WO2014021630A1 - 인테그린αvβ3에 특이적 압타머 및 이의 용도 - Google Patents

인테그린αvβ3에 특이적 압타머 및 이의 용도 Download PDF

Info

Publication number
WO2014021630A1
WO2014021630A1 PCT/KR2013/006889 KR2013006889W WO2014021630A1 WO 2014021630 A1 WO2014021630 A1 WO 2014021630A1 KR 2013006889 W KR2013006889 W KR 2013006889W WO 2014021630 A1 WO2014021630 A1 WO 2014021630A1
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
aptamer
seq
group
integrin
Prior art date
Application number
PCT/KR2013/006889
Other languages
English (en)
French (fr)
Inventor
이중환
함승주
허용민
채영찬
류성호
임은경
김종인
Original Assignee
포항공과대학교 산학협력단
연세대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 포항공과대학교 산학협력단, 연세대학교 산학협력단 filed Critical 포항공과대학교 산학협력단
Priority to US14/418,266 priority Critical patent/US20150359911A1/en
Publication of WO2014021630A1 publication Critical patent/WO2014021630A1/ko

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K49/00—Preparations for testing in vivo
    • A61K49/06—Nuclear magnetic resonance [NMR] contrast preparations; Magnetic resonance imaging [MRI] contrast preparations
    • A61K49/18—Nuclear magnetic resonance [NMR] contrast preparations; Magnetic resonance imaging [MRI] contrast preparations characterised by a special physical form, e.g. emulsions, microcapsules, liposomes
    • A61K49/1818—Nuclear magnetic resonance [NMR] contrast preparations; Magnetic resonance imaging [MRI] contrast preparations characterised by a special physical form, e.g. emulsions, microcapsules, liposomes particles, e.g. uncoated or non-functionalised microparticles or nanoparticles
    • A61K49/1821—Nuclear magnetic resonance [NMR] contrast preparations; Magnetic resonance imaging [MRI] contrast preparations characterised by a special physical form, e.g. emulsions, microcapsules, liposomes particles, e.g. uncoated or non-functionalised microparticles or nanoparticles coated or functionalised microparticles or nanoparticles
    • A61K49/1824—Nuclear magnetic resonance [NMR] contrast preparations; Magnetic resonance imaging [MRI] contrast preparations characterised by a special physical form, e.g. emulsions, microcapsules, liposomes particles, e.g. uncoated or non-functionalised microparticles or nanoparticles coated or functionalised microparticles or nanoparticles coated or functionalised nanoparticles
    • A61K49/1827—Nuclear magnetic resonance [NMR] contrast preparations; Magnetic resonance imaging [MRI] contrast preparations characterised by a special physical form, e.g. emulsions, microcapsules, liposomes particles, e.g. uncoated or non-functionalised microparticles or nanoparticles coated or functionalised microparticles or nanoparticles coated or functionalised nanoparticles having a (super)(para)magnetic core, being a solid MRI-active material, e.g. magnetite, or composed of a plurality of MRI-active, organic agents, e.g. Gd-chelates, or nuclei, e.g. Eu3+, encapsulated or entrapped in the core of the coated or functionalised nanoparticle
    • A61K49/1866—Nuclear magnetic resonance [NMR] contrast preparations; Magnetic resonance imaging [MRI] contrast preparations characterised by a special physical form, e.g. emulsions, microcapsules, liposomes particles, e.g. uncoated or non-functionalised microparticles or nanoparticles coated or functionalised microparticles or nanoparticles coated or functionalised nanoparticles having a (super)(para)magnetic core, being a solid MRI-active material, e.g. magnetite, or composed of a plurality of MRI-active, organic agents, e.g. Gd-chelates, or nuclei, e.g. Eu3+, encapsulated or entrapped in the core of the coated or functionalised nanoparticle the nanoparticle having a (super)(para)magnetic core coated or functionalised with a peptide, e.g. protein, polyamino acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K49/00—Preparations for testing in vivo
    • A61K49/04—X-ray contrast preparations
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
    • G01N33/57492—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites involving compounds localized on the membrane of tumor or cancer cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/16—Aptamers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
    • G01N2333/70546—Integrin superfamily, e.g. VLAs, leuCAM, GPIIb/GPIIIa, LPAM
    • G01N2333/70557—Integrin beta3-subunit-containing molecules, e.g. CD41, CD51, CD61

Definitions

  • the present invention relates to a DNA aptamer specifically binding to integrin ⁇ ⁇ ⁇ 3 , and to a cancer or cancer metastasis diagnostic composition comprising the same as an active ingredient.
  • the present invention also relates to a composition for imaging a tumor disease site comprising the aptamer, and a contrast agent comprising the same.
  • Integrin is a cell surface receptor that regulates important physiological functions of cells such as cell adhesion and migration, differentiation, and proliferation. Integrins function as heterodimers in which ⁇ and ⁇ subunits are non-covalent bonds, and the ⁇ and ⁇ subunits are paired to form 22 integrin families.
  • Integrins bind mainly to extracellular matrix proteins such as bibronectin, fibronectin, collagen, laminin, vWF, and fibrinogen, but differ in ligand specificity by type of integrin, and one type of integrin can bind to several ligands have.
  • integrin ⁇ ⁇ ⁇ 3 is expressed in various cancers including skin cancer, prostate cancer, breast cancer, cervical cancer, colorectal cancer, lung cancer, gallbladder cancer, pancreatic cancer, and stomach cancer. It is known to improve the malignancy of various human tumors by regulating the growth, survival and penetration of cells. Recently, inter-green ⁇ ⁇ ⁇ 3 has been found to increase tumor growth and metastasis as a mediator independent of adhesion by regulating intracellular signal transduction (David A Cheresh et al., Nature Medicine 2009, 15 (10). ): 1163).
  • integrin ⁇ ⁇ ⁇ 3 converts the benign radiation growth of tumors into malignant vertical growth stages in skin cancer and mediates the metastasis of the cork through improved tumor cell adhesion in breast and prostate cancer.
  • Integrin ⁇ ⁇ ⁇ 3 expression in cervical cancer patients correlates with disease progression and short survival.Integrin ⁇ ⁇ ⁇ 3 expression in pancreatic ductal adenocarcinoma is observed in about 58% of human tumors. And increased lymph node metastasis.
  • integrin since integrin is specifically expressed in various cancer cells and is involved in cancer progression and metastasis, it has been suggested that integrin can be developed as a diagnostic marker and therapeutic target for cancer or cancer metastasis.
  • US Patent No. 6,171,588 discloses integrin ⁇ ⁇ ⁇ 3 and provides a monoclonal antibody specifically binding to the purposes to detect or treat a tumor
  • a cancer diagnostic agent using a peptide-based compound that specifically binds is provided.
  • antibodies or peptides that specifically recognize integrins are difficult to manufacture because of their large molecular size, are not easily modified, and have low stability because they are not stored or transported at room temperature. In addition, there is a problem that the immune rejection reaction may occur when in vivo.
  • the present inventors have DNA which binds with high affinity to the result, the integrin ⁇ ⁇ ⁇ 3 studies to provide new material coming to solve the existing problems and to recognize and combine the integrin ⁇ ⁇ ⁇ 3 specifically to specific The foundation of the aptamer was excavated.
  • the aptamer of the present invention is excellent in stability and sensitivity compared to a conventional protein-based formulation, and is easy to manufacture due to its small size, and can be produced at low cost in a short time by a chemical synthesis method, and various modifications are easy to increase the binding force. There is an advantage.
  • the aptamer of the present invention detects integrin ⁇ ⁇ ⁇ 3 with high stability and sensitivity, it may be usefully used to diagnose all kinds of cancers and cancer metastasis associated with integrin ⁇ ⁇ ⁇ 3 .
  • the present inventors confirmed the cancer cell target orientation of the newly discovered aptamer, prepared magnetic nanoparticles to which the aptamer was bound, and successfully image cancer cells by MRI, thereby completing the present invention.
  • One object of the present invention is to provide an aptamer that specifically binds to integrin ⁇ ⁇ ⁇ 3 .
  • Another object of the present invention to provide a composition for diagnosing cancer or cancer metastasis comprising the aptamer as an active ingredient.
  • Another object of the present invention is to provide a method for providing cancer or cancer metastasis diagnostic information using the aptamer.
  • Another object of the present invention is to provide a method for diagnosing cancer or cancer metastasis using the aptamer.
  • Still another object of the present invention is to provide a composition for imaging a tumor disease site including the aptamer as an active ingredient.
  • the present invention provides an aptamer having high binding force and selectivity to integrin ⁇ ⁇ ⁇ 3 , and the aptamer may be usefully used for diagnosis of all kinds of cancers related to integrin ⁇ ⁇ ⁇ 3 and cancer metastasis therefrom.
  • Figure 1 shows the results of confirming the ester (-COO-) structure formed during the preparation of P8 ()-triCOOH through the infrared spectrum.
  • FIG. 2 shows a process of preparing magnetic nanoparticles to which integrin ⁇ ⁇ ⁇ 3 aptamer is bound.
  • Figure 3 (a) shows the result of measuring the size of the magnetic nanoparticles bonded to the prepared integrin ⁇ ⁇ ⁇ 3 aptamer using a dynamic laser light scattering method, (b) is the transmission of the particles through a transmission electron microscope (C) shows the results of checking the superparamagnetism using a vibrating sample magnetometer, and (d) shows the results of measuring the content of magnetic nanoparticles through a thermal analyzer.
  • Figure 4 (a) is a result of confirming that the significantly dark MR contrast as the concentration of the magnetic nanoparticles at 1.5T when the integrin ⁇ ⁇ ⁇ 3 aptamer is applied to MR imaging experiments, (b) is the concentration It is confirmed that r2 (T2 relaxvity coefficients) increases as increases.
  • FIG. 5 shows that integrin ⁇ ⁇ ⁇ 3 aptamer-coupled magnetic nanoparticles (Apt av (33 -MNPs) and cRGD-coupled magnetic nanoparticles cRGD-MNPs) were subjected to buffer conditions in which serum was included according to the concentration condition. The result which confirmed having stability is shown.
  • FIG. 7A shows that Apt av (13 -MNPs and cRGD-MNPs were treated to PAE / KDR (integrin ⁇ ⁇ ⁇ 3 overexpression, experimental group) cells and A431 (integrin ⁇ ⁇ ⁇ 3 low expression, control) cells, respectively.
  • PAE / KDR integrated ⁇ ⁇ ⁇ 3 overexpression, experimental group
  • A431 integrated ⁇ ⁇ ⁇ 3 low expression, control
  • FIG. 8 (a) shows the results of confirming the image contrast effect over time in cancer tissues after injecting Apt av (i3- MNPs and cRGD-MNPs) into the cancer animal model, respectively
  • (b) is FIG. 8 (a) MR signal intensity is graphed from the image results measured at.
  • the present invention provides a DNA aptamer specifically binding to integrin ⁇ ⁇ ⁇ 3 , a composition for diagnosing cancer or mammary metastases comprising the same as an active ingredient, and a method for diagnosing cancer or cancer metastasis using the same.
  • the present invention also provides a composition for imaging a tumor disease site comprising the aptamer, and a contrast agent comprising the same.
