WO2014022357A1 - Polythérapie pour le traitement du cancer - Google Patents

Polythérapie pour le traitement du cancer Download PDF

Info

Publication number
WO2014022357A1
WO2014022357A1 PCT/US2013/052670 US2013052670W WO2014022357A1 WO 2014022357 A1 WO2014022357 A1 WO 2014022357A1 US 2013052670 W US2013052670 W US 2013052670W WO 2014022357 A1 WO2014022357 A1 WO 2014022357A1
Authority
WO
WIPO (PCT)
Prior art keywords
days
camptothecin analog
antisense oligonucleotide
eif
cancer
Prior art date
Application number
PCT/US2013/052670
Other languages
English (en)
Inventor
Robert A. Macleod
Alexey REVENKO
Tim F. GRETEN
Austin G. DUFFY
Original Assignee
Isis Pharmaceuticals, Inc.
The United States Of America, As Represented By The Secretary, Department Of Health & Human Services
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Isis Pharmaceuticals, Inc., The United States Of America, As Represented By The Secretary, Department Of Health & Human Services filed Critical Isis Pharmaceuticals, Inc.
Publication of WO2014022357A1 publication Critical patent/WO2014022357A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47—Quinolines; Isoquinolines
    • A61K31/4738—Quinolines; Isoquinolines ortho- or peri-condensed with heterocyclic ring systems
    • A61K31/4745—Quinolines; Isoquinolines ortho- or peri-condensed with heterocyclic ring systems condensed with ring systems having nitrogen as a ring hetero atom, e.g. phenantrolines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7125—Nucleic acids or oligonucleotides having modified internucleoside linkage, i.e. other than 3'-5' phosphodiesters
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/33—Chemical structure of the base
    • C12N2310/334—Modified C
    • C12N2310/3341—5-Methylcytosine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/341—Gapmers, i.e. of the type ===---===
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/346—Spatial arrangement of the modifications having a combination of backbone and sugar modifications
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/31—Combination therapy

