lipid moiety may be a direct linkage, or it may be via an optional linker moiety.
  • the linker moiety may also serve to facilitate the chemical synthesis of the compounds. Whether or not a linker group is used to mediate the conjugation of the oligonucleotide and the lipid moiety components, there are multiple sites on oligonucleoside components of the oligonucleotide to which the lipid moiety(ies) may be conveniently conjugated. Suitable linkage points include the 5' and 3' termini, one or more sugar rings, the internucleoside backbone and the nucleobases of the oligonucleoside. Typically, the lipid moiety is attached to the 3' or 5' terminus of the oligonucleoside.
  • the attachment may be directly to the 3' substituent, such as a 3'-amino group or 3 '-hydroxy group.
  • the lipid moiety may be linked via a 3'-linked phosphate group. If the lipid moiety is to be linked to the 5' terminus, it is typically attached through a 5'-linked phosphate group.
  • Attachment of the lipid moiety to a base on the oligonucleoside may through any suitable atom, for example to the N 2 amino group of guanosine.
  • Examples of preferred linker groups x include amino glycerol and O-alkyl glycerol-type linkers, which can be depicted, respectively, by the generic structures: -NR-(CH 2 ) m -CH(R')-(CH 2 ) n -Z- and -0-(CH 2 )-CH(OR')-(CH 2 )-0-
  • one or two lipid or cholesterol moieties can be conjugated to a c- myc antisense oligonucleotide.
  • the one or two lipid or cholesterol moieties can be conjugated to a c-myc antisense oligonucleotide by a linker, such as any of the linkers disclosed above.
  • one lipid or cholesterol moiety is used, it can be conjugated to either the 5' or 3' end of the oligonucleotide.
  • each lipid or cholesterol moiety component can be identical or can be selected independently.
  • a palmitic acid lipid moiety is not conjugated to a c-myc antisense oligonucleotide wherein the intersubunit linkages of the oligonucleotide are entirely NPS and wherein the oligonucleotide has the sequence AACGTTGAGGGGCAT (SEQ ID NO: l).
  • contacting any of the oligonucleotides disclosed herein with a proliferating cell decreases relative c-myc protein expression in the cell by greater than at least about 35% (such as at least about 40%, 45%, 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, inclusive, including any percentages in between these values) in comparison to cells that have not been contacted with the
  • contacting any of the oligonucleotides disclosed herein with a proliferating cell decreases relative c-myc protein expression in the cell by greater than at least about 35%-45%, 40%-50%, 45%-55%, 50%-60%, 55%-65%, 60%-70%, 65%-75%, 70%- 80%, 75%-85%, 80%-90%, 85%-95%, or 90%-100% in comparison to cells that have not been contacted with the oligonucleotide. In other embodiments, contacting any of the
  • oligonucleotides disclosed herein with a population of proliferating cells decreases the relative cell growth rate of the population of cells by greater than at least about 35% (such as at least 40%, 45%, 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, inclusive, including any percentages in between these values) in comparison to cells that have not been contacted with the oligonucleotide.
  • contacting any of the oligonucleotides disclosed herein with a population of proliferating cells decreases the relative cell growth rate of the population of cells by greater than at least about 35%-45%, 40%-50%, 45%-55%, 50%-60%, 55%-65%, 60%-70%, 65%-75%, 70%-80%, 75%-85%, 80%-90%, 85%-95%, or 90%-100% in comparison to cells that have not been contacted with the oligonucleotide.
  • the oligonucleotide is complementary to an mRNA from a c-myc gene at the site of the mRNA's translation initiation region. In other embodiments, the oligonucleotide is at least 80% complementary (such as at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary) to an mRNA from a c-myc gene at the site of the mRNA's translation initiation region. In other embodiments of any of the c-myc antisense
  • the oligonucleotide is complementary (such as at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%%, 96%, 97%, 98%, 99%, or 100%, including any percentages in between these values, complementary) to an mRNA from a c-myc gene at a site on the mRNA where two exons are spliced together.
  • the oligonucleotide comprises the sequence ACGTTGAGGGGCAT (SEQ ID NO: 15).
  • the oligonucleotide comprises the sequence TCGTCGCGGGAGGCTG (SEQ ID NO:16). In some embodiments of any of the embodiments herein, the oligonucleotide has the sequence selected from the group consisting of AACGTTGAGGGGCAT (SEQ ID NO: l), UAACGTTGAGGGGCA (SEQ ID NO:2), TAACGTTGAGGGGCAT (SEQ ID NO:3), or TTTCATTGTTTTCCA (SEQ ID NO:4), CTCGTCGTTTCCGCAACAAG (SEQ ID NO:6), ACGTTGAGGGGCATCGTCGC (SEQ ID NO:7), AACGTTGAGGGGCATCGTCG (SEQ ID NO:8), CTGCTGTCGTTGAGAGGGTA (SEQ ID NO:9), GGCATCGTCGCGGGAGGCTGCTGGAGCG (SEQ ID NO: 10),
  • GGCATCGTCGCGGGAGGCTG SEQ ID NO: 11
  • TCGTCGCGGGAGGCTGCTGG SEQ ID NO: 12
  • CCGCCCGCTCGCTCCCTCTG SEQ ID NO: 13
  • the oligonucleotide comprises the sequence AACGTTGAGGGGCAT (SEQ ID NO: l). In another embodiment, the oligonucleotide comprises the sequence UAACGTTGAGGGGCA (SEQ ID NO:2). In one embodiment, when the oligonucleotide comprises UAACGTTGAGGGGCA (SEQ ID NO:2), the 5 'uridine can be 3 '-amino-2' -hydroxy- uridine or 3 '-oxy-2' -hydroxy-uridine. In a further embodiment, the oligonucleotide comprises the sequence TAACGTTGAGGGGCAT (SEQ ID NO: 3). In yet another embodiment, the oligonucleotide comprises the sequence TTTCATTGTTTTCCA (SEQ ID NO:4). In another embodiment, a palmitic acid is conjugated to the 5' end of the oligonucleotide.
  • Antisense oligonucleotides of the present invention described as being conjugated to a specified hydrocarbon or a specified fatty acid (with the same number of carbon atoms as the specified hydrocarbon) are closely related and differ in structure only in the nature of the bond that joins the moiety to the oligonucleotide, which in turn is a result of the synthesis procedure used to produce the conjugated compound.
  • the use of the aldehyde form of a fatty acid (a fatty aldehyde) as the starting material results in the formation of an amine linkage between the lipid chain and the oligonucleoside, such that the lipid group appears as a hydrocarbon.
  • fatty acid when describing the conjugated lipid group is used broadly herein to include fatty acid derivatives, including fatty amides).
  • Techniques for conjugating lipid or cholesterol moieties to oligonucleotides can be found, inter alia, in U.S. Patent No. 7,494,982, the disclosure of which is incorporated herein in its entirety.
  • any of the c-myc antisense oligonucleotides disclosed herein can further comprise one or more modified or substituted sugar moieties.
  • the oligonucleotides comprise one of the following substitutions at the 2' position: OH; F; O— , S— , or N-alkyl; O— , S— , or N-alkenyl; O— , S— or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl can be substituted or unsubstituted Ci to C 10 alkyl or C 2 to C 10 alkenyl and alkynyl.
  • oligonucleotides can comprise one of the following at the 2' position: Q to Cio lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O- aralkyl, SH, SCH 3 , OCN, CI, Br, CN, CF 3 , OCF 3 , SOCH 3 , S0 2 CH 3 , ON0 2 , N0 2 , N 3 , NH 2 , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the
  • Another modification can include 2'-methoxyethoxy (2'-0- CH 2 CH 2 OCH 3 , also known as 2'-0-(2-methoxy ethyl) or 2'-MOE) i.e., an alkoxyalkoxy group.
  • a further modification can include 2'-dimethylaminooxyethoxy, i.e., a 0( ⁇ 3 ⁇ 4) 2 0 ⁇ (03 ⁇ 4) 2 group, also known as 2'- DMAOE, as described in examples herein, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-0-dimethyl-amino-ethoxy-ethyl or 2'-DMAEOE), i.e. , 2'-0— CH 2 — O— CH 2 — N(CH 3 ) 2 , also described in examples herein.
  • the 2'-modification can be in the arabino (up) position or ribo (down) position.
  • a 2'-arabino modification can be 2'-F.
  • Oligonucleotides can also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar.
  • Representative U.S. patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Pat. Nos. 5,514,785; 5,519,134; 5,567,811 ; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; 5,792,747; and 5,700,920, 20 each of which is herein incorporated by reference in its entirety.
  • any of the c-myc antisense oligonucleotides disclosed herein can also include nucleobase modifications or substitutions.
  • "unmodified” or “natural” nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
  • Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, N-alkyl N-derivatives of 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (— 0 A C— CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8- thioalkyl,
  • nucleobases include tricyclic pyrimidines such as phenoxazine cytidine (lH-pyrimido[5,4- b] [l,4]benzoxazin2(3H)-one), phenothiazine cytidine (lH-pyrimido[5,4-b] [l, 4]benzothiazin- 2(3H)-one), G-clamps such as a substituted phenoxazine cytidine (e.g.
  • nucleobases can also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.
  • nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. I., ed. John Wiley & Sons, 1990, those disclosed by Englisch et al., Angewandte Chemie,
  • nucleobases are particularly useful for increasing the binding affinity of the compounds of the invention.
  • These include 5-substituted pyrimidines, 6- azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5- propynyluracil and 5-propynylcytosine.
  • 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability and can be included as base substitutions, even more particularly when combined with 2'-0-methoxyethyl sugar modifications.
  • the c-myc antisense oligonucleotides disclosed herein can be formulated with a pharmaceutically acceptable excipient or carrier to be formulated into a pharmaceutical composition.
  • the c-myc antisense oligonucleotides can be administered in the form of pharmaceutical compositions. These compounds can be
  • compositions are prepared in a manner well known in the art.
  • the c-myc antisense oligonucleotides disclosed herein are protected from acid digestion in the stomach by a pharmaceutically acceptable protectant.