  • the invention relates to aptamers that specifically bind to integrin ⁇ ⁇ ⁇ 3 .
  • Integrin ⁇ ⁇ ⁇ 3 in the present invention may be derived from a mammal, preferably a human.
  • the aptamer of the present invention may comprise a modified base, the total base length including the modified base may be 25 to 100, preferably 30 to 80, more preferably 35 to 50, integrin ⁇ It is characterized by binding specifically to ⁇ ⁇ 3 .
  • the modified base means a modified form in which the 5-position of dU (deoxyuracil) is substituted with a hydrophobic functional group, and may replace the base 'T'.
  • the hydrophobic functional group may be at least one member selected from the group consisting of benzyl group, naphthyl group, pirbenzyl group, tryptophan and the like, and preferably benzyl group.
  • the 5-position of the dU base is substituted with a hydrophobic functional group to be modified, thereby significantly increasing the affinity with integrin ⁇ ⁇ ⁇ 3 as compared with the case where it is not modified.
  • the number of modified bases in the aptamer may be 5 to 20, preferably 10 to 17.
  • the aptamer is SEQ ID NO: 1 to SEQ ID NO: 56 of the base sequence
  • 'n' is a modified base or T), including one or more base sequences selected from the group consisting of 25 to 100 bases, preferably 30 to 80, more preferably 35 to 50 Can be.
  • the aptamer consists only of one or more base sequences selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 56, 30 to 120, 35 to 100, or further including a base sequence consisting of 3 to 25, specifically 5 to 20 bases at the 5 'end, 3' end, or both ends of the base sequence It may be 45 to 90 bases.
  • the base sequence further included in the 5 'end, 3' end or both ends may be selected from the group consisting of SEQ ID NO: 57 to SEQ ID NO: 60.
  • the aptamer has TCAGCCGCCAGCCAGTTC (SEQ ID NO: 57) at the 5 'end of at least one nucleotide sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 56, and has GACCAGAGCACCACAGAG (SEQ ID NO: 58) at the 3' end, or It may be one having AGTTC (SEQ ID NO: 59) at the 5 'end and GACCA (SEQ ID NO: 60) at the 3' end, but is not limited thereto.
  • the aptamer of the present invention may be one having the following SEQ ID NO: 61 or SEQ ID NO: 62:
  • each base A, C, G , T, their deoxy form, and the 5-position of dU (deoxyuracil) are modified with a base substituted with a hydrophobic functional group (e.g., at least one selected from the group consisting of benzyl, naphthyl, pyrrolebenzyl, tryptophan) Independently selected from the group consisting of).
  • a hydrophobic functional group e.g., at least one selected from the group consisting of benzyl, naphthyl, pyrrolebenzyl, tryptophan
  • N may be selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 56.
  • 'n' means a modified form in which 5-position of ⁇ or dU (deoxyuracil) is substituted with a hydrophobic functional group, unless otherwise specified, preferably The 5-position of dU (deoxyuracil) is modified by substitution with a hydrophobic group.
  • the hydrophobic functional group is at least one member selected from the group consisting of benzyl group, naphthyl group, pirbenzyl group, tryptophan and the like, and preferably benzyl group.
  • the aptamer in order to enhance stability in the serum, 5 'end, 3' end, or both ends may be modified to improve the stability in the serum.
  • the modifications include PEG (polyethylene glycol), inverted deoxythymidine (IDT), Locked Nucleic Acid (LNA), 2'-methoxy nucleoside, and 2'-amino nucleoside at the 5 'end, 3' end, or both ends.
  • PEG polyethylene glycol
  • IDT inverted deoxythymidine
  • LNA Locked Nucleic Acid
  • 2'-methoxy nucleoside 2'-methoxy nucleoside
  • 2'-amino nucleoside at the 5 'end, 3' end, or both ends.
  • 2'F-nucleoside, amine linker, thiol linker, and cholester may be modified by combining one or more selected from the group consisting of.
  • the aptamer is polyethylene glycol (PEG) at the 5 'end;
  • molecular weight 500-50,000 Da is attached, or inverted deoxythymidine (idT) is attached at the 3 'end, PEG (eg, molecular weight 500-50,000 Da) is attached at the 5' end, and idT (at the 3 'end). inverted deoxythymidine) may be attached.
  • idT inverted deoxythymidine
  • the 'idT (inverted deoxythymidine)' is one of the molecules used to prevent the degradation of nucleases of aptamers, which generally have low resistance to nucleases, and the nucleic acid unit is composed of -OH of the previous unit and the next unit.
  • idT binds 3'-OH of the previous unit to 3'-OH of the next unit by artificially changing to expose 5'-OH instead of 3'-OH. It is a molecule that produces an effect of inhibiting degradation by 3'exonuclease, a kind of nuclease.
  • the aptamer of the present invention can be used as a composition for diagnosing cancer or cancer metastasis.
  • the present invention is directed to the integrin ⁇ ⁇ ⁇ 3
  • composition for diagnosing cancer or cancer metastasis comprising integrin ⁇ ⁇ ⁇ 3 aptamer specifically binding as an active ingredient.
  • the present invention relates to a method of providing a cancer or cancer metastasis diagnosis information with an integrin ⁇ ⁇ ⁇ 3 aptamer specifically binding to the integrin ⁇ ⁇ ⁇ 3.
  • the method of providing information for diagnosing cancer or cancer metastasis in the present invention is preferably, the method of providing information for diagnosing cancer or cancer metastasis in the present invention
  • the method may further comprise measuring the degree of binding of the aptamer in the normal sample.
  • the patient may be a mammal including a human, and preferably, as a rodent or a human, a subject to determine whether the cancer has developed or has metastasized.
  • Cancer types that can provide information for diagnosis in this manner may be any type of cancer associated with integrin ⁇ ⁇ ⁇ 3 , such as skin cancer, prostate cancer, breast cancer, cervical cancer, colon cancer, lung cancer, gallbladder cancer, pancreatic cancer, and It may be at least one selected from the group consisting of gastric cancer.
  • the normal sample may be a mammal including a human, preferably obtained from a rodent or a human, and may be a target cancer for providing information for diagnosis, such as skin cancer, prostate cancer, breast cancer, cervical cancer, colon cancer, Lung cancer, gallbladder cancer, pancreatic cancer, gastric cancer and the like selected from the group consisting of cancer and biological samples obtained from individuals without metastasis of the cancer.
  • a target cancer for providing information for diagnosis such as skin cancer, prostate cancer, breast cancer, cervical cancer, colon cancer, Lung cancer, gallbladder cancer, pancreatic cancer, gastric cancer and the like selected from the group consisting of cancer and biological samples obtained from individuals without metastasis of the cancer.
  • the biological sample may be a mammalian living body except humans, cells, tissues, blood, body fluids, saliva, etc. isolated from mammals including humans.
  • Measuring the degree of binding of the aptamer in the biological sample may be performed using DNA aptamer binding measuring techniques commonly used in the art, for example, by labeling a fluorescent or radioactive material at the aptamer end or Biotin may be combined to measure or image and observe fluorescence or radioactive intensity, but the present invention is not limited thereto.
  • a pair of aptamers selected from the aptamers different from the integrin ⁇ ⁇ ⁇ 3 so as not to interfere with each other one is fixed to the substrate (capture aptamer), the other ( The detection aptamer is labeled with a detectable label at the end and the intensity thereof is measured, thereby determining the presence or overexpression of integrin ⁇ ⁇ ⁇ 3 in the sample.
  • the detectable label may be a fluorescent substance or radioactive substance label (or a substance capable of reacting with the fluorescent substance or radioactive substance), for example, chromosome (eg peroxidase, alkaline phosphatase), radioisotope (eg : 124 1, 125 1, 1 1 'In, 99m Tc, 32 P, 35 S), chromophore, FITC, RITC,
  • chromosome eg peroxidase, alkaline phosphatase
  • radioisotope eg : 124 1, 125 1, 1 1 1 'In, 99m Tc, 32 P, 35 S
  • chromophore FITC, RITC
  • GFP Green Fluorescent Protein
  • EGFP Enhanced Green Fluorescent
  • Cy3, Cy5 and Cy7.5 may be exemplified, but is not limited thereto.
  • the sensitivity is significantly superior to that of detection using an existing antibody or peptide.
  • the aptamer of the present invention specifically binds to integrin ⁇ ⁇ ⁇ 3
  • the aptamer of the present invention may be usefully used for imaging an onset site of a neoplastic disease.
  • the present invention relates to a composition for imaging tumor tumor comprising the aptamer as an active ingredient.
  • the invention in another aspect, relates to a method of imaging a neoplastic disease comprising administering the aptamer to a subject.
  • Imaging and diagnosis of neoplastic disease may include, but are not limited to, the initial purpose of neoplastic disease, as well as the progress of progress, the course of treatment for tumor treatment, the monitoring of response to therapeutic agents, and the like.
  • the aptamer may be provided by linking (eg, covalently or crosslinking) to a detectable label to facilitate identification, detection and quantification of binding.
  • the detectable label for imaging a tumorous disease site is a radioisotope, fluorophore, quantum dot, or magnetic particle, such as super paramagnetic particles or superparamagnetic particles ( ultrasuper paramagnetic particles) and the like, but is not limited thereto.
  • the aptamer of the present invention may be provided in the form of a nanoparticle contrast agent for imaging of a tumorous disease site by binding to the nanoparticles.
  • the present invention is the above containing aptamer It relates to a nanoparticle contrast agent comprising a composition for imaging of a tumor disease site.
  • the aptamer of the present invention binds specifically to integrin ⁇ ⁇ ⁇ 3 and serves as a target ligand for targeting a tumorous disease site, thereby rapidly and accurately identifying the tumor site by an active target-oriented method. Diagnosis is possible.
  • contrast agent refers to an agent used for organs, for the purpose of diagnosis, to make a difference in contrast between artificial blood vessels and tissues, and to make an image of contrast. Contrast agents can determine the presence and extent of disease or damage by increasing the visibility and control of the surface under study.
  • the nanoparticle contrast agent combined with the aptamer of the present invention has a very high efficiency of cancer tissue accumulation, and has been found to be a safe substance having no toxicity and no abnormal findings in living organisms, and thus is suitable for use as a contrast agent.
  • Embodiments to which the contrast agent of the present invention can be applied include magnetic resonance imaging (MRI), X-ray imaging technology, nuclear imaging including PET (positron emission tomography), and the like, but are not limited thereto. no.
  • MRI magnetic resonance imaging
  • X-ray imaging technology nuclear imaging including PET (positron emission tomography), and the like, but are not limited thereto. no.
  • PET positron emission tomography
  • Magnetic resonance imaging is an imaging technique that uses images of the spin of hydrogen atoms in magnetic fields to obtain anatomical, physiological and biochemical information about the body.
  • paramagnetic nanoparticles or superparamagnetic nanoparticles widely used in the art may be used.
  • transition metal ions such as Gd, Fe, and Mn may be used, and as superparamagnetic particles, superparamagnetic
  • Superparamagnetic iron oxide nanoparticles and the like can be used.
  • the nanoparticle contrast agent of the present invention may have a structure in which a shell is formed by adding an amphiphilic compound to the core containing the magnetic nanoparticles.
