WO2021102341A2 - Composés pour moduler l'expression de la bêta globine - Google Patents

Composés pour moduler l'expression de la bêta globine Download PDF

Info

Publication number
WO2021102341A2
WO2021102341A2 PCT/US2020/061627 US2020061627W WO2021102341A2 WO 2021102341 A2 WO2021102341 A2 WO 2021102341A2 US 2020061627 W US2020061627 W US 2020061627W WO 2021102341 A2 WO2021102341 A2 WO 2021102341A2
Authority
WO
WIPO (PCT)
Prior art keywords
modified
oligomeric compound
certain embodiments
modified oligonucleotide
seq
Prior art date
Application number
PCT/US2020/061627
Other languages
English (en)
Other versions
WO2021102341A3 (fr
Inventor
Susan M. Freier
Original Assignee
Ionis Pharmaceuticals, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ionis Pharmaceuticals, Inc. filed Critical Ionis Pharmaceuticals, Inc.
Publication of WO2021102341A2 publication Critical patent/WO2021102341A2/fr
Publication of WO2021102341A3 publication Critical patent/WO2021102341A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A61P7/06—Antianaemics
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • C07H21/02—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with ribosyl as saccharide radical

Definitions

  • oligomeric compounds, methods, and pharmaceutical compositions for modulating the amount of b-globin in a cell or subject.
  • oligomeric compounds, methods, and pharmaceutical compositions modulate splicing of HBB RNA in a cell or subject.
  • oligomeric compounds, methods, and pharmaceutical compositions increase the amount of wild type HBB RNA in a cell or subject.
  • oligomeric compounds, methods, and pharmaceutical compositions increase the amount of hemoglobin in a cell or subject.
  • Such compounds and pharmaceutical compositions are useful to ameliorate at least one symptom or hallmark of b-thalassemia. Such symptoms and hallmarks include a low hemoglobin level, erythrocyte deformities, fatigue, weakness, pale skin or jaundice, abdominal swelling, and decreased longevity.
  • the human gene HBB encodes human b-globin.
  • Human b-globin is also referred to as HBB, b-globin chain, beta globin, hemoglobin beta, and hemoglobin subunit beta.
  • Human hemoglobin is a tetramer of two a- globin chains and two b-globin chains, and is required in red blood cells to transport oxygen and other gases throughout the body. Hemoglobin also plays a role in iron metabolism. A hemoglobin deficiency resulting from a lack of adequate amounts of b-globin leads to insufficient oxygen transport and iron homeostasis.
  • a mutation in HBB known as IVS-2-745 creates an aberrant 5' splice site at nucleotide position 745 of intron 2 of HBB pre-mRNA, and activates a common cryptic 3' splice site at nucleotide position 579 within the same intron.
  • the splicing machinery recognizes these splice sites; as a result, a 165- nucleobase fragment of the intronic sequence between the newly activated splice sites is incorrectly retained in a mutant HBB RNA.
  • the retained 165-micleobase fragment carries an in-frame stop codon that prevents proper translation of the mutant HBB RNA and production of a functional b-globin protein.
  • compounds, methods, and pharmaceutical compositions for modulating the splicing of HBB RNA in a cell or subject and in certain embodiments, increasing b-globin in a cell or subject.
  • compounds useful for modulating the splicing of HBB RNA are oligomeric compounds or modified oligonucleotides.
  • oligomeric compounds comprise a modified oligonucleotide.
  • oligomeric compounds or modified oligonucleotides provide for splicing of HBB pre-mRNA that results in wildtype HBB mRNA.
  • oligomeric compounds or modified oligonucleotides described herein increase an amount of wildtype HBB mRNA in a cell or subject.
  • symptoms and hallmarks include low hemoglobin level, erythrocyte deformities, fatigue, weakness, pale skin or jaundice, abdominal swelling, decreased longevity, and dark urine.
  • amelioration of these symptoms results in improved energy levels and increased longevity.
  • methods provided herein result in rebalancing the stoichiometry of a-globin and b-globin chains, reducing toxic a-chain aggregates, and correcting erythrocyte deformities.
  • 2’-deoxyribonucleoside means a nucleoside comprising a 2’-H(H) deoxyribosyl sugar moiety, as found in naturally occurring deoxyribonucleic acids (DNA).
  • a 2’- deoxyribonucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil).
  • a 2’-deoxyribonucleoside may comprise hypoxanthine.
  • a 2’- deoxyribonucleoside is in the b-D configuration, and is referred to as a nucleoside comprising a b -D-2’- deoxyribose sugar moiety.
  • 2 ’-substituted nucleoside means a nucleoside comprising a 2 ’-substituted sugar moiety.
  • 2 ’-substituted in reference to a sugar moiety means a sugar moiety comprising at least one 2'-substituent group other than H or OH.
  • 5-methyl cytosine means a cytosine modified with a methyl group attached to the 5-position.
  • a 5-methyl cytosine is a modified nucleobase.
  • administering means providing a pharmaceutical agent to a subject.
  • antisense activity means any detectable and/or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid.
  • antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound.
  • antisense compound means an oligomeric compound capable of achieving at least one antisense activity.
  • amelioration in reference to a treatment means improvement in at least one symptom relative to the same symptom in the absence of the treatment.
  • amelioration is the reduction in the severity or frequency of a symptom or the delayed onset or slowing of progression in the severity or frequency of a symptom.
  • the symptom is a lack of subcutaneous fat, weight loss, hair loss, hypertension, metabolic syndrome, progressive cardiovascular disease resembling atherosclerosis, congestive heart failure, or premature death.
  • amelioration of these symptoms results in a reduction of weight loss and increased survival.
  • bicyclic nucleoside or “BNA” means a nucleoside comprising a bicyclic sugar moiety.
  • bicyclic sugar or “bicyclic sugar moiety” means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure.
  • the first ring of the bicyclic sugar moiety is a furanosyl moiety.
  • the bicyclic sugar moiety does not comprise a furanosyl moiety.
  • cleavable moiety means a bond or group of atoms that is cleaved under physiological conditions, for example, inside a cell or a subject.
  • oligonucleotide in reference to an oligonucleotide means that at least 70% of the nucleobases of the oligonucleotide or one or more regions thereof and the nucleobases of another nucleic acid or one or more regions thereof are capable of hydrogen bonding with one another when the nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions.
  • complementary nucleobases means nucleobases that are capable of forming hydrogen bonds with one another.
  • Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5 -methyl cytosine (mC) and guanine (G).
  • Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated.
  • oligonucleotides are complementary to another oligonucleotide or nucleic acid at each nucleoside of the oligonucleotide.
  • conjugate group means a group of atoms that is directly attached to an oligonucleotide.
  • Conjugate groups include a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.
  • conjugate linker means a single bond or group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.
  • a conjugate linker comprises a cleavable moiety.
  • conjugate moiety means a group of atoms that is attached to an oligonucleotide via a conjugate linker.
  • oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or intemucleoside linkages that are immediately adjacent to each other.
  • contiguous nucleobases means nucleobases that are immediately adjacent to each other in a sequence.
  • chirally enriched population means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers.
  • the molecules are oligomeric compounds disclosed herein.
  • the oligomeric compounds are antisense compounds.
  • the molecules are modified oligonucleotides.
  • the molecules are oligomeric compounds comprising modified oligonucleotides.
  • gapmer means a modified oligonucleotide comprising an internal region having a plurality of nucleosides that support RNase H cleavage positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions.
  • the internal region may be referred to as the “gap” and the external regions may be referred to as the “wings.”
  • wings refers to a sugar motif. Unless otherwise indicated, the sugar moieties of the nucleosides of the gap of a gapmer are unmodified 2’-deoxyribosyl.
  • MOE gapmer indicates a gapmer having a sugar motif of 2’-MOE nucleosides in both wings and a gap of 2’-deoxynucleosides.
  • a MOE gapmer may comprise one or more modified intemucleoside linkages and/or modified nucleobases and such modifications do not necessarily follow the gapmer pattern of the sugar modifications.
  • hybridization means the pairing or annealing of complementary oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.
  • increasing the amount or activity refers to more transcriptional expression or activity relative to the transcriptional expression or activity in an untreated or control sample.
  • decreasing the amount or activity refers to less transcriptional expression or activity relative to the transcriptional expression or activity in an untreated or control sample.
  • intemucleoside linkage is the covalent linkage between adjacent nucleosides in an oligonucleotide.
  • modified intemucleoside linkage means any intemucleoside linkage other than a phosphodiester intemucleoside linkage.
  • Phosphorothioate linkage is a modified intemucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester intemucleoside linkage is replaced with a sulfur atom.
  • intemucleoside linkage is the covalent linkage between adjacent nucleosides in an oligonucleotide.
  • modified intemucleoside linkage means any intemucleoside linkage other than a phosphodiester intemucleoside linkage.
  • Phosphorothioate intemucleoside linkage is a modified intemucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester intemucleoside linkage is replaced with a sulfur atom.
  • linker-nucleoside means a nucleoside that links, either directly or indirectly, an oligonucleotide to a conjugate moiety.
  • Linker-nucleosides are located within the conjugate linker of an oligomeric compound. Linker-nucleosides are not considered part of the oligonucleotide portion of an oligomeric compound even if they are contiguous with the oligonucleotide.
  • linker region in reference to a conjugate moiety refers that part of a conjugate linker that is not a cleavable moiety.
  • non-bicyclic modified sugar moiety means a modified sugar moiety that comprises a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring.
  • mismatch or “non-complementary” means a nucleobase of a first oligonucleotide that is not complementary with the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotide are aligned.
  • MOE means methoxyethyl.
  • 2’-MOE 2 -b-0-MOE, or “2’-MOE modified sugar” means a 2’-0CH 2 CH 2 0CH 3 group in place of the 2’-OH group of a ribosyl sugar moiety.
  • 2’-MOE nucleoside means a nucleoside comprising a 2’-MOE modified sugar.
  • motif means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or intemucleoside linkages, in an oligonucleotide.
  • nucleobase means an unmodified nucleobase or a modified nucleobase.
  • an “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), and guanine (G).