Definitions

  • the present embodiments relate to combinations of an antisense oligonucleotide (ASO) targeted to eukaryotic translation initiation factor 4E (eIF-4E) and a camptothecin analog, such as irinotecan or topotecan. Methods of using such combinations to inhibit growth or proliferation of cancer cells and to treat cancer are also provided.
  • ASO antisense oligonucleotide
  • eIF-4E eukaryotic translation initiation factor 4E
  • camptothecin analog such as irinotecan or topotecan.
  • eIF-4E is elevated in multiple human cancers and is directly related to disease progression. Elevated eIF-4E function triggers enhanced assembly of the eIF-4F translation initiation complex, which includes elF- 4E as a component, driving the expression of a pool of mRNAs that are dependent on elevated eIF-4E activity for translation and which promotes tumor cell growth, proliferation, development, survival, and angiogenesis.
  • PCT International Publication WO 2005/028628 incorporated herein by reference, discloses antisense oligonucleotides targeted to eIF-4E, including ASOs disclosed herein, and methods of using these ASOs for modulating the expression or overexpression of eIF-4E in vitro and in vivo.
  • Graff et al. (2007) J. Clin. Invest. 117:2638-48 discloses studies on a number of ASOs targeted to eIF-4E. Detailed Description
  • Methods are provided herein for the combined use of a chemically modified eIF-4E ASO disclosed herein with a camptothecin analog, such as irinotecan or topotecan to inhibit cancer cell proliferation.
  • the combined use is provided to achieve an additive, or greater-than-additive, effect in inhibiting cancer cell proliferation compared to that achieved with ASO alone or the camptothecin analog alone.
  • Methods are provided herein for the combined use of a chemically modified eIF-4E ASO disclosed herein with a camptothecin analog, such as irinotecan or topotecan, to reduce tumor volume.
  • the combined use is provided to achieve an additive, or greater-than-additive, effect in reducing tumor volume compared to the reduction in tumor volume achieved with ASO alone or the camptothecin analog alone.
  • Methods are provided herein for the combined use of a chemically modified eIF-4E ASO disclosed herein with a camptothecin analog, such as irmotecan or topotecan, to increase survival.
  • the combined use is provided to achieve an additive, or greater-than-additive, effect in increasing survival compared to the increase in survival achieved with ASO alone or the camptothecin analog alone.
  • the additive, or greater-than-additive, effect is achieved with toxicity that is no greater than the additive effect of the toxicities of each drug.
  • a method of treating cancer comprises administering to a patient in need thereof a therapeutically effective combination of a modified eIF-4E antisense oligonucleotide and a camptothecin analog, such as irinotecan or topotecan.
  • the cancer is colorectal cancer. In some aspects, the colorectal cancer is refractory to the camptothecin analog.
  • the cancer is lung cancer, such as small cell lung cancer, or ovarian cancer.
  • the antisense oligonucleotide is in the form of a pharmaceutically acceptable salt.
  • the pharmaceutically acceptable salt can be a sodium salt.
  • the camptothecin analog such as irinotecan or topotecan
  • the therapeutically effective interval is in the range of about 1 day to about 4 days, about 1 day to about 7 days, about 1 day to about 14 days, about 1 day to about 21 days, about 1 day to about 28 days, about 4 days to about 7 days, about 4 days to about 14 days, about 4 days to about 21 days, about 4 days to about 28 days, about 7 days to about 14 days, about 7 days to about 21 days, about 7 days to about 28 days, about 14 days to about 21 days, about 14 days to about 28 days, or about 21 days to about 28 days.
  • a method of treating cancer comprises administering to a patient in need thereof a modified eIF-4E antisense oligonucleotide and a camptothecin analog, such as irinotecan or topotecan, in amounts that in combination are effective in treating said cancer.
  • the cancer is colorectal cancer. In some aspects, the colorectal cancer is refractory to the camptothecin analog.
  • the cancer is lung cancer, such as small cell lung cancer, or ovarian cancer.
  • the antisense oligonucleotide is in the form of a pharmaceutically acceptable salt.
  • the pharmaceutically acceptable salt can be a sodium salt.
  • the camptothecin analog such as irinotecan or topotecan
  • the therapeutically effective interval is in the range of about 1 day to about 4 days, about 1 day to about 7 days, about 1 day to about 14 days, about 1 day to about 21 days, about 1 day to about 28 days, about 4 days to about 7 days, about 4 days to about 14 days, about 4 days to about 21 days, about 4 days to about 28 days, about 7 days to about 14 days, about 7 days to about 21 days, about 7 days to about 28 days, about 14 days to about 21 days, about 14 days to about 28 days, or about 21 days to about 28 days.
  • a method of treating cancer comprises sequentially administering to a patient in need thereof an amount of a modified eIF-4E antisense oligonucleotide, followed by an amount of a camptothecin analog, such as irinotecan or topotecan, wherein said amounts of said modified eIF-4E antisense oligonucleotide and said camptothecin analog in combination are effective in treating said cancer in said patient, and wherein said camptothecin analog is administered within a therapeutically effective interval after administration of said modified eIF-4E antisense oligonucleotide.
  • the cancer is colorectal cancer.
  • the colorectal cancer is refractory to the camptothecin analog.
  • the cancer is lung cancer, such as small cell lung cancer, or ovarian cancer.
  • the antisense oligonucleotide is in the form of a pharmaceutically acceptable salt.
  • the pharmaceutically acceptable salt can be a sodium salt.
  • the therapeutically effective interval is in the range of about 1 day to about 4 days, about 1 day to about 7 days, about 1 day to about 14 days, about 1 day to about 21 days, about 1 day to about 28 days, about 4 days to about 7 days, about 4 days to about 14 days, about 4 days to about 21 days, about 4 days to about 28 days, about 7 days to about 14 days, about 7 days to about 21 days, about 7 days to about 28 days, about 14 days to about 21 days, about 14 days to about 28 days, or about 21 days to about 28 days.
  • a method of treating cancer comprises administering to a patient in need thereof a camptothecin analog-sensitizing amount of a modified eIF-4E antisense oligonucleotide, followed by administering to said patient an effective amount of a camptothecin analog, such as irinotecan or topotecan, within a therapeutically effective interval.
  • a camptothecin analog such as irinotecan or topotecan
  • the cancer is colorectal cancer. In some aspects, the colorectal cancer is refractory to the camptothecin analog. In certain embodiments, the cancer is lung cancer, such as small cell lung cancer, or ovarian cancer.
  • the antisense oligonucleotide is in the form of a pharmaceutically acceptable salt.
  • the pharmaceutically acceptable salt can be a sodium salt.
  • the therapeutically effective interval is in the range of about 1 day to about 4 days, about 1 day to about 7 days, about 1 day to about 14 days, about 1 day to about 21 days, about 1 day to about 28 days, about 4 days to about 7 days, about 4 days to about 14 days, about 4 days to about 21 days, about 4 days to about 28 days, about 7 days to about 14 days, about 7 days to about 21 days, about 7 days to about 28 days, about 14 days to about 21 days, about 14 days to about 28 days, or about 21 days to about 28 days.
  • a method of sensitizing a cancer cell to a camptothecin analog comprises contacting said cancer cell with a camptothecin analog-sensitizing amount of a modified eIF-4E antisense oligonucleotide and subsequently contacting said cancer cell with an effective amount of a camptothecin analog, such as irinotecan or topotecan, within an effective interval.
  • the cancer is colorectal cancer. In some aspects, the colorectal cancer is refractory to the camptothecin analog.
  • the cancer is lung cancer, such as small cell lung cancer, or ovarian cancer.
  • the antisense oligonucleotide is in the form of a pharmaceutically acceptable salt.
  • the pharmaceutically acceptable salt can be a sodium salt.
  • the therapeutically effective interval is in the range of about 1 day to about 4 days, about 1 day to about 7 days, about 1 day to about 14 days, about 1 day to about 21 days, about 1 day to about 28 days, about 4 days to about 7 days, about 4 days to about 14 days, about 4 days to about 21 days, about 4 days to about 28 days, about 7 days to about 14 days, about 7 days to about 21 days, about 7 days to about 28 days, about 14 days to about 21 days, about 14 days to about 28 days, or about 21 days to about 28 days.
  • a method of inhibiting the growth or proliferation of a cancer cell comprises contacting said cancer cell with an amount of a modified eIF-4E antisense oligonucleotide and an amount of a camptothecin analog, such as irinotecan or topotecan, wherein said amounts of said modified eIF-4E antisense oligonucleotide and said camptothecin analog are effective in combination in inhibiting the growth or proliferation of said cancer cell.
  • the cancer cell is colorectal cancer. In some aspects, the colorectal cancer cell is refractory to the camptothecin analog.
  • the cancer is lung cancer, such as small cell lung cancer, or ovarian cancer.
  • the antisense oligonucleotide is in the form of a pharmaceutically acceptable salt.
  • the pharmaceutically acceptable salt can be a sodium salt.
  • the cancer cell is first contacted with the modified eIF-4E antisense oligonucleotide, and subsequently with the camptothecin analog, such as irinotecan or topotecan, within an effective interval.
  • the therapeutically effective interval is in the range of about 1 day to about 4 days, about 1 day to about 7 days, about 1 day to about 14 days, about 1 day to about 21 days, about 1 day to about 28 days, about 4 days to about 7 days, about 4 days to about 14 days, about 4 days to about 21 days, about 4 days to about 28 days, about 7 days to about 14 days, about 7 days to about 21 days, about 7 days to about 28 days, about 14 days to about 21 days, about 14 days to about 28 days, or about 21 days to about 28 days.
  • a method of inhibiting the growth or proliferation of a cancer cell comprises contacting said cancer cell with a camptothecin analog-sensitizing amount of a modified eIF-4E antisense oligonucleotide, followed by contacting said cancer cell with an effective amount of camptothecin analog, such as irinotecan or topotecan, within an effective interval.
  • camptothecin analog such as irinotecan or topotecan
  • together said amounts produce an additive or greater-than-additive-effect in inhibiting the growth or proliferation of said cancer cell compared to the sum of the effect achieved with said modified eIF-4E antisense oligonucleotide alone or said camptothecin analog alone.
  • the cancer is colorectal cancer.
  • the colorectal cancer is refractory to the camptothecin analog.
  • the cancer is lung cancer, such as small cell lung cancer, or ovarian cancer.