  • the hydrophobic region including the structure of pyrene of the amphiphilic compound By chemical bonding of the pi-pi bonds, the surface of the nanoparticles can bind to the surface of the nanoparticles.
  • Water-insoluble nanoparticles can be stabilized in aqueous media to maximize bioavailability.
  • Synthesis methods of such nanoparticles include coprecipitation,
  • Hydrothermal synthesis microemulsion (oil-in-water or water-in-oil), thermal decomposition, and the like can be used, but are not limited thereto.
  • the magnetic nanoparticles are preferably particles having a diameter of 1 to 1000 nm, more preferably 2 to 100 nm, and a metal, magnetic material, or magnetic alloy having the diameter may be used.
  • the metal is not particularly limited, but Pt, Pd, Ag, Cu, or Au may be used alone or in combination of two or more.
  • the magnetic material is not particularly limited, but Co, Mn, Fe, Ni, Gd, Mo, MM ' 2 0 4 , or MxOy (M and M' are each independently Co, Fe, Ni, Mn, Zn, Gd, Or Cr, and x and y satisfy the formulas " 0 ⁇ x ⁇ 3 " and " 0 ⁇ y ⁇ 5 ", respectively.
  • the magnetic alloy is not particularly limited, but CoCu, CoPt, FePt, CoSm, NiFe, or NiFeCo may be used alone or in combination of two or more.
  • the magnetic nanoparticles are combined with an amphi
  • the combination of magnetic nanoparticles and organic surface stabilizer is organic to precursors of magnetic nanoparticles.
  • Surface stabilizers can be coordinated to form complexes.
  • the organic surface stabilizer is to change the state and size of the nanoparticles
  • the surfactant may be a cationic surfactant including alkyl trimethylammonium halide, saturated or unsaturated fatty acids such as oleic acid, lauric acid, or dodecylic acid, tri Octylphosphine oxide (0 ( ⁇ 1 1 51103 1 ) 1 1 ⁇ 2 0 06: ⁇ 01 > 0) ,
  • TOP Trioctylphosphine
  • Trialkylphosphines such as tributylphosphine or
  • Anionic surfactants including phosphate) may be used, but are not limited thereto.
  • amphiphilic compound is a nanoparticle in the matrix
  • the targeting ligand may be chemically bound to one end of the polymer.
  • the hydrophobic region of the amphiphilic compound may include a hydrophobic compound to which a substance including a pyrene structure is bound.
  • the hydrophobic compound may be used alone or two or more of saturated fatty acid : unsaturated fatty acid or hydrophobic polymer.
  • the saturated fatty acid is not particularly limited, but butyric acid, caproic acid, caprylic acid, capric acid, lauric acid (dodecyl acid), myristic acid, palmitic acid, stearic acid, eicosanoic acid, or docosano Acid or the like can be used alone or in combination of two or more.
  • the unsaturated fatty acid is not particularly limited, but oleic acid, linoleic acid, linolenic acid, arachidonic acid, eicosaptanoic acid, docosanuclinoic acid, or erucic acid may be used alone or in combination.
  • the hydrophobic polymer is not particularly limited, but polyphosphazene, polylactide, polylactide-co-glycolide,
  • Polycaprolactone polyanhydride, polymalic acid or derivatives thereof,
  • Polyalkyl cyanoacrylate, polyhydroxybutylate, polycarbonate, polyorthoester, hydrophobic polyamino acid, or hydrophobic vinyl series polymers may be used alone or in combination of two or more.
  • the material containing the pyrene structure is not particularly limited, but pyrene, pyrenebutyric acid, pyrene methylamine, l-Aminopyrene, pyreneboro Pyrene- 1-boronic acid, organic molecules including a pyrene structure, etc. may be used alone or in combination of two or more.
  • the hydrophilic region of the amphiphilic compound is polyalkylene glycol (PAG),
  • Polysaccharides such as polyetherimide (PEI), polyvinylpyrrolidone (PVP), hydrophilic polyamino acid (PAA), hydrophilic vinyl polymer, hydrophilic acrylic polymer or textran (Dextran), hyaluronic acid (Hyauronic acid)
  • PVP polyetherimide
  • PAA hydrophilic polyamino acid
  • PAA hydrophilic vinyl polymer
  • Hyauronic acid Polymeric polymers may be used alone or in combination of two or more.
  • the magnetic nanoparticles according to the present invention may provide a target orientation to the magnetic nanoparticles by introducing an aptamer into the hydrophilic region.
  • Aptamers have functional groups such as —NH 2 , —SH, and —COOH at the 5′- and 3′-terminus, and may be useful for binding to the functional groups of the active ingredient binding region.
  • functional groups such as carboxylic acid, phosphate
  • Imaging compositions or nanoparticle contrast agents of the present invention may be used in conjunction with an imaging acceptable carrier, the imaging acceptable carrier includes carriers and vehicles commonly used in the pharmaceutical arts,
  • partial glycerol of ion exchange resin alumina, aluminum stearate, lecithin, serum protein (e.g. human serum albumin), buffer substance (e.g. various phosphates, glycine, sorbic acid, potassium sorbate, saturated vegetable fatty acid Lysates), water, salts or electrolytes (e.g., protamine sulfate, disodium hydrogen phosphate, sodium hydrogen phosphate, sodium chloride and zinc salts), colloidal silica, magnesium trisilicate, polyvinylpyrrolidone, cellulose based substrates Polyethylene glycol, sodium
  • Carboxy methylcelose polyarylate, wax, polyethylene glycol or wool, and the like. In addition to the above components, it may further include a lubricant, wetting agent, emulsifier, suspending agent, or preservative.
  • Cancer metastasis is the leading cause of cancer related deaths. In particular, cancer patients are often diagnosed after metastasis progresses and have high recurrence rates despite surgery and chemotherapy. Thus, the treatment of cancer metastasis is the main goal of cancer treatment.
  • cancer cells In order for metastatic cancer to grow in the microenvironment of the new organ, cancer cells must overcome various types of stress and rate-limiting steps. Integrin ⁇ ⁇ ⁇ 3 is known to overexpress in cancer cells and promote the progression of metastatic and malignant tumors, and thus may be a potential target for the diagnosis and treatment of cancer or cancer metastases.
  • DNA aptamers have various advantages as cancer targeting molecules because they are chemically synthesizable, easy to modify for in vivo application, and excellent in penetrating into tumor tissue.
  • Natural oligonucleotides are chemically synthesizable, easy to modify for in vivo application, and excellent in penetrating into tumor tissue.
  • deoxyuracil is a hydrophobic functional group to increase binding affinity and reduce slow off-rate while increasing resistance to nucleases.
  • SELEX was performed using nucleotides modified with groups.
  • the aptamers of the present invention may be useful for diagnostic or molecular level imaging of integrin ⁇ ⁇ ⁇ 3 -mediated metastases.
  • magnetic nanoparticles to which the aptamer of the present invention is bound for use as an MR contrast agent were prepared (Example 2), and the magnetic nanoparticles were confirmed to have target-oriented oligomers against cancer cells. Furthermore, when the magnetic nanoparticles were administered to a cancer animal model to confirm MR images, it was confirmed that the magnetic nanoparticles accumulated in cancer tissues effectively image cancer tissues (Example 3). In addition, in vivo safety evaluation, it was confirmed that the aptamer is a safe substance that is not toxic to the living body and does not exhibit abnormal findings (Example 3).
  • the aptamers of the present invention can be used in vitro and in vivo for cancer patients. It can be usefully used to measure metastatic potential and cancer prognosis.
  • the DNA aptamers of the present invention exhibit faster tumor uptake, faster blood clearance, and more consistent tumor retention, resulting in higher blood to tumor ratios. Significant imaging is possible. Therefore, the aptamer of the present invention can be usefully used for in vivo imaging of integrin ⁇ ⁇ ⁇ 3 expressing cancer cells, particularly in a living microenvironment in which tumors have metastasized.
  • antisense library [5'-Biotin-d (CTC TGT GGT GCT CTG GTC- (N x 40) -GAA CTG GCT GGC GGC TGA -3 '; (SEQ ID NO: 64)] with 20 ⁇ M 5' primer (TCA GCC GCC AGC CAG TTC; SEQ ID NO: 65) with 0.5mM dNTP (ATP, GTP, CTP, BzdUTP), 0.25U / ul KOD XL (KOD XL DNA polymerase, Novagen), 10X extension buffer (1.2M Tris-HCl pH7.8, 100 mM KC1, 60 mM (NH 4 ) 2 S0 4 , 70 mM MgS0 4 , 1% Triton X-100, lmg / ml BSA) was incubated at 70 ° C for 1 hour to prepare a double strand DNA.
  • 10X extension buffer 1.2M Tris-HCl pH7.8, 100 mM
  • the SELEX technique was used to select DNA aptamers that bind to integrin ⁇ ⁇ ⁇ 3 (R & D systems, 3030-AV).
  • integrin ⁇ ⁇ ⁇ 3 tagging EZ-Link NHS-PEG4-Biotin (Thermo scientific) was used for non-tag protein integrin ⁇ ⁇ ⁇ 3 , and the cells were dispensed for SELEX after biotinylation.
  • the synthesized Library lnmole was added to a selection buffer (200mM HEPES, 510mM NaCl, 25mM KCl, 25mM MgCl 2 ) and reacted at 95 ° C, 70 ° C, 48 ° C, and 37 ° C for 5 minutes, respectively, followed by Negative.
  • a selection buffer 200mM HEPES, 510mM NaCl, 25mM KCl, 25mM MgCl 2
  • 10X protein competition buffer K ⁇ M prothrombin, ⁇ casein, 0.1% (/ v) HSA (human serum albumin, SIGMA) 10
  • SA bead 50% (v / v) slurry, lOmg / ml lnvitrogen
  • Dynal MyOne SA beads combined with DNA and integrin ⁇ ⁇ ⁇ 3 complexes were washed 5 times with selection buffer (200 mM HEPES, 510 mM NaCl, 25 mM KCl 25 mM MgCl 2 ) 100
  • selection buffer 200 mM HEPES, 510 mM NaCl, 25 mM KCl 25 mM MgCl 2
  • LiL 100
  • the library bound to the target was added by adding 85 ⁇ of 2 mM NaOH solution, followed by neutralization with 20 ⁇ of 8 mM HC1 solution.
  • Library DN A binding to the target was amplified using QPCR (quantitative PCR, IQ5 multicolor real time PCR detection system, Bio-rad).
  • the 5 'primer (TCA GCC GCC AGC CAG TTC; SEQ ID NO: 65) and the 3' primer (Biotin-CTC TGT GGT GCT CTG GTC; SEQ ID NO: 66), which were previously used for library preparation, were 5uM (5 X QPCR master Mix, Novagen), 0.075 U / ul KOD (Novagen), ImM dNTP (Roche Applied Science), 25 mM MgCl 2 , 5XSYBR green I (Invitrogen), were mixed to a total volume of 125 ⁇ , 96 ° C 15 seconds, 55 ° C 10
  • a double strand library was prepared by repeating 1 cycle at 68 ° C for 30 minutes, and 30 cycles at 96 ° C for 15 seconds and 72 ° C for 1 minute.
  • eDNA is enzymatic DNA and means aptamer produced using DNA template and polymerase.
