WO2014064943A1 - Peptide antigène dérivé du virus de la dengue - Google Patents

Peptide antigène dérivé du virus de la dengue Download PDF

Info

Publication number
WO2014064943A1
WO2014064943A1 PCT/JP2013/006333 JP2013006333W WO2014064943A1 WO 2014064943 A1 WO2014064943 A1 WO 2014064943A1 JP 2013006333 W JP2013006333 W JP 2013006333W WO 2014064943 A1 WO2014064943 A1 WO 2014064943A1
Authority
WO
WIPO (PCT)
Prior art keywords
antigenic peptide
amino acid
denv
edii
acid residues
Prior art date
Application number
PCT/JP2013/006333
Other languages
English (en)
Inventor
Kazuyoshi Ikuta
Tadahiro Sasaki
Mitsuhiro Nishimura
Takeshi Kurosu
Itaru HIRAI
Akifumi Yamashita
Shota Nakamura
Norihito Kawashita
Chonlatip PIPATTANABOON
Pannamthip PITAKSAJJAKUL
Tamaki OKABAYASHI
Ken-Ichiro Ono
Yoshinobu Okuno
Pongrama Ramasoota
Original Assignee
Osaka University
The Research Foundation For Microbial Diseases Of Osaka University
Medical And Biological Laboratories Co., Ltd
Mahidol University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Osaka University, The Research Foundation For Microbial Diseases Of Osaka University, Medical And Biological Laboratories Co., Ltd, Mahidol University filed Critical Osaka University
Publication of WO2014064943A1 publication Critical patent/WO2014064943A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C07K14/08—RNA viruses
    • C07K14/18—Togaviridae; Flaviviridae
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56983—Viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/24011—Flaviviridae
    • C12N2770/24111—Flavivirus, e.g. yellow fever virus, dengue, JEV
    • C12N2770/24134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/005—Assays involving biological materials from specific organisms or of a specific nature from viruses
    • G01N2333/08—RNA viruses
    • G01N2333/18—Togaviridae; Flaviviridae
    • G01N2333/183—Flaviviridae, e.g. pestivirus, mucosal disease virus, bovine viral diarrhoea virus, classical swine fever virus (hog cholera virus) or border disease virus
    • G01N2333/185—Flaviviruses or Group B arboviruses, e.g. yellow fever virus, japanese encephalitis, tick-borne encephalitis, dengue
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2469/00—Immunoassays for the detection of microorganisms
    • G01N2469/20—Detection of antibodies in sample from host which are directed against antigens from microorganisms
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates to materials and methods for detecting, preventing, and treating dengue viral infections.
  • the present invention relates to an isolated antigenic peptide in the first domain II of a dengue virus (DENV) envelope protein, and use of the same.
  • DEV dengue virus
  • the causative virus is the mosquito-borne dengue virus (DENV), has a positive-sense, single-stranded 11 kb RNA genome encoding a capsid protein (C), a pre-membrane protein (prM), and an envelope glycoprotein (E), in addition to seven nonstructural proteins (NS) [Kuhn et al., Cell 108:717-725 (2002)].
  • the primary target of neutralizing antibodies is the viral E protein that coats the virion surface [Valdes et al., Clin. Diagn. Lab. Immunol., 7:856-857(2000); Churdboonchart et al., Am. J. Trop. Med. Hyg. 44:481-493(1991); dos Santos et al., Am. J. Trop. Med. Hyg., 71:144-152(2004)].
  • Three E domains, named domain I (EDI), II (EDII), and III (EDIII) have been identified [Modis et al., Proc. Natl. Acad. Sci.
  • PBMCs peripheral blood mononuclear cells
  • the E and prM proteins were shown to be the primary targets for these HuMAbs with neutralizing activities [Dejnirattisai et al., Science, 328:745-748 (2010); Beltramello et al., Cell Host Microbe, 8:271-283 (2010); Smith et al., J. Virol., 86:2665-2675(2012)]. Most of the neutralizing antibodies were cross-reactive and showed only weak neutralization activity.
  • HuMAbs that bound to EDIII are rare and most of them recognize epitopes in EDI/EDII located on the intact virion surface [NLP 1:Dejnirattisai et al., Science, 328:745-748 (2010); NLP 2:Beltramello et al., Cell Host Microbe, 8:271-283 (2010)].
  • human and murine neutralizing antibodies appear to recognize distinct epitopes on the dengue virion surface E protein, especially with regard to epitopes on EDIII, which are believed to be the primary target, at least in murine neutralizing antibodies [Wahala et al., Viruses, 3:2374-2395 (2011); Wahala et al., J. Virol 86:4019-4023 (2012)].
  • dengue-virus serotypes There are four antigenically distinct dengue-virus serotypes (DENV-1 to DENV-4) sharing major antigens within the group, and with other mosquito and tick-borne flaviviruses [NLP 3: Innis et al., Am. J. Trop. Med. Hyg. 40:676-687 (1989); NLP 4: Calisher et al., J. Gen. Virol. 70: 37-43 (1989)].
  • the global spread of four dengue-virus serotypes has made dengue virus a major and growing public-health concern.
  • pre-existing neutralizing antibodies from primary DENV infection play a significant role in providing protective neutralizing antibodies against infection with the same serotype.
  • DENV infections may be asymptomatic, even in secondary infections.
  • Most severe dengue cases often occur among patients secondarily infected with heterotypic serotypes of DENV, which is believed to be due to ADE, by which the secondarily infected DENV serotype can use pre-existing anti-DENV antibodies, derived from primary infection.
  • NPL 1 Dejnirattisai et al., Science, 328:745-748 (2010)
  • NPL 2 Beltramello et al., Cell Host Microbe, 8:271-283 (2010)
  • NLP 3 Innis et al., Am. J. Trop. Med. Hyg. 40:676-687 (1989);
  • NLP 4 Calisher et al., J. Gen. Virol. 70: 37-43 (1989)
  • Another feature of the present invention is to provide an antigenic peptide and a vaccine for the dengue virus based on the first domain II of the envelope protein of a dengue virus.
  • a further feature of the present invention is to use peptide compositions to immunize or vaccinate subjects who have or have not been previously infected with a dengue virus.
  • an isolated antigenic peptide that can have at least 8 consecutive amino acid residues of amino acid residues 52-132 in the first domain II of a dengue virus (DENV) envelope protein (EDII) is provided.
  • An isolated antigenic peptide is also provided that can have at least 8 consecutive amino acid residues of amino acid residues 52-132 in the first domain II of a dengue virus (DENV) envelope protein (EDII) of a DENV-1 serotype EDII, a DENV-2 serotype EDII, a DENV-3 serotype EDII, or a DENV-4 serotype EDII, and the peptide can be at least 50% identical to corresponding peptides in the other three serotype EDIIs.
  • An antigenic peptide is further provided that can have an amino acid sequence selected from a region of amino acid residues 52-132 in the first domain II of an E protein of dengue virus based on the amino acid sequence shown at SEQ ID NO. 2.
  • An isolated antigenic peptide that can have the first domain II of a dengue virus (DENV) envelope protein (EDII); a fragment thereof; an isolated antigenic peptide thereof comprising one or more amino acid substitutions, deletions, or additions; a fragment thereof comprising one or more amino acid substitutions, deletions, deletions; or any combination thereof is provided by the present invention.
  • Isolated nucleic acid molecules having a nucleotide sequence of a gene or other construct encoding an antigenic peptide of the present invention are also provided.
  • the isolated antigenic peptides of the present invention can be capable of stimulating a dengue virus immunological response in a subject.
  • the subject can have or have not been previously infected with a dengue virus.
  • the present invention provides vaccines comprising one or more antigenic peptide.
  • the vaccines of the present invention can also include at least one pharmaceutically acceptable excipient, at least one adjuvant, or both.
  • a reagent formulated for a dengue disease diagnostic test containing at least one antigenic peptide and kits containing the same are provided by the present invention.
  • a method of diagnosing a dengue virus infection using the antigenic peptides of the invention is also provided.
  • the present invention relates to: 1. An isolated antigenic peptide comprising at least 8 consecutive amino acid residues of amino acid residues 52-132 in the first domain II of a dengue virus (DENV) envelope protein (EDII). 2. The isolated antigenic peptide of item 1, wherein the EDII comprises a DENV-1 serotype EDII, a DENV-2 serotype EDII, a DENV-3 serotype EDII, a DENV-4 serotype EDII, or any combination thereof. 3.
  • DENV-1 serotype EDII a DENV-2 serotype EDII
  • DENV-3 serotype EDII a DENV-3 serotype EDII
  • DENV-4 serotype EDII or any combination thereof.
  • the isolated antigenic peptide of item 1 wherein the isolated antigenic peptide comprises amino acid residues 98 to 110, 82-132, 83-109, 84-109, 85-109, 86-109, or 87-109 of EDII. 14.
  • the isolated antigenic peptide of item 13 wherein the isolated antigenic peptide comprises no more than amino acid residues 52 to 132 of EDII.
  • the isolated antigenic peptide of item 1, wherein the isolated antigenic peptide comprises amino acid residues 52 to 132 of EDII. 16.
  • the isolated antigenic peptide of item 1 wherein the isolated antigenic peptide comprises at least 13 consecutive amino acid residues of EDII. 18. The isolated antigenic peptide of item 1, wherein the isolated antigenic peptide comprises at least 25 consecutive amino acid residues of EDII. 19. The isolated antigenic peptide of item 1, having at least 90% identity to a peptide comprising at least 8 consecutive amino acid residues of amino acid residues 52-132 of SEQ ID NO: 2. 20. The isolated antigenic peptide of item 1, having at least 95% identity to a peptide comprising at least 8 consecutive amino acid residues of amino acid residues 52-132 of SEQ ID NO: 2. 21.
  • An isolated antigenic peptide comprising at least 8 consecutive amino acid residues of amino acid residues 52-132 in the first domain II of a dengue virus (DENV) envelope protein (EDII) of a DENV-1 serotype EDII, a DENV-2 serotype EDII, a DENV-3 serotype EDII, or a DENV-4 serotype EDII, and the peptide is at least 90% identical to corresponding peptides in the other three serotype EDIIs. 22.
  • An antigenic peptide comprising an amino acid sequence selected from a region of amino acid residues 52-132 in the first domain II of an E protein of dengue virus based on the amino acid sequence shown at SEQ ID NO. 2.
  • An isolated antigenic peptide comprising the first domain II of a dengue virus (DENV) envelope protein (EDII); a fragment thereof; an isolated antigenic peptide thereof comprising one or more amino acid substitutions, deletions, or additions; a fragment thereof comprising one or more amino acid substitutions, deletions, deletions; or any combination thereof.
  • the isolated antigenic peptide of item 23 wherein the subject was previously infected with a dengue virus comprising a DENV-1 serotype, a DENV-2 serotype, a DENV-3 serotype, a DENV-4 serotype, or any combination thereof.
