Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/64—General methods for preparing the vector, for introducing it into the cell or for selecting the vector-containing host
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/70—Vectors or expression systems specially adapted for E. coli

Definitions

• the present invention provides helper plasmids for efficient broad host range mobilization of plasmids, bacterial strains for efficient broad host range mobilization of plasmids comprising a mobilizing part of a conjugal system integrated into a bacterial chromosome, a system for efficient broad host range mobilization of plasmids comprising this plasmid or the bacterial strain together with a mobilizable plasmid comprising an oriT of a nucleotide sequence compatible with this system and uses thereof.
• the pCTX-M3 plasmid has been isolated from a clinical Citrobacter freundii strain in Poland in 1996 as a vector carrying a blac T x-M-3 gene, encoding newly discovered extended spectrum ⁇ -lactamase of the CTX-M type (Gniadkowski et al., 1998, Antimicrob. Agents Chemother., 42:827-832).
• the nucleotide sequence of the pCTX-M3 plasmid has been determined, annotated and deposited in the GenBank under the accession numer AF550415.
• the plasmid bears a single replicon of the IncL/M type and codes for a conjugal system, whose genes are localized in two regions, tra and trb, whose protein products exhibit 30-60% similarity to proteins encoded in the plasmid ColIb-P9 of the Incll family (poorly characterized conjugal system group T4BSS) of a narrow host range.
• the conjugal transfer is a phenomenon prevalent among bacteria, responsible for their quick variability and also crucial in a horizontal gene transfer in a biosphere.
• proteins of the Dtr (Dna transfer and replication) functions provide DNA preparation for transfer: a relaxase/helicase that cuts a single DNA strand in the oriT (origin of conjugal transfer) region, accessory proteins and a coupling protein constituting a relaxosome complex.
• proteins of the Mpf (Mating pair formation) functions are necessary for establishing a mating pair, and in Gram negative bacteria they are responsible for the formation of a pilus which links donor and recipient cells.
• Genes coding for the conjugal transfer proteins are organized in multigenic operons, frequently with separation of the Dtr and Mpf functions, e.g. in plasmids of the IncP or IncW groups. Proteins of the Dtr functions are plasmid-specific - they cut only the strand of a given plasmid, while the Mpf functions can be used by mobilizable plasmids encoding only the Dtr functions and oriT, which co-exist in the bacterial cell. The presence of an oriT sequence alone is the minimal requirement for a plasmid to be mobilized for transfer and to be moved to a recipient cell, i.e to be a mobilizable plasmid.
• helper plasmid or a mobilizing one have to code for both functions: Mpf and Dtr. Cooperation of these two machineries - Mpf and Dtr, is assured by a coupling protein, an ATPase, also encoded in a helper plasmid.
• genes of the pCTX-M3 plasmid conjugal system are localized in two distant regions (Golebiewski et al., 2007, Antimicrob. Agents Chemother., 51: 3789-3795). Moreover, apart from the mentioned ColIb-P9 and R64 plasmids of the Incll family and the plasmids of the identical plasmid relievebackbone" (pEL60 and pCTX360), these genes do not exhibit substantial sequence homology to sequences with ascribed functions, collected in public databases (I. Kern-Zdanowicz and M. Golebiewski, unpublished).
• the genes encoding the pCTX-M3 and ColIb-P9 (Incll) conjugal systems exhibit a similarity and the majority of genes have for both plasmids the same order within the regions, the whole tra and trb regions have different localizations relative to each other.