  • a “modified nucleobase” is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one unmodified nucleobase.
  • a “5-methyl cytosine” is a modified nucleobase.
  • a universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases.
  • nucleobase sequence means the order of contiguous nucleobases in a nucleic acid or oligonucleotide independent of any sugar or intemucleoside linkage modification.
  • nucleoside means a compound comprising a nucleobase and a sugar moiety.
  • the nucleobase and sugar moiety are each, independently, unmodified or modified.
  • modified nucleoside means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety.
  • Modified nucleosides include abasic nucleosides, which lack a nucleobase.
  • Linked nucleosides are nucleosides that are connected in a contiguous sequence (i.e., no additional nucleosides are presented between those that are linked).
  • oligomeric compound means an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group.
  • An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound or may be unpaired.
  • a “singled-stranded oligomeric compound” is an unpaired oligomeric compound.
  • oligomeric duplex means a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex may be referred to as a “duplexed oligomeric compound.”
  • oligonucleotide means a strand of linked nucleosides connected via intemucleoside linkages, wherein each nucleoside and intemucleoside linkage may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8-50 linked nucleosides.
  • modified oligonucleotide means an oligonucleotide, wherein at least one nucleoside or intemucleoside linkage is modified.
  • unmodified oligonucleotide means an oligonucleotide that does not comprise any nucleoside modifications or intemucleoside modifications.
  • pharmaceutically acceptable carrier or diluent means any substance suitable for use in administering to a subject. Certain such carriers enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspension and lozenges for the oral ingestion by a subject.
  • a pharmaceutically acceptable carrier or diluent is sterile water, distilled water for injection, sterile saline, or sterile buffer solution.
  • pharmaceutically acceptable salts means physiologically and pharmaceutically acceptable salts of compounds. Pharmaceutically acceptable salts retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.
  • a pharmaceutical composition means a mixture of substances suitable for administering to a subject.
  • a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution.
  • a pharmaceutical composition shows activity in free uptake assay in certain cell lines.
  • phosphorus moiety means a group of atoms comprising a phosphorus atom.
  • a phosphorus moiety comprises a mono-, di-, or tri-phosphate, or phosphorothioate.
  • prodrug means a therapeutic agent in a form outside the body that is converted to a different form within a subject or cells thereof.
  • conversion of a prodrug within the subject is facilitated by the action of an enzyme (e.g., endogenous or viral enzyme) or chemicals present in cells or tissues and/or by physiologic conditions.
  • an enzyme e.g., endogenous or viral enzyme
  • oligonucleotide that at least partially hybridizes to itself.
  • stereorandom chiral center in the context of a population of molecules of identical molecular formula means a chiral center having a random stereochemical configuration.
  • the number of molecules having the (5) configuration of the stereorandom chiral center may be but is not necessarily the same as the number of molecules having the (R) configuration of the stereorandom chiral center.
  • the stereochemical configuration of a chiral center is considered random when it is the results of a synthetic method that is not designed to control the stereochemical configuration.
  • a stereorandom chiral center is a stereorandom phosphorothioate intemucleoside linkage.
  • sugar moiety means an unmodified sugar moiety or a modified sugar moiety.
  • unmodified sugar moiety means a 2’-OH(H) ribosyl moiety, as found in RNA (an “unmodified RNA sugar moiety”), or a 2’-H(H) deoxyribosyl moiety, as found in DNA (an “unmodified DNA sugar moiety”).
  • Unmodified sugar moieties have one hydrogen at each of the G, 3’, and 4’ positions, an oxygen at the 3’ position, and two hydrogens at the 5’ position.
  • modified sugar moiety or “modified sugar” means a modified furanosyl sugar moiety or a sugar surrogate.
  • subject means a human or non-human animal. In certain embodiments, the subject is a human.
  • sugar surrogate means a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an intemucleoside linkage, conjugate group, or terminal group in an oligonucleotide.
  • Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or target nucleic acids.
  • symptom or hallmark means any physical feature or test result that indicates the existence or extent of a disease or disorder.
  • a symptom is apparent to a subject or to a medical professional examining or testing said subject.
  • a hallmark is apparent upon invasive diagnostic testing, including, but not limited to, post-mortem tests.
  • target nucleic acid and “target RNA” mean a nucleic acid that an antisense compound is designed to affect.
  • An antisense compound hybridizes to the target nucleic acid, but may comprise one or more mismatches thereto.
  • target region means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.
  • terminal group means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.
  • terapéuticaally effective amount means an amount of a pharmaceutical agent that provides a therapeutic benefit to a subject.
  • a therapeutically effective amount improves a symptom of a disease.
  • Embodiment 1 An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to an equal length portion of an HBB nucleic acid, and wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar and a modified intemucleoside linkage.
  • An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOS: 12-163.
  • An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising a portion of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 contiguous nucleobases, wherein the portion is complementary to an equal length portion of nucleobases 1650-2055 of SEQ ID NO: 1 or SEQ ID NO: 2.
  • Embodiment 4 An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising a portion of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 contiguous nucleobases, wherein the portion is complementary to: an equal length portion of nucleobases 1650-1693 of SEQ ID NO: 1 or SEQ ID NO: 2; an equal length portion of nucleobases 1739-1858 of SEQ ID NO: 1 or SEQ ID NO: 2; an equal length portion of nucleobases 1864-1938 of SEQ ID NO: 1 or SEQ ID NO: 2; or an equal length portion of nucleobases 1953-2055 of SEQ ID NO: 1 or SEQ ID NO: 2.
  • Embodiment 5 The oligomeric compound of 4, wherein the nucleobase sequence is selected from: SEQ ID NOS: 14-19; SEQ ID NOS: 20-73; SEQ ID NOS: 79-89, and 92-104; and SEQ ID NOS: 121-163.
  • Embodiment 6. The oligomeric compound of any of embodiments 1-5, wherein the modified oligonucleotide has a nucleobase sequence that is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to a nucleobase sequence selected from SEQ ID NOS: 1-4, when measured across the entire nucleobase sequence of the modified oligonucleotide.
  • Embodiment 7 The oligomeric compound of any of embodiments 1-6, wherein the modified oligonucleotide comprises at least one modified nucleoside.
  • Embodiment 8 The oligomeric compound of embodiment 7, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety.
  • Embodiment 9 The oligomeric compound of embodiment 8, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety.
  • Embodiment 10 The oligomeric compound of embodiment 9, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety having a 2’ -4’ bridge, wherein the 2 ’-4’ bridge is selected from -O-CH2-; and -O-CE ⁇ CEE)-.
  • Embodiment 11 The oligomeric compound of any of embodiments 7-10, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a non-bicyclic modified sugar moiety.
  • Embodiment 12. The oligomeric compound of embodiment 11, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a non-bicyclic modified sugar moiety comprising a 2’-MOE modified sugar or 2’-OMe modified sugar.
  • Embodiment 13 The oligomeric compound of any of embodiments 7-12, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate.
  • Embodiment 14 The oligomeric compound of embodiment 13, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate selected from morpholino and PNA.
  • Embodiment 15 The oligomeric compound of any of embodiments 7-12, wherein each nucleoside of the modified oligonucleotide comprises the modified sugar moiety.
  • Embodiment 16 The oligomeric compound of any of embodiments 1-15, wherein the modified oligonucleotide comprises at least one modified intemucleoside linkage.
  • Embodiment 17 The oligomeric compound of embodiment 16, wherein each intemucleoside linkage of the modified oligonucleotide is a modified intemucleoside linkage.
  • Embodiment 18 The oligomeric compound of embodiment 16 or 17, wherein at least one intemucleoside linkage is a phosphorothioate intemucleoside linkage.
  • Embodiment 19 The oligomeric compound of embodiment 16 or 18, wherein the modified oligonucleotide comprises at least one phosphodiester intemucleoside linkage.
  • Embodiment 20 The oligomeric compound of any of embodiments 16, 18 or 19, wherein each intemucleoside linkage is either a phosphodiester intemucleoside linkage or a phosphorothioate intemucleoside linkage.
  • Embodiment 21 The oligomeric compound of any of embodiments 1-20, wherein the modified oligonucleotide comprises at least one modified nucleobase.
  • Embodiment 22 The oligomeric compound of embodiment 21, wherein the modified nucleobase is a 5- methyl cytosine.
  • Embodiment 23 The oligomeric compound of any of embodiments 1-22, wherein the modified oligonucleotide consists of 12-30, 12-22, 12-20, 14-20, 15-25, 16-20, 18-22 or 18-20 linked nucleosides.
  • Embodiment 24 The oligomeric compound of any of embodiments 1-23, wherein the modified oligonucleotide consists of 18 linked nucleosides.
  • Embodiment 25 The oligomeric compound of any of embodiments 1-24 consisting of the modified oligonucleotide.
  • Embodiment 26 The oligomeric compound of any of embodiments 1-24 comprising a conjugate group comprising a conjugate moiety and a conjugate linker.
  • Embodiment 27 The oligomeric compound of embodiment 26, wherein the conjugate group comprises a GalNAc cluster comprising 1-3 GalNAc ligands.
  • Embodiment 28 The oligomeric compound of embodiment 26 or 27, wherein the conjugate linker consists of a single bond.
  • Embodiment 29 The oligomeric compound of embodiment 26 or 27, wherein the conjugate linker is cleavable.
  • Embodiment 30 The oligomeric compound of embodiment 29, wherein the conjugate linker comprises 1-3 linker-nucleosides .
  • Embodiment 31 The oligomeric compound of any of embodiments 26-30, wherein the conjugate group is attached to the modified oligonucleotide at the 5 ’-end of the modified oligonucleotide.
  • Embodiment 32 The oligomeric compound of any of embodiments 26-30, wherein the conjugate group is attached to the modified oligonucleotide at the 3 ’-end of the modified oligonucleotide.
  • Embodiment 33 The oligomeric compound of any of embodiments 1-32 comprising a terminal group.
  • Embodiment 34 The oligomeric compound of any of embodiments 1-33 wherein the oligomeric compound is a singled-stranded oligomeric compound.