  • 26. The isolated antigenic peptide of item 23, wherein the EDII is from the same DENV serotype as that with which the subject was previously infected.
  • 27. The isolated antigenic peptide of item 23, wherein the EDII is from a different DENV serotype as that with which the subject was previously infected.
  • a vaccine comprising at least one antigenic peptide of any one of items 1-27. 29.
  • 35. An isolated nucleic acid molecule comprising a nucleotide sequence encoding the antigenic peptide according to any one of items 1 to 27.
  • 36. A reagent formulated for a dengue disease diagnostic test comprising at least one antigenic peptide according to any one of items 1 to 27.
  • a reagent kit for dengue disease diagnostic test comprising at least one antigenic peptide according to any one of items 1 to 27.
  • a method of diagnosing a dengue virus infection comprising a step of using at least one antigenic peptide according to any one of items 1 to 27.
  • 40. A method of manufacturing a medicament comprising the antigenic peptide of any one of items 1 or 27 to vaccinate a subject.
  • An antigenic peptide comprising an amino acid sequence selected from a region of amino acid residues 52-132 (SEQ ID NO.
  • the antigenic peptide according to item 41 wherein the amino acid sequence is selected from a region of amino acid residues 71-132 (SEQ ID NO. 7) in the first domain II of E protein of dengue virus based on amino acid sequence shown at SEQ ID NO. 2.
  • 46. The antigenic peptide according to item 42, wherein the amino acid sequence is selected from a region of amino acid residues 96-112 (SEQ ID NO. 8), 82-132 (SEQ ID NO. 101), 83-109 (SEQ ID NO. 102), 84-109 (SEQ ID NO. 103), 85-109 (SEQ ID NO. 104), 86-109 (SEQ ID NO. 105), or 87-109 (SEQ ID NO.
  • the antigenic peptide of the present invention is recognized by the most of the globally reactive antibodies with strong neutralizing activity in patients at the acute phase of secondary infection.
  • the antigenic peptide is similar site of the first EDII, including fusion domain as epitopes.
  • the anti-DENV multifocal antibodies appeared quickly after boost stimulation of memory B lymphocytes by secondary DENV infection can function for the blocking of virus entry process.
  • the antigenic peptide as the epitope site identified in the present invention could be highly useful for the development of an epitope-based prophylactic vaccine for dengue illness.
  • Fig. 1 shows, in accordance with the present invention, epitope mapping of HuMAbs by Western blotting with DENV E truncated proteins expressed in mammalian cells.
  • DENV E full-length (EF) and truncated proteins (T1-T5) (A) expressed by a mammalian expression system were subjected to Western blotting for reactivity with anti-FLAG MAb (B) and anti-DENV HuMAb (D23-1G7C2) (C).
  • Fig. 2 shows, in accordance with the present invention, confirmation and refinement of the epitope regions recognized by HuMAbs by Western blotting with truncated forms within the 1st DI and DII of DENV-2 E expressed in E. coli.
  • Plasmids expressing truncated forms (aa 1-192, aa 53-192, aa 53-132, aa 71-132, aa 71-105, and aa 74-109) within the DENV-2 E 1st DI and DII were constructed (A). These expressed proteins were subjected to SDS-PAGE, followed by CBB staining (B, upper panel) and Western blotting with D23-1G7C2 HuMAb (B, lower panel).
  • Fig. 4 shows, in accordance with the present invention, epitope mapping of HuMAbs by Western blotting with DENV-2 E truncated proteins expressed in E. coli.
  • A Five truncated proteins of the first EDII were constructed as thioredoxin (Trx) and His-tag (His6) fusion proteins. Secondary structures and their arrangement are depicted based on the crystal structure of E protein (PDB ID: 1OAN [Modis et al., Proc. Natl. Acad. Sci. (USA) 100:6986-6991(2003)]). Beta strand, helices, disulfide bonds and fusion loop are represented by yellow arrows, red ribbons, green dots and purple circles, respectively.
  • FIG. 5 shows, in accordance with the present invention, that DENV-2 prM-E fusion proteins were constructed with amino acid substitutions at different residues and illustrative summary for their reactivities with anti-DENV HuMAbs.
  • the present invention provides antigenic peptides and vaccines against dengue viruses and methods of using the same to treat or prevent a dengue viral infection. Accordingly, an isolated antigenic peptide having at least 8 consecutive amino acid residues of amino acid residues 52-132 in the first domain II of a dengue virus (DENV) envelope protein (EDII) is provided by the present invention.
  • DEV dengue virus envelope protein
  • An isolated antigenic peptide is also provided that has at least 8 consecutive amino acid residues of amino acid residues 52-132 in the first domain II of a dengue virus (DENV) envelope protein (EDII) of a DENV-1 serotype EDII, a DENV-2 serotype EDII, a DENV-3 serotype EDII, or a DENV-4 serotype EDII, and the peptide is at least 50%, at least 60%, at least 75%, at least 80%, at least 85%, at least 90% at least 92.5% at least 95%, at least 97%, at least 98%, at least 99%, or 100% identical to corresponding peptides in the other three serotype EDIIs.
  • DENV dengue virus
  • EDII dengue virus envelope protein
  • An antigenic peptide is further provided that has an amino acid sequence selected from a region of amino acid residues 52-132 in the first domain II of an E protein of dengue virus based on the amino acid sequence shown at SEQ ID NO. 2.
  • An isolated antigenic peptide having the first domain II of a dengue virus (DENV) envelope protein (EDII); a fragment thereof; an isolated antigenic peptide thereof comprising one or more amino acid substitutions, deletions, or additions; a fragment thereof comprising one or more amino acid substitutions, deletions, deletions; or any combination thereof is provided in accordance with the present invention.
  • nucleotide sequence encoding the peptide of domain I (EDI) and domain II (EDII) of an E protein of dengue virus is as follows: ⁇ SEQ ID: No. 1> ATGCGTTGCATAGGAATATCAAACAGAGACTTTGTAGAAGGGGTTTCAGGAGGAAGCTGGGTTGACATAGTCTTAGAACATGGAAGCTGTGTGACGACGATGGCAAAAAACAAACCAACATTGGATTTTGAACTGATAAAAACAGAAGCCAAACAACCTGCCACTCTAAGGGAGTACTGTATAGAGGCAAAGCTGACCAACACAACAACAGATTCTCGCTGCCCAACACAAGGAGAACCCAGCCTAAATGAAGAGCAGGACAAAAGGTTCGTCTGCAAACACTCCATGGTGGACAGAGGATGGGGAAATGGATGTGGACTATTTGGAAAAGGAGGCATTGTGACCTGCTATGTTCACATGCAAAAAGAACATGAAAGGAAAAGTCGTGCAACCAGAAAACTTGGAATA
  • the amino acid sequence of the peptide of domain I (EDI) and domain II (EDII) of an E protein of dengue virus (serotype DENV-2 NGC strain) is as follows: ⁇ SEQ ID: No. 2> M R C I G I S N R D F V E G V S G G S W V D I V L E H G S C V T T M A K N K P T L D F E L I K T E A K Q P A T L R E Y C I E A K L T N T T T D S R C P T Q G E P S L N E E Q D K R F V C K H S M V D R G W G N G C G L F G K G G G I V T C A M F T C K K N M K G K V V Q P E N L E Y T I V I T P H S G E E H A V G N D T G K H G K E I K I T P Q S I T E A E L T G Y G T V T M E C S P R T G L D
  • the isolated antigenic peptides of the present invention can be capable of stimulating a dengue virus immunological response in a subject.
  • the subject can have or have not been previously infected with a dengue virus.
  • the immunological response stimulated in the subject can include any response or combination of responses of the subject's immune system to DENV infection.
  • the immunological response can include an innate immune response, an adaptive immune response, a primary immune response, a secondary immune response, an increase in DENV specific antibodies, an increase in cells presenting DENV antigens, an increase in leukocytes, an increase in lymphocytes, an increase in T-cells, an increase in B-cells, an increase in helper T-cells, an increase in natural killer cells, an increase in cytokines, and increase in interleukins, or any combination thereof.
  • the EDII can include a DENV-1 serotype EDII, a DENV-2 serotype EDII, a DENV-3 serotype EDII, a DENV-4 serotype EDII, or any combination thereof.
  • the subject can have been previously infected with a dengue virus including a DENV-1 serotype, a DENV-2 serotype, a DENV-3 serotype, a DENV-4 serotype, or any combination thereof.
  • the EDII can be from the same DENV serotype, a different DENV serotype, or both as that with which the subject was previously infected.
  • the vaccines of the present invention can also be effective in stimulating an immune response in subjects who have not previously been infected with a dengue virus and/or who have not previously displayed symptoms of a DENV infection.
  • the vaccines of the present invention can be effective in alleviating and/or preventing one or more symptoms of a DENV virus.
  • the isolated antigenic peptide can contain at least 8 consecutive amino acid residues, at least 9 consecutive amino acid residues, at least 10 consecutive amino acid residues, at least 12 consecutive amino acid residues, at least 13 consecutive amino acid residues, at least 15 consecutive amino acid residues, at least 20 consecutive amino acid residues, at least 25 consecutive amino acid residues, at least 30 consecutive amino acid residues, at least 40 consecutive amino acid residues, at least 50 consecutive amino acid residues, at least 60 consecutive amino acid residues, at least 70 consecutive amino acid residues, at least 75 consecutive amino acid residues, at least 90 consecutive amino acid residues, at least 100 consecutive amino acid residues, substantially all amino acid residues, all amino acid residues of a DENV EDII, or any intervening range, or any combination thereof.
  • the isolated antigenic peptide can contain amino acid residues 74 to 109 of EDII, residues 74 to 118 of EDII, residues 82 to 132 of EDII, residues 83 to 109 of EDII, residues 84 to 109 of EDII, residues 85 to 109 of EDII, residues 86 to 109 of EDII, residues 87 to 109 of EDII, residues 60 to 121 of EDII, residues 71 to 132 of EDII, residues 98 to 110 of EDII, residues 96 to 112 of EDII, residues 95 to 115 of EDII, residues 90 to 120 of EDII, residues 25 to 140, residues 40 to 125, residues 52 to 132, substantially all amino acid residues, all amino acid residues of a DENV EDII, or any intervening range, or any combination thereof.
  • the isolated antigenic peptide consists of preferably no more than 25 amino acid residues of amino acid residues 52-132 of EDII, more preferably no more than 20 amino acid residues of amino acid residues 52-132 of EDII, even more preferably no more than 15 amino acid residues of amino acid residues 52-132 of EDII.
  • the isolated antigenic peptide contains at least 8 to 9 amino acid residues for having the ability to bind to the major histocompatibility complex (MHC) class I.
  • MHC major histocompatibility complex
  • the isolated antigenic peptide contains 8 to 25 amino acid residues, more preferably 13 to 25 amino acid residues, for having the ability to bind to MHC class II.