  • compositions which contain, as the active ingredient, one or more of the antisense oligonucleotides associated with one or more pharmaceutically acceptable excipients or carriers.
  • the active ingredient is usually mixed with an excipient or carrier, diluted by an excipient or carrier or enclosed within such an excipient or carrier which can be in the form of a capsule, sachet, paper or other container.
  • the excipient or carrier serves as a diluent, it can be a solid, semi-solid, or liquid material, which acts as a vehicle, carrier or medium for the active ingredient.
  • compositions can be in the form of tablets, pills, powders, lozenges, sachets, cachets, elixirs, suspensions, emulsions, solutions, syrups, aerosols (as a solid or in a liquid medium), ointments containing, for example, up to 10% by weight of the active compound, soft and hard gelatin capsules, suppositories, sterile injectable solutions, and sterile packaged powders.
  • the active lyophilized compound it may be necessary to mill the active lyophilized compound to provide the appropriate particle size prior to combining with the other ingredients. If the active compound is substantially insoluble, it ordinarily is milled to a particle size of less than 200 mesh. If the active compound is substantially water soluble, the particle size is normally adjusted by milling to provide a substantially uniform distribution in the formulation, e.g. about 40 mesh.
  • excipients or carriers include lactose, dextrose, sucrose, sorbitol, mannitol, starches, gum acacia, calcium phosphate, alginates, tragacanth, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, sterile water, syrup, and methyl cellulose.
  • the formulations can additionally include: lubricating agents such as talc, magnesium stearate, and mineral oil; wetting agents; emulsifying and suspending agents; preserving agents such as methyl- and propylhydroxy-benzoates; sweetening agents; and flavoring agents.
  • the compositions of the invention can be formulated so as to provide quick, sustained or delayed release of the active ingredient after administration to the patient by employing procedures known in the art.
  • compositions can be formulated in a unit dosage form, each dosage containing from about 5 mg to about 100 mg or more, such as any of about 1 mg to about 5 mg, 1 mg to about 10 mg, about 1 mg to about 20 mg, about 1 mg to about 30 mg, about 1 mg to about 40 mg, about 1 mg to about 50 mg, about 1 mg to about 60 mg, about 1 mg to about 70 mg, about 1 mg to about 80 mg, or about 1 mg to about 90 mg, inclusive, including any range in between these values, of the active ingredient.
  • unit dosage forms refers to physically discrete units suitable as unitary dosages for individuals, each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect, in association with a suitable pharmaceutical excipient or carrier.
  • the antisense oligonucleotides are effective over a wide dosage range and are generally administered in a therapeutically effective amount. It will be understood, however, that the amount of the antisense oligonucleotides actually administered will be determined by a physician, in the light of the relevant circumstances, including the condition to be treated, the chosen route of administration, the actual compound administered, the age, weight, and response of the individual patient, the severity of the patient's symptoms, and the like.
  • the principal active ingredient antisense oligonucleotide is mixed with a pharmaceutical excipient or carrier to form a solid
  • preformulation composition containing a homogeneous mixture of a compound of the present invention.
  • preformulation compositions as homogeneous, it is meant that the active ingredient is dispersed evenly throughout the composition so that the composition can be readily subdivided into equally effective unit dosage forms such as tablets, pills and capsules.
  • the tablets or pills of the present invention can be coated or otherwise compounded to provide a dosage form affording the advantage of prolonged action and to protect the c-myc antisense oligonucleotide from acid hydrolysis in the stomach.
  • the tablet or pill can comprise an inner dosage and an outer dosage component, the latter being in the form of an envelope over the former.
  • the two components can be separated by an enteric layer which serves to resist disintegration in the stomach and permit the inner component to pass intact into the duodenum or to be delayed in release.
  • enteric layers or coatings such materials including a number of polymeric acids and mixtures of polymeric acids with such materials as shellac, cetyl alcohol, and cellulose acetate.
  • liquid forms in which the novel compositions of the present invention can be incorporated for administration orally or by injection include aqueous solutions, suitably flavored syrups, aqueous or oil suspensions, and flavored emulsions with edible oils such as corn oil, cottonseed oil, sesame oil, coconut oil, or peanut oil, as well as elixirs and similar pharmaceutical vehicles.
  • compositions for inhalation or insufflation include solutions and suspensions in pharmaceutically acceptable, aqueous or organic solvents, or mixtures thereof, and powders.
  • the liquid or solid compositions can contain suitable pharmaceutically acceptable excipients as described supra.
  • the compositions can be administered by the oral or nasal respiratory route for local or systemic effect.
  • Compositions in pharmaceutically acceptable solvents can be nebulized by use of inert gases. Nebulized solutions can be inhaled directly from the nebulizing device or the nebulizing device can be attached to a face mask tent, or intermittent positive pressure breathing machine. Solution, suspension, or powder compositions can also be administered, orally or nasally, from devices which deliver the formulation in an appropriate manner.
  • the antisense oligonucleotides (such as in compositions) disclosed herein can be used for the treatment and/or prevention of a cell proliferative disorder.
  • the individual is diagnosed with or is suspected of having a cell proliferative disorder.
  • the present invention is directed to methods for inhibiting the symptoms or conditions (disabilities, impairments) associated with a cell proliferative disorder as described in detail below. As such, it is not required that all effects of the condition be entirely prevented or reversed, although the effects of the presently disclosed methods likely extend to a significant therapeutic benefit for the patient.
  • a therapeutic benefit is not necessarily a complete prevention or cure for a particular condition resulting from a cell proliferative disorder, but rather, can encompass a result which includes reducing or preventing the symptoms that result from a cell proliferative disorder, reducing or preventing the occurrence of such symptoms (either quantitatively or qualitatively), reducing the severity of such symptoms or physiological effects thereof, and/or enhancing the recovery of the individual after experiencing a cell proliferative disorder symptoms.
  • a composition of the present invention when administered to an individual, can treat or prevent one or more of the symptoms or conditions associated with a cell proliferative disorder and/or reduce or alleviate symptoms of or conditions associated with this disorder.
  • protecting an individual from the effects or symptoms resulting from an a cell proliferative disorder includes both preventing or reducing the occurrence and/or severity of the effects of the disorder and treating a patient in which the effects of the disorder are already occurring or beginning to occur.
  • a beneficial effect can easily be assessed by one of ordinary skill in the art and/or by a trained clinician who is treating the patient.
  • adjuvant setting refers to a clinical setting in which an individual has had a history of a proliferative disease, particularly cancer, and generally (but not necessarily) been responsive to therapy, which includes, but is not limited to, surgery (such as surgical resection), radiotherapy, and chemotherapy. However, because of their history of the proliferative disease (such as cancer), these individuals are considered at risk of development of the disease.
  • Treatment or administration in the "adjuvant setting” refers to a subsequent mode of treatment.
  • the degree of risk i.e., when an individual in the adjuvant setting is considered as "high risk” or "low risk) depends upon several factors, most usually the extent of disease when first treated.
  • the methods provided herein can also be practiced in a "neoadjuvant setting," i.e., the method can be carried out before the primary/definitive therapy.
  • the individual has previously been treated.
  • the individual has not previously been treated.
  • the treatment is a first line therapy.
  • a “proliferative disorder” is any cellular disorder in which the cells proliferate more rapidly than normal tissue growth.
  • a “proliferating cell” is a cell that is proliferating more rapidly than normal cells.
  • the proliferative disorder includes, but is not limited to, neoplasms.
  • a “neoplasm” is an abnormal tissue growth, generally forming a distinct mass that grows by cellular proliferation more rapidly than normal tissue growth. Neoplasms show partial or total lack of structural organization and functional coordination with normal tissue. These can be broadly classified into three major types.
  • Malignant neoplasms arising from epithelial structures are called carcinomas, malignant neoplasms that originate from connective tissues such as muscle, cartilage, fat or bone are called sarcomas and malignant tumors affecting hematopoetic structures (structures pertaining to the formation of blood cells) including components of the immune system, are called leukemias and lymphomas.
  • a tumor is the neoplastic growth of the disease cancer.
  • a neoplasm also referred to as a "tumor”
  • Other proliferative disorders include, but are not limited to neurofibromatosis.