• the plasmid pCTX-M3 can mobilize plasmids comprising the heterologous oriTc 0 ii b -P9 and vice versa
• a plasmid with the oriT p c T x-M3 is mobilized by the ColIb-P9-derived plasmid (I. Kern-Zdanowicz and M. Golebiewski, unpublished).
• the genes encoded in the leading region i.e. those which enter into a recipient cell as the first, are different in pCTX- M3 and ColIb-P9 (except for two genes, encoding Ssb - a single stranded DNA binding protein and an antirestriction protein).
• orf35 is the first gene in the pCTX-M3 leading region (Golebiewski et al., 2007, Antimicrob. Agents Chemother., 51: 3789-3795). This gene has a similar length, localization and transcription direction as the genes of several plasmids, especially those of a broad host range.
• a hypothetic product of this gene exhibits low homology to the MobC protein of the IncQ plasmid group and it is a distant homologue of the TraK protein of the RP4 plasmid, encoding a relaxase complex accessory protein (Ziegelin et al., 1992, J. Biol. Chem., 267: 17279-17286).
• plasmids such as R46 of IncN, R388 of IncW, RK2 (RP4) of IncP-1 or NAH7 of IncP-9, a trigenic operon is present in their leading region , the so called leading operon.
• Conjugal transfer systems enable efficient transfer from donor cells to recipient cells of every plasmid bearing an oriT sequence which is specific for this system.
• oriT pCT x-jvo is a 160 bp fragment, that is shown in SEQ. ID. NO: 1.
• the oriT p c T x-M3 sequence covers both a nickase cleavage site i.e. the "nick site", and the nic region, where the proteins of Dtr complex interact.
• Plasmids capable of conjugal transfer to recipient bacteria belonging to different taxonomic groups are an interesting object for biotechnological vehicle construction, serving e.g. to introduce plasmids to gripdifficult" strains of bacteria.
• the plasmid RK2 also called plasmid that serves this purpose.
• the plasmid is 60kb in size and determines resistances to tetracycline, ampicillin and kanamycin. Furthermore, it is capable of replicating in a broad range of bacteria.
• the RK2 plasmid is capable of mobilizing oriT RK 2 bearing plasmids and not only Gram negative bacteria but also Gram positive ones could become recipients in such a conjugal transfer or mobilization (Poyart and Trieu-Cuot, 1997, FEMS Microbiol., 156, 193- 198). Conjugal transfer to yeast Saccharomyces cerevisiae (Bates et al., 1998, J. Bacterid., 180:6538-6543) and mammal cells (Waters, Nature Genet., 2001, 29:375-376) with the use of RK2 also have been described.
• mice with burn injuries infected by Acinetobacter baumanii were cured (Shankar et al., 2007, Journal of Burn Care and Reasearch, 28: 16-12).
• the aim of the invention is to provide new plasmids, bacteria and the broad host range systems for efficient plasmid mobilization devoid of limitations present in existing systems for plasmid mobilization and assuring efficient mobilization to a broad group of bacterial recipients.
• the invention is based on an unexpected finding that an effective engineering of the known plasmid pCTX-M3 and obtainment of new plasmids and bacterial strains and of systems based thereon for efficient plasmid broad host range mobilization is possible.
• Such plasmids derived from the pCTX-M3 are devoid of pathogenic factors and unable to transfer by conjugation.
• the invention is based on an unexpected finding that engineered plasmid derivatives of pCTX-M3 devoid of orf35, whose presence seemed to be indispensable for mobilization due to its localization in the leading region and its possible function in plasmid stabilization in a recipient, have exhibited additional increased ability to mobilize oriT p c T x-M3 bearing plasmids.