  • the DNA library made through the QPCR was mixed and fixed in 25 ⁇ L Myone SA bead (Invitrogen) for 10 minutes at room temperature. At this time The amount of DNA mixed was 60 ul as the QPCR product. 20 mM NaOH solution was added to make single strand DNA. Then, DNA containing the modified nucleic acid was synthesized in the same manner as in the library preparation of Example 1.1, and used in the next round. A total of 8 SELEX rounds were performed and 4 to 6 times for more selective binding. DNA aptamers were screened by diluting DNA and protein (integrin ⁇ ⁇ ⁇ 3 ) complexes in 10 mM DxSO 4 (sigma) solutions at 1/200 and 1/400, respectively.
  • a filter binding assay was performed to determine the binding force between DNA integrin ⁇ ⁇ ⁇ 3 and SELEX round.
  • the pools of 6 rounds and 8 rounds were first labeled with aP 32 ATP (Perkin Elmer) and TdT (Terminal deoxynucleotidyl transferase, NEB).
  • Labeled DNA po was purified using a Micro spin G-50 column (GE healthcare).
  • the labeled DNA pool 20,000cpm was added to ⁇ ⁇ lxSB buffer (200mM HEPES, 510mM NaCl, 25mM KCl, 25mM MgCl 2 ) and slowly cooled from 95 ° C: to 1TC (U ° C 3TC) for 1 second.
  • 200mM HEPES, 510mM NaCl, 25mM KCl, 25mM MgCl 2 was used to serially dilution integrin ⁇ ⁇ ⁇ 3 (R & D systems, 3050-AV) from 100 nM to 12 points, and then heated and mutated DNA pooI 3C.
  • ⁇ L was added and reacted for 30 minutes at 37 ° C.
  • IX selection buffer 200mM HEPES, 5 lOmM NaCl, 25mM KCl, 25mM MgCl 2 ). After exposing the filter plate to the image plate overnight
  • the image was quantified with FLA-5100 (Fuji).
  • Binding between the obtained integrin ⁇ ⁇ ⁇ 3 and DNA po through SELEX round The affinity is shown in Table 1 below.
  • the binding affinity was obtained by using SigmaPlot 11 (Systat Software Inc.), the value obtained through the filter binding assay, Table 1 increase B max represents the ratio of the aptamer bound to the input, K d (dissociation constant) Indicates affinity.
  • library is a DNA having a benzyl modified nucleic acid random sequence used
  • 8 round ssDNA Po which has the highest binding affinity, was amplified into double strand DNA by the QPCR method mentioned above and cloned using TA cloning kit (SolGent). The sequence was obtained by sequencing with the M13 primer (CAGGAAACAGCTATGAC; SEQ ID NO: 67) present on the vector.
  • Kd dissociation constant
  • DNA aptamers cloned through the SELEX process have a length of about 80mer, and this length has been selected to have a suitable dissociation constant (3 ⁇ 4) with the target protein.
  • the best rated clone, # 25 Clone (2100-25-)) contains some primer regions
  • Aptamers were synthesized by Solid Phase Oligo Synthesis using a Mermade 12 synthesizer from Bioautomation, a nucleic acid-specific fixed-synthesizer.
  • the excavated aptamers having the modified nucleic acid were synthesized by using a solilide phase D-cyanoethyl phosphoramidite chemistry using an oligonucleotide synthesizer (Bioautomation, Mermadel2) and after synthesis, a 200 nmole synthesis column ( ⁇ ( ⁇ - ⁇ -)) After cleavage / deprotection in cleavage solution [t-butylamine: methanol: water (l: l: 2 volume ratio)] for 5 hours at 70 ° C, vacuum drying, and then using HPLC (GE, AKTA basic) Separation / purification.
  • oligonucleotide synthesizer Bioautomation, Mermadel2
  • the column used was RP-C 18 column (Waters, Xbridge OST C 18 10x50mm) and UV 254 nm / 290nm, flow rate: 5ml / min, temperature: 65 ° C using 0.1M TEAB / Acetonitrile Buffer. All of these aptamers were measured with an LC-ESI MS spectrometer (Waters HPLC systems (Waters) + Qtrap2000 (ABI)) to determine the correct molecular weight within the 0.02% margin of error and yield 80-90% by HPLC.
  • Magnetic nano-crystals of 7 nm each contain 0.6 mole of dodecyl acid and dodecyl amine in 215 ° C benzyl ether solvent.
  • Triacetylacetonate and manganese triacetylacetonate (Aldrich) were heated for 2 hours and synthesized by thermal decomposition at 315 ° C. for 1 hour.
  • the 7nm of MNCs (10 mg / ml) and dodecanoic acids (0.2 mol), dodecylamine (0.1 mol), iron triacetyl acetonate four are teugwa broken Jimenez triacetyl acetonate four byte 1 15 ° benzyl Terre solution for comprising MNCs of 12 nm were prepared by heating at C for 30 minutes, at 215 ° C. for 2 hours, and at 315 ° C. for 1 hour.
  • Magnetic nanoparticles bound to integrin ⁇ ⁇ ⁇ 3 aptamers (Aptamer avP3 , Apt avP3 )
  • the size of Apt avp3 -MNPs was measured using dynamic laser light scattering method, and the shape of the particles was confirmed by transmission electron microscope.
  • thermogravimetric analyzer TGA
  • the content of nanocrystals was measured and shown in FIGS. 3A, 3B, 3C, and 3D.
  • MR imaging effects of the magnetic nanocomposites were investigated by measuring the coefficients. Specifically, MR imaging tests were performed using a 1.5 T clinical MRI instrument (Intera, Philips Medical System) with a Micro-47 surface coil. magnetism
  • the r2 (unit of mM " V l ) value of the nanocomposite was measured at room temperature.
  • -MNPs were also performed at the same time by dispensing 4 ⁇ ⁇ ⁇ per well into 96-well cells (PAE / KDR) and 5% fetal bovine serum (FBS).
  • the cells were cultured in MEM culture medium containing 1% of antibiotics at 37 ° C and 5% CO2, then treated with various concentrations of Apt « vP 3-MNPs and cRGD-MNPs. Further incubation for hours.
  • Target orientation of innagrin ⁇ ⁇ ⁇ 3 of magnetic nanoparticles was confirmed and compared with the target orientation of cRGD-MNPs.
  • PAE / KDR integrated ⁇ ⁇ ⁇ 3 over-expression, the experiment
  • A431 integrated ⁇ ⁇ ⁇ 3 that expression, control
  • the injection of Apt av showed a very dark image contrast of neovascularization formed in cancer cell tissues, and it was confirmed that the image contrast was more clearly shown through color mapping.
  • the darkest contrast was shown in the 24-hour MR image, which was able to target Apt av (i3 -MNP S to be expressed in integrin ⁇ ⁇ ⁇ 3 allele in neovascularization of cancer tissue. It was confirmed that the cancer tissues accumulated in the cancer tissues were effectively imaged.
  • the imaging results when injecting Apt av (i 3 -MNPs, the signal intensity continuously increased up to 24 hours, up to ⁇ 33.7%, whereas when injecting cRGD-MNPs, the signal intensity increased from 1 hour to maximum. ⁇ 30.0% was found to decrease with time.
  • each mouse was sacrificed to extract cancer tissue, liver, brain, kidney and spleen.
  • the amount of Apt avpr MNPs and cRGD-MNPs accumulated in the organs was measured by inductively coupled plasma-atomic emission spectroscopy (ICP-AES).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Nanotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Oncology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Analytical Chemistry (AREA)
  • Pathology (AREA)
  • Biophysics (AREA)
  • Epidemiology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Hospice & Palliative Care (AREA)
  • Animal Behavior & Ethology (AREA)
  • Plant Pathology (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Radiology & Medical Imaging (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

본 발명은 인테그린αvβ3에 특이적으로 결합하는 DNA 압타머, 및 이를 유효성분으로 포함하는 암 또는 암전이 진단용 조성물에 관한 것이다. 또한 본 발명은 상기 압타머를 포함하는 종양성 질환 부위의 영상화용 조성물, 및 이를 포함하는 조영제에 관한 것이다.

Description

【명세서】
【발명의 명칭】
인테그린 ανβ3에 특이적 압타머 및 이의 용도
【기술분야】
본 발명은 인테그린 ανβ3에 특이적으로 결합하는 DNA 압타머, 및 이를 유효성분으로 포함하는 암 또는 암전이 진단용 조성물에 관한 것이다. 또한 본 발명은 상기 압타머를 포함하는 종양성 질환 부위의 영상화용 조성물, 및 이를 포함하는 조영제에 관한 것이다.
【배경기술】
인테그린 (Integrin)은 세포 부착 및 이동, 분화， 증식 등과 같은 세포의 중요한 생리작용을 조절하는 세포 표면 수용체이다. 인테그린은 α와 β 서브유닛이 비 공유 결합으로 이루어진 헤테로다이머로 작용하며 ,α와 β 서브유닛이 쌍을 이루어 22가지의 인테그린 패밀리 *구성하고 있다.
인테그린은 주로 비브로넥틴， 피브로넥틴, 콜라겐, 라미닌, vWF, 피브리노겐 등의 세포외 메트릭스 단백질에 결합하나, 인테그린의 종류별로 리간드 특이성에 차이가 있으며, 한 종류의 인테그린이 여러 가지 리간드에 동시에 결합할 수 있다.
이 중， 인테그린 ανβ3는 피부암, 전립선암, 유방암, 자궁경부암， 대장암, 폐암, 담낭암, 췌장암, 위암을 포함하는 다양한 암들 증 대부분의 공격적인 종양 세포들에서 발현되며, 부착에 의존적인 종양 세포의 성장, 생존과 침투를 조절하여, 다양한 인간 종양들의 악성을 향상시키는 것으로 알려져 있다. 최근에는 인터)그린 ανβ3이 세포 내 신호 전달을 조절하여 부착에 독립적인 매개체로서 종양의 성장 및 전이를 증가시킨다는 것이 밝혀지기도 하였다 (David A Cheresh et al., Nature Medicine 2009, 15 (10): 1163).
보다구체적으로, 인테그린 ανβ3은 피부암에서 종양의 양성적인 방사선 성장을 악성적인 수직적 성장 단계로 변환시키며, 유방암과 전립선암에서 향상된 종양 세포 부착을 통해 뻐의 전이를 매개한다. 자궁경부암 환자에서 인테그린 ανβ3의 발현은 질병의 진행과 짧은 생존 기간과 상관관계가 있으며, 췌장 관선암종 (pancreatic ductal adenocarcinoma)에서 인테그린 ανβ3의 발현은 인간 종양의 약 58%에서 관찰되고 증가된 림프절 전이와 연관되어 있다. 이와 같이 , 인테그린이 각종 암 세포에서 특이적으로 발현하며 암의 진행과 전이에 관여하므로, 인테그린을 암또는 암전이의 진단 표지 및 치료 타겟으로 개발할 수 있다는 가능성이 제시되었다.
그 예로, Bro이s 등 (1994)에 의하면 암 조직 혈관 내피세포에서만 특이하게 발현된 인테그린 단백질이 신생혈관의 생화학적 표지로서 보고되었으며， Gasparini등 (1998)은 이를 유방암 조직에서 확인하였다.