  • the isolated antigenic peptide or fragment thereof can have one or more substitutions, deletions, additions, or any combination thereof of one or more amino acid residues, for example, 1 residue, 2 residues, 3 residue, 4 residues, 5 residues, 10 residues, 12 residues, 15 residues, 20 residues, 25 residues, 40 residues, 60 residues, 100 residues of EDII, or any range thereof, or any combination thereof.
  • Substitutions can be conservative, non-conservative, or both.
  • the antigenic peptide can be provided such that residues conserved amongst two or more of the DENV serotypes are retained and/or have conservative substitutions.
  • the number of amino acid residue is based on an amino acid sequence of an envelope protein (E protein) of dengu virus, which includes envelope first domains I, II and III (EDI, EDII, and EDIII), and more specifically based on an amino acid sequence of SEQ ID NO. 2.
  • E protein envelope protein
  • EDIII envelope first domains I, II and III
  • SEQ ID NO. 2 amino acid sequence of SEQ ID NO. 2.
  • the isolated antigenic peptide of the present invention can include a conformationally intact fusion loop of EDII.
  • the isolated antigenic peptide of the present invention can include a linear epitope.
  • the isolated antigenic peptide can be free of cysteine residues or contain 1, 2, 3, 4, 5, 6, or more cysteine amino acid residues.
  • the isolated antigenic peptide can contain a sufficient number of cysteine residues that form disulfide bonds with one another so as to retain, approximate, or sufficiently retain the conformation of the EDII or a portion thereof, for example, the fusion loop, so as to stimulate an immune response to a dengue viral infection.
  • the linear epitope may include a sufficient number of cysteine residues that form disulfide bonds with one another so as to retain, approximate, or sufficiently retain the conformational form.
  • Isolated nucleic acid molecules having a nucleotide sequence of a gene or other construct encoding an antigenic peptide of the present invention are provided.
  • the isolated nucleic acid molecules can contain one or more, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 20, 25, 30, 35, 40, 45, 50, 60, 75, 100, or more, nucleic substitutions, additions, deletions, or combination thereof, which can retain the amino acid sequence of the antigenic peptide or results in one or more amino acid residue substitutions, additions, and/or deletions.
  • Such nucleic acid molecules can be used to express the antigenic peptides using any suitable translation system including in vivo translation systems, ex vivo translation systems, in vitro translation systems, or any combination thereof.
  • the isolated nucleic acid molecules can be in the form of plasmids or other constructs.
  • the isolated nucleic acid molecules of the invention can be used for DNA or other nucleic-acid based vaccines.
  • a reagent formulated for a dengue disease diagnostic test containing at least one antigenic peptide of the present invention is provided. Such reagents can be provided separately or as part of kits. Accordingly, a reagent kit for dengue disease diagnostic test comprising at least one antigenic peptide of the present invention is also provided.
  • a method of diagnosing a dengue virus infection including a step of using at least one antigenic peptide of the present invention is also provided.
  • the method can include measuring a dengue virus antibody titer by an immunological method. Examples of immunological methods include enzyme-linked immunosorbent assay (ELISA)-type tests.
  • An antigenic peptide can bind an anti-dengue virus antibody obtained from a subject.
  • the bound antibody can be detected using a secondary antibody having a linked substrate, enzyme, or radiolabel that can be detected and analyzed for the presence or absence of a dengue virus infection.
  • diagnosis a dengue virus includes “measuring antibody levels of the subject to determine the subject to be given a vaccine” or “monitoring the status of the subject after administration of vaccine”.
  • the present invention provides vaccines comprising one or more antigenic peptide.
  • the vaccines of the present invention can also include at least one pharmaceutically acceptable excipient, at least one adjuvant, or both. Any suitable excipient, adjuvant, or both can be employed, for example, as described herein or otherwise known in the art.
  • the isolated EDII antigenic peptide, fragment thereof, variant thereof, or combination thereof can be conjugated to at least one carrier.
  • the at least one carrier can include at least one carrier protein. Any suitable carrier can be employed.
  • the at least one carrier protein need not include a DENV EDII or a fragment thereof.
  • the present invention provides a method of manufacturing a medicament including any vaccine of the present invention to vaccinate a subject that has or has not been previously infected with a dengue virus.
  • the present invention also provides a method of administering any vaccine of the present invention to vaccinate a subject that has or has not been previously infected with a dengue virus.
  • the patient can have been infected with any type of dengue virus, for example, a DENV-1 serotype, a DENV-2 serotype, a DENV-3 serotype, a DENV-4 serotype, or any combination thereof.
  • the vaccine can be administered before a DENV infection, after a DENV infection, or both.
  • the vaccine can be administered before a subject displays one or more DENV symptoms, after a subject displays one or more DENV symptoms, or both.
  • the vaccine can be administered one or more times, for example, the vaccine can be administered as an initial vaccination, as a booster, or both.
  • the dosage of vaccine administered can be varied to suit a particular subject, for example, based on the subject's physiology, the subject's medical history, whether or not the subject has previously had a DENV infection, the particular serotype(s) of a previous infection, whether or not the subject has previously been vaccinated for a DENV, the type of the previous DENV vaccination, the dosage of the previous vaccination, or any combination thereof.
  • the dose of DENV vaccine can be less than 1.0 ng, from about 1.0 ng to about 1.0 g, from about 100 ng to about 100 mg, from about 1 mg to about 10 mg, or other suitable amount of EDII antigenic peptide, fragment thereof, or derivative thereof.
  • Two or more dengue antagonists can act synergistically to prevent, treat, or reduce a dengue infection or a symptom of the same, for example, fever.
  • a dengue antagonist can be one or more antigenic peptide alone or in combination with one or more other dengue antagonist, for example, an anti-dengue antibody, a small drug pharmaceutical, or other anti-dengue therapy.
  • Two or more anti-dengue vaccines (for example, individual epitope-containing antigenic peptides, or at least one vaccine and one or more additional therapies can act synergistically to treat or reduce the susceptibility to the at least one inflammatory condition.
  • Two or more therapies, including one or more dengue vaccine can be administered in synergistic amounts.
  • the administration of two or more therapies can have a synergistic effect on the decrease in one or more symptoms of a dengue infection, whether administered simultaneously, sequentially, or in any combination.
  • a first therapy can increase the efficacy of a second therapy greater than if second therapy was employed alone, or a second therapy increases the efficacy of a first therapy, or both.
  • the effect of administering two or more therapies can be such that the effect on decreasing one or more symptoms of a dengue infection is greater than the additive effect of each being administered alone.
  • one therapy can enhance the efficacy of one or more other therapy on the decrease in one or more symptoms of a dengue infection, even if the amount of one or more therapy alone would have no substantial effect on one or more symptom of a dengue infection.
  • Measurements and calculations of synergism can be performed as described in Teicher, "Assays for In Vitro and In Vivo Synergy," in Methods in Molecular Medicine, vol. 85: Novel Anticancer Drug Protocols, pp. 297-321 (2003) and/or by calculating the combination index (CI) using CalcuSyn software.
  • Vaccine compositions of the present invention can be prophylactic (used to prevent infection), therapeutic (used to treat disease after infection), or both.
  • the vaccine compositions of the present invention can optionally contain diluents, such as water, saline, glycerol, ethanol, etc. Additionally, auxiliary substances, such as wetting or emulsifying agents, pH buffering substances, and the like, can be present in the compositions.
  • Vaccine compositions can include an immunogenic complex of the present invention in combination with one or more pharmaceutically acceptable carriers and/or diluents.
  • Suitable carriers can include large, slowly metabolized macromolecules such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers, lipid aggregates (such as oil droplets or liposomes), and inactive virus particles. Such carriers are well known to those of ordinary skill in the art. Additionally, these carriers can function as immunostimulating agents or adjuvants in addition to the adjuvant effect of the immunogenic complex itself.
  • the antigen can be conjugated to a bacterial toxoid, such as a toxoid from diphtheria, tetanus, cholera, H. pylori, etc., pathogens.
  • Vaccines of the present invention can be formulated and administered in any suitable manner, for example, as described in one or more of the following: Plotkin et al., Vaccines, 5th ed. (2008); Rappuoli et al., editor, Vaccine Design: Alternative Approaches and Novel Strategies (2011); Paoletti et al., editor, Vaccines: From Concept to Clinic: A Guide to the Development and Clinical Testing of Vaccines for Human Use (1998); O'Hagan et al., Vaccine Adjuvants: Preparation Methods and Research Protocols (Methods in Molecular Medicine) (2010); hackett et al., editor, “Vaccine Adjuvants: Immunological and Clinical Principles” (2005); Singh, editor, “Vaccine Adjuvants and Delivery Systems” (2007).
  • the vaccine compositions can optionally include adjuvants to enhance effectiveness of the composition.
  • Aluminum salts such as aluminum hydroxide, aluminum phosphate, aluminum sulfate, and the like; oil-in-water emulsion formulations with or without other specific immunostimulating agents such as muramyl peptides, such as, for example (a) MF59 (PCT Publ. No.
  • WO 90/14837 containing 5% Squalene, 0.5% Tween 80, and 0.5% Span 85 formulated into submicron particles
  • SAF containing 10% Squalene, 0.4% Tween 80, 5% pluronic-blocked polymer, and thr-MDP either microfluidized into a submicron emulsion or vortexed to generate a large particle size emulsion
  • RAS RIBI adjuvant system
  • Coreixa containing 2% squalene, 0.2% Tween 80, and one or more bacterial cell wall components from the group consisting of monophosphorylipid A (MPL), trehalose dimycolate (TDM), and cell wall skeleton (CWS), preferably MPL+CWS (DETOX); saponin adjuvants, such as STIMULON; Complete Freund's Adjuvant (CFA) and Incomplete Freund's Adjuvant (IFA); cytokines, such as interleukins (