  • the c-myc antisense oligonucleotides (such as in compositions) provided herein are useful for modulating disease states associated with dysregulation of c-myc expression in cells.
  • the c-myc gene is involved in multiple biological and physiological functions, including, e.g., cell proliferation.
  • the cell proliferative disorder is associated with increased expression or activity of c-myc or cellular growth, or both.
  • the cell proliferation is cancer.
  • a method of treating lung cancer including, for example, non-small cell lung cancer (NSCLC, such as advanced NSCLC), small cell lung cancer (SCLC, such as advanced SCLC), and advanced solid tumor malignancy in the lung.
  • NSCLC non-small cell lung cancer
  • SCLC small cell lung cancer
  • advanced solid tumor malignancy in the lung there is provided a method of treating any of ovarian cancer, head and neck cancer, gastric malignancies, melanoma (including metastatic melanoma and malignant melanoma), ovarian cancer, colorectal cancer, and pancreatic cancer.
  • the method is useful for treating one or more of the following: cutaneous T cell lymphoma (CTCL), leukemia, follicular lymphoma, Hodgkin lymphoma, and acute myeloid leukemia.
  • CCL cutaneous T cell lymphoma
  • the disease is a cancer of any one of the following: basal cell carcinoma, medulloblastoma, glioblastoma, multiple myeloma, chronic myelogenous leukemia (CML), acute myelogenous leukemia, pancreatic cancer, lung cancer (small cell lung cancer and non-small cell lung cancer), esophageal cancer, stomach cancer, biliary cancer, prostate cancer, liver cancer, hepatocellular cancer, gastrointestinal cancer, gastric cancer, and ovarian and bladder cancer.
  • basal cell carcinoma medulloblastoma
  • glioblastoma multiple myeloma
  • multiple myeloma multiple myeloma
  • chronic myelogenous leukemia (CML) chronic myelogenous leukemia
  • pancreatic cancer lung cancer (small cell lung cancer and non-small cell lung cancer), esophageal cancer, stomach cancer, biliary cancer, prostate cancer, liver cancer, hepatocellular cancer,
  • the cancer is selected from the group consisting of pancreas ductal adenocarcinoma, colon adenocarcinoma, and ovary cystadenocarcinoma. In some embodiments, the cancer is pancreas ductal adenocarcinoma. In some embodiments, the cancer is a tumor that is poorly perfused and/or poorly vascularized.
  • the cancer is pancreatic cancer, including for example pancreatic adenocarcinoma, pancreatic adenosquamous carcinoma, pancreatic squamous cell carcinoma, and pancreatic giant cell carcinoma.
  • the pancreatic cancer is exocrine pancreatic cancer.
  • the pancreatic cancer is endocrine pancreatic cancer (such as islet cell carcinoma).
  • the pancreatic cancer is advanced metastatic pancreatic cancer.
  • lymphangiomyomatosis rectal cancer, renal cancer, renal pelvis and ureter cancer (transitional cell cancer), rhabdomyosarcoma, salivary gland cancer, skin cancer (e.g., non-melanoma (e.g., squamous cell carcinoma), melanoma, and Merkel cell carcinoma), small intestine cancer, squamous cell cancer, testicular cancer, throat cancer, thymoma and thymic carcinoma, thyroid cancer, tuberous sclerosis, urethral cancer, vaginal cancer, vulvar cancer, Wilms' tumor, and post-transplant lymphoproliferative disorder (PTLD), abnormal vascular proliferation associated with phakomatoses, edema (such as that associated with brain tumors), and Meigs' syndrome.
  • PTLD post-transplant lymphoproliferative disorder
  • the cancer is a solid tumor (such as advanced solid tumor).
  • Solid tumor includes, but is not limited to, sarcomas and carcinomas such as fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, Kaposi's sarcoma, soft tissue sarcoma, uterine sacronomasynovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary a
  • cystadenocarcinoma medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma (including for example adenocarcinoma, clear cell renal cell carcinoma, papillary renal cell carcinoma, chromophobe renal cell carcinoma, collecting duct renal cell carcinoma, granular renal cell carcinoma, mixed granular renal cell carcinoma, renal angiomyolipomas, or spindle renal cell carcinoma.), hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilm's tumor, cervical cancer, testicular tumor, lung carcinoma, small cell lung carcinoma, bladder carcinoma, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, menangioma, melanoma, neuroblastoma, and
  • the lymphoid neoplasm is a B-cell neoplasm.
  • B-cell neoplasms include, but are not limited to, precursor B-cell neoplasms (e.g., precursor B -lymphoblastic leukemia/lymphoma) and peripheral B-cell neoplasms (e.g., B-cell chronic lymphocytic leukemia/prolymphocytic leukemia/small lymphocytic lymphoma (small lymphocytic (SL) NHL), lymphoplasmacytoid lymphoma/immunocytoma, mantel cell lymphoma, follicle center lymphoma, follicular lymphoma (e.g., cytologic grades: I (small cell), II (mixed small and large cell), III (large cell) and/or subtype: diffuse and predominantly small cell type), low grade/follicular non-Ho
  • the lymphoid neoplasm is a T-cell and/or putative NK-cell neoplasm.
  • T-cell and/or putative NK-cell neoplasms include, but are not limited to, precursor T-cell neoplasm (precursor T-lymphoblastic lymphoma/leukemia) and peripheral T-cell and NK-cell neoplasms (e.g., T-cell chronic lymphocytic
  • LGL large granular lymphocyte leukemia
  • T-cell type and/or NK-cell type e.g., T-cell type and/or NK-cell type
  • cutaneous T-cell lymphoma e.g., mycosis fungoides/Sezary syndrome
  • primary T-cell lymphomas unspecified e.g., cytological categories (e.g., medium- sized cell, mixed medium and large cell), large cell, lymphoepitheloid cell, subtype
  • hepatosplenic ⁇ T-cell lymphoma hepatosplenic ⁇ T-cell lymphoma, and subcutaneous panniculitic T-cell lymphoma
  • angioimmunoblastic T-cell lymphoma AILD
  • angiocentric lymphoma intestinal T-cell lymphoma (e.g., +/- enteropathy associated), adult T-cell lymphoma/leukemia (ATL), anaplastic large cell lymphoma (ALCL) (e.g., CD30+, T- and null-cell types), anaplastic large-cell lymphoma, and Hodgkin' s lymphoma).
  • the lymphoid neoplasm is Hodgkin' s disease.
  • the Hodgkin' s disease can be lymphocyte predominance, nodular sclerosis, mixed cellularity, lymphocyte depletion, and/or lymphocyte-rich.
  • the cancer is leukemia.
  • the leukemia is chronic leukemia.
  • Examples of chronic leukemia include, but are not limited to, chronic myelocytic I (granulocytic) leukemia, chronic myelogenous, and chronic lymphocytic leukemia (CLL).
  • CLL chronic lymphocytic leukemia
  • the leukemia is acute leukemia.
  • acute leukemia examples include, but are not limited to, acute lymphoblastic leukemia (ALL), acute myeloid leukemia, acute lymphocytic leukemia, and acute myelocytic leukemia (e.g., myeloblastic, promyelocytic, myelomonocytic, monocytic, and erythroleukemia).
  • ALL acute lymphoblastic leukemia
  • acute myeloid leukemia e.g., acute myeloid leukemia, acute lymphocytic leukemia
  • acute myelocytic leukemia e.g., myeloblastic, promyelocytic, myelomonocytic, monocytic, and erythroleukemia.
  • the cancer is liquid tumor or plasmacytoma.
  • Plasmacytoma includes, but is not limited to, myeloma.
  • Myeloma includes, but is not limited to, an
  • extramedullary plasmacytoma a solitary myeloma, and multiple myeloma.
  • the plasmacytoma is multiple myeloma.
  • the cancer is multiple myeloma.
  • multiple myeloma include, but are not limited to, IgG multiple myeloma, IgA multiple myeloma, IgD multiple myeloma, IgE multiple myeloma, and nonsecretory multiple myeloma.
  • the multiple myeloma is IgG multiple myeloma.
  • the multiple myeloma is IgA multiple myeloma.
  • the multiple myeloma is a smoldering or indolent multiple myeloma.
  • the multiple myeloma is progressive multiple myeloma.
  • multiple myeloma may be resistant to a drug, such as, but not limited to, bortezomib, dexamethasone (Dex-), doxorubicin (Dox-), and melphalan (LR).
  • a drug such as, but not limited to, bortezomib, dexamethasone (Dex-), doxorubicin (Dox-), and melphalan (LR).
  • the cell proliferative disorder is associated with increased expression or activity of c-myc or cellular growth, or both.
  • the cell proliferation is cancer.
  • the cancer is liver cancer, lymphoma, lung cancer, glioblastoma, pancreatic cancer, sarcoma, renal cell carcinoma, gastric cancer, colorectal cancer, or breast cancer.
  • the cancer is stage Illb and/or stage IV.
  • the cancer is locally advanced or metastatic cancer.
  • the cancer is c-myc positive (i.e. the cancer cells express c-myc, for example, as determined by immunohistochemistry (IHC)).
  • administration of the c-myc antisense oligonucleotide comprises contacting one or more cancer cells with the oligonucleotide.
  • administration of the therapeutically effective amount of one or more of the oligonucleotides results in one or more of reduced cellular proliferation, increased apoptosis, or cellular senescence.
  • administration of the therapeutically effective amount of one or more of the oligonucleotides does not result in significant toxicity or morbidity in the individual.
  • the individual is a human.
  • kits for treating a pathological condition associated with dysregulation of c-myc expression in a subject comprising administering to an individual in need thereof a therapeutically effective amount of a c-myc antisense
  • the cell proliferative disorder is associated with increased expression or activity of c-myc or cellular growth, or both.
  • the cell proliferation is cancer.
  • the cancer is liver cancer, lymphoma, lung cancer, glioblastoma, pancreatic cancer, sarcoma, renal cell carcinoma, gastric cancer, colorectal cancer, or breast cancer.
  • the cancer is stage Illb and/or stage IV.
  • the cancer is locally advanced or metastatic cancer.
  • the therapy is second line or third line therapy.
  • the cancer is c-myc positive (i.e.
  • administration of the c-myc antisense oligonucleotide comprises contacting one or more cancer cells with the oligonucleotide.
  • administration of the therapeutically effective amount of one or more of the oligonucleotides results in one or more of reduced cellular proliferation, increased apoptosis, or cellular senescence.