  • Embodiment 35 The oligomeric compound of any of embodiments 1-29 or 31-33, wherein the oligomeric compound does not comprise linker-nucleosides.
  • Embodiment 36 An oligomeric duplex comprising an oligomeric compound of any of embodiments 1-33 or 35.
  • Embodiment 37 An antisense compound comprising or consisting of an oligomeric compound of any of embodiments 1-35 or an oligomeric duplex of embodiment 36.
  • Embodiment 38 A pharmaceutical composition comprising an oligomeric compound of any of embodiments 1-35 or an oligomeric duplex of embodiment 36 and a pharmaceutically acceptable carrier or diluent.
  • Embodiment 39 A modified oligonucleotide according to the following formula:
  • Embodiment 40 A modified oligonucleotide according to the following structure:
  • Embodiment 41 A modified oligonucleotide according to the following structure:
  • Embodiment 42 The modified oligonucleotide of any one of embodiments 39-41, which is a sodium salt of the formula.
  • Embodiment 43 A modified oligonucleotide according to the following formula:
  • Embodiment 44 A modified oligonucleotide according to the following formula:
  • Embodiment 45 A modified oligonucleotide according to the following formula:
  • Embodiment 46 A chirally enriched population of the modified oligonucleotide of any of embodiments 39- 45, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate intemucleoside linkage having a particular stereochemical configuration.
  • Embodiment 47 The chirally enriched population of embodiment 46, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate intemucleoside linkage having the (Sp) configuration.
  • Embodiment 48 The chirally enriched population of embodiment 46 or 47, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate intemucleoside linkage having the (7/p) configuration.
  • Embodiment 49 The chirally enriched population of embodiment 46, wherein the population is enriched for modified oligonucleotides having a particular, independently selected stereochemical configuration at each phosphorothioate intemucleoside linkage
  • Embodiment 50 The chirally enriched population of embodiment 49, wherein the population is enriched for modified oligonucleotides having the (.S'p) configuration at each phosphorothioate intemucleoside linkage.
  • Embodiment 51 The chirally enriched population of embodiment 49, wherein the population is enriched for modified oligonucleotides having the (7y) configuration at each phosphorothioate intemucleoside linkage.
  • Embodiment 52 The chirally enriched population of embodiment 49, wherein the population is enriched for modified oligonucleotides having the (7y) configuration at each phosphorothioate intemucleoside linkage.
  • Embodiment 53 A population of modified oligonucleotides of any of embodiments 39-45, wherein all of the phosphorothioate intemucleoside linkages of the modified oligonucleotide are stereorandom.
  • Embodiment 54 A pharmaceutical composition comprising the modified oligonucleotide of any of embodiments 39-45 and a pharmaceutically acceptable diluent or carrier.
  • Embodiment 55 The pharmaceutical composition of embodiment 54, wherein the pharmaceutically acceptable diluent is phosphate buffered saline (PBS).
  • PBS phosphate buffered saline
  • Embodiment 56 The pharmaceutical composition of embodiment 55, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and PBS.
  • Embodiment 57 A method comprising contacting a cell with the oligomeric compound of any one of embodiments 1-35, the oligomeric duplex of embodiment 36, or the modified oligonucleotide of any one of embodiments 39-45.
  • Embodiment 58 The method of embodiment 57, wherein the cell is a human cell comprising an HBB gene, and wherein the HBB gene comprises a guanine at nucleotide position 745 of intron 2.
  • Embodiment 59 The method of embodiment 58, wherein an amount of mutant HBB RNA is reduced.
  • Embodiment 60 The method of embodiment 58 or 59, wherein an amount of wildtype HBB mRNA is increased.
  • Embodiment 63 Embodiment 63.
  • oligomeric compounds comprising oligonucleotides, which consist of linked nucleosides.
  • Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or may be modified oligonucleotides.
  • Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA. That is, modified oligonucleotides comprise at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nucleobase) and/or at least one modified intemucleoside linkage.
  • Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modifed sugar moiety and a modified nucleobase.
  • modified sugar moieties are non-bicyclic modified sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.
  • modified sugar moieties are non-bicyclic modified sugar moieties comprising a furanosyl ring with one or more substituent groups none of which bridges two atoms of the furanosyl ring to form a bicyclic structure.
  • Such non bridging substituents may be at any position of the furanosyl, including but not limited to substituents at the 2’, 4’, and/or 5’ positions.
  • one or more non-bridging substituent of non-bicyclic modified sugar moieties is branched.
  • 2’- substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 2’-F, 2'- OCH3 (“OMe” or “O-methyl”), and 2'-0(CH 2 ) 2 0CH 3 (“MOE”).
  • these 2'-substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl.
  • Examples of 4 ’-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et ah, WO 2015/106128.
  • Examples of 5 ’-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 5 ’-methyl (R or S), 5'- vinyl, and 5 ’-methoxy.
  • non-bicyclic modified sugar moieties comprise more than one non-bridging sugar substituent, for example, 2'-F-5'-methyl sugar moieties and the modified sugar moieties and modified nucleosides described in Migawa et ak, WO 2008/101157 and Rajeev et ah,
  • a 2 ’-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2 ’-substituent group selected from: F, NEE, N3, OCF3 , OCH3,
  • a 2 ’-substituted nucleoside non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2 ’-substituent group selected from: F, OCF3 , OCH3,
  • a 2 ’-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2 ’-substituent group selected from: F, OCH3, and OCEECEEOCH3.
  • Certain modifed sugar moieties comprise a substituent that bridges two atoms of the furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety.
  • the bicyclic sugar moiety comprises a bridge between the 4' and the 2' furanose ring atoms.
  • Examples of such 4’ to 2’ bridging sugar substituents include but are not limited to: 4'-CH 2 -2', 4'-(CH 2 ) 2 -2', 4'-(CH 2 ) 3 -2', 4'-CH 2 -0-2' (“ENA”), 4'-CH 2 -S-2', 4'-(CH 2 ) 2 -0-2' (“ENA”), 4'-CH(CH 3 )-0-2' (referred to as “constrained ethyl” or “cEt”), 4’-CH 2 - O-CEb-2’, 4’-CH 2 -N(R)-2’, 4'-CH(CH 2 0CH 3 )-0-2' (“constrained MOE” or “cMOE”) and analogs thereof (see, e.g., Seth et ak, U.S.
  • such 4’ to 2’ bridges independently comprise from 1 to 4 linked groups independently selected from: -
  • bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration.
  • an UNA nucleoside (described herein) may be in the a-U configuration or in the b-D configuration.
  • general descriptions of bicyclic nucleosides include both isomeric configurations. When the positions of specific bicyclic nucleosides (e.g., LNA or cEt) are identified in exemplified embodiments herein, they are in the b-D configuration, unless otherwise specified.
  • modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5 ’-substituted and 4 ’-2’ bridged sugars).
  • modified sugar moieties are sugar surrogates.
  • the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom.
  • such modified sugar moieties also comprise bridging and/or non-bridging substituents as described herein.
  • certain sugar surrogates comprise a 4’-sulfur atom and a substitution at the 2'- position (see, e.g., Bhat et al., U.S. 7,875,733 and Bhat et al., U.S. 7,' 939,677) and/or the 5’ position.
  • sugar surrogates comprise rings having other than 5 atoms.
  • a sugar surrogate comprises a six-membered tetrahydropyran (“THP”).
  • THP tetrahydropyran
  • Such tetrahydropyrans may be further modified or substituted.
  • Nucleosides comprising such modified tetrahydropyrans include but are not limited to hexitol nucleic acid (“HNA”), anitol nucleic acid (“ANA”), manitol nucleic acid (“MNA”) (see, e.g., Leumann, CJ. Bioorg. &Med. Chem. 2002, 10, 841-854), fluoro HNA:
  • F-HNA see e.g., Swayze et al., U.S. 8,088,904; Swayze et al., U.S. 8,440,803; Swayze et al., U.S. 8,796,437; and Swayze et al., U.S. 9,005,906;
  • F-HNA can also be referred to as a F-THP or 3'-fluoro tetrahydropyran), and nucleosides comprising additional modified THP compounds having the formula: wherein, independently, for each of said modified THP nucleoside:
  • Bx is a nucleobase moiety
  • T3 and T4 are each, independently, an intemucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide or one of T3 and T4 is an intemucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5' or 3'-terminal group; qi, q 2 .
  • modified THP nucleosides are provided wherein qi, q2, q3, q4, qs, qe and q 7 are each H. In certain embodiments, at least one of qi, q2, q3, q4, qs, qe and q 7 is other than H. In certain embodiments, at least one of qi, q2, q3, q4, qs, qe and q 7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of Ri and R2 is F. In certain embodiments, Ri is F and R2 is H, in certain embodiments, Ri is methoxy and R2 is H, and in certain embodiments, Ri is methoxyethoxy and R2 is
  • sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom.
  • nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., U.S. 5,698,685; Summerton et al., U.S. 5,166,315; Summerton et al., U.S. 5,185,444; and Summerton et al., U.S. 5,034,506).
  • morpholino means a sugar surrogate having the following structure:
  • morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure.
  • sugar surrogates are referred to herein as “modifed morpholinos.”
  • sugar surrogates comprise acyclic moieites.
  • nucleosides and oligonucleotides comprising such acyclic sugar surrogates include but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., WO2011/133876.
  • modified oligonucleotides comprise one or more nucleosides comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside that does not comprise a nucleobase, referred to as an abasic nucleoside.
  • modified nucleobases are selected from: 5-substituted pyrimidines, 6- azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and 0-6 substituted purines.
  • modified nucleobases are selected from: 2-aminopropyladenine, 5 -hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N- methyladenine, 2-propyladenine , 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (-CoC-CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4- thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-
  • nucleobases include tricyclic pyrimidines, such as l,3-diazaphenoxazine-2-one, l,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-l,3-diazaphenoxazine-2- one (G-clamp).
  • Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2- pyridone.
  • Further nucleobases include those disclosed in Merigan et al., U.S.
  • nucleosides of modified oligonucleotides may be linked together using any intemucleoside linkage.
  • the two main classes of intemucleoside linking groups are defined by the presence or absence of a phosphorus atom.
  • Modified intemucleoside linkages compared to naturally occurring phosphodiester linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide.
  • intemucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Methods of preparation of phosphorous-containing and non-phosphorous-containing intemucleoside linkages are well known to those skilled in the art.
  • Representative intemucleoside linkages having a chiral center include but are not limited to alkylphosphonates and phosphorothioates.
  • Modified oligonucleotides comprising intemucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom intemucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate linkages in particular stereochemical configurations.
  • populations of modified oligonucleotides comprise phosphorothioate intemucleoside linkages wherein all of the phosphorothioate intemucleoside linkages are stereorandom.
  • modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. Nonetheless, as is well understood by those of skill in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration.
  • populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate intemucleoside linkages in a particular, independently selected stereochemical configuration.
  • the particular configuration of the particular phosphorothioate linkage is present in at least 65% of the molecules in the population.
  • the particular configuration of the particular phosphorothioate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 99% of the molecules in the population.
  • modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et ak, JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO 2017/015555.
  • a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (rip) configuration.
  • a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (/Zp) configuration.
  • modified oligonucleotides comprising (/Zp) and/or (.S'p) phosphorothioates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase:
  • chiral intemucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.
  • Further neutral intemucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research ; Y.S. Sanghvi and P.D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral intemucleoside linkages include nonionic linkages comprising mixed N, O, S and CEE component parts.
  • modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified intemucleoside linkage. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and/or intemucleoside linkages of a modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleobases, and intemucleoside linkages are each independent of one another.
  • a modified oligonucleotide may be described by its sugar motif, nucleobase motif and/or intemucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases).
  • oligonucleotides comprise one or more type of modified sugar and/or unmodified sugar moiety arranged along the oligonucleotide or region thereof in a defined pattern or sugar motif.
  • sugar motifs include but are not limited to any of the sugar modifications discussed herein.
  • modified oligonucleotides comprise or consist of a region having a gapmer motif, which is defined by two external regions or “wings” and a central or internal region or “gap.”
  • the three regions of a gapmer motif (the 5 ’-wing, the gap, and the 3 ’-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap.
  • the sugar moieties of the nucleosides of each wing that are closest to the gap differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap (i.e., the wing/gap junction).
  • the sugar moieties within the gap are the same as one another.
  • the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap.
  • the sugar motifs of the two wings are the same as one another (symmetric gapmer).
  • the sugar motif of the 5'-wing differs from the sugar motif of the 3'-wing (asymmetric gapmer).
  • the wings of a gapmer comprise 1-5 nucleosides.
  • each nucleoside of each wing of a gapmer is a modified nucleoside.
  • at least one nucleoside of each wing of a gapmer is a modified nucleoside.
  • at least two nucleosides of each wing of a gapmer are modified nucleosides.
  • at least three nucleosides of each wing of a gapmer are modified nucleosides.
  • at least four nucleosides of each wing of a gapmer are modified nucleosides.
  • the gap of a gapmer comprises 7-12 nucleosides. In certain embodiments, each nucleoside of the gap of a gapmer is an unmodified 2’-deoxy nucleoside.
  • the gapmer is a deoxy gapmer.
  • the nucleosides on the gap side of each wing/gap junction are unmodified 2’-deoxy nucleosides and the nucleosides on the wing sides of each wing/gap junction are modified nucleosides.
  • each nucleoside of the gap is an unmodified 2 ’-deoxy nucleoside.
  • each nucleoside of each wing of a gapmer is a modified nucleoside.
  • modified oligonucleotides comprise or consist of a region having a fully modified sugar motif.
  • each nucleoside of the fully modified region of the modified oligonucleotide comprises a modified sugar moiety.
  • each nucleoside of the entire modified oligonucleotide comprises a modified sugar moiety.
  • modified oligonucleotides comprise or consist of a region having a fully modified sugar motif, wherein each nucleoside within the fully modified region comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif.
  • a fully modified oligonucleotide is a uniformly modified oligonucleotide.
  • each nucleoside of a uniformly modified comprises the same 2 ’-modification.
  • the lengths (number of nucleosides) of the three regions of a gapmer may be provided using the notation [# of nucleosides in the 5’-wing] - [# of nucleosides in the gap] - [# of nucleosides in the 3’- wing].
  • a 5-10-5 gapmer consists of 5 linked nucleosides in each wing and 10 linked nucleosides in the gap.
  • that modification is the modification in each sugar moiety of each wing and the gap nucleosides comprise unmodified deoxynucleoside sugars.
  • a 5-10-5 MOE gapmer consists of 5 linked MOE modified nucleosides in the 5’-wing, 10 linked deoxynucleosides in the gap, and 5 linked MOE nucleosides in the 3’-wing.
  • modified oligonucleotides are 5-10-5 MOE gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 BNA gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 cEt gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 LNA gapmers.
  • modified oligonucleotides comprise or consist of a region having a fully modified sugar motif.
  • each nucleoside of the fully modified region of the modified oligonucleotide comprises a modified sugar moiety.
  • modified oligonucleotides comprise or consist of a region having a fully modified sugar motif, wherein each nucleoside within the fully modified region comprises the same modified sugar moiety (uniformly modified sugar motif).
  • the uniformly modified sugar motif is 7 to 20 nucleosides in length.
  • each nucleoside of the uniformly modified sugar motif is a 2 ’-substituted nucleoside, a sugar surrogate, or a bicyclic nucleoside.
  • each nucleoside of the uniformly modified sugar motif comprises either a 2’-0CH 2 CH 2 0CH 3 group or a 2’-OCH 3 group.
  • modified oligonucleotides having at least one fully modified sugar motif may also have at least 1, at least 2, at least 3, or at least 42’-deoxyribonucleosides.
  • each nucleoside of the entire modified oligonucleotide comprises a modified sugar moiety (fully modified oligonucleotide).
  • a fully modified oligonucleotide comprises different 2 ’-modifications.
  • each nucleoside of a fully modified oligonucleotide is a 2 ’-substituted nucleoside, a sugar surrogate, or a bicyclic nucleoside.
  • each nucleoside of a fully modified oligonucleotide comprises either a 2’-0CH2CH20CH3 group and at least one 2’-OCH 3 group.
  • each nucleoside of a fully modified oligonucleotide comprises the same 2’- modification (uniformly modified oligonucleotide).
  • each nucleoside of a uniformly modified oligonucleotide is a 2 ’-substituted nucleoside, a sugar surrogate, or a bicyclic nucleoside.
  • each nucleoside of a uniformly modified oligonucleotide comprises either a 2’- OCH2CH2OCH3 group or a 2’-OCH3 group.
  • modified oligonucleotides comprise at least 12, at last 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 nucleosides comprising a modified sugar moiety.
  • each nucleoside of a modified oligonucleotide is a 2 ’-substituted nucleoside, a sugar surrogate, a bicyclic nucleoside, or a p-D-2’-deoxyribonucleoside.
  • each nucleoside of a modified oligonucleotide comprises a 2’-0CH2CH20CH3 group, a 2’- H(H) deoxyribosyl sugar moiety, or a cEt modified sugar.
  • oligonucleotides comprise modified and/or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif.
  • each nucleobase is modified. In certain embodiments, none of the nucleobases are modified.
  • each purine or each pyrimidine is modified.
  • each adenine is modified.
  • each guanine is modified.
  • each thymine is modified.
  • each uracil is modified.
  • each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methyl cytosines.
  • modified oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3 ’-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 3 ’-end of the oligonucleotide. In certain embodiments, the block is at the 5’- end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 5 ’-end of the oligonucleotide.
  • oligonucleotides having a gapmer motif comprise a nucleoside comprising a modified nucleobase.
  • one nucleoside comprising a modified nucleobase is in the central gap of an oligonucleotide having a gapmer motif.
  • the sugar moiety of said nucleoside is a 2’-deoxyribosyl moiety.
  • the modified nucleobase is selected from: a 2-thiopyrimidine and a 5-propynepyrimidine.
  • the modified nucleobase is a hypoxanthine.
  • oligonucleotides comprise modified and/or unmodified intemucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif.
  • each intemucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate intemucleoside linkage and phosphodiester intemucleoside linkage.
  • each phosphorothioate intemucleoside linkage is independently selected from a stereorandom phosphorothioate, a (.S'p) phosphorothioate, and a (7/p) phosphorothioate.
  • the sugar motif of a modified oligonucleotide is a gapmer and the intemucleoside linkages within the gap are all modified.
  • the intemucleoside linkages in the wings are unmodified phosphodiester intemucleoside linkages.
  • the terminal intemucleoside linkages are modified.
  • the sugar motif of a modified oligonucleotide is a gapmer, and the intemucleoside linkage motif comprises at least one phosphodiester intemucleoside linkage in at least one wing, wherein the at least one phosphodiester linkage is not a terminal intemucleoside linkage, and the remaining intemucleoside linkages are phosphorothioate intemucleoside linkages.
  • all of the phosphorothioate linkages are stereorandom. In certain embodiments, all of the phosphorothioate linkages in the wings are (Sp) phosphorothioates, and the gap comprises at least one Sp, Sp, Rp motif. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising such intemucleoside linkage motifs.
  • oligonucleotide it is possible to increase or decrease the length of an oligonucleotide without eliminating activity.
  • Woolf et al. Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992
  • a series of oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model.
  • Oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the oligonucleotides were able to direct specific cleavage of the target RNA, albeit to a lesser extent than the oligonucleotides that contained no mismatches.
  • target specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with 1 or 3 mismatches.
  • oligonucleotides can have any of a variety of ranges of lengths.