  • the antisense oligonucleotide is in the form of a pharmaceutically acceptable salt.
  • the pharmaceutically acceptable salt can be a sodium salt.
  • the therapeutically effective interval is in the range of about 1 day to about 4 days, about 1 day to about 7 days, about 1 day to about 14 days, about 1 day to about 21 days, about 1 day to about 28 days, about 4 days to about 7 days, about 4 days to about 14 days, about 4 days to about 21 days, about 4 days to about 28 days, about 7 days to about 14 days, about 7 days to about 21 days, about 7 days to about 28 days, about 14 days to about 21 days, about 14 days to about 28 days, or about 21 days to about 28 days.
  • a method of inhibiting tumor growth comprising administering to a patient in need thereof a modified eIF-4E antisense oligonucleotide and a camptothecin analog, such as irinotecan or topotecan, in amounts that in combination are effective in inhibiting growth of said tumor.
  • the amounts produce an additive or greater-than-additive effect in inhibiting the growth.
  • the antisense oligonucleotide is in the form of a pharmaceutically acceptable salt.
  • the pharmaceutically acceptable salt can be a sodium salt.
  • the camptothecin analog is administered after administration of the modified eIF-4E antisense oligonculetoide, within a therapeutically effective interval.
  • the therapeutically effective interval is in the range of about 1 day to about 4 days, about 1 day to about 7 days, about 1 day to about 14 days, about 1 day to about 21 days, about 1 day to about 28 days, about 4 days to about 7 days, about 4 days to about 14 days, about 4 days to about 21 days, about 4 days to about 28 days, about 7 days to about 14 days, about 7 days to about 21 days, about 7 days to about 28 days, about 14 days to about 21 days, about 14 days to about 28 days, or about 21 days to about 28 days.
  • a method of inhibiting increase in tumor volume of a cancer tumor comprises administering to a patient in need thereof a camptothecin analog-sensitizing amount of a modified eIF-4E antisense oligonucleotide, followed by administering an effective amount of a camptothecin analog, such as irinotecan or topotecan, within a therapeutically effective interval.
  • a camptothecin analog such as irinotecan or topotecan
  • together said amounts produce an additive or greater-than-additive reduction in tumor volume increase of said cancer tumor compared to the sum of the reductions in tumor volume increase achieved by administering said modified eIF-4E antisense oligonucleotide alone or said camptothecin analog alone.
  • the antisense oligonucleotide is in the form of a pharmaceutically acceptable salt.
  • the pharmaceutically acceptable salt can be a sodium salt.
  • the therapeutically effective interval is in the range of about 1 day to about 4 days, about 1 day to about 7 days, about 1 day to about 14 days, about 1 day to about 21 days, about 1 day to about 28 days, about 4 days to about 7 days, about 4 days to about 14 days, about 4 days to about 21 days, about 4 days to about 28 days, about 7 days to about 14 days, about 7 days to about 21 days, about 7 days to about 28 days, about 14 days to about 21 days, about 14 days to about 28 days, or about 21 days to about 28 days.
  • a method of enhancing the therapeutic effectiveness of a camptothecin analog, such as irinotecan or topotecan, in treating cancer comprises administering to a patient in need thereof a therapeutically effective combination of a modified eIF-4E antisense oligonucleotide and a camptothecin analog.
  • the cancer is colorectal cancer. In some aspects, the colorectal cancer is refractory to the camptothecin analog.
  • the cancer is lung cancer, such as small cell lung cancer, or ovarian cancer.
  • the antisense oligonucleotide is in the form of a pharmaceutically acceptable salt.
  • the pharmaceutically acceptable salt can be a sodium salt.
  • the camptothecin analog is administered after administration of the modified eIF-4E antisense oligonucleotide, within a therapeutically effective interval.
  • the therapeutically effective interval is in the range of about 1 day to about 4 days, about 1 day to about 7 days, about 1 day to about 14 days, about 1 day to about 21 days, about 1 day to about 28 days, about 4 days to about 7 days, about 4 days to about 14 days, about 4 days to about 21 days, about 4 days to about 28 days, about 7 days to about 14 days, about 7 days to about 21 days, about 7 days to about 28 days, about 14 days to about 21 days, about 14 days to about 28 days, or about 21 days to about 28 days.
  • the cancer is colorectal cancer.
  • the colorectal cancer is refractory to the camptothecin analog.
  • the cancer is lung cancer, such as small cell lung cancer, or ovarian cancer.
  • the compound of formula I, or other pharmaceutically acceptable salt thereof, and the camptothecin analog, such as irinotecan or topotecan are administered separately, within a therapeutically effective interval.
  • the camptothecin analog such as irinotecan or topotecan
  • the therapeutically effective interval is in the range of about 1 day to about 4 days, about 1 day to about 7 days, about 1 day to about 14 days, about 1 day to about 21 days, about 1 day to about 28 days, about 4 days to about 7 days, about 4 days to about 14 days, about 4 days to about 21 days, about 4 days to about 28 days, about 7 days to about 14 days, about 7 days to about 21 days, about 7 days to about 28 days, about 14 days to about 21 days, about 14 days to about 28 days, or about 21 days to about 28 days.
  • the combination therapy is via the parenteral route, including via intravenous administration, including via slow infusion.
  • each of the compound of formula I, or other pharmaceutically acceptable salt thereof, and the camptothecin analog, such as irinotecan or topotecan is in the form of a sterile injectable solution.
  • Formula I has the nucleotide sequence 5'- TGTCATATTCCTGGATCCTT- 3' (SEQ ID NO: 1), wherein every internucleoside linkage is a phosphorothioate linkage, nucleosides 1-5 and 16-20 reading from the 5' end to the 3' end each comprise a 2'-0-(2-methoxyethyl) modified sugar, nucleosides 6-15 are 2'-deoxynucleosides, and every cytosine residue is a 5-methylcytosine.
  • the cancer is colorectal cancer. In some aspects, the colorectal cancer is refractory to the camptothecin analog.
  • the cancer is lung cancer, such as small cell lung cancer, or ovarian cancer.
  • each of the compound of formula I, or other pharmaceutically acceptable salt thereof, and the camptothecin analog is in the form of a sterile injectable solution.
  • camptothecin is a compound of formula II:
  • Camptothecin analogs suitable for use in several embodiments provided herein include, but are not limited to innotecan and topotecan.
  • irinotecan known by the chemical name (S)- 4,l l -diethyl-3,4,12, 14 etrahydro-4-hydroxy-3,14-dioxolH-pyrano[3 4' :6,7] ndolizino[l ,2-b]quinolin- 9-yl-[l ,4'bipiperidine]-l '-carboxylate, is a compound formula III:
  • irinotecan is provided as the metabolite SN-38 or is metabolized to the metabolite SN-38, which is a compound of formula IV:
  • topotecan known by the chemical name (S)-10-[(dimethylamino)methyl]-4- ethyl-4,9-dihydroxy H-pyrano[3 ⁇ 4':6,7]indolizino[l,2- ⁇ ]quinoline-3,14(4H,12H)-dione monohydrochloride, is a compound of formula V:
  • camptothecin analogs suitable for use in embodiments provided herein include, but are not limited to, those described in U.S. Patent No.: 6,486,320; 6,043,367; 6,040,313; 5,932,588; 5,916,896; 5,889,017; 5,801,167; 5,674,874; 5,658,920; 5,646,159; 5,633,260; 5,604,233; 5,597,829; 5,552,154; 5,541,327; 5,525,731 ; 5,468,754; 5,447,936; 5,446,047; 5,401,747; 5,391,745; 5,364,858; 5,340,817; 5,244,903; 5,227,380; 5,225,404; 5,180,722; 5,122,606; 5,122,526; 5,106,742; 5,061,800; 5,053,512; 5,049,668; 5,004,758; 4,981,968; 4,943,579; 4,939,255; 4,
  • Clinical protocols in cancer chemotherapy commonly employ multiple drugs rather than a single therapeutic.
  • the combined effect may be antagonism, additivity, or synergism. If one of the drugs has no effect by itself but increases the effects of other drug(s), the result is called potentiation. Prediction of synergy is difficult.
  • Each drug in combination has its own effects, i.e., its own potency and a specific shape of dose-effect curve. These effects are also related to affinity and efficacy. Factors such as feedback inhibition, spatial, temporal, and microenvironmental factors (such as pH, ionic strength, and temperature) add to the biological complexity and intricacy of drug effects.
  • Pretreatment with antisense oligonucleotides can at times have a tendency to reduce rather than enhance drug cytotoxicity. This may be caused by a number of nonspecific oligonucleotide effects, such as the ability of the oligonucleotide to interact directly with the cytotoxic drug (Blagosklonny et al. (1994) Anticancer Drugs 5(4):437-442).
  • eIF-4E ASO and camptothecin analog combinations drawn to achieving an additive or greater-than-additive effect in inhibiting cancer cell proliferation, tumor growth, tumor number, tumor volume, and/or patient survival as compared to the effect of eIF-4E ASO alone or camptothecin analog alone, are novel, surprisingly unexpected, and therapeutically useful.
  • the term “about” when applied to days means within ⁇ 2 hours of a value. For example, if it is stated, “the therapeutically effective interval is in the range of about 1 day to about 4 days,” it is implied that the range is within 22 hours to 98 hours.
  • eIF-4E antisense oligonucleotide refers to an eIF-4E antisense oligonucleotide described in WO 2005/028628, which is incorporated herein by reference in its entirety.
  • suitable eIF-4E antisense oligonucleotides include, but are not limited to, the following oligonucleotides shown in Table 1 below targeted to human eIF4E mRNA (Genbank Accession No. M15353.1 , SEQ ID NO: 2):
  • an eIF-4E antisense oligonucleotide is known by the chemical name: d(P-thio) ([2'- 0-(2-methoxyethyl)] m5rU - ([2'-0-(2-methoxyethyl)] rG -([2'-0-(2-methoxyethyl)] m5rU - ([2'-0-(2- methoxyethyl)] m5rC - ([2'-0-(2-methoxyethyl)] rA-T-A-T-T-m5C-m5C-T-G-G-A- ([2'-0-(-methoxyethyl)] m5rU - ([2'- O -(2-methoxyethyl)] m5rC -(
  • the eIF-4E ASO has the linked nucleoside sequence 5'- TGTCATATTCCTGGATCCTT-3 ' (SEQ ID NO: 1), wherein every internucleoside linkage is a phosphorothioate linkage, nucleosides 1 -5 and 16-20 reading from the 5' end to the 3 ' end each comprise a 2'-0-(2-methoxyethyl) modified sugar, nucleosides 6-15 are 2'-deoxynucleosides, and every cytosine residue is a 5-meth lcytosine.
  • the eIF-4E ASO is a compound of formula I:
  • Irinotecan is known by the chemical name (S)-4, l l -diethyl-3,4,12, 14-tetrahydro-4-hydroxy- 3, 14-dioxolH-pyrano[3 4' :6,7]-indolizino[l ,2-b]quinolin-9-yl-[l ,4'bipiperidine]- -carboxylate.
  • irinotecan is a compound of formula III:
  • Irinotecan not only refers to the chemical name or formula above but may also refer to its active metabolite SN-38.
  • Irinotecan serves as a water-soluble precursor of the lipophilic metabolite SN-38, which is formed from irinotecan by carboxylesterase-mediated cleavage of the carbamate bond between the camptothecin moiety and the dipiperidino side chain.