  • the individual is a human.
  • the cell has abnormally high cellular growth.
  • the cell is a cancer cell.
  • the cancer is liver cancer, lymphoma, lung cancer, glioblastoma, pancreatic cancer, sarcoma, renal cell carcinoma, gastric cancer, colorectal cancer, or breast cancer.
  • the cancer is stage Illb and/or stage IV.
  • the cancer is locally advanced or metastatic cancer.
  • the therapy is second line or third line therapy.
  • the cancer is c-myc positive (i.e. the cancer cells express c-myc for example, as determined by immunohistochemistry (IHC)).
  • administration of the c- myc antisense oligonucleotide comprises contacting one or more cancer cells with the oligonucleotide.
  • administration of the therapeutically effective amount of one or more of the oligonucleotides results in one or more of reduced cellular proliferation, increased apoptosis, or cellular senescence. In another embodiment, administration of the therapeutically effective amount of one or more of the oligonucleotides does not result in significant toxicity or morbidity in the individual. In some embodiments, the individual is a human.
  • the c-myc antisense oligonucleotide (such as any of the c-myc antisense oligonucleotides disclosed herein) is administered in the form of an injection.
  • the injection can comprise the compound in combination with an aqueous injectable excipient or carrier.
  • suitable aqueous injectable excipients or carriers are well known to persons of ordinary skill in the art, and they, and the methods of formulating the formulations, may be found in such standard references as Alfonso AR: Remington's
  • Suitable aqueous injectable excipients or carriers include water, aqueous saline solution, aqueous dextrose solution, and the like, optionally containing dissolution enhancers such as 10% mannitol or other sugars, 10% glycine, or other amino acids.
  • the composition can be injected subcutaneously, intraperitoneally, or intravenously.
  • intravenous administration is used, and it can be continuous intravenous infusion over a period of a few minutes to an hour or more, such as around fifteen minutes.
  • the amount administered can vary widely depending on the type of antisense oligonucleotide, size of a unit dosage, kind of excipients or carriers, and other factors well known to those of ordinary skill in the art.
  • the antisense oligonucleotide can comprise, for example, from about 0.001% to about 10% (w/w), from about 0.01% to about 1%, from about 0.1% to about 0.8%, or any range therein, with the remainder comprising the excipient(s) or carrier(s).
  • the c-myc antisense oligonucleotide can take the form of, for example, tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients or carriers such as binding agents; fillers; lubricants; disintegrants; or wetting agents.
  • Liquid preparations for oral administration can take the form of, for example, solutions, syrups or suspensions, or they can be presented as a dry product for constitution with water or other suitable vehicle before use.
  • Such liquid preparations can be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, cellulose derivatives or hydrogenated edible fats); emulsifying agents (e.g., lecithin or acacia); non-aqueous vehicles (e.g., ationd oil, oily esters, ethyl alcohol or fractionated vegetable oils); and preservatives (e.g., methyl or propyl-p- hydroxybenzoates or sorbic acid).
  • suspending agents e.g., sorbitol syrup, cellulose derivatives or hydrogenated edible fats
  • emulsifying agents e.g., lecithin or acacia
  • non-aqueous vehicles e.g., ationd oil, oily esters, ethyl alcohol or fractionated vegetable oils
  • preservatives e.g., methyl or propyl-p- hydroxybenzoates or sorbic acid.
  • the c-myc antisense oligonucleotide can be administered by inhalation through an aerosol spray or a nebulizer that can include a suitable propellant such as, for example, dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide, or a combination thereof.
  • a dosage unit for a pressurized aerosol can be delivered through a metering valve.
  • capsules and cartridges of gelatin for example, can be used in an inhaler and can be formulated to contain a powderized mix of the compound with a suitable powder base such as, for example, starch or lactose.
  • the amount of c-myc antisense oligonucleotide in the composition is included in any of the following ranges: about 0.5 to about 5 mg, about 5 to about 10 mg, about 10 to about 15 mg, about 15 to about 20 mg, about 20 to about 25 mg, about 20 to about 50 mg, about 25 to about 50 mg, about 50 to about 75 mg, about 50 to about 100 mg, about 75 to about 100 mg, about 100 to about 125 mg, about 125 to about 150 mg, about 150 to about 175 mg, about 175 to about 200 mg, about 200 to about 225 mg, about 225 to about 250 mg, about 250 to about 300 mg, about 300 to about 350 mg, about 350 to about 400 mg, about 400 to about 450 mg, or about 450 to about 500 mg.
  • the amount of a of c-myc antisense oligonucleotide in the effective amount of the pharmaceutical composition is in the range of about 5 mg to about 500 mg, such as about 30 mg to about 300 mg or about 50 mg to about 200 mg. In some
  • the concentration of the of c-myc antisense oligonucleotide in the pharmaceutical composition is dilute (about 0.1 mg/ml) or concentrated (about 100 mg/ml), including for example any of about 0.1 to about 50 mg/ml, about 0.1 to about 20 mg/ml, about 1 to about 10 mg/ml, about 2 mg/ml to about 8 mg/ml, about 4 to about 6 mg/ml, about 5 mg/ml.
  • the concentration of the of c-myc antisense oligonucleotide is at least about any of 0.5 mg/ml, 1.3 mg/ml, 1.5 mg/ml, 2 mg/ml, 3 mg/ml, 4 mg/ml, 5 mg/ml, 6 mg/ml, 7 mg/ml, 8 mg/ml, 9 mg/ml, 10 mg/ml, 15 mg/ml, 20 mg/ml, 25 mg/ml, 30 mg/ml, 40 mg/ml, or 50 mg/ml.
  • compositions include, but are not limited to, at least about any of 25 mg/m 2 , 30 mg/m 2 , 50 mg/m2 , 60 mg/m2 , 75 mg/m2 , 80 mg/m2 , 90 mg/m2 , 100 mg/m 2 , 120 mg/m 2 , 125 mg/m 2 , 150 mg/m 2 , 160 mg/m 2 , 175 mg/m 2 , 180 mg/m 2 , 200 mg/m 2 , 210 mg/m 2 , 220 mg/m 2 , 250 mg/m 2 , 260 mg/m 2 , 300 mg/m 2 , 350 mg/m 2 , 400 mg/m 2 , 500 mg/m 2 , 540 mg/m 2 , 750 mg/m 2 , 1000 mg/m 2 , or 1080 mg/m 2 .
  • the pharmaceutical composition includes less than about any of 350 mg/m 2", 300 mg/m 2", 250 mg/m 2", 200 mg/m 2", 150 mg/m 2", 120 mg/m 2 , 100 mg/m 2 , 90 mg/m 2 , 50 mg/m 2 , or 30 mg/m 2 of a of c-myc antisense oligonucleotide.
  • the amount of the of c-myc antisense oligonucleotide per administration is less than about any of 25 mg/m 2 , 22 mg/m 2 , 20 mg/m 2 , 18 mg/m 2 , 15 mg/m 2 , 14 mg/m 2 , 13 mg/m 2 , 12 mg/m 2 , 11 mg/m 2 , 10 mg/m 2 , 9 mg/m2 , 8 mg/m2 , 7 mg/m2 , 6 mg/m2 , 5 mg/m2 , 4 mg/m 2 , 3 mg/m 2 , 2 mg/m 2 , or 1 mg/m 2 .
  • the effective amount of a of c- myc antisense oligonucleotide in the pharmaceutical composition is included in any of the following ranges: about 1 to about 5 mg/m2, about 5 to about 10 mg/m 2 , about 10 to about 25 mg/m 2 , about 25 to about 50 mg/m 2 , about 50 to about 75 mg/m 2 , about 75 to about 100 mg/m 2 , about 100 to about 125 mg/m 2 , about 125 to about 150 mg/m 2 , about 150 to about 175 mg/m 2 , about 175 to about 200 mg/m 2 , about 200 to about 225 mg/m 2 , about 225 to about 250 mg/m 2 , about 250 to about 300 mg/m 2 , about 300 to about 350 mg/m 2 , or about 350 to about 400 mg/m 2 .
  • the effective amount of a of c-myc antisense oligonucleotide in the pharmaceutical composition is about 5 to about 300 mg/m 2 , such as about 20 to about 300 mg/m 2 , about 50 to about 250 mg/m 2 , about 100 to about 150 mg/m 2 , about 120 mg/m 2 , about 130 mg/m 2 , or about 140 mg/m 2 , or about 260 mg/m2 '
  • the effective amount of a c-myc antisense oligonucleotide in the pharmaceutical composition includes at least about any of 1 mg/kg, 2.5 mg/kg, 3.5 mg/kg, 5 mg/kg, 6.5 mg/kg, 7.5 mg/kg, 10 mg/kg, 15 mg/kg, or 20 mg/kg.
  • the effective amount of a of c-myc antisense oligonucleotide in the pharmaceutical composition includes less than about any of 350 mg/kg, 300 mg/kg, 250 mg/kg, 200 mg/kg, 150 mg/kg, 100 mg/kg, 50 mg/kg, 30 mg/kg, 25 mg/kg, 20 mg/kg, 10 mg/kg, 7.5 mg/kg, 6.5 mg/kg, 5 mg/kg, 3.5 mg/kg, 2.5 mg/kg, or 1 mg/kg of a of c-myc antisense oligonucleotide.
  • Exemplary dosing frequencies for the pharmaceutical compositions include, but are not limited to, daily; every other day; twice per week; three times per week; weekly without break; weekly, three out of four weeks; once every three weeks; once every two weeks; weekly, two out of three weeks.
  • the pharmaceutical composition is administered about once every 2 weeks, once every 3 weeks, once every 4 weeks, once every 6 weeks, or once every 8 weeks.
  • the composition is administered at least about any of lx, 2x, 3x, 4x, 5x, 6x, or 7x (i.e., daily) a week, or three times daily, two times daily.
  • the intervals between each administration are less than about any of 6 months, 3 months, 1 month, 20 days, 15 days, 12 days, 10 days, 9 days, 8 days, 7 days, 6 days, 5 days, 4 days, 3 days, 2 days, or 1 day.
  • the intervals between each administration are more than about any of 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 8 months, or 12 months.
  • the interval between each administration is no more than about a week.
  • the administration of the pharmaceutical composition can be extended over an extended period of time, such as from about a month up to about seven years.
  • the composition is administered over a period of at least about any of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 18, 24, 30, 36, 48, 60, 72, or 84 months.
  • any of the methods disclosed herein can further comprise administering to the individual a therapeutically effective amount (such as any of the therapeutically effective amounts described above) of one or more additional anticancer therapeutic agents in addition to any of the c-myc antisense oligonucleotides disclosed herein (such as in a pharmaceutical composition).
  • a therapeutically effective amount such as any of the therapeutically effective amounts described above