  • oligonucleotides consist of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number nucleosides in the range.
  • X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38,
  • oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15,
  • modified oligonucleotides are characterized by their modification motifs and overall lengths. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each intemucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications.
  • the intemucleoside linkages within the wing regions of a sugar gapmer may be the same or different from one another and may be the same or different from the intemucleoside linkages of the gap region of the sugar motif.
  • sugar gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. Unless otherwise indicated, all modifications are independent of nucleobase sequence.
  • Populations of modified oligonucleotides in which all of the modified oligonucleotides of the population have the same molecular formula can be stereorandom populations or chirally enriched populations. All of the chiral centers of all of the modified oligonucleotides are stereorandom in a stereorandom population. In a chirally enriched population, at least one particular chiral center is not stereorandom in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched for b-D ribosyl sugar moieties, and all of the phosphorothioate intemucleoside linkages are stereorandom.
  • the modified oligonucleotides of a chirally enriched population are enriched for both b-D ribosyl sugar moieties and at least one, particular phosphorothioate intemucleoside linkage in a particular stereochemical configuration.
  • oligonucleotides are further described by their nucleobase sequence.
  • oligonucleotides have a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid.
  • a region of an oligonucleotide has a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid.
  • the nucleobase sequence of a region or entire length of an oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the second oligonucleotide or nucleic acid, such as a target nucleic acid.
  • oligomeric compounds which consist of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and/or terminal groups.
  • Conjugate groups consist of one or more conjugate moieties and a conjugate linker which links the conjugate moiety to the oligonucleotide. Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position. In certain embodiments, conjugate groups are attached to the 2'-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups are attached to the 3’ and/or 5’ end of oligonucleotides.
  • conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups. In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3 ’-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3 ’-end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5 ’-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5 ’-end of oligonucleotides.
  • terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.
  • oligonucleotides are covalently attached to one or more conjugate groups.
  • conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance.
  • conjugate groups impart a new property on the attached oligonucleotide, e.g., fluorophores or reporter groups that enable detection of the oligonucleotide.
  • Certain conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et ah, Proc. Natl. Acad. Sci.
  • cholic acid Manoharan et ah, Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060
  • athioether e.g., hexyl-S-tritylthiol (Manoharan et ah, Ann. NY. Acad. Sci., 1992, 660, 306-309; Manoharan et ah, Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770
  • a thiocholesterol Olet ak, Niicl.
  • a phospholipid e.g., di-hexadecyl-rac -glycerol or triethyl-ammonium l,2-di-0-hexadecyl-rac-glycero-3- H-phosphonate (Manoharan et ak, Tetrahedron Lett., 1995, 36, 3651-3654; Shea et ak, Nucl. Acids Res.,
  • Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.
  • a conjugate moiety comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (.V)-(+)-pranoprofcn carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.
  • an active drug substance for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (.V)-(+)-pranoprofc
  • a conjugate moiety is selected from among: cholesterol, C10-C26 saturated fatty acid, CIO- C26 unsaturated fatty acid, C10-C26 alkyl, triglyceride, tocopherol, or cholic acid. In certain embodiments, a conjugate moiety is C16 alkyl.
  • Conjugate moieties are attached to oligonucleotides through conjugate linkers.
  • the conjugate linker is a single chemical bond (i.e., the conjugate moiety is attached directly to an oligonucleotide through a single bond).
  • the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units.
  • a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group.
  • conjugate linkers including the conjugate linkers described above, are bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate groups to parent compounds, such as the oligonucleotides provided herein.
  • a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to react with particular site on a parent compound and the other is selected to react with a conjugate group. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups.
  • bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.
  • conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane- 1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA).
  • ADO 8-amino-3,6-dioxaoctanoic acid
  • SMCC succinimidyl 4-(N-maleimidomethyl) cyclohexane- 1-carboxylate
  • AHEX or AHA 6-aminohexanoic acid
  • conjugate linkers include but are not limited to substituted or unsubstituted Ci- Cio alkyl, substituted or unsubstituted C2-C10 alkenyl or substituted or unsubstituted C2-C10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.
  • conjugate linkers comprise 1-10 linker-nucleosides. In certain embodiments, conjugate linkers comprise 2-5 linker-nucleosides. In certain embodiments, conjugate linkers comprise exactly 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise the TCA motif.
  • linker-nucleosides are modified nucleosides. In certain embodiments such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, linker-nucleosides are unmodified. In certain embodiments, linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine.
  • a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methyl cytosine, 4-N-benzoyl-5-methyl cytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine. It is typically desirable for linker-nucleosides to be cleaved from the oligomeric compound after it reaches a target tissue. Accordingly, linker-nucleosides are typically linked to one another and to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.
  • linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which an oligomeric compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and/or a specified percent complementarity to a reference nucleic acid and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker-nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for the reference nucleic acid.
  • an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker-nucleosides that are contiguous with the nucleosides of the modified oligonucleotide.
  • the total number of contiguous linked nucleosides in such an oligomeric compound is more than 30.
  • an oligomeric compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in such an oligomeric compound is no more than 30.
  • conjugate linkers comprise no more than 10 linker-nucleosides.
  • conjugate linkers comprise no more than 5 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 2 linker- nucleosides. In certain embodiments, conjugate linkers comprise no more than 1 linker-nucleoside.
  • a conjugate group it is desirable for a conjugate group to be cleaved from the oligonucleotide.
  • oligomeric compounds comprising a particular conjugate moiety are better taken up by a particular cell type, but once the oligomeric compound has been taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligonucleotide.
  • certain conjugate linkers may comprise one or more cleavable moieties.
  • a cleavable moiety is a cleavable bond.
  • a cleavable moiety is a group of atoms comprising at least one cleavable bond.
  • a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds.
  • a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome.
  • a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.
  • a cleavable bond is selected from among: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphodiester linkage between an oligonucleotide and a conjugate moiety or conjugate group.
  • a cleavable moiety comprises or consists of one or more linker-nucleosides.
  • the one or more linker-nucleosides are linked to one another and/or to the remainder of the oligomeric compound through cleavable bonds.
  • such cleavable bonds are unmodified phosphodiester bonds.
  • a cleavable moiety is 2'-deoxy nucleoside that is attached to either the 3' or 5'-terminal nucleoside of an oligonucleotide by a phosphate intemucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate linkage.
  • the cleavable moiety is 2'- deoxyadenosine.
  • oligomeric compounds comprise one or more terminal groups.
  • oligomeric compounds comprise a stabilized 5’-phophate.
  • Stabilized 5 ’-phosphates include, but are not limited to 5’-phosphanates, including, but not limited to 5’-vinylphosphonates.
  • terminal groups comprise one or more abasic nucleosides and/or inverted nucleosides.
  • terminal groups comprise one or more 2’-linked nucleosides. In certain such embodiments, the 2 ’-linked nucleoside is an abasic nucleoside.
  • oligomeric compounds described herein comprise an oligonucleotide, having a nucleobase sequence complementary to that of a target nucleic acid.
  • an oligomeric compound is paired with a second oligomeric compound to form an oligomeric duplex.
  • Such oligomeric duplexes comprise a first oligomeric compound having a region complementary to a target nucleic acid and a second oligomeric compound having a region complementary to the first oligomeric compound.
  • the first oligomeric compound of an oligomeric duplex comprises or consists of (1) a modified or unmodified oligonucleotide and optionally a conjugate group and (2) a second modified or unmodified oligonucleotide and optionally a conjugate group.
  • Either or both oligomeric compounds of an oligomeric duplex may comprise a conjugate group.
  • the oligonucleotides of each oligomeric compound of an oligomeric duplex may include non-complementary overhanging nucleosides.
  • oligomeric compounds and oligomeric duplexes are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity; such oligomeric compounds and oligomeric duplexes are antisense compounds.
  • antisense compounds have antisense activity when they increase the amount or activity of a target nucleic acid by 25% or more in the standard cell assay. In certain embodiments, antisense compounds selectively affect one or more target nucleic acid.
  • Such antisense compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in significant undesired antisense activity.
  • hybridization of an antisense compound to a target nucleic acid results in recruitment of a protein that cleaves the target nucleic acid.
  • certain antisense compounds result in RNase H mediated cleavage of the target nucleic acid.
  • RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex.
  • the DNA in such an RNA:DNA duplex need not be unmodified DNA.
  • described herein are antisense compounds that are sufficiently “DNA-like” to elicit RNase H activity.