최근에는 박테리오파아지를 이용한 펩타이드 라이브러리를 이용하여 각 기관 혹은 종양별 특이한 표지를 찾는 시도가 이루어지고 있는데, Pasqualini 둥 (1997)에 의하면 Arg-Gly-Asp (RGD) 펩타이드를 포함한 파아지가 인테그린에 특이하게 결합하는 것이 보고되었다. 이러한 RGD 펩타이드는 인테그린의 길항제로 개발되고 있다.
또한, 미국특허등록 제 6,171,588호는 인테그린 ανβ3에 특이적으로 결합하는 단클론항체를 종양 부위를 탐지 또는 치료하기 위한 용도로 제공하고 있으며, 미국특허공개 제 20090263320호는 인테그린 (3에
특이적으로 결합하는 펩티드계화합물을 이용한 암 진단 제제를 제공하고 있다.
그러나, 인테그린을 특이적으로 인식하는 항체 또는 펩타이드의 경우 분자가크기 때문에 제조에 어려움이 있고， 변형이 용이하지 못하며， 실온에서 보관이나 운반이 불가능하여 안정성이 낮은 문제가 있다. 또한 생체 내 투입시 면역거부반웅이 일어날 수 있는 문제가 있다.
【발명의 상세한 설명】
【기술적 과제】
이에, 본 발명자들은 기존의 문제점들을 해결하고 인테그린 ανβ3을 특이적으로 인식 및 결합하는 새로운 물질올 제공하기 위하여 연구한 결과, 인테그린 ανβ3에 높은 친화력을 가지고 특이적으로 결합하는 DNA기반의 압타머를 발굴하였다.
본 발명의 압타머는 기존 단백질 기반의 제제에 비하여 안정성과 민감도가 우수하며, 크기가 작아 제조가 용이하고, 화학적 합성방법으로 단시간에 적은 비용으로 생산이 가능하며， 결합력을 높이기 위해 다양한 변형이 용이한 장점이 있다. 또한， 본 발명의 압타머는 높은 안정성과 민감도로 인테그린 ανβ3을 탐지하므로, 인테그린 ανβ3과 관련된 모든 종류의 암 및 암 전이를 진단하는데 유용하게 사용될 수 있다. 실제로 본 발명자들은 신규 발굴한 압타머의 암세포 표적 지 향성을 확인하고, 상기 압타머 가 결합된 자성나노입자를 제조하여 MRI 로 암세포를 영상화하는데 성공하여 본 발명을 완성하였다.
【기술적 해결방법】
본 발명의 하나의 목적은 인테그린 ανβ3에 특이 적으로 결합하는 압타머를 제공하는 것 이 다.
본 발명의 또 하나의 목적은 상기 압타머를 유효성분으로 포함하는 암 또는 암 전이 진단용 조성물을 제공하는 것이다.
본 발명의 또 하나의 목적은 상기 압타머를 이용한 암 또는 암 전이 진단 정보를 제공하는 방법을 제공하는 것 이다.
본 발명의 또 하나의 목적은 상기 압타머를 이용한 암 또는 암 전이를 진단하는 방법을 제공하는 것 이다.
본 발명의 또 하나의 목적은 상기 압타머를 유효성분으로 포함하는 종양성 질환 부위의 영상화용 조성물을 제공하는 것 이 다.
본 발명의 또 하나의 목적은 상기 압타머를 개체에 투여하는 단계를 포함하는 종양성 질환 부위 영상화 방법을 제공하는 것 이다.
본 발명의 또 하나의 목적은 상기 종양성 질환 부위의 영상화용 조성물을 포함하는 나노입자 조영 제를 제공하는 것 이 다.
【유리 한 효과]
본 발명은 인테그린 ανβ3에 높은 결합력과 선택성을 가지는 압타머를 제공하며， 상기 압타머는 인테그린 ανβ3와 관련된 모든 종류의 암 및 이로부터의 암전이 진단에 유용하게 사용될 수 있다.
【도면의 간단한 설명】
도 1은 적외선 스펙트럼을 통해 P8()-triCOOH 의 제조 시 형성되는 에스터 (-COO-) 구조를 확인한 결과를 나타낸다.
도 2는 인테그린 <χνβ3 압타머가 결합된 자성 나노입자를 제조하는 과정을 나타낸다. 도 3의 (a)는 제조된 인테그린 ανβ3 압타머가 결합된 자성나노입자의 크기를 동적 레이저 광 산란법을 사용하여 측정 한 결과를 나타내고， (b)는 투과 전자 현미 경을 통해 입자의 형 태를 확인한 결과를 나타내고, (c)는 진동 시료 마그네토미터를 이용하여 초상자성을 확인한 결과를 나타내고, (d)는 열분석 기를 통해 자성 나노입자의 함량을 측정 한 결과를 나타낸다.
도 4의 (a)는 MR 영상 실험에 인테그린 ανβ3 압타머를 적용하였을 때 1.5T 에서 자성 나노입자의 농도가 증가함에 따라 현저히 어두운 MR contrast가 나타남을 확인한 결과이고, (b)는 농도가 증가함에 따라 r2 (T2 relaxvity coefficients)가 증가함을 확인한 결과를 나타낸다.
도 5는 인테그린 ανβ3 압타머 가 결합된 자성 나노입자 (Aptav(33-MNPs)와 cRGD가 결합된 자성 나노입자 cRGD-MNPs)가 농도 조건에 따라 세 럼 이 포함된 버 퍼 조건에서 안정성을 가짐을 확인한 결과를 나타낸다.
도 6은 인테그린 ανβ3 압타머가 결합된 자성 나노입자 (Aptavl33-MNPs)와 cRGD가 결합된 자성 나노입자 cRGD-MNPs) 모두 높은 농도에서도 세포 독성을 나타내지 않는다는 결과를 나타낸다.
도 7의 (a)는 PAE/KDR (인테그린 ανβ3 과발현， 실험군) 세포와 A431 (인테그린 ανβ3 저 발현, 대조군) 세포에 각각 Aptav(13-MNPs 과 cRGD-MNPs 를 처리 한 경우 시간에 따른 영상 대조 효과를 확인한 결과를 나타내며， (b) 는 도 7(a) 에서 측정된 영상 결과로부터 MR signal intensity (R2) 를 측정하여 물질을 처 리하지 않은 (non-treat) 세포의 R2 값을 기준으로, 신호 증가율 그래프를 도시 한 것 이다.
도 8의 (a)는 암 동물 모델에 각각 Aptav(i3-MNPs 과 cRGD-MNPs 를 주사한 후 암 조직에서 시간에 따른 영상 대조 효과를 확인한 결과를 나타내며 , (b) 는 도 8(a) 에서 측정된 영상 결과로부터 MR signal intensity 를 그래프로 나타낸 것이다.
도 9은 암 동물 모델에 각각 Aptav(i3-MNPs 과 cRGD-MNPs 를 주사하여 24시 간 영상 확인 후, 각 동물에서 적출한 각 장기 내에 축적된 Aptavp3-MNPs 과 cRGD-MNPs 의 양을 폴라스마 -원자 방출 분광법을 통해 측정 한 결과를 나타낸다.
【발명의 실시를 위 한 최선의 형 태】 본 발명은 인테그린 ανβ3에 특이적으로 결합하는 DNA 압타머, 이를 유효성분으로 포함하는 암 또는맘 전이 진단용 조성물, 이를 이용한 암 또는 암 전이 진단 방법을 제공한다. 또한, 본 발명은 상기 압타머를 포함하는 종양성 질환 부위의 영상화용 조성물， 및 이를 포함하는 조영제를 제공한다.
하나의 양태로서, 본 발명은 인테그린 ανβ3에 특이적으로 결합하는 압타머에 관한 것이다.
본 발명에서 상기 인테그린 ανβ3는 포유류, 바람직하게는 인간에서 유래하는 것일 수 있다.
본 발명의 압타머는 변형된 염기를 포함할 수 있으며， 변형된 염기를 포함하여 총 염기 길이가 25 내지 100개, 바람직하게는 30 내지 80개， 더욱 바람직하게는 35 내지 50개일 수 있고, 인테그린 ανβ3에 특이적으로 결합하는 것을 특징으로 한다. 본 발명의 압타머에서 상기 변형된 염기 이외에 사용되는 염기는 특별한 언급이 없는 한， A,G,C,T, 및 이들의 deoxy 형태 (예컨대, 2'-deoxy 형태)의 염기들로 이루어진 군에서 선택된 것이다.
상기 변형된 염기는 dU(deoxyuracil)의 5-위치가 소수성 작용기로 치환되어 변형된 형태를 의미하는 것으로, 염기 'T '를 대체하는 것일 수 있다. 소수성 작용기는 벤질기， 나프틸기, 피를벤질기, 트립토판 등으로 이루어진 군에서 선택된 1종 이상일 수 있으며， 바람직하게는 벤질기이다. 이와 같이 dU 염기의 5-위치가 소수성 작용기로 치환되어 변형됨으로써, 변형되지 않은 경우와 비교하여 인테그린 ανβ3와의 친화력 (affinity)이 현저하게 높아지는 이점이 있다.
본 발명에서 압타머 내의 상기 변형된 염기 개수는 5 내지 20개， 바람직하게는 10 내지 17개일 수 있다.
구체예에서 상기 압타머는 서열번호 1 내지 서열번호 56 (염기서열 중
'n'은 변형된 염기 또는 T임)으로 이루어진 군에서 선택된 1종 이상의 염기서열을 포함하여 총 염기 길이가 25 내지 100개, 바람직하게는 30 내지 80개, 더욱 바람직하게는 35 내지 50개인 것일 수 있다.
본 발명의 구체예에서, 상기 압타머는 상기 서열번호 1 내지 서열번호 56으로 이루어진 군에서 선택된 1종 이상의 염기서열로만 이루어지거나, 상기 염기서열 5' 말단, 3' 말단, 또는 양 말단에 3 내지 25개, 구체적으로 5 내지 20개의 염기로 이루어진 염기서열을 추가로 포함하여 총 길이가 30 내지 120개, 35 내지 100개, 또는 45 내지 90개의 염기인 것일 수 있다. 상기 5' 말단, 3' 말단또는 양 말단에 추가로 포함되는 염기서열은 서열번호 57 내지 서열번호 60으로 이루어진 군에서 선택된 것일 수 있다. 예컨대, 상기 압타머는 서열번호 1 내지 서열번호 56으로 이루어진 군에서 선택된 1종 이상의 염기서열의 5' 말단에 TCAGCCGCCAGCCAGTTC (서열번호 57)를 갖고 3' 말단에 GACCAGAGCACCACAGAG (서열번호 58)를 갖는 것， 또는 5' 말단에 AGTTC (서열번호 59)를 갖고 3' 말단에 GACCA (서열번호 60)를 갖는 것일 수 있으나 이에 제한되는 것은 아니다.