  • additional anticancer therapeutic agents in addition to any of the c-myc antisense oligonucleotides disclosed herein (such as in a pharmaceutical composition).
  • Various classes of anti-cancer agents can be used.
  • Non-limiting examples include: alkylating agents, antimetabolites, anthracyclines, plant alkaloids, topoisomerase inhibitors, podophyllotoxin, antibodies (e.g., monoclonal or polyclonal), tyrosine kinase inhibitors (e.g., imatinib mesylate (Gleevec® or Glivec®)), hormone treatments, soluble receptors and other antineoplastics.
  • alkylating agents include: antimetabolites, anthracyclines, plant alkaloids, topoisomerase inhibitors, podophyllotoxin, antibodies (e.g., monoclonal or polyclonal), tyrosine kinase inhibitors (e.g., imatinib mesylate (Gleevec® or Glivec®)), hormone treatments, soluble receptors and other antineoplastics.
  • Topoisomerase inhibitors are also another class of anti-cancer agents that can be used. Topoisomerases are essential enzymes that maintain the topology of DNA. Inhibition of type I or type II topoisomerases interferes with both transcription and replication of DNA by upsetting proper DNA supercoiling. Some type I topoisomerase inhibitors include camptothecins:
  • irinotecan and topotecan examples include amsacrine, etoposide, etoposide phosphate, and teniposide. These are semisynthetic derivatives of epipodophyllotoxins, alkaloids naturally occurring in the root of American Mayapple (Podophyllum peltatum).
  • Antineoplastics include the immunosuppressant dactinomycin, doxorubicin, epirubicin, bleomycin, mechlorethamine, cyclophosphamide, chlorambucil, ifosfamide.
  • the antineoplastic compounds generally work by chemically modifying a cell's DNA.
  • Alkylating agents can alkylate many nucleophilic functional groups under conditions present in cells. Cisplatin and carboplatin, and oxaliplatin are alkylating agents. They impair cell function by forming covalent bonds with the amino, carboxyl, sulfhydryl, and phosphate groups in biologically important molecules.
  • Vinca alkaloids bind to specific sites on tubulin, inhibiting the assembly of tubulin into microtubules (M phase of the cell cycle).
  • the vinca alkaloids include: vincristine, vinblastine, vinorelbine, and vindesine.
  • Anti-metabolites resemble purines (azathioprine, mercaptopurine) or pyrimidine and prevent these substances from becoming incorporated in to DNA during the "S" phase of the cell cycle, stopping normal development and division. Anti-metabolites also affect RNA synthesis.
  • Plant alkaloids and terpenoids are derived from plants and block cell division by preventing microtubule function. Since microtubules are vital for cell division, without them, cell division cannot occur.
  • the main examples are vinca alkaloids and taxanes.
  • Taxanes as a group includes paclitaxel and docetaxel.
  • Paclitaxel is a natural product, originally known as Taxol and first derived from the bark of the Pacific Yew tree.
  • Docetaxel is a semi- synthetic analogue of paclitaxel. Taxanes enhance stability of microtubules, preventing the separation of chromosomes during anaphase.
  • the invention provides an article of manufacture that includes a pharmaceutical composition containing an inhibitor of the invention for any of the uses and methods of the invention.
  • Such articles may be a useful device such as a sustained release device, bandage, transdermal patch or a similar device.
  • the device holds a therapeutically effective amount of a pharmaceutical composition, such as any of the pharmaceutical compositions described herein.
  • the device may be packaged in a kit along with instructions for using the pharmaceutical composition for any of the uses or methods described herein.
  • the pharmaceutical composition includes at least one c-myc antisense oligonucleotide of the present invention, in a therapeutically effective amount such that the use or method is accomplished.
  • Example 1 Effects of c-myc antisense oligonucleotides on c-myc protein expression and proliferation of liver cancer cells in vitro
  • C-myc protein expression was assessed by Western blot according to standard procedures. Protein levels were normalized to the housekeeping gene Hsp90. Antibodies were obtained from Santa Cruz Biotechnology, Inc. Protein expression was determined by densitometry and normalized to expression in untreated control cells.
  • Example 2 Effects of c-myc antisense oligonucleotides on c-myc protein expression and proliferation of follicular lymphoma cells in vitro.
  • This example shows that c-myc antisense oligonucleotide are effective in reducing c-myc protein expression and cell growth in VAL follicular lymphoma cancer cells.
  • C-myc protein expression was assessed by Western blot according to standard procedures. Protein levels were normalized to the housekeeping gene Hsp90. Antibodies were obtained from Santa Cruz Biotechnology, Inc. Protein expression was determined by densitometry and normalized to expression in untreated control cells.
  • Example 3 Effects of c-myc antisense therapy on cancer cell lines in vivo
  • HepG2-Luc liver cancer cells or VAL follicular lymphoma cancer cells (10 x 106 cells in PBS) were subcutaneously injected into the right flank of 5-6 week old male SCID mice.
  • HepG2 cells were employed.
  • ODNs were administered by IP injection at a concentration of 30 mg/kg/day three times per week beginning on day 47. Tumor volumes were monitored periodically by calipers. Control animals received injections of PBS.
  • VAL cells were used and after tumor size reached an approximate volume of 5-50 mm3, c-myc antisense ODNs or sense control ODN 23 were administered by IP injection at a concentration of 30 mg/kg/day three times per week beginning on day 13. Control animals received PBS alone for the same period. Antitumor activities of the oligonucleotides were estimated by decreased tumor volume, which was measured with a caliper periodically over the period of the study.
  • Each point represents mean tumor volume calculated from 4 animals per experimental group. At the end of the study, the animals were sacrificed and the tumors removed and weighed. Results
  • Example 4 Effects of c-myc antisense therapy on primary murine c-myc-induced cancer in vivo
  • This example utilizes a conditional mouse model system for producing c-myc-induced hematopoietic tumors to determine the efficacy of c-myc antisense oligonucleotides in treating cancer.
  • mice were generated using conventional techniques. Founders were derived in FVB/N. Human MYC cDNA exons 2 and 3 were cloned into the EcoRl site of the polylinker of pUHD10-3 (provided by H. Bujard), which contains the tetracycline response element generating tet-o- FC. tTA was cloned into the EcoRV site of ⁇ 8 ⁇ (Felsher & Bishop, Mol. Cell, 4: 199-207, 1999).
  • mice were administered doxycycline in their drinking water, changed once per week, at a concentration of 100 ⁇ g/ml. Upon initiation of the study, doxycycline administration to the mice was halted, resulting in overexpression of c-myc, and primary HCC tumors began to form.
  • Mice were IP administered either c-myc antisense oligonucleotide 20 or 16, sense oligonucleotide 23 at 30 mg/kg/day, three days a week beginning when overall tumor size reached 50 mm 3 . Control animals received IP injections of PBS.
  • Tissues were fixed in 10% buffered formalin, and 5 ⁇ paraffin sections were stained with hematoxylin and eosin (Felsher & Bishop, Mol. Cell, 4: 199-207, 1999). Sections were also stained following labeling with antibodies to the Ki-67 protein (representative of cellular proliferation) and cleaved caspase 3 (indicating active apoptosis) (Santa Cruz Biotechnology) according to standard techniques. Tissue sections were also stained to detect senescence- associated beta-galactosidase (SA- gal) activity according to techniques known in the art ⁇ see Debacq-Chainiaux et al, Nature Protocols, 4(12):1798-1806, 2009).
  • SA- gal beta-galactosidase
  • Hepatocytes in the mice utilized in this experiment have a c-myc gene under control of a tetracycline promoter. Following activation by removing docycyline from the diets of animlas, c-myc is overexpressed in the liver resulting in the formation of liver tumors (Figure 6).
  • mice treated with vehicle or sense oligonucleotide 23 show that, in contrast to mice treated with vehicle or sense oligonucleotide 23, the liver tumors in mice treated with ODNs 16 or 20 either did not increase in size or actually shrunk as the study progressed (Figure 9).
  • antisense oligonucleotides targeted to c-myc have significant activity in primary transgenic mouse models of c-myc-mediated liver cancer. Treatment with the anti-c- myc oligonucleotides is associated with reduced proliferation, increased apoptosis, and increased cellular senescence. Importantly, administration of these oligonucleotides do not result any observed significant toxicity or morbidity in mice treated with them.
  • Example 5 Effects of c-myc antisense oligonucleotides on c-myc protein expression and proliferation of liver cancer cells in vitro
  • HepG2 cells obtained from ATCC were thawed and cultured for 5-25 passages in Eagle's minimal essential medium (EMEM, Invitrogen) plus 10% foetal calf serum (FCS, Hyclone). Cells were treated with antisense PS- oligonucleotides or non-silencing control oligonucleotide (NC) as shown in Table 7 by transfection using LipofectamineTM RNAiMAX (Invitrogen, Cat#13778) following the manufacturer's protocol. Treated cells were incubated in culture medium for 16-18 hours at 37°C, 5% CO 2 prior to fixation or cell lysis for measurement of c-myc protein.
  • EMEM Eagle's minimal essential medium
  • FCS foetal calf serum
  • NC non-silencing control oligonucleotide
  • Cells were fixed in 1% formaldehyde for 15 minutes. Cells were then incubated with a rabbit anti-c-myc antibody (cln D84C12, CST) at 5 ⁇ g/mL, in block (10% FCS in PBS, 0.1% Triton X-100) at 37°C for 30', followed by incubation with a fluorescent anti-rabbit-Alexa594 (Invitrogen A21207) antibody at 10 ⁇ g/mL in block at 37°C for 30 minutes. For this second incubation Hoechst was also added to stain cell nuclei. Cells were imaged on a Cellomics Arrayscan HCS imager (Thermoscientific).