  • one or more non-DNA-like nucleoside in the gap of a gapmer is tolerated.
  • an antisense compound or a portion of an antisense compound is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid.
  • RISC RNA-induced silencing complex
  • certain antisense compounds result in cleavage of the target nucleic acid by Argonaute.
  • Antisense compounds that are loaded into RISC are RNAi compounds. RNAi compounds may be double- stranded (siRNA) or single -stranded (ssRNA).
  • hybridization of an antisense compound to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain embodiments, hybridization of the antisense compound to the target nucleic acid results in alteration of splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in alteration of translation of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in an increase in the amount or activity of a target nucleic acid.
  • oligomeric compounds useful for modulating gene expression via antisense mechanisms of action, including antisense mechanisms based on target occupancy.
  • the oligomeric compounds provided herein modulate splicing of a target gene.
  • an antisense compound is complementary to a region of an HBB pre- mRNA.
  • a modified oligonucleotide modulates splicing of a pre-mRNA.
  • a modified oligonucleotide modulates splicing of an HBB pre-mRNA.
  • the HBB pre-mRNA is transcribed from a mutant variant of HBB.
  • the mutant variant comprises an aberrant splice site.
  • the aberrant splice site of the mutant variant comprises a mutation that induces a cryptic 5’ splice site.
  • a modified oligonucleotide increases wildtype HBB mRNA.
  • a modified oligonucleotide increases the production of b-globin protein.
  • hybridization of a compound disclosed herein to an HBB RNA results in modulating the splicing of the HBB RNA.
  • modulating the splicing of HBB RNA alters splicing of an HBB pre-mRNA.
  • the HBB pre-mRNA is encoded by a HBB gene having the IVS-2-745 mutation.
  • modulating the splicing of the HBB pre- mRNA encoded by the HBB gene having the IVS-2-745 mutation decreases the amount of mutant HBB RNA in the cell or the subject.
  • modulating the splicing of the HBB pre-mRNA encoded by the HBB gene having the IVS-2-745 mutation increases the amount of wildtype HBB mRNA in the cell or the subject.
  • hybridization of an antisense compound to the HBB RNA results in inhibition of a binding interaction between the HBB RNA and a protein or other nucleic acid.
  • hybridization of an antisense compound to the HBB RNA results in alteration of translation of the HBB RNA.
  • hybridization of an antisense compound to the HBB RNA results in exon skipping.
  • hybridization of an antisense compound to the HBB RNA results in an increase or a reduction in the amount or activity of the HBB RNA.
  • hybridization of an antisense compound complementary to the HBB RNA results in alteration of splicing, leading to the omission of an exon in an HBB mRNA.
  • This alteration of a splice site may be referred to, for example, as splice-switching, or splice skipping, and the alteration of a splice site that leads to the omission of an exon may be referred to as exon skipping, or exon (number) skipping.
  • the alteration of a splice site, or exon skipping may result in elimination of a premature stop codon.
  • the alteration of a splice site, or exon skipping may result in elimination of a frame-shift; in certain embodiments the elimination of a frame-shift may result in elimination of a premature stop codon.
  • modulating the splicing of HBB RNA comprises contacting an HBB RNA in a cell with a splice-switching oligonucleotide.
  • the splice -switching oligonucleotide is an oligonucleotide that reverses aberrant splicing in a pre-mRNA.
  • aberrant splicing is caused by an IVS-2-745 (OG) mutation in HBB.
  • reversing aberrant splicing caused by the IVS-2-745 (OG) mutation results in an increase in the amount of wildtype HBB mRNA in a cell, and in some instances an increase in an amount of b-globin in the cell.
  • splice switching oligonucleotides are stable and are RNase H resistant.
  • splice switching oligonucleotides are safe and have low toxicity.
  • splice switching oligonucleotides are freely taken up by a cell.
  • Antisense activities may be observed directly or indirectly.
  • observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein and/or a phenotypic change in a cell or subject.
  • oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid.
  • the target nucleic acid is an endogenous RNA molecule.
  • the target nucleic acid encodes a protein.
  • the target nucleic acid is selected from: a mature RNA and a pre-mRNA, including intronic, exonic and untranslated regions.
  • the target RNA is a mature RNA.
  • the target nucleic acid is a pre-mRNA.
  • the target region is entirely within an intron. In certain embodiments, the target region spans an intron/exon junction.
  • the target region is at least 50% within an intron.
  • the target nucleic acid has a disease-associated mutation.
  • the target nucleic acid is the RNA transcriptional product of a retrogene.
  • the target nucleic acid is a non-coding RNA.
  • the target non-coding RNA is selected from: a long non-coding RNA, a short non-coding RNA, an intronic RNA molecule.
  • Gautschi et al demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti tumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res.
  • oligonucleotides are complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, oligonucleotides are 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, oligonucleotides are at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide and comprise a region that is 100% or fully complementary to a target nucleic acid. In certain embodiments, the region of full complementarity is from 6 to 20, 10 to 18, or 18 to 20 nucleobases in length.
  • oligonucleotides comprise one or more mismatched nucleobases relative to the target nucleic acid.
  • antisense activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount.
  • selectivity of the oligonucleotide is improved.
  • the mismatch is specifically positioned within an oligonucleotide having a gapmer motif.
  • the mismatch is at position 1, 2, 3, 4, 5, 6, 7, or 8 from the 5’-end of the gap region.
  • the mismatch is at position 9, 8, 7, 6, 5, 4, 3, 2, 1 from the 3 ’-end of the gap region.
  • the mismatch is at position 1, 2, 3, or 4 from the 5 ’-end of the wing region.
  • the mismatch is at position 4, 3, 2, or 1 from the 3 ’-end of the wing region.
  • oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to an equal length portion of a target nucleic acid, wherein the target nucleic acid is an HBB nucleic acid.
  • the HBB nucleic acid is pre-mRNA.
  • the HBB nucleic acid is represented by the nucleobase sequence set forth in SEQ ID NO: 1 (the complement of GENBANK Accession No. NT_009237.18 truncated from nucleotides 5186000 to 5189000).
  • the target nucleic acid comprises the nucleobase sequence set forth in SEQ ID NO: 2.
  • SEQ ID NO: 2 is identical to SEQ ID NO: 1 aside from a guanine at position 1939 of SEQ ID NO: 2, which corresponds to position 745 of intron 2. In contrast, there is a cytosine at position 1939 of SEQ ID NO:l.
  • contacting a cell with an oligomeric compound complementary to an equal length portion of SEQ ID NO: 1 or SEQ ID NO: 2 increases wildtype HBB mRNA, and in certain embodiments increases b-globin in the cell.
  • wildtype HBB mRNA is an mRNA encoded by the HBB gene that can be translated into a full-length, wildtype b-globin protein.
  • wildtype HBB mRNA is represented by the nucleobase sequence set forth in SEQ ID NO: 3 (NM_000518.5).
  • contacting a cell with an oligomeric compound complementary to an equal length portion of SEQ ID NO: 1 or SEQ ID NO: 2 decreases mutant HBB RNA.
  • the mutant HBB RNA is encoded by the HBB gene, wherein the HBB gene comprises the IVS- 2-745 (OG) mutation.
  • the mutant HBB RNA is selected from pre-mRNA, mRNA, and a combination thereof.
  • oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid, wherein the target nucleic acid is expressed in a pharmacologically relevant tissue or cells.
  • the pharmacologically relevant tissue is selected from blood, bone marrow, brain, macrophages, liver, kidney, and lung.
  • the pharmacologically relevant tissue is blood.
  • the pharmacologically relevant cells are erythroblasts, neurons, macrophages, alveolar cells, endometrial cells, hepatocytes, mesangial cells, and epithelial cells.
  • oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid, wherein the target nucleic acid is expressed in a blood cell or progenitor thereof.
  • Compound No. 671991 is a modified oligonucleotide having a sequence of (from 5’ to 3’) CTTTAGAATGGTGCAAAG (SEQ ID NO: 58), wherein each nucleoside is a 2 -0- methoxyethyl nucleoside, and each of the intemucleoside linkages is a phosphorothioate linkage, and wherein each cytosine is a 5-methylcytosine.
  • Compound No. 671991 is represented by the following chemical structure:
  • the sodium salt of Compound No. 671991 is represented by the following chemical structure:
  • Compound No. 671992 is a modified oligonucleotide having a sequence of (from 5’ to 3’) TTCTTTAGAATGGTGCAA (SEQ ID NO: 59), wherein each nucleoside is a 2 -0- methoxyethyl nucleoside, and each of the intemucleoside linkages is a phosphorothioate linkage, and wherein each cytosine is a 5-methylcytosine.
  • Compound No. 671992 is described by the following chemical structure
  • Compound No. 671993 is a modified oligonucleotide having a sequence of (from 5’ to 3’) TATTCTTTAGAATGGTGC (SEQ ID NO: 60), wherein each nucleoside is a 2 -0- methoxyethyl nucleoside, and each of the intemucleoside linkages is a phosphorothioate linkage, and wherein each cytosine is a 5-methylcytosine.
  • Compound No. 671993 is represented by the following chemical structure:
  • compositions comprising one or more oligomeric compounds.
  • the one or more oligomeric compounds each consists of a modified oligonucleotide.
  • the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier.
  • a pharmaceutical composition comprises or consists of a sterile saline solution and one or more oligomeric compound.
  • the sterile saline is pharmaceutical grade saline.
  • a pharmaceutical composition comprises or consists of one or more oligomeric compound and sterile water.
  • the sterile water is pharmaceutical grade water.
  • a pharmaceutical composition comprises or consists of one or more oligomeric compound and phosphate-buffered saline (PBS).
  • PBS phosphate-buffered saline
  • the sterile PBS is pharmaceutical grade PBS.
  • a pharmaceutical composition comprises or consists of one or more oligomeric compound and artificial cerebrospinal fluid.
  • the artificial cerebrospinal fluid is pharmaceutical grade.
  • a pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, a pharmaceutical composition consists of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, a pharmaceutical composition consists essentially of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.
  • compositions comprise one or more oligomeric compound and one or more excipients.
  • excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone.
  • oligomeric compounds may be admixed with pharmaceutically acceptable active and/or inert substances for the preparation of pharmaceutical compositions or formulations.
  • Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