• a plasmid, a bacterial strain and a system for efficient plasmid mobilization based thereon according to the invention is devoid of the majority of genes determining antibiotic resistance as well as mobile genetic elements such as IS (insertion sequence) sequences and transposones, thus being structurally stable and not leading to uncontrolled recombination events in a bacterial host.
• an engineered plasmid, a bacterial strain and a system based thereon according to the invention have been prepared in such a way that they comprise the smallest set of genes indispensable for generation of an efficient conjugal system, and its size, smaller in comparison with the whole pCTX-M3 plasmid, facilitates possible manipulations within its sequence and also facilitates its introduction into host cells (large plasmids are difficult to introduce via transformation).
• Such a plasmid, a bacterial strain and a system based thereon bear oriT p c T x-M3-mut> i-e. damaged oriT site, therefore while coding for the conjugal system it cannot be transferred this way itself, thus it cannot spread in an uncontrolled manner but stays exclusively in donor cells.
• the invention thus relates to the helper plasmid for mobilization, comprising the mobilizing part of the conjugal system tra and trb within the nucleotides from 34 to 23136 of SEQ. ID. NO: 2 and from 24740 to 29654 of SEQ. ID. NO: 2, more preferably it comprises nucleotides from 34 to 29654 of SEQ. ID. NO: 2 or a functional equivalent of these nucleotide sequences.
• a plasmid is preferably a pMOBS plasmid, the sequence of which is shown in SEQ. ID. NO: 2.
• the invention also relates to a bacterial strain for efficient plasmid broad host range mobilization comprising the mobilizing part of the tra and trb conjugal system within nucleotides from 34 to 23136 of SEQ. ID. NO: 2 and from 24740 to 29654 of SEQ. ID. NO: 2 integrated into bacterial chromosome, more preferably it comprises integrated nucleotides from 34 to 29654 of SEQ. ID. NO: 2 or a functional equivalent of these nucleotide sequences.
• the bacterial strain preferably is a Gram negative bacterium of ⁇ -, ⁇ -, or ⁇ - Proteobacteria, more preferably it is a bacterium selected from a group consisting of: Escherichia coli, Klebsiella pneumoniae, Klebsiella oxytoca, Enterobacter cloacae, Morganella morganii, Serratia marcescens, Salmonella enterica and Agrobacterium tumefaciens.
• the bacterial strain is preferably an E. coli strain into which the mobilizing part of the conjugal system has been integrated into the attB site of the chromosome, more preferably it is the S 14 E. coli strain.
• the invention relates also to a system for efficient broad host range mobilizaton of plasmids comprising the plasmid according to the invention and/or the bacterial strain according to the invention and the mobilizable plasmid comprising oriT with a sequence compatible with this system.
• oriT with the sequence compatible with this system is oriTpCTx-M3 or oriTc 0 iib-P9, more preferably it is oriT p cTx-M3 shown in SEQ. ID. NO: 1.
• the mobilizable plasmid comprises a replicon enabling replication within a donor, preferably comprises ⁇ ⁇ ⁇ of pUC19, ori RA3 of pRA3, oripis A of pACYC184 or ori pC Tx-M3 of pCTX-M3.
• the invention also relates to use of the helper plasmid according to the invention and the system comprising the mobilizable plasmid according to the invention for efficient plasmid mobilization to recipient cells, wherein said recipient cells are Gram negative bacteria: a-Proteobacteria, ?-Proteobacteria, y-Proteobacteria and Gram positive bacteria, particularly of the Bacilli class.
• the helper plasmid comprises oriT p c T x-M3 or oriTc 0 ii b -P9, more preferably oriT shown in SEQ ID NO: l.
• the mobilizable plasmid comprises a replicon enabling replication within a donor, preferably comprises ⁇ ⁇ ⁇ of pUC19, ori RA3 of pRA3, oripis A of pACYC184 or ori pCT x- M 3 of pCTX-M3.