Abstract

La présente invention concerne des oligonucléotides antisens qui peuvent empêcher ou réduire de manière efficace l'expression protéique c-myc et réduire les taux globaux de la prolifération cellulaire dans les modèles in vitro et les modèles mammifères in vivo de troubles de la prolifération cellulaire ainsi que des procédés pour les utiliser. Les oligonucléotides antisens comportent au moins une liaison inter-sous-unité de thiophosphoramidate (NPS)-modifié ou de phosphoramidate (NP)-modifié.
PCT/US2013/066960 2012-10-26 2013-10-25 Oligonucléotides antisens c-myc et ses procédés d'utilisation pour le traitement de troubles de la prolifération cellulaire WO2014066851A1 (fr)

Priority Applications (3)

Application Number Priority Date Filing Date Title
EP13849097.4A EP2912179A4 (fr) 2012-10-26 2013-10-25 Oligonucléotides antisens c-myc et ses procédés d'utilisation pour le traitement de troubles de la prolifération cellulaire
CA2887702A CA2887702C (fr) 2012-10-26 2013-10-25 Oligonucleotides antisens c-myc et ses procedes d'utilisation pour le traitement de troubles de la proliferation cellulaire
HK16102007.9A HK1214293A1 (zh) 2012-10-26 2016-02-23 反義寡核苷酸和利用其治療細胞增殖性疾病的方法

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US201261719348P 2012-10-26 2012-10-26
US61/719,348 2012-10-26
US201361784910P 2013-03-14 2013-03-14
US61/784,910 2013-03-14
US13/829,594 US9228189B2 (en) 2012-10-26 2013-03-14 C-myc antisense oligonucleotides and methods for using the same to treat cell-proliferative disorders
US13/829,594 2013-03-14

Publications (1)

Publication Number Publication Date
WO2014066851A1 true WO2014066851A1 (fr) 2014-05-01

Family

ID=53002976

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2013/066960 WO2014066851A1 (fr) 2012-10-26 2013-10-25 Oligonucléotides antisens c-myc et ses procédés d'utilisation pour le traitement de troubles de la prolifération cellulaire

Country Status (4)

Country Link
EP (1) EP2912179A4 (fr)
CA (2) CA2887702C (fr)
HK (1) HK1214293A1 (fr)
WO (1) WO2014066851A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020124043A1 (fr) * 2018-12-13 2020-06-18 Gordon Erlinda M Procédés d'exploitation d'oncogènes pilotes le long de la voie biologique de la cycline g1 humaine pour thérapie génique du cancer

Citations (53)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3687808A (en) 1969-08-14 1972-08-29 Univ Leland Stanford Junior Synthetic polynucleotides
US5177196A (en) 1990-08-16 1993-01-05 Microprobe Corporation Oligo (α-arabinofuranosyl nucleotides) and α-arabinofuranosyl precursors thereof
US5188897A (en) 1987-10-22 1993-02-23 Temple University Of The Commonwealth System Of Higher Education Encapsulated 2',5'-phosphorothioate oligoadenylates
US5194599A (en) 1988-09-23 1993-03-16 Gilead Sciences, Inc. Hydrogen phosphonodithioate compositions
US5264423A (en) 1987-03-25 1993-11-23 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5276019A (en) 1987-03-25 1994-01-04 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5278302A (en) 1988-05-26 1994-01-11 University Patents, Inc. Polynucleotide phosphorodithioates
US5321131A (en) 1990-03-08 1994-06-14 Hybridon, Inc. Site-specific functionalization of oligodeoxynucleotides for non-radioactive labelling
US5399676A (en) 1989-10-23 1995-03-21 Gilead Sciences Oligonucleotides with inverted polarity
US5405939A (en) 1987-10-22 1995-04-11 Temple University Of The Commonwealth System Of Higher Education 2',5'-phosphorothioate oligoadenylates and their covalent conjugates with polylysine
US5455233A (en) 1989-11-30 1995-10-03 University Of North Carolina Oligoribonucleoside and oligodeoxyribonucleoside boranophosphates
US5466677A (en) 1993-03-06 1995-11-14 Ciba-Geigy Corporation Dinucleoside phosphinates and their pharmaceutical compositions
US5476925A (en) 1993-02-01 1995-12-19 Northwestern University Oligodeoxyribonucleotides including 3'-aminonucleoside-phosphoramidate linkages and terminal 3'-amino groups
US5502177A (en) 1993-09-17 1996-03-26 Gilead Sciences, Inc. Pyrimidine derivatives for labeled binding partners
US5514785A (en) 1990-05-11 1996-05-07 Becton Dickinson And Company Solid supports for nucleic acid hybridization assays
US5519126A (en) 1988-03-25 1996-05-21 University Of Virginia Alumni Patents Foundation Oligonucleotide N-alkylphosphoramidates
US5519134A (en) 1994-01-11 1996-05-21 Isis Pharmaceuticals, Inc. Pyrrolidine-containing monomers and oligomers
US5525711A (en) 1994-05-18 1996-06-11 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Pteridine nucleotide analogs as fluorescent DNA probes
US5550111A (en) 1984-07-11 1996-08-27 Temple University-Of The Commonwealth System Of Higher Education Dual action 2',5'-oligoadenylate antiviral derivatives and uses thereof
US5552540A (en) 1987-06-24 1996-09-03 Howard Florey Institute Of Experimental Physiology And Medicine Nucleoside derivatives
US5567811A (en) 1990-05-03 1996-10-22 Amersham International Plc Phosphoramidite derivatives, their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides
US5571799A (en) 1991-08-12 1996-11-05 Basco, Ltd. (2'-5') oligoadenylate analogues useful as inhibitors of host-v5.-graft response
US5576427A (en) 1993-03-30 1996-11-19 Sterling Winthrop, Inc. Acyclic nucleoside analogs and oligonucleotide sequences containing them
US5587469A (en) 1990-01-11 1996-12-24 Isis Pharmaceuticals, Inc. Oligonucleotides containing N-2 substituted purines
US5587361A (en) 1991-10-15 1996-12-24 Isis Pharmaceuticals, Inc. Oligonucleotides having phosphorothioate linkages of high chiral purity
US5591722A (en) 1989-09-15 1997-01-07 Southern Research Institute 2'-deoxy-4'-thioribonucleosides and their antiviral activity
US5594121A (en) 1991-11-07 1997-01-14 Gilead Sciences, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified purines
US5596091A (en) 1994-03-18 1997-01-21 The Regents Of The University Of California Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides
US5597909A (en) 1994-08-25 1997-01-28 Chiron Corporation Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use
US5610300A (en) 1992-07-01 1997-03-11 Ciba-Geigy Corporation Carbocyclic nucleosides containing bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates
US5614617A (en) 1990-07-27 1997-03-25 Isis Pharmaceuticals, Inc. Nuclease resistant, pyrimidine modified oligonucleotides that detect and modulate gene expression
US5625050A (en) 1994-03-31 1997-04-29 Amgen Inc. Modified oligonucleotides and intermediates useful in nucleic acid therapeutics
US5627053A (en) 1994-03-29 1997-05-06 Ribozyme Pharmaceuticals, Inc. 2'deoxy-2'-alkylnucleotide containing nucleic acid
US5639873A (en) 1992-02-05 1997-06-17 Centre National De La Recherche Scientifique (Cnrs) Oligothionucleotides
US5645985A (en) 1991-11-26 1997-07-08 Gilead Sciences, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines
US5646265A (en) 1990-01-11 1997-07-08 Isis Pharmceuticals, Inc. Process for the preparation of 2'-O-alkyl purine phosphoramidites
US5658873A (en) 1993-04-10 1997-08-19 Degussa Aktiengesellschaft Coated sodium percarbonate particles, a process for their production and detergent, cleaning and bleaching compositions containing them
US5670633A (en) 1990-01-11 1997-09-23 Isis Pharmaceuticals, Inc. Sugar modified oligonucleotides that detect and modulate gene expression
US5672697A (en) 1991-02-08 1997-09-30 Gilead Sciences, Inc. Nucleoside 5'-methylene phosphonates
WO1997036005A1 (fr) 1996-03-26 1997-10-02 Lynx Therapeutics, Inc. Traitements a base d'oligonucleotides et compositions contre les melanomes humains
US5681941A (en) 1990-01-11 1997-10-28 Isis Pharmaceuticals, Inc. Substituted purines and oligonucleotide cross-linking
US5721218A (en) 1989-10-23 1998-02-24 Gilead Sciences, Inc. Oligonucleotides with inverted polarity
US5750692A (en) 1990-01-11 1998-05-12 Isis Pharmaceuticals, Inc. Synthesis of 3-deazapurines
US5792747A (en) 1995-01-24 1998-08-11 The Administrators Of The Tulane Educational Fund Highly potent agonists of growth hormone releasing hormone
US5824793A (en) 1996-02-21 1998-10-20 Lynx Therapeutics, Inc. Solid phase synthesis of oligonucleotide N3'-P5' phosphoramidates
US5830653A (en) 1991-11-26 1998-11-03 Gilead Sciences, Inc. Methods of using oligomers containing modified pyrimidines
US5837835A (en) 1994-03-18 1998-11-17 Lynx Therapeutics, Inc. Oligonucleotide N3'-P5' phosphoramidates: hybridization and nuclease resistance properties
US5859233A (en) 1996-02-21 1999-01-12 Lynx Therapeutics, Inc. Synthons for synthesis of oligonucleotide N3-P5 phosphoramidates
US5965720A (en) * 1994-03-18 1999-10-12 Lynx Therapeutics, Inc. Oligonucleotide N3'→P5' phosphoramidates
WO2001083740A2 (fr) 2000-05-04 2001-11-08 Avi Biopharma, Inc. Composition anti-sens a region d'epissage et methode associee
US6867294B1 (en) 1998-07-14 2005-03-15 Isis Pharmaceuticals, Inc. Gapped oligomers having site specific chiral phosphorothioate internucleoside linkages
US20050113325A1 (en) 2003-09-09 2005-05-26 Sergei Gryaznov Modified oligonucleotides for telomerase inhibition
WO2008094640A2 (fr) * 2007-01-30 2008-08-07 Geron Corporation Composés à effets antiadhésifs sur les cellules cancéreuses