  • interferons e.g. gamma interferon
  • M-CSF macrophage colony stimulating favtor
  • TNF tumor necrosis factor
  • a bacterial ADP-ribosylating toxin such as a cholera toxin (CT), a pertussis toxin (PT), or an E. coli heat-labile toxin (LT), particularly LT-K63, LT-R72, CT-S109, PT-K9/G129; see, e.g.
  • WO 93/13302 and WO 92/19265 other substances that act as immunostimulating agents to enhance the effectiveness of the composition; and microparticles with adsorbed macromolecules, as described in International Patent Application No. PCT/US99/17308 can be used alone or in combination as adjuvants.
  • Alum and/or MF59 can be used as adjuvants.
  • Adjuvants are utilized in a suitable amount, which can vary with the adjuvant, host animal and the particular epitope antigenic peptide utilized. Typical amounts can vary, for example, from about 1 microgram to about 1 milligram per immunization.
  • Adjuvants can be used, for example, as described in US 2007/0036826; US 2010/0047271.; Vaccine Adjuvants: Preparation Methods and Research Protocols (Methods in Molecular Medicine) (2010); hackett et al., editor, “Vaccine Adjuvants: Immunological and Clinical Principles” (2005); Singh, editor, “Vaccine Adjuvants and Delivery Systems” (2007) and Powell et al. editor, vol. 6, “Vaccine Design--The Subunit and Adjuvant Approach," 1995, Pharmaceutical Biotechnology.. Any suitable adjuvant can be employed, for example, those adjuvants that are capable of enhancing the antibody responses against epitopes.
  • Exemplary adjuvants include complete Freund's adjuvant (CFA), incomplete Freund's adjuvant (IFA), squalene, squalane, and an alum such as ALHYDROGEL (Superfos, Denmark).
  • Aluminum or calcium salts, such as hydroxide or phosphate salts, and aluminum hydroxide gels (alum) can be used.
  • Epitope antigenic peptide can be mixed with the adjuvant so that, for example, from about 50 microgram to about 800 microgram of aluminum are present per dose, or from about 400 microgram to about 600 microgram are present.
  • Calcium phosphate nanoparticles (CAP) from Biosante, Inc (Lincolnshire, Ill.) can be used as an adjuvant.
  • the epitope antigenic peptide can be coated on the outside of particles, encapsulated inside on the inside, or both, see He et al., Clin. Diagn. Lab. Immunol., 7(6):899-903 (2000).
  • the adjuvant can include an emulsion such as an oil-in-water emulsion or a water-in-oil emulsion.
  • emulsions can contain, for example, an oil phase of squalene, squalane, peanut oil or the like as are well known, and a dispersing agent.
  • Non-ionic dispersing agents can be used and can include, for example, mono- and di-C12-C24-fatty acid esters of sorbitan and mannide such as sorbitan mono-stearate, sorbitan mono-oleate and mannide mono-oleate.
  • Water-in-oil emulsions can include, for example, squalene, glycerol and a surfactant such as mannide mono-oleate (ARLACEL), optionally with squalane, emulsified with epitope antigenic peptides in an aqueous phase.
  • the oil phase can contain, for example, about 0.1 to about 10 percent of the vaccine, and more preferably about 0.2 to about 1 percent by weight or volume.
  • Alternative components of the oil-phase include alpha-tocopherol, mixed-chain di- and tri-glycerides, and sorbitan esters.
  • emulsions examples include MONTANIDE ISA-720, and MONTANIDE ISA 703 (Seppic, Castres, France), each of which is understood to contain both squalene and squalane, with squalene predominating in each, but to a lesser extent in MONTANIDE ISA 703.
  • MONTANIDE ISA-720 can be used, for example, using a ratio of oil-to-water of 7:3.
  • suitable oil-in-water emulsion adjuvants include those disclosed in WO 95/17210 and EP 0 399 843.
  • An adjuvant mixture can contain a stable water-in-oil emulsion further containing aminoalkyl glucosamine phosphates such as described in U.S. Pat. No. 6,113,918.
  • aminoalkyl glucosamine phosphate is the molecule known as RC-529.
  • a suitable water-in-oil emulsion is described in WO 9956776.
  • Small molecule adjuvants can be employed.
  • a 7-substituted-8-oxo- or 8-sulfo-guanosine derivative described in U.S. Pat. Nos. 4,539,205; 4,643,992; 5,011,828 and 5,093,318, can be used.
  • 7-allyl-8-oxoguanosine (loxoribine) can be used.
  • An adjuvant can include monophosphoryl lipid A (MPL), 3-deacyl monophosphoryl lipid A (3D-MPL).
  • the adjuvant can contain bacterial-derived components: monophosphoryl lipid (MPL) A, trehalose dimycolate (TDM) and cell wall skeleton (CWS) (MPL+TDM+CWS) in a 2% squalene/TWEEN 80 emulsion.
  • MPL monophosphoryl lipid
  • TDM trehalose dimycolate
  • CWS cell wall skeleton
  • This adjuvant can be prepared by the methods taught in GB 2122204B.
  • the adjuvant can be a compound structurally related to MPL adjuvant called aminoalkyl glucosamide phosphates (AGPs) such as RC-529 adjuvant ⁇ 2-[(R)-3-tetra-decanoyloxytetradecanoylamino]-ethyl-2-deoxy-4-O-phosphon-o-3-O-[(R)-3-tetradecanoyloxytetra-decanoyl]-2-[(R)-3-tetra-decanoyloxytet-radecanoyl-amino]-p-D-glucopyranoside triethylammonium salt ⁇ .
  • AGPs aminoalkyl glucosamide phosphates
  • RC-529 adjuvant is available in a squalene emulsion sold as RC-529SE and in an aqueous formulation as RC-529AF (see, U.S. Pat. No. 6,355,257 and No. 6,303,347; U.S. Pat. No. 6,113,918; and U.S. Publication No. 03-0092643).
  • Adjuvants can include synthetic oligonucleotide adjuvants containing the CpG nucleotide motif one or more times (plus flanking sequences).
  • the adjuvant designated QS21 is an immunologically active saponin fractions having adjuvant activity derived from the bark of the South American tree Quillaja Saponaria Molina (for example, QUIL), and the method of its production is disclosed in U.S. Pat. No. 5,057,540.
  • Derivatives of QUIL for example QS21 (an HPLC purified fraction derivative of QUIL also known as QA21), and other fractions such as QA17 can be used.
  • Muramyl dipeptide adjuvants can be used and include, for example, N-acetyl-muramyl-L-threonyl-D-isoglutamine (thur-MDP), N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine [CGP 11637, referred to as nor-MDP], and N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(1'-2'-dipalmityol-s- n-glycero-3-hydroxyphosphoryloxy)ethylamine [(CGP) 1983A, referred to as MTP-PE].
  • thur-MDP N-acetyl-muramyl-L-threonyl-D-isoglutamine
  • nor-MDP nor-MDP
  • MTP-PE N-acetylmuramyl-L-alanyl-D-
  • Muramyl dipeptide analogues are described in U.S. Pat. No. 4,767,842.
  • Suitable muramyl peptides include, but are not limited to, N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-acetyl-normauramyl-L-alanyl-D-isoglutamine (nor-MDP), N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(1'-2'-dipalmitoyl-s- n-glycero-3-hydroxyphosphoryloxy)-ethylamine (MTP-PE), and the like.
  • thr-MDP N-acetyl-muramyl-L-threonyl-D-isoglutamine
  • nor-MDP N-acetyl-normauramyl-
  • Adjuvant mixtures can be used and can include, for example, combinations of 3D-MPL and QS21 (EP 0 671 948 B1), oil-in-water emulsions comprising 3D-MPL and QS21 (WO 95/17210, PCT/EP98/05714), 3D-MPL formulated with other carriers (EP 0 689 454 B1), QS21 formulated in cholesterol-containing liposomes (WO 96/33739), or immunostimulatory oligonucleotides (WO 96/02555).
  • Adjuvant SBAS2 or ASO2, available from Glaxo
  • Adjuvants also include those described in WO 99/52549 and non-particulate suspensions of polyoxyethylene ether (UK Patent Application No. 9807805.8).
  • An adjuvant that contains one or more agonists for toll-like receptor-4 (TLR-4) such as an MPL adjuvant or a structurally related compound such as an RC-529 adjuvant or a Lipid A mimetic, can be used alone or along with an agonist for TLR-9 such as a non-methylated oligo deoxynucleotide-containing the CpG motif.
  • TLR-4 toll-like receptor-4
  • Such adjuvants can enhance the production of gamma-producing CD 8+, CD 4+ T cells and cytotoxic lymphocytes when admixed with a contemplated immunogenic HBc-containing particles or chemically linked to such an immunogen.
  • An organic carrier, positively charged, negatively charged, or both can be an adjuvant, for example, a saponin or a saponin complex such as ISCOMATRIX.
  • Exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. [See, e.g., Fingl et. al., in The Pharmacological Basis of Therapeutics, 1975, Ch. 1 p. I.]
  • the attending physician can determine when to terminate, interrupt, or adjust administration due to toxicity, or to organ dysfunctions. Conversely, the attending physician can also adjust treatment to higher levels if the clinical response were not adequate, precluding toxicity.
  • the magnitude of an administrated dose in the management of disorder of interest will vary with the severity of the disorder to be treated and the route of administration. The severity of the disorder can, for example, be evaluated, in part, by standard prognostic evaluation methods.
  • the dose and dose frequency can vary according to the age, body weight, and response of the individual patient. A program comparable to that discussed above can be used in veterinary medicine.
  • compositions herein disclosed for the practice of the invention are within the scope of the present invention.
  • the compounds can be formulated readily using pharmaceutically acceptable carriers well known in the art into dosages suitable for oral administration.
  • Such carriers enable the compounds relevant to the present invention to be formulated as tablets, pills, capsules, liquids, gels, syrups, slurries, tablets, dragees, solutions, suspensions and the like, for oral ingestion by a patient to be treated.
  • the therapeutic agent can be prepared in a depot form to allow for release into the body to which it is administered is controlled with respect to time and location within the body (see, for example, U.S. Patent No. 4,450,150).
  • Depot forms of therapeutic agents can be, for example, an implantable composition containing the therapeutic agent and a porous or non-porous material, such as a polymer, wherein the therapeutic agent is encapsulated by or diffused throughout the material and/or degradation of the non-porous material.
  • the depot is then implanted into the desired location within the body and the therapeutic agent is released from the implant at a predetermined rate.
  • the therapeutic agent that is used in the present invention can be formed as a composition, such as a pharmaceutical composition containing a carrier and a therapeutic compound.
  • Pharmaceutical compositions containing the therapeutic agent can include more than one therapeutic agent.
  • the pharmaceutical composition can alternatively contain a therapeutic agent in combination with other pharmaceutically active agents or drugs.
  • the carrier can be any suitable carrier.
  • the carrier can be a pharmaceutically acceptable carrier.