• the invention further relates to use of the system according to the invention as a medicament in the Bacterial Conjugation Based Therapy BCBT, wherein plasmids comprising oriT p cTx-M3 or oriTc 0 iib-P9 more preferably comprising oriT shown in SEQ. ID. NO: 1, are mobilized in conjugation, wherein a factor leading to growth inhibition, more preferably to death of the recipient cell is introduced into the donor cell on the mobilizable plasmid, and wherein said factor is safe for the donor strain.
• the bacterial strain for effective plasmid mobilization is the strain according to the invention.
• the invention further relates to use of the system according to the invention for the introduction of genes encoding a factor beneficial for the recipient bacterium in a specific environment or in specific conditions, wherein the plasmids mobilized in conjugation comprise either oriT p c T x-M3 or oriTc 0 iib-P9, more preferably comprise oriT shown in SEQ. ID. NO: 1, and wherein said factor which enables its growth in a specific environment or in specific conditions, is introduced into the recipient cell on the mobilizable plasmid, wherein said factor is safe for the donor strain.
• the invention further relates to use of the system according to the invention for the introduction of nucleotide sequences on the mobilizable plasmid into a recipient strain in order to integrate said sequence into the chromosome of a recipient, wherein the mobilizable plasmid does not replicate, and wherein plasmid mobilized in conjugation comprises oriT p c T x_ M3 or oriTcoiib-P9, more preferably comprise oriT shown in SEQ. ID. NO: 1, and said mobilizable plasmid comprises a sequence integrating into a recipient's chromosome.
• the nucleotide sequence integration into a recipient's chromosome is performed for transposon mutagenesis purpose, wherein said mobilizable plasmid comprises a sequence, integrating into a recipient's chromosome which is a transposon sequence.
• the molecular kit comprising the plasmid according to the invention and/or the bacterial strain according to the invention and/or the broad host range system for efficient plasmid mobilization according to the invention is also within the scope of the present invention.
• nucleotide sequence means a nucleotide sequence encoding products comprising a nucleotide or amino acid sequence identical or highly similar to sequences encoded by the original nucleotide sequence, whose nucleotide sequence has been changed e.g. by substitution, replacement, deletion or insertion in such a way that it does not generally change the activity of products encoded by these sequences.
• the functional equivalent of a nucleotide sequence concerns the nucleotide sequence identical in at least in 60%, preferably in 70%, more preferably in 80%, even more preferably in 90%, the most preferably in 95%.
• the efficient system for mobilization according to the invention was generated, to introduce from Gram negative bacteria cells of a group ⁇ -, ⁇ -, or y-Proteobacteria e.g.
• Escherichia coli a plasmid capable of replication in cells of a donor and/or a recipient and comprising oriT p c T x_M3 to recipient cells which can be Gram negative bacteria: a- Proteobacteria such as Agrobacterium tumefaciens, ?-Proteobacteria e.g. Ralstonia eutropha, y-Proteobacteria such as Pseudomonas putida or enterobacteria such as E. coli and Gram positive bacteria of the Bacilii class such as Lactococcus lactis.
• a- Proteobacteria such as Agrobacterium tumefaciens
• ?-Proteobacteria e.g. Ralstonia eutropha
• y-Proteobacteria such as Pseudomonas putida or enterobacteria such as E. coli