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20070112295A (ko) * 1999-09-10 2007-11-22 제론 코포레이션 올리고뉴클레오티드 엔3'→피5' 티오포스포라미데이트,이의 합성 및 용도
ES2749426T3 (es) * 2009-12-18 2020-03-20 Univ British Columbia Métodos y composiciones para administración de ácidos nucleicos

Patent Citations (64)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3687808A (en) 1969-08-14 1972-08-29 Univ Leland Stanford Junior Synthetic polynucleotides
US5550111A (en) 1984-07-11 1996-08-27 Temple University-Of The Commonwealth System Of Higher Education Dual action 2',5'-oligoadenylate antiviral derivatives and uses thereof
US5276019A (en) 1987-03-25 1994-01-04 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5286717A (en) 1987-03-25 1994-02-15 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5264423A (en) 1987-03-25 1993-11-23 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5552540A (en) 1987-06-24 1996-09-03 Howard Florey Institute Of Experimental Physiology And Medicine Nucleoside derivatives
US5405939A (en) 1987-10-22 1995-04-11 Temple University Of The Commonwealth System Of Higher Education 2',5'-phosphorothioate oligoadenylates and their covalent conjugates with polylysine
US5188897A (en) 1987-10-22 1993-02-23 Temple University Of The Commonwealth System Of Higher Education Encapsulated 2',5'-phosphorothioate oligoadenylates
US5519126A (en) 1988-03-25 1996-05-21 University Of Virginia Alumni Patents Foundation Oligonucleotide N-alkylphosphoramidates
US5278302A (en) 1988-05-26 1994-01-11 University Patents, Inc. Polynucleotide phosphorodithioates
US5453496A (en) 1988-05-26 1995-09-26 University Patents, Inc. Polynucleotide phosphorodithioate
US5194599A (en) 1988-09-23 1993-03-16 Gilead Sciences, Inc. Hydrogen phosphonodithioate compositions
US5565555A (en) 1988-09-23 1996-10-15 Gilead Sciences, Inc. Nucleoside hydrogen phosphonodithioate diesters and activated phosphonodithioate analogues
US5591722A (en) 1989-09-15 1997-01-07 Southern Research Institute 2'-deoxy-4'-thioribonucleosides and their antiviral activity
US5399676A (en) 1989-10-23 1995-03-21 Gilead Sciences Oligonucleotides with inverted polarity
US5721218A (en) 1989-10-23 1998-02-24 Gilead Sciences, Inc. Oligonucleotides with inverted polarity
US5527899A (en) 1989-10-23 1996-06-18 Gilead Sciences, Inc. Oligonucleotides with inverted polarity
US5455233A (en) 1989-11-30 1995-10-03 University Of North Carolina Oligoribonucleoside and oligodeoxyribonucleoside boranophosphates
US5681941A (en) 1990-01-11 1997-10-28 Isis Pharmaceuticals, Inc. Substituted purines and oligonucleotide cross-linking
US5646265A (en) 1990-01-11 1997-07-08 Isis Pharmceuticals, Inc. Process for the preparation of 2'-O-alkyl purine phosphoramidites
US5670633A (en) 1990-01-11 1997-09-23 Isis Pharmaceuticals, Inc. Sugar modified oligonucleotides that detect and modulate gene expression
US5587469A (en) 1990-01-11 1996-12-24 Isis Pharmaceuticals, Inc. Oligonucleotides containing N-2 substituted purines
US5750692A (en) 1990-01-11 1998-05-12 Isis Pharmaceuticals, Inc. Synthesis of 3-deazapurines
US5536821A (en) 1990-03-08 1996-07-16 Worcester Foundation For Biomedical Research Aminoalkylphosphorothioamidate oligonucleotide deratives
US5541306A (en) 1990-03-08 1996-07-30 Worcester Foundation For Biomedical Research Aminoalkylphosphotriester oligonucleotide derivatives
US5321131A (en) 1990-03-08 1994-06-14 Hybridon, Inc. Site-specific functionalization of oligodeoxynucleotides for non-radioactive labelling
US5563253A (en) 1990-03-08 1996-10-08 Worcester Foundation For Biomedical Research Linear aminoalkylphosphoramidate oligonucleotide derivatives
US5567811A (en) 1990-05-03 1996-10-22 Amersham International Plc Phosphoramidite derivatives, their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides
US5514785A (en) 1990-05-11 1996-05-07 Becton Dickinson And Company Solid supports for nucleic acid hybridization assays
US5614617A (en) 1990-07-27 1997-03-25 Isis Pharmaceuticals, Inc. Nuclease resistant, pyrimidine modified oligonucleotides that detect and modulate gene expression
US5177196A (en) 1990-08-16 1993-01-05 Microprobe Corporation Oligo (α-arabinofuranosyl nucleotides) and α-arabinofuranosyl precursors thereof
US5672697A (en) 1991-02-08 1997-09-30 Gilead Sciences, Inc. Nucleoside 5'-methylene phosphonates
US5571799A (en) 1991-08-12 1996-11-05 Basco, Ltd. (2'-5') oligoadenylate analogues useful as inhibitors of host-v5.-graft response
US5587361A (en) 1991-10-15 1996-12-24 Isis Pharmaceuticals, Inc. Oligonucleotides having phosphorothioate linkages of high chiral purity
US5594121A (en) 1991-11-07 1997-01-14 Gilead Sciences, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified purines
US5830653A (en) 1991-11-26 1998-11-03 Gilead Sciences, Inc. Methods of using oligomers containing modified pyrimidines
US5645985A (en) 1991-11-26 1997-07-08 Gilead Sciences, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines
US5639873A (en) 1992-02-05 1997-06-17 Centre National De La Recherche Scientifique (Cnrs) Oligothionucleotides
US5700920A (en) 1992-07-01 1997-12-23 Novartis Corporation Carbocyclic nucleosides containing bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates
US5610300A (en) 1992-07-01 1997-03-11 Ciba-Geigy Corporation Carbocyclic nucleosides containing bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates
US5476925A (en) 1993-02-01 1995-12-19 Northwestern University Oligodeoxyribonucleotides including 3'-aminonucleoside-phosphoramidate linkages and terminal 3'-amino groups
US5466677A (en) 1993-03-06 1995-11-14 Ciba-Geigy Corporation Dinucleoside phosphinates and their pharmaceutical compositions
US5576427A (en) 1993-03-30 1996-11-19 Sterling Winthrop, Inc. Acyclic nucleoside analogs and oligonucleotide sequences containing them
US5658873A (en) 1993-04-10 1997-08-19 Degussa Aktiengesellschaft Coated sodium percarbonate particles, a process for their production and detergent, cleaning and bleaching compositions containing them
US5763588A (en) 1993-09-17 1998-06-09 Gilead Sciences, Inc. Pyrimidine derivatives for labeled binding partners
US5502177A (en) 1993-09-17 1996-03-26 Gilead Sciences, Inc. Pyrimidine derivatives for labeled binding partners
US6005096A (en) 1993-09-17 1999-12-21 Gilead Sciences, Inc. Pyrimidine derivatives
US5519134A (en) 1994-01-11 1996-05-21 Isis Pharmaceuticals, Inc. Pyrrolidine-containing monomers and oligomers
US5837835A (en) 1994-03-18 1998-11-17 Lynx Therapeutics, Inc. Oligonucleotide N3'-P5' phosphoramidates: hybridization and nuclease resistance properties
US5596091A (en) 1994-03-18 1997-01-21 The Regents Of The University Of California Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides
US5965720A (en) * 1994-03-18 1999-10-12 Lynx Therapeutics, Inc. Oligonucleotide N3'→P5' phosphoramidates
US5627053A (en) 1994-03-29 1997-05-06 Ribozyme Pharmaceuticals, Inc. 2'deoxy-2'-alkylnucleotide containing nucleic acid
US5625050A (en) 1994-03-31 1997-04-29 Amgen Inc. Modified oligonucleotides and intermediates useful in nucleic acid therapeutics
US5525711A (en) 1994-05-18 1996-06-11 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Pteridine nucleotide analogs as fluorescent DNA probes
US5597909A (en) 1994-08-25 1997-01-28 Chiron Corporation Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use
US5792747A (en) 1995-01-24 1998-08-11 The Administrators Of The Tulane Educational Fund Highly potent agonists of growth hormone releasing hormone
US5824793A (en) 1996-02-21 1998-10-20 Lynx Therapeutics, Inc. Solid phase synthesis of oligonucleotide N3'-P5' phosphoramidates
US5859233A (en) 1996-02-21 1999-01-12 Lynx Therapeutics, Inc. Synthons for synthesis of oligonucleotide N3-P5 phosphoramidates
WO1997036005A1 (fr) 1996-03-26 1997-10-02 Lynx Therapeutics, Inc. Traitements a base d'oligonucleotides et compositions contre les melanomes humains
US6867294B1 (en) 1998-07-14 2005-03-15 Isis Pharmaceuticals, Inc. Gapped oligomers having site specific chiral phosphorothioate internucleoside linkages
WO2001083740A2 (fr) 2000-05-04 2001-11-08 Avi Biopharma, Inc. Composition anti-sens a region d'epissage et methode associee
US20050113325A1 (en) 2003-09-09 2005-05-26 Sergei Gryaznov Modified oligonucleotides for telomerase inhibition
US7494982B2 (en) 2003-09-09 2009-02-24 Geron Corporation Modified oligonucleotides for telomerase inhibition
WO2008094640A2 (fr) * 2007-01-30 2008-08-07 Geron Corporation Composés à effets antiadhésifs sur les cellules cancéreuses