  • the carrier can be any of those conventionally used with consideration of chemico-physical considerations, such as solubility and lack of reactivity with the active compound(s), and by the route of administration.
  • the therapeutic compounds of the present inventive methods can be formulated as inclusion complexes, such as cyclodextrin inclusion complexes, or liposomes.
  • the pharmaceutically acceptable carriers described herein for example, vehicles, adjuvants, excipients, and diluents; are well-known to those skilled in the art and are readily available to the public.
  • the pharmaceutically acceptable carrier can be chemically inert to the active agent(s) and one which has no detrimental side effects or toxicity under the conditions of use.
  • the choice of carrier can be determined in part by the particular therapeutic agent, as well as by the particular method used to administer the therapeutic compound.
  • suitable formulations of the pharmaceutical composition of the present invention There are a variety of suitable formulations of the pharmaceutical composition of the present invention.
  • compositions for oral, aerosol, parenteral, subcutaneous, transdermal, transmucosal, intestinal, intramedullary injections, direct intraventricular, intravenous, intranasal, intraocular, intramuscular, intraarterial, intrathecal, intraperitoneal, rectal, and vaginal administration are exemplary and are in no way limiting. More than one route can be used to administer the therapeutic agent, and in some instances, a particular route can provide a more immediate and more effective response than another route. Such agents can be formulated and administered systemically or locally. Techniques for formulation and administration can be found in Remington's Pharmaceutical Sciences, 18th ed., Mack Publishing Co., Easton, Pa. (1990).
  • Formulations suitable for oral administration can include (a) liquid solutions, such as an effective amount of the inhibitor dissolved in diluents, such as water, saline, or orange juice; (b) capsules, sachets, tablets, lozenges, and troches, each containing a predetermined amount of the active ingredient, as solids or granules; (c) powders; (d) suspensions in an appropriate liquid; and (e) suitable emulsions.
  • Liquid formulations can include diluents, such as water and alcohols, for example, ethanol, benzyl alcohol, and the polyethylene alcohols, either with or without the addition of a pharmaceutically acceptable surfactant.
  • Capsule forms can be of the ordinary hard or soft shelled gelatin type containing, for example, surfactants, lubricants, and inert fillers, such as lactose, sucrose, calcium phosphate, and corn starch.
  • Tablet forms can include one or more of lactose, sucrose, mannitol, corn starch, potato starch, alginic acid, microcrystalline cellulose, acacia, gelatin, guar gum, colloidal silicon dioxide, croscarmellose sodium, talc, magnesium stearate, calcium stearate, zinc stearate, stearic acid, and other excipients, colorants, diluents, buffering agents, disintegrating agents, moistening agents, preservatives, flavoring agents, and other pharmacologically compatible excipients.
  • Lozenge forms can contain the inhibitor in a flavor, usually sucrose and acacia or tragacanth, as well as pastilles containing the inhibitor in an inert base, such as gelatin and glycerin, or sucrose and acacia, emulsions, gels, and the like containing, in addition to, such excipients as are known in the art.
  • an inert base such as gelatin and glycerin, or sucrose and acacia, emulsions, gels, and the like containing, in addition to, such excipients as are known in the art.
  • compositions that can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol.
  • the push-fit capsules can contain the active ingredients in admixture with filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers.
  • the active compounds can be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols.
  • stabilizers can be added.
  • the therapeutic agent can be made into aerosol formulations to be administered via inhalation.
  • aerosol formulations can be placed into pressurized acceptable propellants, such as dichlorodifluoromethane, propane, nitrogen, and the like. They also can be formulated as pharmaceuticals for non-pressurized preparations, such as in a nebulizer or an atomizer. Such spray formulations also can be used to spray mucosa.
  • Topical formulations are well known to those of skill in the art. Such formulations are particularly suitable in the context of the invention for application to the skin.
  • Injectable formulations are in accordance with the present invention.
  • the parameters for effective pharmaceutical carriers for injectable compositions are well-known to those of ordinary skill in the art [see, e.g., Pharmaceutics and Pharmacy Practice, J. B. Lippincott Company, Philadelphia, PA, Banker and Chalmers, eds., pages 238250 (1982), and ASHP Handbook on Injectable Drugs, Toissel, 4th ed., pages 622 630 (1986)].
  • the agents of the present invention can be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer. Penetrants appropriate to the barrier to be permeated can be used in the formulation.
  • Formulations suitable for parenteral administration can include aqueous and non-aqueous, isotonic sterile injection solutions, which can contain anti-oxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, and preservatives.
  • the therapeutic agent can be administered in a physiologically acceptable diluent in a pharmaceutical carrier, such as a sterile liquid or mixture of liquids, including water, saline, aqueous dextrose and related sugar solutions, an alcohol, such as ethanol or hexadecyl alcohol, a glycol, such as propylene glycol or polyethylene glycol, poly(ethyleneglycol) 400, glycerol, dimethylsulfoxide, ketals such as 2,2-dimethyl-l,3- dioxolane-4-methanol, ethers, oils, fatty acids, fatty acid esters or glycerides, or acetylated fatty acid glycerides with or without the addition of a pharmaceutically acceptable surfactant, such as a soap or a detergent, suspending agent, such as pectin, carbomers, methylcellulose, hydroxypropylmethylcellulose, or carboxymethylcellulose, or emulsifying agents and other pharmaceutical adjuvants.
  • Oils which can be used in parenteral formulations, include petroleum, animal, vegetable, or synthetic oils. Specific examples of oils include peanut, soybean, sesame, cottonseed, corn, olive, petrolatum, and mineral. Suitable fatty acids for use in parenteral formulations include oleic acid, stearic acid, and isostearic acid. Ethyl oleate and isopropyl myristate are examples of suitable fatty acid esters.
  • Suitable soaps for use in parenteral formulations include fatty alkali metal, ammonium, and triethanolamine salts
  • suitable detergents include (a) cationic detergents such as, for example, dimethyl dialkyl ammonium halides, and alkyl pyridinium halides, (b) anionic detergents such as, for example, alkyl, aryl, and olefin sulfonates, alkyl, olefin, ether, and monoglyceride sulfates, and sulfosuccinates, (c) nonionic detergents such as, for example, fatty amine oxides, fatty acid alkanolamides, and polyoxyethylenepolypropylene copolymers, (d) amphoteric detergents such as, for example, alkyl-beta-aminopropionates, and 2-alkyl-imidazoline quaternary ammonium salts, and (e) mixtures thereof.
  • Preservatives and buffers can be used.
  • such compositions can contain one or more nonionic surfactants having a hydrophilic-lipophilic balance (HLB) of from about 12 to about 17.
  • HLB hydrophilic-lipophilic balance
  • the quantity of surfactant in such formulations can range, for example, from about 5% to about 15% by weight of the formulation.
  • Suitable surfactants include, for example, polyethylene glycol sorbitan fatty acid esters, such as sorbitan monooleate and the high molecular weight adducts of ethylene oxide with a hydrophobic base, formed by the condensation of propylene oxide with propylene glycol.
  • parenteral formulations can be presented in unit-dose or multi-dose sealed containers, such as ampoules and vials, and can be stored in a freeze-dried (lyophilized) condition involving only the addition of the sterile liquid excipient, for example, water, for injections, immediately prior to use.
  • sterile liquid excipient for example, water
  • Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules, and tablets of the kind previously described.
  • the therapeutic agent can be made into suppositories by mixing with a variety of bases, such as emulsifying bases or water-soluble bases.
  • bases such as emulsifying bases or water-soluble bases.
  • Formulations suitable for vaginal administration can be presented as pessaries, tampons, creams, gels, pastes, foams, or spray formulas containing, in addition to the active ingredient, such carriers as are known in the art to be appropriate.
  • Agents intended to be administered intracellularly can be administered using techniques well known to those of ordinary skill in the art.
  • such agents can be encapsulated into liposomes.
  • Liposomes are spherical lipid bilayers with aqueous interiors. Molecules present in an aqueous solution at the time of liposome formation are incorporated into the aqueous interior.
  • the liposomal contents are both protected from the external microenvironment and, because liposomes fuse with cell membranes, are efficiently delivered into the cell cytoplasm. Additionally, due to their hydrophobicity, small organic molecules can be directly administered intra-cellularly.
  • Materials and methods described for one aspect of the present invention can also be employed in other aspects of the present invention. For example, a material such as a peptide, a nucleic acid, or an antibody described for use in screening assays can also be employed as therapeutic agents and vice versa.
  • Anti-dengue vaccines of the present invention can be administered to a subject before, during, and/or after diagnosing the patient as having a dengue infection.
  • Dengue infection is caused by any one of four distinct but closely related dengue virus (DENV) serotypes (called DENV-1, -2, -3, and -4).
  • DENV-1, -2, -3, and -4 distinct but closely related dengue virus serotypes
  • These dengue viruses are single-stranded RNA viruses that belong to the family Flaviviridae and the genus Flavivirus-a family which includes other medically significant vector-borne viruses (for example, West Nile virus, Yellow Fever virus, Japanese Encephalitis virus, St. Louis Encephalitis virus, and the like).
  • Dengue viruses are arboviruses that are transmitted primarily to humans through the bite of an infected Aedes species mosquito.
  • Transmission can also occur through transfusion of infected blood or transplantation of infected organs or tissues.
  • Human transmission of dengue is also known to occur after occupational exposure in healthcare settings (for example, needle stick injuries) and cases of vertical transmission have been described in the literature (that is, transmission from a dengue infected pregnant mother to her fetus in utero or to her infant during labor and delivery).