• the conjugal system encoding genes are localized on the pMOBS plasmid. It is a pCTX-M3 derivative, devoid of genes determining antibiotic resistances, mobile genetic elements such as ISs and transposones carried by this plasmid, but comprising tra and trb genes and devoid of orf35 and orf46 genes (Example 3).
• the pMOBS plasmid comprises a set of genes indispensable for the constitution of an efficient conjugal system that comprises nucleotides from 34 to 23136 of SEQ. ID. NO: 2 and from 24740 to 29654 of SEQ. ID. NO: 2 constituting tra and trb modules (Fig. 1).
• the mobilization frequency of the plasmid bearing oriT pCT x-M3 is 1000-times higher in the presence of the plasmid pMOBS as a helper plasmid compared to when in the presence of pCTX-M3.
• the genes encoding the conjugal system are localized on a chromosome of a bacterium.
• Example 4 shows the mobilization frequency of the plasmid bearing oriT p c T x-M3 in the strain E. coli S 14, in which the tra and trb modules are located in the phage ⁇ integration site.
• the mobilization frequency is ca. 10-times higher than in the presence of plasmid pCTX-M3.
• oriT p c T x-M3 is located in the plasmid to be transferred to recipient cells. Furthermore, genes indispensable for the mobilization of this plasmid remain in the donor cell and are not transferred to the recipient cell in the process of conjugation / mobilization.
• Another advantage of one version of the system according to the invention, wherein the genetic information enabling conjugation is localized on the chromosome of the bacterium (chromosomal localization of the conjugal transfer genes), is the inability of the plasmid to cut itself out in the donor cells, as is possible, for example, in systems based on the integrated plasmid RK2.
• the introduction into the bacterial chromosome of the genetic information enabling conjugation also does not narrow the choice of a mobilizable plasmid due to its replicon (plasmid incompatibility is avoided).
• the bacterial strain obtained in this way can be subject of further modification involving cat gene deletion from the chromosome. Therefore, the generated strain can be entirely devoid of the gene determining chloramphenicol resistance.
• the prepared system for conjugation and the biotechnological vehicles generated on their base can be used in many ways, for example: a/ for introduction of plasmids bearing apropriate oriT into diverse recipients, whose transformation is impossible for various reasons (e.g. clinical or environmental strains); b/ for the preparation and conduct of therapy of a BCBT type, based on a bacterial conjugation phenomenon and relying on the introduction on a mobilizable plasmid of a factor, which while being safe for the donor leads to death of the recipient cell (Filutowicz et al., 2008, Plasmid 60:38-44); said factor could be a gene encoding a toxin (e.g of the pSM19035 plasmid) from a toxin- antidote system, which in the absence of an antidote in a recipient would lead to death, whereas the donor would be protected against the action of the toxin by an introduced antidote gene; cl for the introduction in an
• strains employed in utilization e.g sewage treatment, introduction of heavy metals resistance genes, genes determining decomposition of toxic compounds such as phenol, toluene, dimethyformamide); d/ for the introduction into a recipient, in which a mobilizable plasmid does not replicate, genes which would be integrated into its chromosome, including transposon mutagenesis (Simon et al., 1983, Nature Biotechnology,l:784-791), using various transposons such as Mu or derivatives of Tn3, Tn5 or Tn7 (Choi and Kim, 2009. J Microbiol Biotechnol., 19:217-28).
• Fig. 1 shows a graphical representation of the tra and trb modules, used in described embodiments. Coordinates next to the blocks illustrating the tra and trb regions correspond to those of SEQ. ID. NO: 2.