Non-Patent Citations (29)

* Cited by examiner, † Cited by third party
Title
"Current Protocols in Molecular Biology", 1987
"Of Polymer Science And Engineering", 1990, JOHN WILEY & SONS, article "The Concise Encyclopedia", pages: 858 - 859
ADAMS, J. AM. CHEM. SOC., vol. 105, 1983, pages 661
ALFONSO AR: "Remington's Pharmaceutical Sciences", 1985, MACK PUBLISHING COMPANY
ALTSCHUL ET AL., J. MOL. BIOL, vol. 215, 1990, pages 403 - 410
AYEREISENMAN, GENES DEVEL, vol. 7, 1993, pages 2110 - 2119
BEAUCAGE, TETRA. LETT, vol. 22, 1981, pages 1859
BELOUSOV, NUCLEIC ACIDS RES., vol. 5, no. 25, 1997, pages 3440 - 3444
BLOMMERS, BIOCHEMISTRY, vol. 33, 1994, pages 7886 - 7896
CARRUTHERS: "Cold Spring Harbor Symp. Quant. Biol", vol. 47, 1982, pages: 411 - 418
COPPOLACOLE, NATURE, vol. 320, 1986, pages 760 - 763
DEBACQ-CHAINIAUX ET AL., NATURE PROTOCOLS, vol. 4, no. 12, 2009, pages 1798 - 1806
ENGLISCH ET AL.: "Angewandte Chemie", vol. 30, 1991, INTERNATIONAL EDITION, pages: 613
FELSHERBISHOP, MOL. CELL, vol. 4, 1999, pages 199 - 207
FRENKEL, FREE RADIC. BIOL. MED, vol. 19, 1995, pages 373 - 380
GEWIRTZ, J. CLIN. ONCOL, vol. 18, 2000, pages 1809 - 1811
GRYAZNOV, S.M.: "OLIGONUCLEOTIDE N3' --> P5' PHOSPHORAMIDATES AND THIO- PHOSHORAMIDATES AS POTENTIAL THERAPEUTIC AGENTS", CHEMISTRY AND BIODIVERSITY, vol. 7, no. 3, 15 March 2012 (2012-03-15), WEINHEIM, pages 477 - 493, XP055229920 *
KLEIN, GENES, CHROMOSOMES, CANCER, vol. 1, 1989, pages 3 - 8
KOMBERGBAKER: "DNA Replication", 1992
NARANG, METH. ENZYMOL, vol. 68, 1979, pages 109
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual, third edition", 1989
SANGHVI, Y. S.: "Antisense Research and Applications", 1993, CRC PRESS, pages: 289 - 302
SCHEIT: "Nucleotide Analogs", 1980, JOHN WILEY
See also references of EP2912179A4
SHACHAF ET AL., NATURE, vol. 431, 2004, pages 1117
SMITHWICKSTROM, METHODS ENZYMOL., vol. 314, 2000, pages 537 - 580
SPENCERGROUDINE, ADV. CANCER. RES, vol. 56, 1991, pages 1 - 48
UHLMANNPEYMAN, CHEMICAL REVIEWS, vol. 90, 1990, pages 543 - 584
ZHANGMADDEN, GENOME RES., vol. 7, 1997, pages 649 - 656

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020124043A1 (fr) * 2018-12-13 2020-06-18 Gordon Erlinda M Procédés d'exploitation d'oncogènes pilotes le long de la voie biologique de la cycline g1 humaine pour thérapie génique du cancer

Also Published As

Publication number Publication date
CA3201145A1 (fr) 2014-05-01
HK1214293A1 (zh) 2016-07-22
CA2887702C (fr) 2023-08-01
EP2912179A4 (fr) 2016-10-12
CA2887702A1 (fr) 2014-05-01
EP2912179A1 (fr) 2015-09-02

Similar Documents

Publication Publication Date Title
JP5535076B2 (ja) 肝臓癌を治療するための標的化ミクロｒｎａ
US9771581B2 (en) C-myc antisense oligonucleotides and methods for using the same to treat cell-proliferative disorders
WO2011088309A1 (fr) Compositions de microarn et procédés
KR20180118716A (ko) Ｄｂａｉｔ 분자의 전신 투여에 의한 암 치료법
EA023793B1 (ru) Лечение рака комбинацией молекул днк, имитирующих двухнитевые разрывы, и гипертермии
JP2022031642A (ja) アンチセンスオリゴヌクレオチド
US7273932B1 (en) Antisense oligonucleotides for fertility and menstrual cycle regulation and for chemopreventive and chemotherapeutic use
CN104470509A (zh) 剂量范围在2至30mg/kg的地塞米诺或其衍生物在癌症治疗中的用途
US20210238603A1 (en) Beta catenin nucleic acid inhibitor molecule
WO2019136157A2 (fr) Diminution de l'expression de la bêta-caténine et de ido pour potentialiser une immunothérapie
CA2887702C (fr) Oligonucleotides antisens c-myc et ses procedes d'utilisation pour le traitement de troubles de la proliferation cellulaire
US20220096517A1 (en) MicroRNA Compounds and Methods for Modulating MIR-10B Activity
JP2023073256A (ja) ベータカテニン発現を減少させて免疫療法を強化する
TW202210633A (zh) 用於治療癌症之dbait分子與kras抑制劑的組合
JP7441455B2 (ja) 筋ジストロフィーの処置のためのチオモルホリノオリゴヌクレオチド
US20170183650A1 (en) Pharmaceutical compositions comprising rna and use for treating cancer
EP3436069A2 (fr) Modulation de l'entretien structural de l'expression du chromosome-1

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13849097

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2887702

Country of ref document: CA

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2013849097

Country of ref document: EP