  • compositions comprising an oligomeric compound encompass any pharmaceutically acceptable salts of the oligomeric compound, esters of the oligomeric compound, or salts of such esters.
  • pharmaceutical compositions comprising oligomeric compounds comprising one or more oligonucleotide upon administration to a subject, including a human, are capable of providing (directly or indirectly) the biologically active metabolite or residue thereof.
  • the disclosure is also drawn to pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.
  • Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
  • prodrugs comprise one or more conjugate group attached to an oligonucleotide, wherein the conjugate group is cleaved by endogenous nucleases within the body.
  • Lipid moieties have been used in nucleic acid therapies in a variety of methods.
  • the nucleic acid such as an oligomeric compound, is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids.
  • DNA complexes with mono- or poly-cationic lipids are formed without the presence of a neutral lipid.
  • a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue.
  • a lipid moiety is selected to increase distribution of a pharmaceutical agent to fat tissue.
  • a lipid moiety is selected to increase distribution of a pharmaceutical agent to muscle tissue.
  • compositions comprise a delivery system.
  • delivery systems include, but are not limited to, liposomes and emulsions.
  • Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds.
  • certain organic solvents such as dimethylsulfoxide are used.
  • compositions comprise one or more tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents of the present invention to specific tissues or cell types.
  • pharmaceutical compositions include liposomes coated with a tissue-specific antibody.
  • compositions comprise a co-solvent system.
  • co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase.
  • co-solvent systems are used for hydrophobic compounds.
  • a non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant Polysorbate 80TM and 65% w/v polyethylene glycol 300.
  • the proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics.
  • co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80TM; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.
  • compositions are prepared for oral administration.
  • pharmaceutical compositions are prepared for buccal administration.
  • a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.).
  • a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer.
  • other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives).
  • injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like.
  • compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers.
  • Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes. Under certain conditions, certain compounds disclosed herein are shown in the form of a free acid.
  • aqueous solutions of such compounds may exist in equilibrium among an ionized (anion) form, and in association with a cation (salt form).
  • a phosphate linkage of an oligonucleotide in aqueous solution exists in equilibrium among free acid, anion, and salt forms.
  • compounds described herein are intended to include all such forms.
  • oligonucleotides have several such linkages, each of which is in equilibrium.
  • oligonucleotides in solution exist in an ensemble of forms at multiple positions, all at equilibrium.
  • the term “oligonucleotide” is intended to include all such forms.
  • Drawn structures necessarily depict a single form.
  • oligomeric compounds disclosed herein are in a form of a sodium salt. In certain embodiments, oligomeric compounds disclosed herein are in a form of a potassium salt. In certain embodiments, oligomeric compounds disclosed herein are in aqueous solution with sodium. In certain embodiments, oligomeric compounds are in aqueous solution with potassium. In certain embodiments, oligomeric compounds are in PBS. In certain embodiments, oligomeric compounds are in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and/or HC1 to achieve a desired pH.
  • RNA nucleoside comprising a 2 ’-OH sugar moiety and a thymine base
  • nucleic acid sequences provided herein are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases.
  • an oligomeric compound having the nucleobase sequence “ATCGATCG” encompasses any oligomeric compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence “AUCGAUCG” and those having some DNA bases and some RNA bases such as “AUCGATCG” and oligomeric compounds having other modified nucleobases, such as “AT m CGAUCG,” wherein m C indicates a cytosine base comprising a methyl group at the 5-position.
  • Certain compounds described herein e.g., modified oligonucleotides have one or more asymmetric center and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), as a or b such as for sugar anomers, or as (D) or (L), such as for amino acids, etc.
  • Compounds provided herein that are drawn or described as having certain stereoisomeric configurations include only the indicated compounds.
  • Compounds provided herein that are drawn or described with undefined stereochemistry included all such possible isomers, including their stereorandom and optically pure forms, unless specified otherwise.
  • all tautomeric forms of the compounds herein are also included unless otherwise indicated. Unless otherwise indicated, compounds described herein are intended to include corresponding salt forms.
  • the compounds described herein include variations in which one or more atoms are replaced with a non-radioactive isotope or radioactive isotope of the indicated element.
  • compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the 'H hydrogen atoms.
  • Isotopic substitutions encompassed by the compounds herein include but are not limited to: 2 H or 3 H in place of 3 ⁇ 4, 13 C or 14 C in place of 12 C, 15 N in place of 14 N, 17 0 or 18 0 in place of 16 0, and 33 S, 34 S, 35 S, or 36 S in place of 32 S.
  • non-radioactive isotopic substitutions may impart new properties on the oligomeric compound that are beneficial for use as a therapeutic or research tool.
  • radioactive isotopic substitutions may make the compound suitable for research or diagnostic purposes such as imaging.
  • Modified oligonucleotides complementary to SEQ ID NO: 1 (the complement of GENBANK Accession No. NT_009237.18 truncated from nucleotides 5186000 to 5189000) or SEQ ID NO: 4 were designed and tested for their effect on mutant HBB RNA and wildtype HBB mRNA expression in a murine erythroleukemia cell line that stably expresses human mutant HBB RNA (MEL IVS-2-745 cells).
  • These modified oligonucleotides are listed in Tables 1 and 2. Tables 1 and 2 correspond to two separate plates assayed in a single experiment.
  • “Start site” indicates the 5 ’-most nucleoside of SEQ ID NO: 1 or SEQ ID NO: 4 to which the modified oligonucleotide is complementary. “Stop site” indicates the 3 ’-most nucleoside of SEQ ID NO: 1 or SEQ ID NO: 4 to which the modified oligonucleotide is complementary.
  • Modified oligonucleotides are 18 nucleosides in length, and each nucleoside is a 2’-MOE modified nucleoside and each intemucleoside linkage is a phosphorothioate intemucleoside linkage. All cytosine residues are 5- methylcytosines.
  • Compound Nos. 18076 and 18078 are gapmers, wherein the central gap segment consists of nine 2’- -D-deoxyribonucleosides, the 3 ’-wing consists of five 2’-MOE modified nucleosides, and the 5 ’-wing consists of six five 2’-MOE modified nucleosides. Each intemucleoside linkage is a phosphorothioate intemucleoside linkage.
  • Compound Nos. 18076 and 18078 contain a mix of 5- methylcytosines and non-methylated cytosines. The non-methylated cytosines are underlined. ‘N/A’ indicates that the modified oligonucleotide is not 100% complementary to that particular gene sequence.
  • Human MEL cells that stably express human mutant HBB RNA (MEL IVS-2-745) were cultured at a density of 300,000 cells per well, and treated with modified oligonucleotides at a concentration of 7,000 nM using electroporation for a treatment period of 24 hours. At the end of the treatment period, total RNA was isolated from the cells and human HBB mRNA levels were measured by quantitative real-time PCR.
  • Wildtype human HBB mRNA levels were measured with human HBB primer probe set RTS4553 (forward sequence CACCTTTGCCACACTGAGTGA, designated herein as SEQ ID NO: 6; reverse sequence GCCCAGGAGCCTGAAGTTCT, designated herein as SEQ ID NO: 7; probe sequence CACTGTGACAAGCTGCACGTGGATCC, designated herein as SEQ ID NO: 8).
  • Mutant human HBB RNA levels were measured with human HBB primer-probe set RTS4500 (forward sequence GCTCACCTGGACAACCTCAAG, designated herein as SEQ ID NO: 9; reverse sequence TCATTATTGCCCCTGAAGTTCTC, designated herein as SEQ ID NO: 10; probe sequence CACCTTTGCCACACTGAGTGAGCTGC, designated herein as SEQ ID NO: 11).
  • Both wildtype and mutant human HBB RNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented in Table 1 as percent human HBB RNA levels relative to untreated control cells (%UTC). As shown in Table 1, modified oligonucleotides complementary to human HBB increased the amount of wildtype human HBB mRNA and decreased the amount of mutant human HBB RNA I these cells.
  • Example 2 Effect of modified oligonucleotides on human HBB mRNA expression in vitro, multiple doses
  • Modified oligonucleotides described in Example 1 were tested at various doses in MEL IVS-2-745 cells.
  • Cultured MEL IVS-2-745 cells at a density of 30,000 cells per well were transfected using electroporation with 625 nM, 1,250 nM, 2,500 nM, 5,000 nM, 10,000 nM and 20,000 nM of modified oligonucleotide, as specified in the tables below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and HBB mRNA levels were measured by quantitative real-time PCR. Wildtype human HBB mRNA levels were measured with human HBB primer probe set RTS4553 as described above.
  • Mutant human HBB RNA levels were measured with human HBB primer probe set RTS4500, as described above. Human HBB mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Tables 3 and 4 present results as percent change in the amount of wildtype human HBB mRNA relative to untreated control (%UTC), as well as the corresponding fold increase in wildtype human HBB mRNA. Tables 5 and 6 present results as percent change in the amount of mutant human HBB RNA relative to untreated control (%UTC), as well as the corresponding IC50 values. Results presented in Tables 3 and 5 were obtained from a single experiment. Results presented in Tables 4 and 6 were obtained from separate experiments carried out under similar conditions.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Diabetes (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Hematology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention concerne des composés oligomères, des méthodes et des compositions pharmaceutiques pour moduler la quantité de β-globine dans une cellule ou chez un sujet, et dans certains cas, augmenter la quantité d'ARN HBB de type sauvage dans une cellule ou chez un sujet. De tels composés et compositions pharmaceutiques sont utiles pour améliorer au moins un symptôme ou un trouble de la β-thalassémie. De tels symptômes et troubles comprennent un faible taux d'hémoglobine, des difformités érythrocytaires, la fatigue, la débilité, la pâleur ou la jaunisse, un gonflement abdominal et une longévité réduite.
PCT/US2020/061627 2019-11-22 2020-11-20 Composés pour moduler l'expression de la bêta globine WO2021102341A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201962939472P 2019-11-22 2019-11-22
US62/939,472 2019-11-22