  • dengue serotypes can produce the full spectrum of illness and severity.
  • the spectrum of illness can range from a mild, non-specific febrile syndrome to classic dengue fever (DF), to the severe forms of the disease, dengue hemorrhagic fever (DHF) and dengue shock syndrome (DSS). Severe forms typically manifest after a two to seven day febrile phase and are often heralded by clinical and laboratory warning signs.
  • Management of dengue can include timely and judicious use of supportive care, including administration of isotonic intravenous fluids or colloids, and close monitoring of vital signs and hemodynamic status, fluid balance, and hematologic parameters.
  • DHF can usually be distinguished from DF as it progresses through its three predictable pathophysiological phases.
  • a febrile phase can include viremia-driven high fevers.
  • a critical/plasma leak phase can include sudden onset of varying degrees of plasma leak into the pleural and abdominal cavities.
  • a convalescence or reabsorption phase can include a sudden arrest of plasma leak with concomitant reabsorption of extravasated plasma and fluids.
  • the anti-dengue antibodies of the present invention can be administered during any phase or combination of phases.
  • Dengue infected patients are either asymptomatic or they can have one of three clinical presentations: undifferentiated fever, dengue fever with or without hemorrhage, or dengue hemorrhagic fever or dengue shock syndrome. As many as one half of all dengue infected individuals are asymptomatic, that is, they have no clinical signs or symptoms of disease.
  • the first clinical course is a relatively benign scenario where the patient experiences fever with mild non-specific symptoms that can mimic any number of other acute febrile illnesses. They may not meet case definition criteria for DF.
  • Dengue fever with or without hemorrhage patients are typically older children or adults and they can present within two to seven days of high fever (occasionally biphasic) and have two or more of the following symptoms: severe headache, retro-orbital eye pain, myalgias, arthralgias, a diffuse erythematous maculo-papular rash, and mild hemorrhagic manifestation.
  • Other forms of hemorrhage such as epistaxis, gingival bleeding, gastrointestinal bleeding, or urogenital bleeding can also occur, but are rare.
  • Leukopenia is frequently found and may be accompanied by varying degrees of thrombocytopenia. Children can also have nausea and vomiting. Patients with DF do not generally develop substantial plasma leak (as in DHF and DSS) or extensive clinical hemorrhage.
  • Serological testing for anti-dengue IgM antibodies or molecular testing for dengue viral RNA or viral isolation can confirm the diagnosis.
  • Clinical presentation of DF and the early phase of DHF are similar. With close monitoring of key indicators, the development of DHF can be detected at the time of defervescence so that early and appropriate therapy can be initiated.
  • DHF Dengue hemorrhagic fever
  • DSS dengue shock syndrome
  • Dengue viremia is typically highest in the first three to four days after onset of fever but then falls quickly to undetectable levels over the next few days. The level of viremia and fever usually follow each other closely, and anti-dengue IgM anti-bodies increase as fever abates.
  • Patients with plasma leak can be monitored for early changes in hemodynamic parameters consistent with compensated shock such as increased heart rate (tachycardia) for age especially in the absence of fever, weak and thready pulse, cool extremities, narrowing pulse pressure (systolic blood pressure minus diastolic blood pressure ⁇ 20 mmHg), delayed capillary refill (>2 seconds), and decrease in urination.
  • compensated shock such as increased heart rate (tachycardia) for age especially in the absence of fever, weak and thready pulse, cool extremities, narrowing pulse pressure (systolic blood pressure minus diastolic blood pressure ⁇ 20 mmHg), delayed capillary refill (>2 seconds), and decrease in urination.
  • Patients exhibiting signs of increasing intravascular depletion, impending or frank shock, or severe hemorrhage can be admitted to an appropriate level intensive care unit for monitoring and intravascular volume replacement.
  • frank shock Once a patient experiences frank shock he or she can be categorized as having DSS
  • Anticipatory management and monitoring indicators can be used in effectively administering therapies as the patient enters the critical phase.
  • New-onset leucopenia WBC ⁇ 5,000 cells/mm3 with a lymphocytosis and an increase in atypical lymphocytes indicate that the fever will likely dissipate within the next 24 hours and that the patient is entering into the critical phase.
  • the critical period can last less than 24 to 48 hours. Most of the complications that arise during this period-such as hemorrhage and metabolic abnormalities (for example, hypocalcemia, hypoglycemia, hyperglycemia, lactic acidosis, and hyponatremia) are frequently related to prolonged shock.
  • the principal objective during this period can be to prevent prolonged shock and support vital systems until plasma leak subsides. Careful attention can be paid to the type of intravenous fluid (or blood product if transfusion is needed) administered, the rate, and the volume received over time. Frequent monitoring of intravascular volume, vital organ function, and the patient's response can be performed. Monitoring for overt and occult hemorrhage can be performed. Transfusion of volume-replacing blood products can be implemented if substantial hemorrhage is suspected during this phase.
  • the convalescent (reabsorption) phase can begin when the critical phase ends and is characterized when plasma leak stops and reabsorption begins. During this phase, fluids that leaked from the intravascular space (i.e., plasma and administered intravenous fluids) during the critical phase are reabsorbed. Indicators suggesting that the patient is entering the convalescent phase include sense of improved well-being reported by the patient, return of appetite, stabilizing vital signs (widen pulse pressure, strong palpable pulse), bradycardia, hematocrit levels returning to normal, increased urine output, and appearance of the characteristic convalescence rash of dengue (i.e., a confluent sometimes pruritic, petechial rash with multiple small round islands of unaffected skin).
  • an acute-phase serum specimen can be collected for serology at least 7 days before onset of fever and paired with convalescent serum drawn at least 7 days after the acute phase, optimally 14-21 days after onset of fever (Halstead, Annu. Rev. Entomol., 53:273-291 (2008); Kurosu et al., Biochem. Biophys. Res. Commun. 394:398-404 (2010)).
  • HuMAbs human monoclonal antibodies
  • peripheral blood lymphocytes peripheral blood lymphocytes
  • E envelope
  • EDII first domain II of envelope
  • HuMAbs Germline analysis of the HuMAbs revealed that the 17 HuMAbs were composed by 10 types of IGHV, 9 types of IGHD, and 5 types of IGHJ gene fragments, indicating no significant correlation between reactivities of HuMAbs and germline profiles.
  • most of the globally reactive antibodies with strong neutralizing activity in patients at the acute phase of secondary infection recognize a similar site of the first EDII, including fusion domain as epitopes, but the amino acid residues significant for their recognitions and germlines of HuMAbs were variable among HuMAb clones.
  • Anti-DENV multifocal antibodies appeared quickly after boost stimulation of memory B lymphocytes by secondary DENV infection and can block the virus entry process.
  • the epitope site identified in this study is highly useful as an epitope-based prophylactic vaccine for dengue illness.
  • Vero cells used for viral neutralization assays, were maintained in a 5% CO2 incubator at 37 degrees C in minimum essential medium (MEM; Sigma-Aldrich, St. Louis, MO) with 10% FBS.
  • the mosquito-derived cell line C6/36 used for virus propagation was maintained in a 28 degrees C incubator in Leibovitz's L-15 medium (Life Technologies Corp., Carlsbad, CA) with 10% FBS and 0.3% tryptose phosphate broth.
  • THP-1 cells used for the ADE assay were maintained in a 5% CO2 incubator at 37 degrees C in DMEM supplemented with 10% FBS.
  • the laboratory strain of DENV-2 was the 16681 strain.
  • 17 HuMAb clones had been selected from a total 136 hybridoma clones, of which 121 were from four Thai patients in the acute phase and 15 from five Thai patients in the convalescent phase [Setthapramote et al., Biochem. Biophy. Res. Commun. 423:867-872 (2012)].
  • all of these 17 clones were derived from three patients in the acute phase: 12 from a 33 year old female (D23) 5 days after the onset of DF; three from a 23 year old female (D30) 8 days after the onset of DHF; and two from a 19 year old male (D32) 8 days after the onset of dengue fever.
  • Table 3 summarizes results of Western blotting for HuMAbs' reactivity with several truncated forms of DENV E protein
  • Table 4 summarizes results of Western blotting for HuMAb reactivities with several truncated forms within the DENV E protein first Domain II.
  • Plasmids expressing full-length (EF) and several truncated forms (T1 to T5) of DENV-2 E protein were constructed ( Figure 1A). Western blotting with anti-FLAG antibody of 293T cells transfected with these plasmids showed that all constructs were expressed at appropriate size ( Figure 1B). HuMAb D23-1G7C2, as a representative, reacted with all truncated forms except for T5 ( Figure 1C), indicating that the 1st DII of E protein (aa 52-132 of E protein based on amino acid sequence shown at SEQ ID: No.2) contains the epitope for this HuMAb.
  • DENV-2 (NC strain) expressed in E. coli were further constructed, as shown in Figure 2A.
  • D23-1G7C2 HuMAb reacted with truncated forms aa 1-192, aa 53-192, aa 53-132, aa 71-132, and aa 74-109, but not aa 71-105 based on amino acid sequence shown at SEQ ID: No.2, by Western blotting ( Figure 2B).
  • the minimum-sized region reactive with D23-1G7C2 HuMAb was aa 74-109 based on amino acid sequence shown at SEQ ID: No.2, which indicates the significance of residues 74C, 92C, and 105C, but not 116C.
  • Another HuMAb (D23-1C2D2), showed the same results ( Figure 2C), as summarized in Table 3.
  • the other 9 HuMAbs such as D23-1H5A11 and D23-3A10G12 ( Figure 2C) showed clear positive reactions to the truncated forms aa 71-132, but not aa 74-109 and aa 71-105; based on amino acid sequence shown at SEQ ID: No.2, as summarized in Table 4.
  • the minimum-sized region reactive with these HuMAbs was aa 71-132, indicating the significance of residues 74C, 92C, 105C, and also 116C.
  • HuMAbs focused were prepared with the PBMCs from three dengue patients at acute-phase (around 1 week after the onset of fever) of the secondarily infected with DENV-2.
  • the initially infected DENV, of unknown serotype(s) can play a role for priming to establish anti-DENV immune repertories and then subsequently lead to the memory immune cells to establish permanent protection against the primarily infected serotype(s) of DENV.