한 구체예에서, 본 발명의 압타머는 다음의 서열번호 61 또는 서열번호 62의 염기서열올 갖는 것일 수 있다:
5'- TCAGCCGCCAGCCAGTTC-[N]- GACCAGAGCACCACAGAG-3' (서열번호 61)
5'- AGTTC-[N]-GACCA-3' (서열번호 62),
(상기 염기서열에서 N은 압타머의 가변 중심 서열로서, 25 내지 100개, 바람직하게는 30 내지' 80개， 더욱 바람직하게는 35 내지 50개의 염기로 이루어지며， 각 염기는 A,C, G,T, 이들의 deoxy 형태, 및 dU(deoxyuracil)의 5-위치가 소수성 작용기 (예컨대, 벤질기, 나프틸기, 피롤벤질기， 트립토판로 이루어진 군에서 선택된 1종 이상)로 치환되어 변형된 염기로 이루어진 군에서 독립적으로 선택됨).
앞서 설명한 바와 같이, 상기 N은 서열번호 1 내지 서열번호 56 으로 이루어진 군에서 선택된 것일 수 있다.
본 명세서 및 첨부된 염기서열에 기재된 염기 서열에서 ,'n'은, 특별한 언급이 없는 한 ,Τ또는 dU(deoxyuracil)의 5-위치가 소수성 작용기로 치환되어 변형된 형태를 의미하며, 바람직하게는 dU(deoxyuracil)의 5-위치가 소수성 작용기로 치환되어 변형된 형태이다. 상기 소수성 작용기는 벤질기， 나프틸기, 피를벤질기, 트립토판 등으로 이루어진 군에서 선택된 1종 이상이며, 바람직하게는 벤질기이다. 또한， 상기 압타머는， 혈청 내 안정성 증진을 위하여 ,5' 말단, 3' 말단, 또는 양 말단 모두가 변형되어 혈청 내 안정성이 증진된 것일 수 있다. 상기 변형은 5' 말단， 3' 말단, 또는 양 말단에 PEG(polyethylene glycol), idT(inverted deoxythymidine), LNA(Locked Nucleic Acid), 2'-메톡시 뉴클레오사이드, 2'-아미노 뉴클레오사이드, 2'F-뉴클레오사이드, 아민 링커， 티올 링커, 및 콜레스테를 둥으로 이루어진 군에서 선택된 1종 이상이 결합되어 변형된 것일 수 있다. 바람직한 구체예에서, 상기 압타머는 5' 말단에 PEG(polyethylene glycol;
예컨대, 분자량 500-50,000 Da)가 부착되어 있거나 ,3' 말단에 idT(inverted deoxythymidine)가부착되어 있거나 ,5' 말단에 PEG (예컨대, 분자량 500-50,000 Da)가부착되고 3' 말단에 idT(inverted deoxythymidine)가부착된 것일 수 있다.
상기 'idT(inverted deoxythymidine)'는 일반적으로 뉴클레아제에 대한 내성이 약한 압타머의 뉴클레아제에 의한 분해를 막기 위하여 사용되는 분자 증 하나로서, 핵산단위체는 앞 단위체의 -OH와 다음 단위체의
5'-0H와 결합하여 사슬을 이루지만 idT는 앞 단위체의 3'-OH에 다음 단위체의 3'-OH를 결합하여 3'-OH가 아닌 5'-OH가 노출이 되도록 인위적인 변화를 가함으로써 뉴클레아제의 일종인 3' 액소뉴클레아제 (3'exonuclease)에 의한 분해를 억제하는 효과를 일으키는 분자이다.
인테그린 ανβ3은 다양한고형암 및 암 전이 환자에게서 과발현이 관찰되므로, 본 발명의 압타머는 암 또는 암전이 진단용 조성물로서 사용 가능하다.
따라서, 또 하나의 양태로서， 본 발명은 상기 인테그린 ανβ3에
특이적으로 결합하는 인테그린 ανβ3압타머를 유효성분으로 포함하는 암 또는 암 전이 진단용 조성물에 관한 것이다ᅳ
또 하나의 양태로서, 본 발명은 상기 인테그린 ανβ3에 특이적으로 결합하는 인테그린 ανβ3압타머를 이용한 암 또는 암 전이 진단 정보를 제공하는 방법에 관한 것이다.
바람직하게, 본 발명에서 암 또는 암 전이 진단에 정보를 제공하는 방법은
환자의 생물학적 시료에 본 발명의 압타머를 반웅시키는 단계， 및 상기 생물학적 시료에서의 압타머 의 결합 정도를 측정하는 단계를 포함하고, 환자의 생물학적 시료에서의 압타머의 결합 정도가 정상 시료보다 높은 경우, 상기 환자를 암 환자로 판단하는 것을 특징으로 하는 것 일 수 있다. 따라서 , 상기 방법은 정상 시료에서의 압타머 의 결합 정도를 측정하는 단계를 추가로 포함할 수 있다.
상기 환자는 인간을 포함하는 포유류일 수 있으며 , 바람직하게는 설치류, 또는 인간으로서， 암의 발생 또는 암의 전이 여부를 판단할 대상을 의미 한다.
상기 방법으로 진단에 정보를 제공할 수 있는 암 종류는 인테그린 ανβ3 과 관련된 모든 종류의 암일 수 있으며 , 예컨대， 피부암， 전립선암, 유방암, 자궁경부암, 대장암， 폐암， 담낭암， 췌장암， 및 위 암 등으로 이루어진 군에서 선택된 1종 이상일 수 있다.
상기 정상 시료는 인간올 포함하는 포유류일 수 있으며 , 바람직하게는 설치류, 또는 인간으로부터 얻어진 것으로， 진단에 정보를 제공할 대상 암, 예컨대, 예컨대, 피부암， 전립선암， 유방암, 자궁경부암, 대장암, 폐 암, 담낭암， 췌장암, 및 위 암 등으로 이루어진 군에서 선택된 암의 발생 및 상기 암의 전이가 없는 개체로부터 얻어 진 생물학적 시료를 의 미 한다.
상기 생물학적 시료는 인간을 제외 한 포유류 생체, 인간을 포함한 포유류로부터 분리된 세포, 조직, 혈액, 체액, 타액 등일 수 있다.
상기 생물학적 시료에서의 압타머의 결합 정도를 측정하는 단계는 관련 기술분야에서 통상적으로 사용되는 DNA 압타머 결합 측정 기술을 이용하여 수행될 수 있으며 , 예컨대, 압타머 말단에 형 광 또는 방사성 물질 표지하거나 비오틴을 결합시 켜 형 광 또는 방사성 세기를 측정하거나, 이미지화하여 관찰하는 방법 둥을 이용할 수 있으나, 이에 제한되는 것은 아니다.
한 구체예에서 , 상기 압타머 중 인테그린 ανβ3 과 결합부위가 상이하여 서로 결합에 방해하지 않는 한 쌍의 압타머를 선택하여 , 하나는 기판에 고정시 키고 (capture aptamer), 다른 하나 (detection aptamer)는 말단에 검출가능한 표지로 표지하여 그 세기를 측정 함으로써， 시료 내 인테그린 ανβ3 존재 여부 또는 과발현 여부를 측정할 수 있다. 상기 검출가능한 표지는 형광 물질 또는 방사성 물질 표지 (또는 형광 물질 또는 방사성 물질과 반응 가능한 물질 결합)일 수 있고, 예를 들어， 발색효소 (예 : 퍼옥시다제, 알칼라인 포스파타제), 방사성 동위원소 (예 : 1241, 1251, 1 1 'In, 99mTc, 32P, 35S), 크로모포어 (chromophore), FITC, RITC,
형 광단백질 (GFP(Green Fluorescent Protein); EGFP(Enhanced Green Fluorescent
Protein), RFP(Red Fluorescent Protein); DsRed(Discosoma sp. red fluorescent protein); CFP(Cyan Fluorescent Protein), CGFP(Cyan Green Fluorescent Protein), YFP (Yellow Fluorescent Protein), Cy3, Cy5 및 Cy7.5 등을 예시할 수 있으나, 이 에 제한되는 것은 아니다.
이와 같이 , 압타머를 사용하여 시료 내 인테그린 ανβ3 의 존재 여부 또는 과발현 여부를 확인하는 경우, 기존의 항체 또는 펩타이드를 이용한 검출보다 현저하게 우수한 민감도를 보인다.
아울러 , 본 발명의 압타머는 인테그린 ανβ3 와 특이 적으로 결합하므로 종양성 질환의 발병 부위의 영상화에도 유용하게 사용될 수 있다.
따라서 , 또 하나의 양태로서, 본 발명은 상기 압타머를 유효성분으로 포함하는 종양성 질환의 영상화용 조성물에 관한 것 이다.
또 하나의 양태로서 , 본 발명은 상기 압타머를 개체에 투여하는 단계를 포함하는 종양성 질환의 영상화 방법에 관한 것 이다.
종양성 질환의 영상화 및 진단은, 이에 한정되지는 않으나, 종양성 질환의 초진 목적 뿐만 아니 라, 진행 경과, 종양 치료에 대한 치료 경과, 치료제에 대한 반응 모니터 링 등을 포괄하여 사용할 수 있다. 상기 압타머는 결합 여부의 확인, 검출 및 정량을 용이하게 하기 위하여 , 검출가능한 표지에 링크 (예 : 공유 결합 또는 가교)되어 제공될 수 있다.
바람직하게, 종양성 질환 부위 영상화를 위 한 상기 검출가능한 표지는, 방사선 동위원소, 플루오로포어, 양자점 (quantum dot), 또는 자성 입자, 예를 들어 상자성 입자 (super paramagnetic particles) 또는 초상자성 입자 (ultrasuper paramagnetic particles) 등일 수 있으나, 이에 제한되는 것은 아니다.
바람직하게， 본 발명의 압타머를 나노입자에 결합하여 종양성 질환 부위의 영상화를 위 한 나노입자 조영제 형 태로 제공될 수 있다.
따라서 , 또 하나의 양태로서 본 발명은 압타머를 함유하는 상기 종양성 질환부위의 영상화용 조성물올 포함하는 나노입자 조영제에 관한 것이다. 이 때, 본 발명의 압타머는 인테그린 ανβ3와특이적으로 결합하여 종양성 질환 부위를 표적화하기 위한 표적지향 리간드 (target ligand) 역할을 하여, 능동적 표적지향 방법에 의해 보다 빠르고 정확하게 종양 부위를 진단할수 있다.
본 발명에서 용어, "조영제"란 기관, 진단을 목적으로 하여 혈관이나 조직 등이 보다 잘 보이도톡 인위적으로 대조도의 차를 만들어 영상으로 나타내기 위해서 사용되는 제제를 말한다. 조영제는 연구 대상 표면의 가시도 및 대조도를 증가시킴으로써， 질환또는 손상의 존재 여부 및 그 정도를 결정할 수 있다.
조영제로사용되기 위해서는 생체 내에서 생체적합성 및 생분해성이 우수해야 하고, 생체 내의 안정성이 우수하여 혈액 내에서의 생체분포도가 높아서 층분한 시간 동안 암 조직에 계속적으로 축적되는 특성이 필요하다. 본 발명의 압타머가 결합된 나노입자조영제는 암조직 축척 효율이 매우 높으며, 생체에 독성이 없고 이상 소견을 나타내지 않는 안전한 물질임을 확인되었으므로, 조영제로사용하기에 적합하다.