• Fig. 2 shows a diagram of cloning of the terminal fragments of the tra and trb modules of the plasmid pCTX-M3 in the vector pLDRlO derivative containing attP region (indispensable for integration into a chromosome) and generating the pLDAB plasmid, precursor of pLMAB212 (shown in Fig. 3).
• Fig. 3 shows a diagram of the sequence blocks, which construct the plasmid pLMAB212 (comprises oriT p c T x-M3X from which the plasmid pMOBS (comprises oriT p c T x- M3-mut) was prepared.
• the strains Escherichia coli DH5a [F " ( ⁇ £>80dlacZ iM15) recAl endAl gyrA96 thi-1 hsdR17(r k m k + ) supE44 relAl deoR zi(lacZYA-argF)U196] (Hanahan, 1983), Escherichia coli JE2571 Rif (leu thr thi lacY thy pil fla) (Bradley 1980), Pseudomonas putida KT2442 (Rif ) (obtained from CM.
• Agrobacterium tumefaciens LBAIOIO Rif obtained from D. Bartosik, Institute of Microbiology, University of Warsaw
• Ralstonia eutropha 7MP228r obtained from K. Smalla, Braunschweig, Germany
• Bacterial cultures were carried out in LB medium (Kahn et al. 1979) or on LB medium solidified with 1,5% agar, in 30°C, 37°C or 42°C (Diederich et al. 1992, Sambrook et al. 1989).
• Table 1 Shows a list of initial plasmids used in the examples and derivative plasmids obtained therefrom.
• pCTX-M3 orf 35 pCTX-M3 derivative contains the cat gene instead of orf35 M.
• Plasmid 28 14-24 pLDR8 helper plasmid for integration, integrase gene Diederich et al., 1992,
• Plasmid 28 14-24 pACYC184 cloning vector ori P i 5A , Tc r , Cm 1 Chang & Cohen, 1978,
• pUCB0318 pCTX-M3 orf46 :cat fragment (83021-85053) amplified with primers FtrbXba and
• pLMAB2 pBS3-l (3624-2152) fragment contains pCTX-M3 replicon, amplified with primers
• pSN17 pCTX-M3 orf46 cat derivative, Ndel-Sphl (53187-59797) and Sphl -Ndel (80753-626) fragments
• pSS29 pCTX-M3 derivative Swal-Sall (30630-59552) and Sall-Swal (64145-64426)
• pLMAB212 Aatll-Nhel pSS29 fragment (729-21542; 31362-52175 in pCTX-M3) cloned into Aatll- Nhel pLMAB202
• pALAPKl pET28a+ fragment (3943-4832), contains a kanamycin resistance gene, amplified with primers FKanSpe2 and RKanSpe (Spel), cloned into Spel pALAP pMOBSK pALAPKl Aatll-PshAI fragment cloned into pLMAB212 Aatll-PshAI
• pBBToriT pALoriT Xbal-Pvul fragment contains tetracycline resistance gene and oriT pC Tx-M3 cloned into Pvul-Xbal pBBRlMCS-2 (pBBRl replicon)
• pToriT pBBToriT derivative fragment Bsal-Bstl 1071 containing MOB RK2 removed pToriTB pToriT derivative, fragment BamHI-BamHI with kanamycin resistance gene removed pLMKoriT2 pToriTB fragment (2310-4127) amplified with primers FKanAatll and oriTminDAatll contains kanamycin resistance gene and oriT pCT x-M3 (Aatll) cloned into Aatll pBS3-l (pCTX-M3 replicon)
• oriTminDAatll TTGGACGTCTGCAGAGATAGCTAACCTCGTTAGG pToriTB
• a series of mobilizing plasmids bearing oriT p c T x-M3 was prepared. These plasmids differ mainly in replicons and in consequence in the range of hosts these plasmids can replicate in.
• the EcoRI-PstI fragment of plasmid pOriT was cloned into pAL3 vector to obtain plasmid pALoriT (pl5A replicon).
• the Xbal-Pvul fragment from this plasmid was also moved to the broad host range plasmid pBBRlMCS-2 to obtain plasmid pBBToriT from which the RK2 mobilizing region (BsaI-Bstl l07I) was subsequently removed to obtain plasmid pToriT (pBBRl replicon).
• Plasmid pOriT was also used as the source of oriT p c T x_M3 for cloning into pABB 19 vector and obtaining plasmid pABB19oriT (pMB l replicon).
• the Hindlll (sticky ends filled-in) -BamHI fragment was also moved from this plasmid to the pABB20 broad host range vector (into PvuII-BamHI site) to obtain plasmid pABB20oriT (RA3 replicon).