  • SN-38 is approximately 1000 times as potent as irinotecan as an inhibitor of topoisomerase I purified from human and rodent tumor cell lines. Camptosar May 2002 - Full, Revised Label - Pharmacia.
  • SN-38 is known by the chemical name 7-ethyl-10- hydroxy-camptothecin).
  • SN-38 is a compound of formula IV:
  • the term "patient” refers to a mammal afflicted with one or more disorders associated with eIF-4E expression or overexpression.
  • the patient is a human.
  • treating refers to curative treatment of disorders associated with eIF-4E activity, including various cancers.
  • Curative treatment refers to processes involving a slowing, interrupting, arresting, controlling, stopping, reducing, or reversing the progression or severity of a symptom, disorder, condition, or disease, but does not necessarily involve a total elimination of all disease-related symptoms, disorders, or conditions, or the disease itself.
  • Inhibiting means restraining, retarding, restricting, reducing, holding back, or preventing.
  • sensitizing to a camptothecin analog means making responsive to, susceptible to the action(s) of, or readily or easily affected by a camptothecin analog, such as irinotecan or topotecan. In some cases, this can also mean eliciting a greater response to a dose or amount of a camptothecin analog, such as irinotecan or topotecan, than that which would occur in the absence of the ASO.
  • camptothecin analog-sensitizing amount refers to an amount or dose of the eIF-4E ASO that is effective in making cancer cells, such as colorectal cancer cells, responsive to, susceptible to the action(s) of, or readily or easily affected by, a camptothecin analog (e.g. irinotecan or topotecan), or eliciting a greater cancer cell response to the action of an amount or dose of camptothecin analog (e.g. irinotecan or topotecan) than that which would occur in response to this amount or dose of camptothecin analog (e.g. irinotecan or topotecan) in the absence of the eIF-4E ASO.
  • camptothecin analog e.g. irinotecan or topotecan
  • a patient having cancer such as colorectal cancer, refractory to the camptothecin analog refers to a patient who has evidence of disease progression whilst receiving a camptothecin analog (e.g. irinotecan or topotecan) or within 3 months after completing camptothecin analog treatment.
  • a camptothecin analog e.g. irinotecan or topotecan
  • Therapeutically effective amounts of the eIF-4E ASO which include camptothecin analog- sensitizing amounts in the therapeutic context, are in the range of from about 100 mg to about 2,000 mg in humans.
  • therapeutically effective amounts of the eIF-4E ASO in terms of efficacy and tolerability include about 300 mg to about 1,200 mg, about 600 mg to about 1,000 mg, or about 800 mg to about 1,000 mg per single dose or administration, administered parenterally, including intravenously, including via slow intravenous infusion, over 1-3 hours.
  • Effective amount of camptothecin analog refers to an amount or dose of camptothecin analog (e.g. irinotecan or topotecan), when used in combination with an eIF-4E ASO, that produces the particular cancer cell growth-inhibiting or proliferation- inhibiting effect, tumor growth inhibiting effect, tumor volume increase-inhibiting effect, or cancer treatment effect.
  • camptothecin analog e.g. irinotecan or topotecan
  • an effective amount of camptothecin analog includes, but is not limited to, about 0.5 to 1,000 mg/m 2 , about 0.50 to 50 mg/m 2 , about 0.75 to 10 mg/m 2 , about 1 to 5 mg/m 2 , about 1 to about 50 to 500 mg/m 2 , about 100 to 350 mg/m 2 , about 125 mg/m 2 , about 150 mg/m 2 , about 180 mg/m 2 , about 200 mg/m 2 , about 250 mg/m 2 , about 300 mg/m 2 , about 350 mg/m 2 , about 400 mg/m 2 , or any amount in between the aforementioned amounts.
  • an effective amount of irinotecan includes, but is not limited to, about 10 to 1,000 mg/m 2 , about 50 to 500 mg/m 2 , about 100 to 350 mg/m 2 , about 125 mg/m 2 , about 150 mg/m 2 , about 180 mg/m 2 , about 200 mg/m 2 , about 250 mg/m 2 , about 300 mg/m 2 , about 350 mg/m 2 , about 400 mg/m 2 , or any amount in between the aforementioned amounts.
  • an effective amount of topotecan includes, but is not limited to, about 0.50 to 50 mg/m 2 , about 0.75 to 10 mg/m 2 , about 1 to 5 mg/m 2 , or any amount in between the aforementioned amounts.
  • any of the aforementioned amounts or range of amounts can be administered intravenously, for example, over 10, 20, 30, 40, 50, 60, 70, 80, 90, 120, 150, or 180 minutes every one week, two weeks, three weeks, four weeks, five weeks, six weeks, seven weeks, eight weeks, nine weeks, or ten weeks.
  • Irinotecan is a derivative of camptothecin that inhibits the enzyme topoisomerase I, which relieves torsional strain in DNA by inducing reversible single-strand breaks.
  • Irinotecan and its active metabolite SN- 38 bind to the topoisomerase I-DNA complex and prevent religation of these single-strand breaks.
  • Current research suggests that the cytotoxicity of irinotecan is due to double-strand DNA damage produced during DNA synthesis when replication enzymes interact with the ternary complex formed by topoisomerase I, DNA, and either irinotecan or SN-38.
  • Irinotecan (Irinotecan hydrochloride injection), under the commercial name Camptosar, received accelerated FDA approval in 1996 for the treatment of patients with metastatic carcinoma of the colon or rectum whose disease has recurred or progressed following initial flurouracil based therapy. Camptosar was subsequently approved as a component of first-line therapy in combination with 5- fluorouracil and leucovorin for patients with metastatic colon or rectal cancer. Camptosar is supplied as an injectable solution of irinotecan hydrochloride and is administered as weekly, or biweekly, or once every 3- week dosage schedules.
  • Topotecan is also a derivative of camptothecin that inhibits the enzyme topoisomerase I.
  • Topotecan hydrochloride received initial FDA approval in 1996 under the commercial name Hycamtin, which is indicated for patients having metastatic carcinoma of the ovary after failure of initial or subsequent chemotherapy or small cell lung cancer or ovarian cancer sensitive disease after failure of first-line chemotherapy.
  • optimum dosages of each of the present therapeutic agents can vary depending on the relative potency of the active ingredients in individual patients. Medical practitioners can determine dose and repetition rates for dosing based on measured residence times and concentrations of the active ingredients in bodily fluids or tissues and/or monitoring of relevant disease-related biomarkers for particular cancers.
  • biomarkers can be assessed by chest radiography, computed tomography (CT), low-dose spiral CT evaluation, magnetic resonance imaging (MRI), gallium scanning (scintigraphy), or position emission tomographic (PET) scanning. Analysis of the data obtained by these methods permits modification of the treatment regimen during therapy so that optimal amounts of the eIF-4E ASO and camptothecin analog in combination therapy are administered, and so that the duration of treatment can be determined as well. In this way, the dosing/treatment regimen can be modified over the course of therapy so that the lowest amounts of the eIF-4E ASO and camptothecin analog used in combination that exhibit satisfactory therapeutic effectiveness are administered, and so that administration of these compounds is continued only so long as is necessary to successfully treat the patient.
  • CT computed tomography
  • MRI magnetic resonance imaging
  • Scintigraphy gallium scanning
  • PET position emission tomographic
  • the term "effective interval" is a period of time beginning upon contact of a cancer cell and the elF- 4E ASO and during which the cell is responsive to the cell growth-inhibiting and proliferation-inhibiting effects of the combination of the ASO and camptothecin analog. This effect can be manifested by: (a) sensitization of the cancer cell to the effects of a camptothecin analog; (b) inhibition of growth or proliferation of the cancer cell; (c) inhibition of tumor growth; (d) inhibition of increase in tumor volume; (d) increased survival; or (e) therapeutically enhanced cancer treatment effect, in a cancer cell or tumor.
  • the effective interval is 4-21 days.
  • the camptothecin analog is irinotecan.
  • the cancer is colorectal cancer.
  • the therapeutically effective eIF-4E ASO/camptothecin analog combination therapy disclosed herein can be achieved by separate administration of the eIF-4E ASO and a camptothecin analog, such as irinotecan or topotecan.
  • the ASO can be administered first, followed by administration of a camptothecin analog within a therapeutically effective interval.
  • the eIF-4E ASO and camptothecin analog can be introduced into the patient on different schedules, as long as the time between the two administrations falls within a therapeutically effective interval.
  • a “therapeutically effective interval” is a period of time after administration of the eIF-4E ASO to a patient during which a tumor is responsive to the beneficial anti-neoplastic therapeutic effects of the combination of the ASO and camptothecin analog.
  • the therapeutically effective interval may optionally include a pre -camptothecin analog treatment period comprising administration of one or more doses of the eIF-4E ASO, e.g., a 1-3 hour infusion of 600 mg - 1000 mg of the eIF-4E ASO once per day for one or more days during the first interval, followed by one or more cycles of combination therapy.
  • the one or more doses is 3 doses delivered on 3 consecutive days during the first week of the interval.
  • the optional pre-camptothecin analog treatment period only occurs at commencement of patient therapy.
  • the one or more cycles of combination therapy may be about 7-31 days in length, about 14-28 days in length, or about 21 days in length, wherein a 1-3 hour infusion of 600 mg - 1000 mg of the eIF-4ASO is administered on day 1, and optionally on day 8, and/or 15. Additionally, on day 1 of each cycle, 1 hour after infusion with the eIF-4E ASO, irinotecan, for example, is administered at a dose of 150-250 mg/m 2 by infusion. This regimen can sensitize the tumor cells to the antiproliferative insult delivered by the camptothecin analog.
  • patient therapy can be commenced with a pre-camptothecin analog (e.g. irinotecan or topotecan) treatment period (e.g. cycle 1) comprising administering to a patient 1 to 7 loading doses of the eIF-4 E ASO per week, such as a 3 hour infusion of 600 mg, 800 mg, or 1000 mg of the eIF-4E ASO in consecutive or staggered days of the week, followed by several cycles of combination therapy.
  • a pre-camptothecin analog e.g. irinotecan or topotecan
  • cycle 1 pre-camptothecin analog
  • each cycle of combination therapy can be 21-28 days in length, during which patients are treated with a 3 hour infusion of 600 mg, 800 mg, or 1000 mg of the eIF-4 ASO on days 1, 8, and 15 of a 21-day cycle or on days 1, 8, 15, 21, and 22 of a 28-day cycle.
  • patients can be treated in each of cycles 2 and beyond with 10-500 mg/m 2 (e.g. 180 mg/m 2 ) of irinotecan, administered by intravenous infusion 1-7 times per week, every 1-4 weeks.
  • patients receiving the eIF-4E ASO in combination with a camptothecin analog e.g.
  • irinotecan or topotecan may have increased survival as compared to patients receiving the camptothecin analog alone.