본 발명의 조영제가 적용될 수 있는 구현예로, 자기공명영상 (magnetic resonance imaging, MRI), X-선 영상화 기술， 및 PET(positron emission tomography)를 비롯한 핵 영상화 등을 들 수 있으나, 이에 제한되는 것은 아니다.
자기공명영상 (MRI)은 자기장 안에서 수소 원자의 스핀이 이완되는 현상을 이용해 신체의 해부학적, 생리학적， 생화학적 정보를 영상으로 얻는 영상 진단 기술을 말한다. 본 발명을 MRI를 위한 나노입자 조영제에 적용하는 경우, 당업계에서 널리 사용되는상자성 나노입자 또는 초상자성 나노입자를 사용할 수 있다. 예를 들어, 상자성 입자의 경우 Gd,Fe,Mn등의 전이금속이온을사용할 수 있고, 초상자성 입자로는 초상자성
산화철 (superparamagnetic iron oxide) 나노입자 등을사용할 수 있다.
바람직한 일구현예로, 본 발명의 나노입자조영제는, 자성 나노입자를 함유하는 코어에 양친매성 화합물을 부가하여 쉘을 형성시킨 구조일 수 있다. 이 때, 양친매성 화합물의 파이렌의 구조를 포함하는 소수성 영역은 파이 -파이 결합의 화학적 결합에 의하여 나노입자의 표면과 결합할 수 있고, 양친매성 화합물의 친수성 영역은 나노입자의 최외곽에 분포하여
수불용성의 나노입자를 수용성 매질 증에서도 안정화시켜 생체 이용률을 극대화시킬 수 있다.
이러한 나노입자의 합성 방법으로는 공침법 (coprecipotation),
열수합성법 (hydrothermal synthesis), 마이크로유화법 (microemulsion; oil-in-water 또는 water-in— oil), 열분해법 (thermal decomposition) 등을 사용할 수 있으나， 이에 제한되는 것은 아니다.
상기 자성 나노입자는 직경이 1 내지 1000 nm, 보다 바람직하게는 2 내지 lOOnm인 입자인 것이 바람직하며， 상기 직경을 갖는 금속, 자성 물질, 또는 자성 합금을 사용할 수 있다. 상기 금속은 특별히 제한하지는 않으나， Pt, Pd, Ag, Cu, 또는 Au등을 단독 또는 2종 이상사용할 수 있다. 상기 자성 물질은 특별히 제한하지는 않으나, Co, Mn, Fe, Ni, Gd, Mo, MM'204, 또는 MxOy (M 및 M'는 각각 독립적으로 Co, Fe, Ni, Mn, Zn, Gd, 또는 Cr을 나타내고， x 및 y는 각각 식 "0<x≤3" 및 "0<y≤5"올 만족한다.) 등을 단독 또는 2종 이상 사용할 수 있다. 상기 자성 합금은 특별히 제한하지는 않으나, CoCu, CoPt, FePt, CoSm, NiFe, 또는 NiFeCo 등을 단독 또는 2종 이상사용할 수 있다. 또한， 상기 자성 나노입자는 양친매성 화합물과의 결합올
안정화시키기 위하여 유기성 표면안정제와 결합될 수 있다. 자성 나노입자와 유기성 표면안정제의 결합은 자성 나노입자의 전구물질에 유기성
표면안정제가 배위하여 착화합물을 형성하여 이루어질 수 있다.
상기 유기성 표면안정제는 상기 나노입자의 상태와 크기를
안정화시킬 수 있는 유기 기능성 분자를 의미하며, 예를 들어 계면활성제를 들 수 있다. 상기 계면활성제는 알킬 트라이메틸암모늄 할라이드 (alkyl trimethylammonium halide)를 포함하는 양이온 계면활성제, 올레산 (oleic acid), 라우르산 (lauric acid), 또는 도데실산 (dodecylic acid)과 같은 포화 또는 불포화 지방산, 트리옥틸포스핀 옥사이드( 0(^11511031)1 ½ 0 06:丁01>0)，
트리옥틸포스핀 (trioctylphosphine: TOP), 또는
트리부틸포스핀 (tributylphosphine)과 같은 트리알킬포스핀 또는
트리알킬포스핀옥사이드, 을레익아민 (oleic amine), 트리옥틸아민 (trioctylamine), 또는 옥틸아민 (octylamine)과 같은 알킬아민 (alkyl amine), 또는 알킬티올 (alkyl thiol)을 포함하는 중성 계면활성 제, 및 소디움 알킬 설페 이트 (sodium alkyl sulfate), 또는 소디움 알킬 포스페 이트 (sodium alkyl phosphate)을 포함하는 음이온 계면활성 제를 사용할 수 있으나, 이에 제한되는 것은 아니다.
또한， 상기 양친매성 화합물은 매트릭스 내에 나노입자를
분포시키거나, 나노입자의 표면과 결합할 수 있고， 표적지 향 리간드를 고분자의 일 말단에 화학적으로 결합시킬 수 있다.
양친매성 화합물의 소수성 영 역은 파이 렌 구조를 포함한 물질이 결합된 소수성 화합물을 포함할 수 있다. 상기 소수성 화합물은 포화 지방산 : 불포화 지 방산 또는 소수성 고분자 등을 단독 또는 2종 이상 사용할 수 있다. 상기 포화 지 방산은 특별히 제한되지 않으나, 부티르산, 카프로산， 카프릴산, 카프릭산, 라우르산 (도데실산), 미리스트산， 팔미트산, 스테아르산， 에 이코사노산, 또는 도코사노산 등을 단^ 또는 2종 이상 사용할 수 있다. 상기 불포화 지 방산은 특별히 제한되지 않으나, 올레산, 리놀레산, 리놀렌산, 아라키돈산， 에 이코사펜타노산， 도코사핵사노산, 또는 에르크산 등을 단독 또는 2종 이상 사용할 수 있다. 상기 소수성 고분자는 특별히 제한되지 않으나, 폴리포스파젠， 폴리 락티드, 폴리 락티드-코-글리콜라이드，
폴리카프로락톤， 폴리안하이드라이드, 폴리 말릭산 또는 그 유도체,
폴리알킬시아노아크릴레이트, 폴리하이드록시부틸레이트, 폴리카보네 이트, 폴리오르소에스테르, 소수성 폴리 아미노산, 또는 소수성 비 닐계열 고분자 등 단독 또는 2종 이상 사용할 수 있다. 상기 파이 렌 구조를 포함하는 물질은 특별히 제한되지 않으나， 파이 렌 (pyrene), 파이 렌부티 릭산 (Pyrenebutyric acid), 파이 렌 메틸 아민 (Pyrene methylamine), 아미노 파이 렌 (l-Aminopyrene), 파이 렌 보로닉 산 (Pyrene- 1-boronic acid), 파이 렌 구조를 포함하는 유기 분자 등을 단독 또는 2종 이상 사용 할 수 있다.
양친매성 화합물의 친수성 영 역은 폴리알킬렌글리콜 (PAG),
폴리에 테르이미드 (PEI), 폴리 비닐피롤리돈 (PVP), 친수성 폴리 아미노산 (PAA), 친수성 비 닐계 고분자, 친수성 아크릴계 고분자 또는 텍스트란 (Dextran), 히 알루론산 (Hyauronic acid) 등의 다당류계 고분자 둥을 단독 또는 2종 이상 사용할 수 있다. 또한, 본 발명 에 따른 자성 나노입자는 친수성 영 역에 압타머를 도입하여 자성 나노입자에 표적지향성을 제공할 수 있다. 압타머는 5'- 및 3'- 말단에 -NH2, -SH, -COOH 등의 작용기가 있어 활성성분 결합영 역의 작용기와 결합하는데 유용하게 이용될 수 있다. 또한, 나노입자의 표면에 카르복실산， 포스페이트, 설페 이트, 아민기， 하이드록시 기, 티을기 등의 기능기를 개질하여 압타머 의 결합을 용이하게 할 수 있다.
본 발명의 영상화 조성물 또는 나노입자 조영 제는 영상학적으로 허용 가능한 담체를 함께 사용할 수 있으며 , 상기 영상학적으로 허용 가능한 담체는 의 약 분야에서 통상 사용되는 담체 및 비히클을 포함하며，
구체적으로 이온 교환 수지， 알루미나， 알루미늄 스테아레이트， 레시 틴, 혈청 단백질 (예, 사람 혈청 알부민), 완충 물질 (예, 각종 인산염 , 글리신, 소르브산, 칼륨 소르베 이트, 포화 식물성 지 방산의 부분적 인 글리세라이드 흔합물)， 물, 염 또는 전해질 (예, 프로타민 설페이트, 인산수소이나트륨, 인산수소캄륨, 염화나트륨 및 아연 염)， 교질성 실리카, 마그네슘 트리실리 케이트, 폴리 비닐피롤리돈, 셀를로즈계 기 질, 폴리에틸렌글리콜, 나트륨
카르복시 메 틸셀를로즈, 폴리아릴레이트， 왁스, 폴리에 틸렌글리콜 또는 양모지 등을 포함하나 이에 제한되지 않는다. 또한, 상기 성분들 이외 에 윤활제， 습윤제, 유화제， 현탁제, 또는 보존제 등을 추가로 포함할 수 있다.
암 전이는 암 관련 사망에 가장 주된 원인이다. 특히， 암 환자들 중에는 전이가 진행된 후에 진단되는 경우가 많고 수술 및 화학요법에도 불구하고 높은 재발률을 나타내기도 한다. 따라서, 암전이의 치료는 암 치료의 주요 목표이다. 새로운 기관의 미세환경에서 전이 암이 성장하기 위해서， 암세포는 다양한 유형의 스트레스와 한계 (rate-limiting steps)를 극복해야 한다. 인테그린 ανβ3 은 암세포에서 과도하게 발현하며 전이성 및 악성 종양으로의 진행을 촉진하는 것으로 알려져 있으므로, 암 또는 암전이의 진단과 치료를 위 한 유력 한 표적 이 될 수 있다.
인테그린 ανβ3 에 대한 몇몇 항체들과 펩타이드들이 전이를 포함하는 인간 암의 치료 전략뿐 아니라 항암제- 또는 방사성동위 원소 -캐리어로서 제안되어 왔다. 그러나, 이들 단백질 기 반의 제체는 낮은 친화성 (uM range Kd)과 바람직하지 못한 약물동태학적 성 질 (예컨대, 종양 침투성 이 낮고 신속하게 제거됨)을 갖기 때문에, 표적 운반에 적용되는데 한계가 있고, 따라서 개선된 약물동태학적 성질 및 혈청 안정성을 갖는 고친화성 분자의 개발이 증요해지고 있다.
반면， DNA 압타머는 화학적으로 합성 가능하고 생체내 적용을 위한 변형이 용이하고 종양조직으로의 침투능이 우수하기 때문에 암 표적화 분자로서 다양한 이점을 갖는다. 천연 을리고뉴클레오타이드는
뉴클리에이즈에 의한 가수분해에 민감하기 때문에， 본 발명자들은 뉴클리에이즈에 대한 저항성을 증가시키면서도 결합 친화도를 높이고 slow off-rate 감소시키기 위하여, dU(deoxyuracil)의 5-위치가 소수성 작용기인 벤질기로 변형된 뉴클레오타이드를사용하여 SELEX를 수행하였다.