Publications (2)

Publication Number Publication Date
WO2021102341A2 true WO2021102341A2 (fr) 2021-05-27
WO2021102341A3 WO2021102341A3 (fr) 2021-07-01

Family

ID=75980871

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2020/061627 WO2021102341A2 (fr) 2019-11-22 2020-11-20 Composés pour moduler l'expression de la bêta globine

Country Status (1)

Country Link
WO (1) WO2021102341A2 (fr)

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6809193B2 (en) * 1997-08-13 2004-10-26 Isis Pharmaceuticals, Inc. Antisense oligonucleotide compositions and methods for the modulation of JNK proteins
AU2015327836B2 (en) * 2014-10-03 2021-07-01 Cold Spring Harbor Laboratory Targeted augmentation of nuclear gene output
ES2942309T3 (es) * 2015-11-04 2023-05-31 Vertex Pharma Materiales y métodos para el tratamiento de hemoglobinopatías

Also Published As

Publication number Publication date
WO2021102341A3 (fr) 2021-07-01

Similar Documents

Publication Publication Date Title
US11583548B2 (en) Compounds and methods for reducing ATXN3 expression
WO2019217708A1 (fr) Composés et procédés pour réduire l'expression d'atxn3
WO2020023737A1 (fr) Composés et méthodes permettant de réduire l'expression d'atxn2
AU2020241693B2 (en) Compounds and methods for reducing KCNT1 expression
WO2020172559A1 (fr) Composés et méthodes pour réduire l'expression d'atxn3
EP4281084A1 (fr) Composés et méthodes pour réduire l'expression de dux4
WO2020160163A1 (fr) Composés et méthodes permettant de réduire l'expression de l'app
WO2020061497A1 (fr) Compositions et procédés de modulation de l'expression de lmna
EP4341406A2 (fr) Composés pour moduler l'expression d'unc13a
EP3976791A1 (fr) Composés et méthodes de réduction de l'expression de fus
EP3897837A1 (fr) Composés et méthodes permettant de réduire l'expression de pmp22
EP3947684A1 (fr) Composés et méthodes de modulation de ube3a-ats
EP4355338A1 (fr) Composés et méthodes pour réduire l'expression d'ifnar1
US20220290146A1 (en) Compounds and methods for modulating atxn1
WO2021252799A2 (fr) Composés et procédés de réduction de l'expression de msh3
WO2022032060A2 (fr) Composés et procédés de modulation de scn2a
WO2021102341A2 (fr) Composés pour moduler l'expression de la bêta globine
WO2021178769A1 (fr) Composés et méthodes de modulation de kcnq2
EP4222261A1 (fr) Composés pour moduler chmp7
WO2021263082A2 (fr) Composés et méthodes de réduction de l'expression de kcnt1

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20890036

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20890036

Country of ref document: EP

Kind code of ref document: A2