  • the effect on patient survival when treated with eIF-4E ASO in combination with irinotecan may be additive or greater-than- additive when compared to survival achieved with ASO alone or camptothecin analog (e.g. irinotecan or topotecan) alone.
  • patients receiving the eIF-4E ASO in combination with camptothecin analog e.g. irinotecan or topotecan
  • the effect on tumor number and tumor volume by treatment with eIF-4E ASO in combination with a camptothecin analog may be additive or greater-than-additive when compared to the reduction in tumor number and tumor volume achieved with ASO alone or camptothecin analog alone.
  • Tumors can be evaluated by X-ray, computerized tomography (CT) scan, or magnetic resonance imaging (MRI).
  • a therapeutically effective interval for any individual patient undergoing treatment with the eIF-4E ASO and camptothecin analog can be determined by monitoring of a biomarker appropriate for the cancer. It should be noted that the 21 day intervals discussed above in connection with both the initial therapeutically effective interval and the subsequent therapeutically effective intervals represent typical starting procedures that are flexible and subject to modification. These intervals can be further optimized, and can be shorter or longer, the effectiveness of which can be monitored via the use of relevant biomarkers as noted above.
  • treatment with the eIF-4E ASO and a camptothecin analog optionally includes a pre -camptothecin analog treatment period comprising administration of one or more doses, e.g., 3 loading doses, of the eIF-4E ASO, i.e., a 1-3 hour infusion of the eIF-4E ASO once per day for one or more days, e.g., 3 consecutive days, during the first week, followed by administration of the eIF-4E ASO and camptothecin analog as described above during the second week (or first week with no pre -camptothecin analog treatment period).
  • the therapeutically effective interval in this case is about 4-7 days.
  • camptothecin analog can be administered every approximately 14, 21, or 28 days (dose interval) in conjunction with weekly administration of the eIF-4E ASO for as long as treatment continues.
  • the camptothecin analog is irinotecan.
  • therapeutically effective intervals include about 4 days to about 21 days, about 4 days to about 7 days, about 4 days to about 28 days, about 7 days to about 14 days, about 7 days to about 21 days, about 7 days to about 28 days, about 14 days to about 21 days, about 14 days to about 28 days, about 21 days to about 28 days, about 14 days, about 21 days, and about 28 days after administration of the eIF-4E ASO alone.
  • any of the aforementioned intervals or ranges of intervals may fall within one or more cycles of combination therapy, which can be about 7-31 days in length, about 14-28 days in length, or about 21 days in length.
  • the eIF-4 E ASO is used in the form of a pharmaceutically acceptable salt, preferably an alkali metal salt, more preferably a lithium, sodium, or potassium salt, most preferably a sodium salt.
  • a pharmaceutically acceptable salt preferably an alkali metal salt, more preferably a lithium, sodium, or potassium salt, most preferably a sodium salt.
  • compositions can be used as medicaments in human or veterinary medicine, administered by a variety of routes. Most preferably, such compositions are for parenteral administration, especially intravenous administration by slow infusion. Administration of solutions of these compounds, especially sterile injectable, non-pyrogenic solutions, by slow intravenous infusion is most preferred.
  • compositions can be prepared by methods well known in the art (See, e.g.,
  • an eIF-4E antisense oligonucleotide is 10-30 subunits in length. In certain embodiments, an eIF-4E antisense oligonucleotide is 12 to 30 subunits in length. In certain embodiments, an eIF-4E antisense oligonucleotide is 12 to 22 subunits in length. In certain embodiments, an eIF-4E antisense oligonucleotide is 14 to 30 subunits in length. In certain embodiments, an eIF-4E antisense oligonucleotide is 14 to 20 subunits in length. In certain embodiments, an antisense compoun is 15 to 30 subunits in length.
  • an eIF-4E antisense oligonucleotide is 15 to 20 subunits in length. In certain embodiments, an eIF-4E antisense oligonucleotide is 16 to 30 subunits in length. In certain embodiments, an eIF-4E antisense oligonucleotide is 16 to 20 subunits in length. In certain embodiments, an eIF-4E antisense oligonucleotide is 17 to 30 subunits in length. In certain embodiments, an eIF-4E antisense oligonucleotide is 17 to 20 subunits in length. In certain embodiments, an eIF-4E antisense oligonucleotide is 18 to 30 subunits in length.
  • an eIF-4E antisense oligonucleotide is 18 to 21 subunits in length. In certain embodiments, an eIF-4E antisense oligonucleotide is 18 to 20 subunits in length. In certain embodiments, an eIF-4E antisense oligonucleotide is 20 to 30 subunits in length.
  • such eIF-4E antisense oligonucleotides are from 12 to 30 linked subunits, 14 to 30 linked subunits, 14 to 20 subunits, 15 to 30 subunits, 15 to 20 subunits, 16 to 30 subunits, 16 to 20 subunits, 17 to 30 subunits, 17 to 20 subunits, 18 to 30 subunits, 18 to 20 subunits, 18 to 21 subunits, 20 to 30 subunits, or 12 to 22 linked subunits, respectively.
  • an eIF-4E antisense oligonucleotide is 14 subunits in length. In certain embodiments, an eIF-4E antisense oligonucleotide is 16 subunits in length.
  • an eIF-4E antisense oligonucleotide is 17 subunits in length. In certain embodiments, an eIF-4E antisense oligonucleotide is 18 subunits in length. In certain embodiments, an eIF-4E antisense oligonucleotide is 20 subunits in length. In other embodiments, an eIF-4E antisense oligonucleotide is 8 to 80, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30, 19 to 50, or 20 to 30 linked subunits.
  • eIF-4E antisense oligonucleotides are 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked subunits in length, or a range defined by any two of the above values.
  • eIF-4E antisense oligonucleotides may be shortened or truncated. For example, a single subunit may be deleted from the 5' end (5' truncation), or alternatively from the 3' end (3' truncation). A shortened or truncated eIF-4E antisense oligonucle may have two subunits deleted from the 5' end, or alternatively may have two subunits deleted from the 3 ' end, of the eIF-4E antisense oligonucleotide.
  • the deleted nucleosides may be dispersed throughout the eIF-4E antisense oligonucleotide, for example, in an eIF-4E antisense oligonucleotide having one nucleoside deleted from the 5' end and one nucleoside deleted from the 3 ' end.
  • the additional subunit may be located at the 5' or 3' end of the eIF-4E antisense oligonucleotide.
  • the added subunits may be adjacent to each other, for example, in an eIF-4E antisense oligonucleotide having two subunits added to the 5' end (5' addition), or alternatively to the 3' end (3' addition), of the eIF-4E antisense oligonucleotide.
  • the added subunits may be dispersed throughout the eIF-4E antisense oligonucleotide, for example, in an eIF-4E antisense oligonucleotide having one subunit added to the 5' end and one subunit added to the 3' end.
  • Antisense oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the antisense oligonucleotides were able to direct specific cleavage of the target mRNA, albeit to a lesser extent than the antisense oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase antisense oligonucleotides, including those with 1 or 3 mismatches.
  • Gautschi et al. demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti-tumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res.
  • a nucleoside is a base-sugar combination.
  • the nucleobase (also known as base) portion of the nucleoside is normally a heterocyclic base moiety.
  • Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2', 3' or 5' hydroxyl moiety of the sugar.
  • Oligonucleotides are formed through the covalent linkage of adjacent nucleosides to one another, to form a linear polymeric oligonucleotide. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside linkages of the oligonucleotide.
  • Modifications to eIF-4E antisense oligonucleotides encompass substitutions or changes to internucleoside linkages, sugar moieties, or nucleobases. Modified oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target, increased stability in the presence of nucleases, or increased inhibitory activity.
  • Chemically modified nucleosides may also be employed to increase the binding affinity of a shortened or truncated eIF-4E antisense oligonucleotide for its target nucleic acid. Consequently, comparable results can often be obtained with shorter eIF-4E antisense oligonucleotides that have such chemically modified nucleosides.
  • RNA and DNA The naturally occuring internucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester linkage.
  • Antisense oligonucleotides having one or more modified, i.e. non-naturally occurring, internucleoside linkages are often selected over antisense oligonucleotides having naturally occurring internucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.
  • Oligonucleotides having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom as well as internucleoside linkages that do not have a phosphorus atom.
  • Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing linkages are well known.
  • eIF-4E antisense oligonucleotides comprise one or more modified internucleoside linkages.
  • the modified internucleoside linkages are phosphorothioate linkages.
  • each internucleoside linkage of an eIF-4E antisense oligonucleotide is a phosphorothioate internucleoside linkage.
  • Modified Sugar Moieties eIF-4E antisense oligonucleotides provided herein can optionally contain one or more nucleosides wherein the sugar group has been modified. Such sugar modified nucleosides may impart enhanced nuclease stability, increased binding affinity, or some other beneficial biological property to the eIF-4E antisense oligonucleotides. In certain embodiments, nucleosides comprise chemically modified ribofuranose ring moieties.
  • Examples of chemically modified ribofuranose rings include without limitation, addition of substitutent groups (including 5' and 2' substituent groups, bridging of non-geminal ring atoms to form bicyclic nucleic acids (BNA), replacement of the ribosyl ring oxygen atom with S, N(R), or C(Ri)(R 2 ) (R, Ri and R 2 are each independently H, C1-C12 alkyl or a protecting group) and combinations thereof.
  • substitutent groups including 5' and 2' substituent groups
  • BNA bicyclic nucleic acids
  • R, Ri and R 2 are each independently H, C1-C12 alkyl or a protecting group
  • Examples of chemically modified sugars include 2'-F-5 '-methyl substituted nucleoside (see PCT International Application WO 2008/101157 Published on 8/21/08 for other disclosed 5',2'-bis substituted nucleosides) or replacement of the ribosyl ring oxygen atom with S with further substitution at the 2'-position (see published U.S. Patent Application US2005-0130923, published on June 16, 2005) or alternatively 5 '-substitution of a BNA (see PCT International Application WO 2007/134181 Published on 1 1/22/07 wherein LNA is substituted with for example a 5'-methyl or a 5'-vinyl group).