  • the virus could actively respond to their memory B cells for a quick production of anti-DENV IgG to play an inhibitory role against as well as an enhancing role for DENV-2 replication at the acute phase.
  • immunological memory is established in the cellular and humoral immune compartments.
  • humoral immune memory depends on two B cell populations: long-lived plasma cells and memory B cells [Slifka et al., Curr. Opin. Immunol. 10: 252-258(1998); Yoshida et al., Immunol. Rev. 237: 117-139 (2010)].
  • Long-lived plasma cells mainly migrate to the bone marrow and are responsible for long-term humoral immunity [Slifka et al., Curr. Opin. Immunol. 10: 252-258(1998); Yoshida et al., Immunol. Rev. 237: 117-139 (2010); Manz et al., Curr. Opin.
  • Plasma cell populations at acute phase in dengue patients have been shown to be unusually high, leached to around 30% in the peripheral blood lymphocytes, that seems to be greatly higher than influenza patients and influenza-vaccinated donors [Wrammert et al., J. Virol., 86:2911-2918(2012)].
  • DENV infections long-lived plasma cells can undergo long-term secretion of specific antibodies, which plays a role in protection against homologous DENV serotypes, while memory B cells seem to be rapidly activated by secondary infection with DENV serotypes different from that of the serotype in the primary infection.
  • HuMAbs selected for this study which showed strong neutralizing activity to all four serotypes [Sasaki et al., Antiviral Res 98:423-431(2013)], were derived from antibody-producing lymphocytes at around 1 week after the onset of illness following a secondary infection with DENV-2. No such HuMAbs were obtained from any of the five patients at around 2 weeks after the onset of illness in another study [Setthapramote et al., Biochem. Biophy. Res. Commun. 423:867-872 (2012)]. Such antibodies constructed and expressed can be generated by the rapid stimulation of DENV-derived memory B cells produced during a primary infection.
  • the three acute phase patients in this study may have been primarily infected with DENV serotypes other than DENV-2. This means that all of the patients in this study may have produced anti-DENV antibodies from serotypes other than DENV-2 during a primary infection. The secondarily infected DENV-2 would have simply served to boost the existing memory B lymphocyte population. Interestingly, immunofluorescence binding and viral neutralization assays showed that their activities of most of the HuMAbs showed higher against DENV-2 and DENV-4 than DENV-1 and DENV-3 [Sasaki et al., Antiviral Res 98:423-431(2013)].
  • Epitope mapping of anti-DENV HuMAbs derived from the acute-phase of secondarily infected patients was performed in accordance with the present invention.
  • Epitope mapping with several truncated E proteins derived from DENV-2 revealed that at least 13 out of the above 17 HuMAbs recognize the first EDII [Sasaki et al., Antiviral Res 98:423-431(2013)].
  • the remaining 4 HuMAbs did not react with any of these truncated forms on Western blots, indicating that the epitope for these four HuMAbs may be conformation-dependent.
  • further shorter truncated forms were constructed and expressed within the first EDII of DENV-2 E protein in E. coli.
  • Plasmids expressing truncated forms of DENV-2 E protein in E. coli. were constructed. A gene fragment corresponding to the N-terminal half of the DENV-2 E protein (1-192) was amplified by one-step RT-PCR as described previously [Setthapramote et al., Biochem. Biophy. Res. Commun. 423:867-872 (2012)] and inserted into the E. coli expression vector pET32b (Merck KGaA, Darmstadt, Germany) by standard gene manipulation techniques. This vector was designed to express the DENV-2 E protein fragment fused with thioredoxin and His6 tag at the N-terminal side.
  • Truncated forms of the DENV-2 E gene were generated by site-directed mutagenesis (KOD -PLUS- Mutagenesis kit; TOYOBO Life Science, Osaka, Japan). Each sequence was confirmed by using the Applied Biosystems 3130xl Genetic Analyzer.
  • E. coli BL21 (DE3) strain was transformed with each expression vector and cultured in LB broth supplemented with 50 microgram per milliliter ampicillin. Expression was induced by the addition of 0.2 mM IPTG, and cells were harvested following incubation for 6 hours at room temperature. The harvested cells were suspended in SDS-PAGE loading buffer containing 100 mM dithiothreitol. Proteins were separated by electrophoresis and blotted onto PVDF membrane.
  • the membrane was incubated with the culture fluid of hybridoma cells of each HuMAb for 20 hours at 4 degrees C, followed by incubation with HRP-conjugated anti-human IgG for 2 hours at room temperature.
  • mouse anti-His MAb and anti-influenza virus HuMAb 5E4 [Yasugi et al. Emerging antigenic variants at the antigenic site Sb in pandemic (H1N1) 2009 influenza virus in Japan detected by a human monoclonal antibody. PLoS One] were employed as the 1st probes.
  • HRP-conjugated anti-mouse IgG was alternatively used as 2nd probe.
  • Membrane was subjected to reaction with Immobilon Western HRP Substrate (Millipore) and detection was performed by ImageQuant LAS4000 imager (GE Healthcare).
  • HuMAbs showed various patterns in reactivity with these truncated forms (Table 5-1) and were classified into at least three groups: 1) HuMAbs (D23-1B3B9, D23-1C2D2, D23-1G7C2, and D30-3A1E2) that reacted with 52-132, 60-121, 74-118, and 74-109, but not 71-105, indicating the presence of epitope within 74-109, named the "group E74-109”; 2) HuMAbs (D23-1H5A11, D23-3A10G12, D23-4F5E1, D23-4F5E1, and D23-5G8E3) that reacted with 52-132, 60-121, 74-118, but not 74-109 and 71-105, indicating the presence of epitope within 74-118, named the "group E74-118”; and 3) HuMAbs (D23-1A10H7 and D30-2D1G5) that reacted with 52-132 and 60
  • HuMAbs recognize the epitope within the region 60-121 of the first EDII where a compact fold is supported by the beta sheet and three disulfide bonds (Figure 4A).
  • the HuMAbs could be divided into the three groups E74-109 (four HuMAbs), E74-118 (five HuMAbs) and E60-121 (two HuMAbs), based on the minimum region within the 60-121.
  • the regions reactive for the HuMAbs that is, 74-109, 74-118 and 60-121, share the whole or most of the fusion loop (98-110) [Roehrig et al., Virology, 177:668-675(1990)], whereas the region 71-105 lacking the 5 residues of the fusion loop seems to lose the reactivity for all HuMAbs.
  • the role of the fusion loop for the 11 HuMAbs was clearly demonstrated by the mutation experiment in prM-E backbone, as a single substitution at the W101 resulted in complete loss of reactivity for all HuMAbs regardless of the substitution types (W101A and W101L).
  • Epitope region for HuMAb D23-1G7C2 was further analyzed using truncates of the envelope protein, including the regions; 82-132 (SEQ ID No. 101), 83-109 (SEQ ID No. 102), 84-109 (SEQ ID No. 103), 85-109 (SEQ ID No. 104), 86-109 (SEQ ID No. 105), 87-109 (SEQ ID No. 106), 88-132 (SEQ ID No. 107), 82-106 (SEQ ID No. 108) and 82-107 (SEQ ID No. 109).
  • the reactivity was examined by western blotting analysis and the result was shown in Table 5-2.
  • D23-1G7C2 reacted with a series of N-terminal truncates, 82-132, 83-109, 84-109, 85-109, 86-109 and 87-109 but not with 88-132, indicating that residue 87 is involved in the epitope.
  • the both truncates; 82-106 and 82-107 lost reactivity, indicating that residue 109 (or 108) is involved in the epitope.
  • the minimum truncate keeping the reactivity for D23-1G7C2 was 87-109, and it could be considered as the epitope region.
  • Mutant prM-E fusion proteins were prepared with amino acid substitutions at several residues and Western blotting using proteins expressed in mammalian cells was performed for more detailed analyses. A total of 14 mutants were constructed in the context of prM-E fusion protein, as shown in Fig. 2A, and expressed in 293T cells. Six cysteine residues forming three S-S bonds (C60 to C121, C74 to C105, and C92 to C116) were substituted to serine. In addition, four amino acid residues at the fusion loop within the first EDII were substituted to alanine and also to amino acid residue with similar property, that is, D98A and D98N; R99A and R99K; W101A and W101L; and F108A and F108L.
  • Wild-type prM-E protein was reacted well with all 11 HuMAbs, while negative control GFP alone was not reacted with any of these 11 HuMAbs by Western blotting. The reactivity of the 11 HuMAbs with the 14 mutants was examined.
  • PCR was performed with mixture of both products and primer pair (T7 primer and SP6 primer) using PrimeSTAR MAX DNA polymerase. After restriction enzyme treatment, the product was ligated with the FLAG-KDEL-pcDNA3 vector and transfected to STBL3 competent cell (Life technologies). Plasmid was extracted from the cells, and then mutation introduced in the prM-E gene was confirmed by using the Applied Biosystems 3130xl Genetic Analyzer.
  • Membranes were incubated with the culture fluid of hybridoma cells overnight at 4 degrees C, followed by incubation with HRP-conjugated anti-human IgG for 1 hour at room temperature. Chemiluminescent detection was performed with Luinata Forte Western HPR Substrate (Millipore) followed by exposure to Amersham Hyperfilm ECL (GE Healthcare). Expression of each mutant protein was confirmed by using mouse anti-FLAG MAb and donkey anti-mouse IgG as first and second probes, respectively.
  • the 11 HuMAbs showed common characteristics as described above, they were separable based on the responses to E protein with the substitutions at D98, R99 and F108 in the fusion loop, and to the truncation of the beta strands around the fusion loop.
  • the fusion loop residue F108 which is spatially adjacent to the W101, has been reported as an epitope residue (W101, L107, and F108) for the DENV cross-reactive HuMAbs [Lai et al., J. Virol., 82:6631-6643(2008)].
  • the HuMAbs derived from the acute-phase of secondarily infected dengue patients with DF and also secondarily infected dengue patient with DHF were very similar in their mechanism to recognize epitope site of DENV protein.
  • This example demonstrates that an epitope-based vaccine of the present invention can produce similar neutralizing antibodies in individuals who already have an anti-DENV immune repertoire by primary infection of DENV, and that such antibodies have the capability to function to reduce viral replication when they infect secondarily with heterotypic DENV.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Virology (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biochemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Cell Biology (AREA)
  • Analytical Chemistry (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Mycology (AREA)
  • Biotechnology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Food Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Epidemiology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