• E. coli cells carrying plasmids pCTX-M3 or pCTX-M3orf35: :cat or pCTX- M3orf46: :cat to mobilize plasmid pToriT (pBBRl replicon, oriT p crx-M3, Tc ) into recipient E. coli JE2571 RiP cells was compared. It turned out that in the presence of the helper plasmid pCTX-M3orf35: :cat, plasmid pToriT is mobilized with almost 1000 fold higher frequency than in the presence of either of remaining plasmids (over 10 - " 1 vs below 10 - " 3 respectively).
• the final plasmid pMOBS (SEQ. ID. NO: 2), which was employed for the integration of tra and trb gene regions into a bacterial chromosome was generated by cloning of its individual fragments obtained with PCR amplification or by cutting out from pCTX-M3 (Fig. 2). Individual steps leading to the construction of the final pMOBS plasmid are described below.
• the terminal fragments of the tra region were amplified using primer pairs FtraHind-RtraPst, FtraSal-RtraXba and pCTX-M3 as template and cloned separately into pUC18 vector into Hindlll-Pstl and Sall-Xbal sites respectively to generate plasmids pUCA0118 and pUCA0218.
• primer pairs FtraHind-RtraPst, FtraSal-RtraXba and pCTX-M3 as template and cloned separately into pUC18 vector into Hindlll-Pstl and Sall-Xbal sites respectively to generate plasmids pUCA0118 and pUCA0218.
• FnicM and RnicM nucleotide substitutions were introduced in the nic sequence of plasmid pUCA0118 which made this sequence nonfunctional and generated plasmid pUCA0318.
• the pUCA0218 Kpnl-Sall fragment containing a part of the tra region was introduced into Kpnl- Sail site of plasmid pUCA0318 to obtain plasmid pUCA3218 containing two terminal parts of the tra region.
• one of the trb terminal fragments was amplified using primers FtrbNco- RtrbEco and pCTX-M3 template, and cloned into SacI-EcoRI site of pUC19 vector.
• the second terminal trb fragment was amplified from pCTX-M3orf46: :cat template, using primers FtrbXba-RtrbBam, and cloned into Smal site of the pUC18 plasmid.
• Sall- Kpnl fragment from plasmid pUCB0318 was transferred into Sall-Kpnl pUCB0219 site obtaining plasmid pUCB3219 containing two terminal parts of the trb region.
• the 186bp fragment between Bspl407I sites was removed from pUCB3219 to allow subsequent cloning.
• the Notl-Notl fragment containing high copy-number replicon pMB 1 was removed from this plasmid and replaced by the low copy-number replicon pCTX-M3 (ori p c T x-M3) obtained by amplification from the pCTX-M3 minireplicon namely plasmid pBS3-l with the use of FrepCNI i RrepANB2 primers.
• the pLMAB2 plasmid was obtained into which the central Bsp 14071- Bspl407I fragment of the trb region was introduced from plasmid pSN17 to obtain plasmid pLMAB202.
• the central Aatll-Nhel fragment of the tra region was introduced into this plasmid from plasmid pSS29 to obtain the 33614bp plasmid pLMAB212 (Fig. 3).
• plasmid pLMAB212 contained a functional nic sequence
• its mutagenesis was performed.
• the regions adjacent to the nic sequences were amplified from pLMAB212 using FAatll-RnicSpe and FnicSpe-RPshAI primer pairs.
• the primers were designed in such a way as to introduce substitutions generating a site recognized by the Spel restrictase in the nic sequence.
• the amplified fragments were cloned separately in the pAL3 plasmid to generate plasmids pAL-AS 14 and pAL-SP3, respectively.
• the Spel-Pstl fragment from plasmid pAL-SP3 was transferred to pAL-AS14 to obtain plasmid pALAP.
• the kanamycin resistance gene obtained by amplification from plasmid pET28a+ using primers FKanSpe2 and RKanSpe was introduced into the Spel site (i.e. the modified nic sequence) of this plasmid.
• plasmid pALAPKl was obtained, whose Aatll- PshAI fragment was used for the exchange of an appropriate fragment in pLMAB212.
• Introduction of the kanamycin resistance gene into the mutated nic sequence enabled selection of appropriate transformants and the isolation of plasmid pMOBSK.