  • nucleosides having modified sugar moieties include without limitation nucleosides comprising 5'-vinyl, 5'-methyl (R or S), 4'-S, 2'-F, 2'-OCH 3 , 2'-OCH 2 CH 3 , 2'-OCH 2 CH 2 F and 2'- 0(CH 2 ) 2 OCH 3 substituent groups.
  • bicyclic nucleosides refer to modified nucleosides comprising a bicyclic sugar moiety.
  • examples of bicyclic nucleosides include without limitation nucleosides comprising a bridge between the 4' and the 2' ribosyl ring atoms.
  • eIF-4E antisense oligonucleotides provided herein include one or more bicyclic nucleosides comprising a 4' to 2' bridge.
  • 4' to 2' bridged bicyclic nucleosides include but are not limited to one of the formulae: 4'-(CH 2 )-0-2' (LNA); 4'-(CH 2 )-S-2'; 4'-(CH 2 ) 2 -0-2' (ENA); 4'-CH(CH 3 )-0-2' (also referred to as constrained ethyl or cEt) and 4'-C- H(CH 2 OCH 3 )-0-2' (and analogs thereof see U.S.
  • Each of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example a-L-ribofuranose and ⁇ -D-ribofuranose (see PCT international application PCT/DK98/00393, published on March 25, 1999 as WO 99/14226).
  • the bridge of a bicyclic sugar moiety is -[C(R a )(R b )] n -, -[C(R a )(R b )] n -0- , -C(R a R b )-N(R)-0- or -C(R a R b )-0-N(R)-.
  • the bridge is 4'-CH 2 -2', 4'-(CH 2 ) 2 -2', 4'- (CH 2 ) 3 -2', 4'-CH 2 -0-2', 4'-(CH 2 ) 2 -0-2', 4'-CH 2 -0-N(R)-2' and 4'-CH 2 -N(R)-0-2'- wherein each R is, independently, H, a protecting group or C 1 -C 12 alkyl.
  • bicyclic nucleosides are further defined by isomeric configuration.
  • a nucleoside comprising a 4 '-2' methylene-oxy bridge may be in the a-L configuration or in the ⁇ - D configuration.
  • a-L-methyleneoxy (4'-CH 2 -0-2') BNA's have been incorporated into eIF-4E antisense oligonucleotides that showed antisense activity (Frieden et al, Nucleic Acids Research, 2003, 21, 6365-6372).
  • bicyclic nucleosides include, but are not limited to, (A) a-L-methyleneoxy (4'-CH 2 -0-2') BNA , (B) ⁇ -D-methyleneoxy (4'-CH 2 -0-2') BNA , (C) ethyleneoxy (4'-(CH 2 ) 2 -0-2') BNA , (D) aminooxy (4'-CH 2 -0-N(R)-2') BNA, (E) oxyamino (4'-CH 2 -N(R)-0-2') BNA, and (F) methyl(methyleneoxy) (4'-CH(CH 3 )-0-2') BNA, (G) methylene-thio (4'-CH 2 -S-2') BNA, (H) methylene- amino (4'-CH 2 -N(R)-2') BNA, (I) methyl carbocyclic (4'-CH 2 -CH(CH 3 )-2') BNA, (J)
  • Bx is the base moiety and R is independently H, a protecting group, C 1 -C 12 alkyl or C 1 -C 12 alkoxy.
  • bicyclic nucleosides are provided having Formula V:
  • Bx is a heterocyclic base moiety
  • R c is C 1 -C 12 alkyl or an amino protecting group
  • T a and T b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium.
  • bicyclic nucleosides are provided having Formula VI:
  • Bx is a heterocyclic base moiety
  • T a and T b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
  • Z a is Ci-Ce alkyl, C 2 -C6 alkenyl, C 2 -C6 alkynyl, substituted Ci-Ce alkyl, substituted C 2 -C6 alkenyl, substituted C 2 -C6 alkynyl, acyl, substituted acyl, substituted amide, thiol or substituted thio.
  • bicyclic nucleosides are provided having Formula VII:
  • Bx is a heterocyclic base moiety
  • T a and T b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
  • bicyclic nucleosides are provided having Formula VIII:
  • Bx is a heterocyclic base moiety
  • T a and T b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
  • R d is Ci-Ce alkyl, substituted Ci-Ce alkyl, C 2 -C6 alkenyl, substituted C 2 -C6 alkenyl, C 2 -C6 alkynyl or substituted C 2 -C6 alkynyl; each q a , q b , q c and q is, independently, H, halogen, Ci-Ce alkyl, substituted Ci-Ce alkyl, C 2 -C6 alkenyl, substituted C 2 -C6 alkenyl, C 2 -C6 alkynyl or substituted C 2 -C6 alkynyl, Ci-Ce alkoxyl, substituted Cp Ce alkoxyl, acyl, substituted acyl, Ci-Ce aminoalkyl or substituted Ci-Ce aminoalkyl;
  • bicyclic nucleosides are provided having Formula IX:
  • Bx is a heterocyclic base moiety
  • T a and T b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium
  • BNA methyleneoxy (4'-CH 2 -0-2') BNA monomers adenine, cytosine, guanine, 5-methyl-cytosine, thymine and uracil, along with their oligomerization, and nucleic acid recognition properties have been described (Koshkin et al., Tetrahedron, 1998, 54, 3607-3630). BNAs and preparation thereof are also described in WO 98/39352 and WO 99/14226.
  • bicyclic nucleosides having Formula X:
  • Bx is a heterocyclic base moiety
  • T a and T b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium
  • 4'-2' bicyclic nucleoside or “4' to 2' bicyclic nucleoside” refers to a bicyclic nucleoside comprising a furanose ring comprising a bridge connecting two carbon atoms of the furanose ring connects the 2' carbon atom and the 4' carbon atom of the sugar ring.
  • nucleosides refer to nucleosides comprising modified sugar moieties that are not bicyclic sugar moieties.
  • sugar moiety, or sugar moiety analogue, of a nucleoside may be modified or substituted at any position.
  • 2 '-modified sugar means a furanosyl sugar modified at the 2' position.
  • such modifications include substituents selected from: a halide, including, but not limited to substituted and unsubstituted alkoxy, substituted and unsubstituted thioalkyl, substituted and unsubstituted amino alkyl, substituted and unsubstituted alkyl, substituted and unsubstituted allyl, and substituted and unsubstituted alkynyl.
  • a halide including, but not limited to substituted and unsubstituted alkoxy, substituted and unsubstituted thioalkyl, substituted and unsubstituted amino alkyl, substituted and unsubstituted alkyl, substituted and unsubstituted allyl, and substituted and unsubstituted alkynyl.
  • Other - substituent groups can also be selected from: C r Ci 2 alkyl, substituted alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH 3 , OCN, CI, Br, CN, F, CF 3 , OCF 3 , SOCH 3 , S0 2 CH 3 , ON0 2 , N0 2 , N 3 , NH 2 , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving pharmacokinetic properties, or a group for improving the pharmacodynamic properties of an eIF-4E antisense oligonucleotide, and other substituents having similar properties.
  • modifed nucleosides comprise a 2'-MOE side chain (Baker et al, J. Biol. Chem., 1997, 272, 11944-12000).
  • 2'-MOE substitution have been described as having improved binding affinity compared to unmodified nucleosides and to other modified nucleosides, such as 2'- O-methyl, O-propyl, and O-aminopropyl.
  • Oligonucleotides having the 2'-MOE substituent also have been shown to be antisense inhibitors of gene expression with promising features for in vivo use (Martin, Helv. Chim.
  • a "modified tetrahydropyran nucleoside” or “modified THP nucleoside” means a nucleoside having a six-membered tetrahydropyran "sugar” substituted in for the pentofuranosyl residue in normal nucleosides (a sugar surrogate).
  • Modified THP nucleosides include, but are not limited to, what is referred to in the art as hexitol nucleic acid (HNA), anitol nucleic acid (ANA), manitol nucleic acid (MNA) (see Leumann, Bioorg. Med. Chem., 2002, 10, 841-854) or fluoro HNA (F-HNA) having a tetrahydropyran ring system as illustrated below:
  • sugar surrogates are selected having Formula XI:
  • the modified THP nucleosides of Formula VII are provided wherein qi, q 2 , q3, q4, q 5 , q6 and q 7 are each H. In certain embodiments, at least one of qi, q 2 , q3, q4, q 5 , q6 and q 7 is other than H. In certain embodiments, at least one of qi, q 2 , q3, q4, q 5 , q6 and q 7 is methyl. In certain embodiments, THP nucleosides of Formula VII are provided wherein one of Ri and R 2 is fluoro. In certain embodiments, Ri is fluoro and R 2 is H; R t is methoxy and R 2 is H, and Ri is methoxyethoxy and R 2 is H.
  • sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom.
  • nucleosides comprising morpholino sugar moieties and their use in oligomeric compounds has been reported (see for example: Braasch et al., Biochemistry, 2002, 41, 4503-4510; and U.S. Patents 5,698,685; 5,166,315; 5,185,444; and 5,034,506).
  • morpholino means a sugar surrogate having the following formula:
  • morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure.
  • sugar surrogates are referred to herein as "modifed morpholinos.”
  • Patent Application US2005-0130923, published on June 16, 2005) or alternatively 5 '-substitution of a bicyclic nucleic acid see PCT International Application WO 2007/134181 , published on 1 1/22/07 wherein a 4'-CH 2 -0-2' bicyclic nucleoside is further substituted at the 5' position with a 5'-methyl or a 5'-vinyl group).
  • PCT International Application WO 2007/134181 published on 1 1/22/07 wherein a 4'-CH 2 -0-2' bicyclic nucleoside is further substituted at the 5' position with a 5'-methyl or a 5'-vinyl group.
  • carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described ⁇ see, e.g., Srivastava et al, J. Am. Chem. Soc. 2007, 129(26), 8362-8379).
  • eIF-4E antisense oligonucleotides comprise one or more modified cyclohexenyl nucleosides, which is a nucleoside having a six-membered cyclohexenyl in place of the pentofuranosyl residue in naturally occurring nucleosides.
  • Modified cyclohexenyl nucleosides include, but are not limited to those described in the art (see for example commonly owned, published PCT Application WO 2010/036696, published on April 10, 2010, Robeyns et al, J. Am. Chem.
  • T 3 and T are each, independently, an internucleoside linking group linking the cyclohexenyl nucleoside analog to an eIF-4E antisense oligonucleotide or one of T 3 and T is an internucleoside linking group linking the tetrahydropyran nucleoside analog to an eIF-4E antisense oligonucleotide and the other of T 3 and T 4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5'-or 3'-terminal group; and qi, q 2 , q 3 , q 4 , qs, qe, q7, qs and q9 are each, independently, H, Ci-C6 alkyl, substituted Ci-Ce alkyl, C 2 - Ce alkenyl, substituted C 2 -C6 alkenyl, C 2 -C6 alkynyl, substituted C 2 -C6 alkynyl or other
  • 2'-modified nucleosides refers to a nucleoside comprising a sugar comprising a substituent at the 2' position other than H or OH.
  • 2'-F refers to a nucleoside comprising a sugar comprising a fluoro group at the 2' position of the sugar ring.
  • 2'-OMe or “2'-OCH 3 " or “2'-0-methyl” each refers to a nucleoside comprising a sugar comprising an -OCH 3 group at the 2' position of the sugar ring.
  • MOE or "2'-MOE” or “2'-OCH 2 CH 2 OCH 3 " or “2'-0-methoxyethyl” each refers to a nucleoside comprising a sugar comprising a -OCH 2 CH 2 OCH 3 group at the 2' position of the sugar ring.
  • oligonucleotide refers to a compound comprising a plurality of linked nucleosides. In certain embodiments, one or more of the plurality of nucleosides is modified. In certain embodiments, an oligonucleotide comprises one or more ribonucleosides (RNA) and/or deoxyribonucleosides (DNA).
  • RNA ribonucleosides
  • DNA deoxyribonucleosides
  • bicyclo and tricyclo sugar surrogate ring systems are also known in the art that can be used to modify nucleosides for incorporation into eIF-4E antisense oligonucleotides (see for example review article: Leumann, Bioorg. Med. Chem. , 2002, 10, 841-854). Such ring systems can undergo various additional substitutions to enhance activity.
  • nucleobase moieties are maintained for hybridization with an appropriate nucleic acid target.
  • eIF-4E antisense oligonucleotides comprise one or more nucleosides having modified sugar moieties.
  • the modified sugar moiety is 2' -MOE.
  • the 2' -MOE modified nucleosides are arranged in a gapmer motif.