L'invention concerne des matériaux et des procédés pour détecter, prévenir et traiter des infections par le virus de la dengue et leurs symptômes. Des peptides antigènes, des acides nucléiques isolés codant pour ces peptides, des réactifs contenant ces peptides, des kits de réactifs et des procédés de détection sont décrits. Des vaccins qui contiennent un ou plusieurs peptides antigènes basés sur le premier domaine II d'une protéine d'enveloppe (EDII) d'un virus de la dengue (DENV) sont décrits. Ces vaccins sont en mesure de stimuler une réponse immunologique à un virus de la dengue chez un sujet infecté au préalable par un virus de la dengue. L'invention concerne également des procédés de fabrication de tels vaccins. Elle concerne également des procédés d'administration de ces vaccins en vue de vacciner un sujet qui a été infecté au préalable, ou non, par un virus de la dengue.
PCT/JP2013/006333 2012-10-25 2013-10-25 Peptide antigène dérivé du virus de la dengue WO2014064943A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201261718266P 2012-10-25 2012-10-25
US61/718,266 2012-10-25

Publications (1)

Publication Number Publication Date
WO2014064943A1 true WO2014064943A1 (fr) 2014-05-01

Family

ID=50544327

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2013/006333 WO2014064943A1 (fr) 2012-10-25 2013-10-25 Peptide antigène dérivé du virus de la dengue

Country Status (1)

Country Link
WO (1) WO2014064943A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018076001A1 (fr) * 2016-10-21 2018-04-26 National Cheng Kung University Polypeptide synthétique, composition vaccinale le comprenant, et leurs utilisations
WO2018071822A3 (fr) * 2016-10-13 2018-05-24 Massachusetts Institute Of Technology Anticorps se liant à la protéine d'enveloppe du virus zika et leurs utilisations
CN114790232A (zh) * 2022-02-24 2022-07-26 中国人民解放军陆军军医大学 Cnpy3蛋白作为治疗登革热靶点的用途
CN115804362A (zh) * 2023-02-08 2023-03-17 中国医学科学院医学生物学研究所 一种IFN-α/βR-/-小鼠抗体依赖性增强感染的注射液及其制备方法

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006025990A2 (fr) * 2004-07-27 2006-03-09 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services, Centers For Diseases Control And Prevention Localisation et caracterisation d'epitopes d'enveloppe de glycoproteine de flavivirus a reactivite croisee et leurs methodes d'utilisation

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006025990A2 (fr) * 2004-07-27 2006-03-09 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services, Centers For Diseases Control And Prevention Localisation et caracterisation d'epitopes d'enveloppe de glycoproteine de flavivirus a reactivite croisee et leurs methodes d'utilisation

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
ANA P. GONCALVEZ ET AL.: "Epitope Determinants of a Chimpanzee Fab Antibody That Efficiently Cross-Neutralizes Dengue Type 1 and Type 2 Viruses Map to Inside and in Close Proximity to Fusion Loop of the Dengue Type 2 Virus Envelope Glycoprotein", J. VIROL., vol. 78, no. 23, 2004, pages 12919 - 12928 *
ANDREW K.I. FALCONAR: "Use of synthetic peptides to represent surface-exposed epitopes defined by neutralizing dengue complex- and flavivirus group-reactive monoclonal antibodies on the native dengue type-2 virus envelope glycoprotein", J. GEN. VIROL., vol. 89, 2008, pages 1616 - 1621 *
CHIH-YUN LAI ET AL.: "Antibodies to Envelope Glycoprotein of Dengue Virus during the Natural Course of Infection Are Predominantly Cross-Reactive and Recognize Epitopes Containing Highly Conserved Residues at the Fusion Loop of Domain II", J. VIROL., vol. 82, no. 13, 2008, pages 6631 - 6643 *
HAMEEDA SULTANA ET AL.: "Fusion Loop Peptide of the West Nile Virus Envelope Protein Is Essential for Pathogenesis and Is Recognized by a Therapeutic Cross-Reactive Human Monoclonal Antibody", J. IMMUNOL., vol. 183, 2009, pages 650 - 660 *
LEON-JUAREZ MOISES ET AL.: "Generation and characterization of a monoclonal antibody that cross-reacts with the envelope protein from the four dengue virus serotypes", APMIS, vol. 121, no. 9, January 2013 (2013-01-01), pages 848 - 858 *
WAYNE D. CRILL ET AL.: "Humoral Immune Responses of Dengue Fever Patients Using Epitope-Specific Serotype-2 Virus-Like Particle Antigens", PLOS ONE, 2009, vol. 4, no. 4, pages E4991 *
YONG-QIANG DENG ET AL.: "Characterization of a novel neutralizing monoclonal antibody that recognizes the fusion loop peptide of flavivirus envelope protein", HUMAN ANTIBODIES, vol. 19, 2010, pages 45 - 47 *
YORGO MODIS ET AL.: "Variable Surface Epitopes in the Crystal Structure of Dengue Virus Type 3 Envelope Glycoprotein", J. VIROL., vol. 79, no. 2, 2005, pages 1223 - 1231 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018071822A3 (fr) * 2016-10-13 2018-05-24 Massachusetts Institute Of Technology Anticorps se liant à la protéine d'enveloppe du virus zika et leurs utilisations
CN109996560A (zh) * 2016-10-13 2019-07-09 麻省理工学院 结合寨卡病毒包膜蛋白的抗体及其用途
US10829545B2 (en) 2016-10-13 2020-11-10 Massachusetts Institute Of Technology Antibodies that bind Zika virus envelope protein and uses thereof
US11267873B2 (en) 2016-10-13 2022-03-08 Massachusetts Institute Of Technology Antibodies that bind zika virus envelope protein and uses thereof
WO2018076001A1 (fr) * 2016-10-21 2018-04-26 National Cheng Kung University Polypeptide synthétique, composition vaccinale le comprenant, et leurs utilisations
CN114790232A (zh) * 2022-02-24 2022-07-26 中国人民解放军陆军军医大学 Cnpy3蛋白作为治疗登革热靶点的用途
CN115804362A (zh) * 2023-02-08 2023-03-17 中国医学科学院医学生物学研究所 一种IFN-α/βR-/-小鼠抗体依赖性增强感染的注射液及其制备方法

Similar Documents

Publication Publication Date Title
JP6830118B2 (ja) ワクチン組成物
Amorim et al. The dengue virus non-structural 1 protein: risks and benefits
Pierson et al. Vaccine development as a means to control dengue virus pathogenesis: do we know enough?
Sánchez et al. Characterization of neutralizing antibodies to West Nile virus
Zhang et al. Modified mRNA-LNP vaccines confer protection against experimental DENV-2 infection in mice
Hermida et al. A recombinant fusion protein containing the domain III of the dengue-2 envelope protein is immunogenic and protective in nonhuman primates
Goncalvez et al. Humanized monoclonal antibodies derived from chimpanzee Fabs protect against Japanese encephalitis virus in vitro and in vivo
Nedjadi et al. Tackling dengue fever: Current status and challenges
Yacoub et al. Recent advances in understanding dengue
Lieberman et al. Preparation and immunogenic properties of a recombinant West Nile subunit vaccine
US20130202634A1 (en) Dengue Virus (DV) Polypeptide Sequences, T Cell Epitopes and Methods and Uses Thereof
US8637035B2 (en) Anti-dengue virus antibodies
KR20130138789A (ko) 재조합 서브유닛 뎅기 바이러스 백신
Acosta et al. Paradoxical role of antibodies in dengue virus infections: considerations for prophylactic vaccine development
Merino-Ramos et al. Protection of a single dose west nile virus recombinant subviral particle vaccine against lineage 1 or 2 strains and analysis of the cross-reactivity with Usutu virus
EP2959915A1 (fr) Polyépitope chimérique du virus de la dengue composé de fragments de protéines non structurelles et son utilisation dans une composition immunogène contre l'infection par le virus de la dengue
WO2014064943A1 (fr) Peptide antigène dérivé du virus de la dengue
Sun et al. Defeat dengue and Zika viruses with a one-two punch of vaccine and vector blockade
JP2016523251A (ja) デングウイルスワクチン組成物およびその使用方法
AU2012305807B2 (en) Dengue-virus serotype neutralizing antibodies
JP2018502080A (ja) デングウイルスワクチン組成物およびその使用方法
Huang et al. A novel chimeric dengue vaccine candidate composed of consensus envelope protein domain III fused to C-terminal-modified NS1 protein
TWI448552B (zh) 抗登革病毒抗體
US10308689B2 (en) Dengue virus (DV) polypeptide sequences, T cell epitopes and methods and uses thereof
Ishikawa et al. Co-immunization with West Nile DNA and inactivated vaccines provides synergistic increases in their immunogenicities in mice

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13849353

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13849353

Country of ref document: EP

Kind code of ref document: A1