• the Spel-Spel fragment (containing the kanamycin resistance gene) was removed from plasmid pMOBSK to give plasmid pMOBS (its sequence is shown in SEQ. ID. NO: 2).
• Plasmid pLMKoriT2 bears the pCTX-M3 plasmid replicon - ori p c T x_M3
• plasmid pABB 19oriT bears the high copy-number narrow host-range replicon - ori pM Bi, of the cloning vector pUC19
• plasmid pToriT bears the pBBRl broad host-range replicon - ori P BBRi
• plasmid pABB20oriT bears the low copy-number replicon of the broad host-range plasmid RA3- ori R A3
• plasmid pALoriT bears the moderate copy-number and narrow host-range ori pl5A replicon.
• All these plasmids contained oriT p c T x-M3 conditioning the mobilization ability.
• the ability of E. coli strain S 14 to mobilize these plasmids to recipient cells E. coli ⁇ 2571 ⁇ was analysed.
• the high copy-number plasmid pABB 19oriT was mobilized at 10 frequency. This means that each S 14 P ABBi9oriT cell was a donor of the plasmid.
• Plasmid pLMKoriT2 was mobilized at a frequency of about 5x1 ⁇ -4 , plasmid pToriT was mobilized at 10 " -10 " , frequency whereas plasmid pABB20oriT was mobilized at frequencies differing in subsequent experiments from 5x10 - " 3 up to 100.
• plasmid pMOBS plasmid pALoriT was mobilized at 10°- 10 "1 frequency. At the same time, when these plasmid did not contain oriT p c T x-M3 they were not mobilized.
• Plasmids with the oriT p c T x_M3 sequence inserted are mobilized by the E. coli S 14 strain at different frequencies depending on the carried replicon, reaching 10° frequency for the high copy-number plasmid pABB 19oriT.
• the E. coli S 14 strain generated in the Example 3 was used to mobilize plasmids carrying oriTpC T x-M3 to representatives of ⁇ -, ⁇ - and y-Proteobacteria, Agrobacterium tumefaciens, Pseudomonas putida and Ralstonia eutropha, respectively.
• Plasmid pToriT (pBBRl replicon) was mobilized to tumefaciens at 10 "3 -10 "4 frequency, R. eutropha 10 "3 -10 "4 , P. putida 10 4.
• Plasmid pABB20oriT (RA3 replicon) was mobilized to A tumefaciens at 10 " 2 frequency, and to P. putida even at 10 "1 frequency.
• the E. coli strains S14 and DH5a with plasmid pMOBS were used for pBSUoriT plasmid (pMB l replicon in E. coli and ⁇ in L. lactis) mobilization to L. lactis.
• plasmid pBSUoriT was mobilized at 10 "4 - 10 "5 frequency per donor cell.
• the conjugation system of plasmid pCTX-M3 is capable of mobilizing plasmids to various Gram negative bacteria belonging to ⁇ -, ⁇ - and y-Proteobacteria groups as well as to Gram positive bacteria such as L. lactis.
• SEQ. ID. NO: 1 shows the oriTpcrx-jvo nucleotide sequence
• SEQ. ID. NO: 2 shows the nucleotide sequence of the generated plasmid pMOBS

Landscapes

• Health & Medical Sciences (AREA)
• Genetics & Genomics (AREA)
• Life Sciences & Earth Sciences (AREA)
• Engineering & Computer Science (AREA)
• Zoology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Biomedical Technology (AREA)
• Organic Chemistry (AREA)
• Biotechnology (AREA)
• General Engineering & Computer Science (AREA)
• Chemical & Material Sciences (AREA)
• Wood Science & Technology (AREA)
• Microbiology (AREA)
• Physics & Mathematics (AREA)
• Plant Pathology (AREA)
• Molecular Biology (AREA)
• Biochemistry (AREA)
• General Health & Medical Sciences (AREA)
• Biophysics (AREA)
• Cell Biology (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Saccharide Compounds (AREA)

Applications Claiming Priority (2)

Publications (1)

Family

ID=49724617

Family Applications (1)

Country Status (2)

Cited By (3)

Citations (1)

• 2012
  • 2012-09-10 PL PL400718A patent/PL230884B1/pl unknown
• 2013
  • 2013-09-07 WO PCT/IB2013/058368 patent/WO2014037917A1/en active Application Filing

Patent Citations (1)

Non-Patent Citations (26)

Also Published As

Similar Documents

Legal Events