  • the modified sugar moiety is a bicyclic nucleoside having a (4'-CH(CH 3 )-0-2') bridging group.
  • the (4'-CH(CH 3 )-0-2') modified nucleosides are arranged throughout the wings of a gapmer motif.
  • RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. RNA is prepared using methods well known in the art, for example, using the TRIZOL Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's recommended protocols.
  • Target nucleic acid levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or quantitaive real-time PCR.
  • RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. Northern blot analysis is also routine in the art. Quantitative real-time PCR can be conveniently accomplished using the commercially available ABI PRISM 7600, 7700, or 7900 Sequence Detection System, available from PE- Applied Biosystems, Foster City, CA and used according to manufacturer's instructions.
  • Quantitation of target RNA levels may be accomplished by quantitative real-time PCR using the ABI PRISM 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, CA) according to manufacturer's instructions. Methods of quantitative real-time PCR are well known in the art.
  • RNA Prior to real-time PCR, the isolated RNA is subjected to a reverse transcriptase (RT) reaction, which produces complementary DNA (cDNA) that is then used as the substrate for the real-time PCR amplification.
  • RT and real-time PCR reactions are performed sequentially in the same sample well.
  • RT and real-time PCR reagents may be obtained from Invitrogen (Carlsbad, CA). RT real-time -PCR reactions are carried out by methods well known to those skilled in the art.
  • Gene (or RNA) target quantities obtained by real time PCR are normalized using either the expression level of a gene whose expression is constant, such as cyclophilin A, or by quantifying total RNA using RIBOGREEN (Invitrogen, Inc. Carlsbad, CA). Cyclophilin A expression is quantified by real time PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA is quantified using RIBOGREEN RNA quantification reagent (Invetrogen, Inc. Eugene, OR). Methods of RNA quantification by RIBOGREEN are taught in Jones, L.J., et al, (Analytical Biochemistry, 1998, 265, 368-374).
  • a CYTOFLUOR 4000 instrument PE Applied Biosystems
  • Probes and primers are designed to hybridize to an eIF-4E nucleic acid.
  • Methods for designing real-time PCR probes and primers are well known in the art, and may include the use of software such as PRIMER EXPRESS Software (Applied Biosystems, Foster City, CA).
  • Example 1 Effect of antisense inhibition of human eIF-4E in colorectal carcinoma cells
  • the antisense oligonucleotide ISIS 183750 (TGTCATATTCCTGGATCCTT, a 5-10-5 MOE gapmer with phosphorothioate backbone, disclosed herein as SEQ ID NO: 1) targeting human eIF-4E at target site 1285 of Genbank Accession No. M15353.1 (disclosed herein as SEQ ID NO: 2) and target site 2780 of GENBANK Accession No. NM 001968.3 (disclosed herein as SEQ ID NO: 106) was utilized.
  • COLO201, COLO205, and HCTl 16 were utilized in this assay.
  • COLO201 and COLO205 cells were grown in RPMI 1640 medium and HCTl 16 cells were grown in McCoy's medium. All media were supplemented with 10% fetal bovine serum (Life Technologies). Cells were plated at a density of 2-5 x 10 4 cells per well in six-well plates.
  • RNAiMax reagent Life Technologies
  • ISIS 141923 CCTTCCCTGAAGGTTCCTCC, 5-10-5 MOE gapmer with no known murine target
  • ISIS 183750 ISIS 141923
  • live cells were counted by direct enumeration.
  • the number of live cells on each day was considered as a direct indicator of cell proliferation.
  • the assay was done in triplicates. Results are presented in Tables 2-4.
  • the data indicates that antisense inhibition of eIF-4E reduced cell proliferation in all the colorectal carcinoma cell lines tested.
  • Example 2 Effect of treatment of colorectal carcinoma cells with ISIS 183750 in combination with camptothecin analogs irinotecan or SN-38
  • COLO201 and COLO205 cells were grown in RPMI 1640 medium; HCT116 cells were grown in McCoy's medium. All media were supplemented with 10% fetal bovine serum (Life Technologies). Cells were plated at a density of 2-5 x 10 3 cells per well in 96-well plates. After 24 hrs, cells were transfected using RNAiMax reagent (Life Technologies) with 25 nM or 50 nM of either control antisense oligonucleotide, ISIS 141923 or ISIS 183750.
  • RNAiMax reagent Life Technologies
  • RNA analysis was also conducted to assess the inhibition of eIF-4E by ISIS 183750 in these cells.
  • the data is presented in Table 5 and indicates that treatment with ISIS 183750 inhibited eIF-4E levels.
  • the results of the cell proliferation assay are presented in the Table below as percent inhibition of cell proliferation compared to cells not treated with irinotecan/SN-38 or ISIS 183750. Since treatment with the control oligonucleotide, ISIS 141923, caused negligible effect to cell proliferation, as demonstrated by the study in Example 1, the batch of cells treated with ISIS 141923 at 25 nM and not treated with irinotecan or SN-38 was considered to demonstrate 100% cell proliferation (shown as 0% inhibition of proliferation in the Tables below). The cell proliferation of batches of cells undergoing treatment with ISIS 183750 and/or irinotecan or SN-38 was compared to this control batch of cells. The inhibition of proliferation in these treated cells was calculated and is presented in the Tables below.
  • the effect of treatment with 50 nM dose of ISIS 183750 and 200 nM SN-38 inhibited cell proliferation by 50%> compared to 18% inhibition with 50 nM ISIS 183750 alone or 13% inhibition with 200 nM SN-38 alone.
  • the effect of treatment with 25 nM dose of ISIS 183750 and 200 nM SN-38 inhibited cell proliferation by 40%> compared to 7%> inhibition with 25 nM ISIS 183750 alone or 27%> inhibition with 200 nM SN-38 alone.
  • the effect of treatment with 25 nM dose of ISIS 183750 and 200 nM SN-38 inhibited cell proliferation by 46% compared to 15% inhibition with 25 nM ISIS 183750 alone or 27%> inhibition with 200 nM SN-38 alone.
  • the combination index (CI) of the treatment of ISIS 183750 with Irinotecan or SN-38 was also calculated by CalcuSyn v2 software (Biosoft). The calculation method is described in detail in the review article, "Theoretical basis, experimental design, and computerized simulation of synergism and antagonism in drug combination studies" (Chou TC. Pharmacol Rev. 2006. 58: 621-681).
  • a CI of 0.85-0.90 is considered low synergy; a CI of 0.70-0.85 is considered moderate synergy; a CI of 0.30-0.70 is considered synergy; a CI of 0.10-0.30 is considered strong synergy.
  • Tables 12 and 13 The results indicates that ISIS 183750 synergizes with irinotecan or SN-38.
  • Example 3 Reduction of Tumors and Tumor Volume by Combined Use of the eIF-4E ASO and irinotecan
  • eIF-4E ASO (Formula 1 ; SEQ ID NO: 1) complements or enhances the activity of irinotecan
  • the effect of the combined use of the eIF-4E ASO and irinotecan on number of tumors and tumor volume in patients with colorectal cancer is studied as follows.
  • cycle 1 a pre -irinotecan treatment period comprising administration of 1 to 7 loading doses of the eIF-4 E ASO per week, e.g., a 3 hour infusion of 600 mg, 800 mg, or 1000 mg of the eIF-4E ASO in consecutive or staggered days of the week, followed by several cycles of combination therapy.
  • cycle 1 a pre -irinotecan treatment period comprising administration of 1 to 7 loading doses of the eIF-4 E ASO per week, e.g., a 3 hour infusion of 600 mg, 800 mg, or 1000 mg of the eIF-4E ASO in consecutive or staggered days of the week, followed by several cycles of combination therapy.
  • Each cycle of combination therapy is 21-28 days in length, during which patients are treated with a 3 hour infusion of 600 mg, 800 mg, or 1000 mg of the elF- 4 ASO on days 1, 8, and 15 of a 21 -day cycle or on days 1, 8, 15, 21, and 22 of a 28-day cycle.
  • patients are treated with 10-500 mg/m 2 (e.g. 180 mg/m 2 ) of irinotecan, administered by intravenous infusion 1-7 times per week every 1-4 weeks.
  • Patients in the control group are treated similarly to those in the eIF-4E experimental group, except they do not receive the eIF-4E ASO.
  • Patients receiving the eIF-4E ASO in combination with irinotecan may have fewer tumors and reduced tumor volume as compared to patients receiving irinotecan without the eIF-4E ASO.
  • the effect on tumor number and tumor volume by treatment with eIF-4E ASO in combination with innotecan may be additive or greater-than-additive when compared to the reduction in tumor number and tumor volume achieved with ASO alone or innotecan alone. Tumors are evaluated by X-ray, computerized tomography (CT) scan, or magnetic resonance imaging (MRI).
  • Example 4 Increase of Survival by Combined Use of the eIF-4E ASO and irinotecan
  • eIF-4E ASO (Formula 1 ; SEQ ID NO: 1) complements or enhances the activity of irinotecan
  • the effect of the combined use of the eIF-4E ASO and irinotecan on survival in patients with colorectal cancer is studied as follows.
  • cycle 1 a pre -irinotecan treatment period comprising administration of 1 to 7 loading doses of the eIF-4 E ASO per week, e.g., a 3 hour infusion of 600 mg, 800 mg, or 1000 mg of the eIF-4E ASO in consecutive or staggered days of the week, followed by several cycles of combination therapy.
  • cycle 1 a pre -irinotecan treatment period comprising administration of 1 to 7 loading doses of the eIF-4 E ASO per week, e.g., a 3 hour infusion of 600 mg, 800 mg, or 1000 mg of the eIF-4E ASO in consecutive or staggered days of the week, followed by several cycles of combination therapy.
  • Each cycle of combination therapy is 21-28 days in length, during which patients are treated with a 3 hour infusion of 600 mg, 800 mg, or 1000 mg of the elF- 4 ASO on days 1, 8, and 15 of a 21 -day cycle or on days 1, 8, 15, 21, and 22 of a 28-day cycle.
  • patients are treated with 10-500 mg/m 2 (e.g. 180 mg/m 2 ) of irinotecan, administered by intravenous infusion 1-7 times per week every 1-4 weeks.
  • Patients in the control group are treated similarly to those in the eIF-4E experimental group, except they do not receive the eIF-4E ASO.
  • Patients receiving the eIF-4E ASO in combination with irinotecan may have increased survival as compared to patients receiving irinotecan alone.
  • the effect on patient survival when treated with eIF-4E ASO in combination with irinotecan may be additive or greater-than-additive when compared to survival achieved with ASO alone or irinotecan alone.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Dermatology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Les modes de réalisation de la présente invention concernent des combinaisons d'un oligonucléotide antisens (ASO) ciblant le facteur d'initiation de la traduction eucaryote 4E (eIF-4E) et d'un analogue de la camptothécine, tel que l'irinotécan ou le topotécan. La présente invention concerne également des procédés d'utilisation de ces combinaisons pour inhiber la croissance ou la prolifération de cellules cancéreuses et de traitement du cancer.
PCT/US2013/052670 2012-07-30 2013-07-30 Polythérapie pour le traitement du cancer WO2014022357A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201261677379P 2012-07-30 2012-07-30
US61/677,379 2012-07-30

Publications (1)

Publication Number Publication Date
WO2014022357A1 true WO2014022357A1 (fr) 2014-02-06

Family

ID=50028468

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2013/052670 WO2014022357A1 (fr) 2012-07-30 2013-07-30 Polythérapie pour le traitement du cancer

Country Status (1)

Country Link
WO (1) WO2014022357A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020150915A1 (fr) * 2019-01-23 2020-07-30 上海交通大学 Conjugué acide nucléique-médicament, système d'administration de médicament, et procédés de préparation associés et application associées

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5786344A (en) * 1994-07-05 1998-07-28 Arch Development Corporation Camptothecin drug combinations and methods with reduced side effects
US20100130589A1 (en) * 2003-09-18 2010-05-27 Freier Susan M MODULATION OF eIF4E EXPRESSION
US20120149888A1 (en) * 2009-02-22 2012-06-14 Srivastava Suresh C Synthesis of ara-2'-o-methyl-nucleosides, corresponding phosphoramidites and oligonucleotides incorporating novel modifications for biological application in therapeuctics, diagnostics, g- tetrad forming oligonucleotides and aptamers

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5786344A (en) * 1994-07-05 1998-07-28 Arch Development Corporation Camptothecin drug combinations and methods with reduced side effects
US20100130589A1 (en) * 2003-09-18 2010-05-27 Freier Susan M MODULATION OF eIF4E EXPRESSION
US20120149888A1 (en) * 2009-02-22 2012-06-14 Srivastava Suresh C Synthesis of ara-2'-o-methyl-nucleosides, corresponding phosphoramidites and oligonucleotides incorporating novel modifications for biological application in therapeuctics, diagnostics, g- tetrad forming oligonucleotides and aptamers

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
MERIC ET AL.: "Translation Initiation in Cancer: A Novel Target for Therapy.", MOLECULAR CANCER THERAPEUTICS, vol. 1, September 2002 (2002-09-01), pages 971 - 979 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020150915A1 (fr) * 2019-01-23 2020-07-30 上海交通大学 Conjugué acide nucléique-médicament, système d'administration de médicament, et procédés de préparation associés et application associées

Similar Documents

Publication Publication Date Title
AU2019294838A1 (en) Compounds and methods for reducing LRRK2 expression
AU2019287635A1 (en) Compounds and methods for increasing STMN2 expression
AU2020241693B2 (en) Compounds and methods for reducing KCNT1 expression
AU2019228607B2 (en) Modulators of IRF4 expression
WO2020061497A1 (fr) Compositions et procédés de modulation de l'expression de lmna
TW202016305A (zh) Ａｐｏｌ１表現之調節劑
TW202104595A (zh) 用來調節ｄｕｘ４的表現之化合物、方法及醫藥組成物
WO2022174053A1 (fr) Composés oligomères à liaison modifiée et leurs utilisations
ES2907254T3 (es) Un compuesto antisentido modificado para su uso en el tratamiento de la enfermedad de Kennedy
US11365416B2 (en) Modulators of EZH2 expression
EP3775215A1 (fr) Procédés de modulation de l'activité antisens
WO2019099781A1 (fr) Méthode de modulation d'une activité antisens
AU2018357932A1 (en) Modulators of ENaC expression
WO2019051173A1 (fr) Modulateurs de l'expression de smad7
WO2014022357A1 (fr) Polythérapie pour le traitement du cancer
WO2021178374A2 (fr) Composés et procédés de réduction de l'expression de l'apoe
WO2021178769A1 (fr) Composés et méthodes de modulation de kcnq2
AU2021264010A1 (en) Compounds and methods for modulating ATXN1
WO2020072887A1 (fr) "no-go decay" médié par un oligonucléotide
WO2019036613A1 (fr) Modulation de la voie de signalisation notch pour le traitement de troubles respiratoires
WO2021102341A2 (fr) Composés pour moduler l'expression de la bêta globine
EP4054655A1 (fr) Composés et méthodes de réduction de l'expression de spdef
WO2021092459A1 (fr) Composés et méthodes de réduction de l'expression de spdef
WO2021178377A2 (fr) Compositions et méthodes pour inhiber l'expression du gène asah1

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13825478

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13825478

Country of ref document: EP

Kind code of ref document: A1