바람직하게， 본 발명의 압타머는 인테그린 ανβ3-매개 전이의 진단 또는 분자 수준 영상화에 유용할 수 있다.
본 발명의 구체적인 실시예에서는， MR조영제로 사용할 목적으로 본 발명의 압타머가 결합된 자성 나노입자를 제조하였고 (실시예 2), 상기 자성 나노입자가 암세포에 대해 표적지향성올 가진다는 것을 확인하고, 나아가 상기 자성 나노입자를 암 동물모델에 투여하여 MR 영상올 확인하였을 때 자성 나노입자가 암 조직 내에 축적되어 효과적으로 암조직을 영상화한다는 것을 확인하였다 (실시예 3). 또한, 생체내 안전성 평가를 통하여 상기 압타머가 생체에 독성이 없고 이상 소견올 나타내지 않는 안전한물질임을 확인하였다 (실시예 3).
또한， 인테그린 ανβ3에 대한 표적지향성이 이미 잘 알려져 있는 cyclo (Arg-Gly-Asp-D-Phe-Lys) (c GD) 펩타이드가 결합된 자성 나노입자를사용한 경우와 비교하였을 때, 동물 모델에서 c-RGD가 결합된 자성 나노입자의 경우 1시간이 지난 후 영상 대조도가 감소하였음에 반하여 본 발명의 압타머가 결합된 자성 나노입자의 경우 24시간까지 지속적인 영상 대조 효과를 나타내었으며, 신호 강도도 더 강하게 나타났고, 암 조직에 보다 많은 양이 축적된 것으로 확인되었다 (도 8 및 도 9). 따라서， 본 발명의 DNA압타머가 기존 제제인 cRGD 펩타이드보다도 더 우수한 암 표적지향성 영상화 효과를 나타냄을 알 수 있다.
따라서, 본 발명의 압타머는 인 비트로 및 인 비조에서 암 환자의 전이 가능성 및 암 예후를 측정하는데 유용하게 사용될 수 있다.
단백질 기 반의 기존 제제와 비교하여， 본 발명의 DNA 압타머는 보다 신속한 종양 흡수 (uptake), 보다 신속한 혈액 제거 및 보다 지속적 인 종양 정 체 (tumor retention)을 나타냄으로써 , 보다 높은 혈액에 대한 종양 비율로 현저 한 이 미지화가 가능하게 한다. 따라서 , 본 발명 의 압타머는， 특히 종양이 전이된 생체 미세 환경 에서 인테그린 ανβ3발현 암 세포의 생체 내 이 미지화에 유용하게 사용될 수 있다.
【발명의 실시를 위 한 형 태】
이하, 본 발명을 실시 예에 의해 상세히 설명한다. 단, 하기 실시 예는 본 발명을 예시하는 것 일 뿐, 본 발명 이 하기 실시 예에 의해 한정되는 것은 아니다.
<실시 예 1> 인테그린 ανβ3 압타머의 발굴
1.1: 변형핵산 라이브러리 합성
SELEX에 필요한 single strand modified DNA library를 제조하기 위하여 , 5' 말단에 Biotin이 결합된 antisense library [5'-Biotin-d(CTC TGT GGT GCT CTG GTC-(N x 40)-GAA CTG GCT GGC GGC TGA -3'; (서 열번호 64)]를 합성하였다. 이와 같이 합성된 antisense를 가지고 20μΜ 5' primer(TCA GCC GCC AGC CAG TTC; 서열번호 65)와, 0.5mM dNTP(ATP, GTP, CTP, BzdUTP), 0.25U/ul KOD XL(KOD XL DNA polymerase, Novagen), 10X extension buffer(1.2M Tris-HCl pH7.8, lOOmM KC1, 60mM (NH4)2S04, 70mM MgS04, 1% Triton X-100, lmg/ml BSA) 상에서 70°C에서 1 시간 동안 인큐베 이션하여 double strand DNA를 제조하였다.
여기 에 20mM NaOH 이용하여 elution한 뒤， 80mM HC1용액으로 중화하여 single strand modified DNA library를 제조하였다. 제조된 DNA library는 Amicon ultra-15(Millipore)를 이용하여 농축한 뒤 UV
spectrophotometer로 정량하였다 .
1.2: SELEX 방법으로 인테그린 (¾^3에 대한 압타머 발굴
인테그린 ανβ3 (R&D systems,3050-AV)에 결합하는 DNA aptamer를 선별하기 위 하여 SELEX 기 법을 이용하였다.
(1) 인테그린 ανβ3 태깅 (tagging): Non-tag protein 인 인테그린 ανβ3에 EZ-Link NHS-PEG4-Biotin(Thermo scientific)을 사용하여 biotinylation 후 SELEX 사용에 맞게 분주해두었다.
(2) 인테그린 ανβ3 와의 결합:
먼저 상기 합성된 Library lnmole을 selection buffer(200mM HEPES, 510mM NaCl, 25mM KCl, 25mM MgCl2)에 넣고 95 °C , 70°C , 48°C, 37°C에서 각각 5분간 반응시 킨 후, Negative selection을 위하여 10X protein competition buffer(K^M prothrombin, ΙΟμΜ casein, 0.1%( /v) HSA (human serum albumin, SIGMA) 10|aL를 혼합한 뒤 , 상층액 이 제거 된 Dynabeads® MyOne™ Streptavidin Cl(SA bead)(50%(v/v) slurry, lOmg/ml lnvitrogen)에 첨가하여 37°C에서 10분간 반응 시 켰다.
Negative selection반웅 후， 상층 액만을 취하여 새로운 tube에 옮긴 후, biotinylation 된 인테그린 ανβ3와 결합시 킨 Dynal MyOne SA beads에 37°C에서 1시간 동안 반응시켰다. Selection buffer(200mM HEPES, 510mM NaCl, 25mM KCl 25mM MgCl2) 100|LiL로 DNA와 인테그린 ανβ3 복합체와 결합한 Dynal MyOne SA beads를 5번 세 척하였다. 5번째 세척시에는 새로운 plate에 옮겨 세척하였다. 2mM NaOH 용액 85μί를 첨가하여 표적 에 결합하는 library를 elution한 뒤 8mM HC1 용액 20μί로 neutralization하였다.
(3) 증폭:
표적에 결합하는 library DN A를 QPCR(quantitative PCR, IQ5 multicolor real time PCR detection system, Bio-rad)을 이용하여 증폭하였다. 앞서 library 제조에 사용된 5' primer(TCA GCC GCC AGC CAG TTC; 서 열번호 65)와 3' primer(Biotin-CTC TGT GGT GCT CTG GTC; 서 열번호 66) 각각 5uM (5 X QPCR master Mix, Novagen), 0.075U/ul KOD(Novagen), ImM dNTP(Roche Applied science), 25mM MgCl2, 5XSYBR green I (Invitrogen)를 총부피가 125μί가 되도록 흔합하여， 96°C 15초， 55 °C 10초, 68 °C 30분 조건으로 1 cycle, 그리고 96 °C 15초， 72 °C 1분 조건으로 30 cycle을 반복하여 double strand library을 제조하였다.
(4) eDNA 제조:
eDNA는 enzymatic DNA로 DNA template와 polymerase를 이용해 생산한 압타머를 의미 한다. 상기 QPCR을 통하여 만들어진 DNA library를 25μL Myone SA bead(Invitrogen)에 상온에서 10분간 흔합하여 고정하였다. 이 때 흔합된 DNA 양은 QPCR product로 60ul로 하였다. 20mM NaOH 용액을 첨 가하여 single strand DNA로 만들어주었다. 그리 고 상기 실시 예 1.1의 Library 제조와 같은 방법으로 변형된 핵산을 포함하는 DNA를 합성하여 다음 round에 사용하였다, SELEX round는 총 8희 수행하였고 보다 선택적 인 결합을 위하여 4희부터 6회까지 그리 고 7회부터 8회까지 각각 DNA와 단백질 (인테그린 ανβ3) 복합체를 10mM DxSO4(sigma)용액에 1/200, 1/400로 회석하여 DNA aptamer를 선별하였다.
(5) Pool binding assay:
인테그린 ανβ3와 SELEX round가 진행된 DNA po이의 결합력을 알아보기 위하여 filter binding assay을 수행하였다. 먼저 수행된 6 round와 8 round의 pool을 a-P32ATP(Perkin Elmer)와 TdT(Terminal deoxynucleotidyl transferase, NEB)로 말단에 표지 하였다. 상기 SELEX 과정을 통하여 얻어진 library DNA ΙμΜ, 0.25μL α-Ρ32ΑΤΡ(5μΜ, perkinelmer), 0.25μί TdT, 및 10XNEB buffer4(NEB) lOj L reaction volume으로 37°C에서 30분간 반응시 키고， 70 °C에서 10분간 incubation 하여 , TdT를 불활성화시 켰다. 표지 된 DNA po이은 Micro spin G-50 column(GE healthcare)을 이용하여 정제하였다.
표지된 DNA pool 20,000cpm을 ΙΟΟμΙ^ lxSB buffer(200mM HEPES, 510mM NaCl, 25mM KCl, 25mM MgCl2)에 넣고 95 °C：에서부터 1초에 (U °C씩 3TC까지 천천히 냉각시 켰다. 그리고, buffer (200mM HEPES, 510mM NaCl, 25mM KCl, 25mM MgCl2)를 이용하여 인테그린 ανβ3 (R&D systems, 3050- AV)을 100nM에서 12 point로 serial dilution한 뒤 , 상기 가열 및 넁각시 킨 DNA pooI 3C^L를 각각 첨가하여 37°C에서 30분간 반응시 켰다. Nylon membrane(GE healthcare)에 DNA와 인테그린 ανβ3의 혼합물을 각각 2 씩 spotting 한 뒤 zorbax resin( Agilent) 5.5(止를 첨가하였다. 그리고 미리 IX SB buffer(200mM HEPES, 510mM NaCl, 25mM KCl, 25mM MgCl2) 5C^L로 적셔놓은 Durapore
filter(Millipore)에 넣고 vacuum을 걸어주었다. 그리고 membrane filter를
ΙΟΟμί의 IX selection buffer(200mM HEPES, 5 lOmM NaCl, 25mM KCl, 25mM MgCl2)로 씻어주었다. Filter plate를 image plate에 overnight expose한 뒤
FLA-5100(Fuji)으로 image를 정 량화 하였다.
상기 얻어진 인테그린 ανβ3와 SELEX round를 거친 DNA po이간의 결합 친화력을 다음의 표 1에 나타내었다. 상기 결합 친화력은 상기 filter binding assay를 통하여 얻어진 값을 SigmaPlot 11 (Systat Software Inc.)올 이용하여 구하였으며, 표 1 증 Bmax는 input 대비 결합한 압타머의 비율을 나타낸 것이고, Kd(dissociation constant)는 친화력을 나타낸다.
【표 1】
Figure imgf000020_0001
상기 표 중, library는 사용된 벤질기 변형핵산 무작위 염기서 열을 갖는 DNA이고, pool binding 은 특정한 library를 이용한 앞서 기 재된 SELEX 단계 중 8 Round 후 얻어지는 ssDNA Po이을 의미 한다.
(6) 인테그린 ανρ3 압타머 염기서열 분석 :
8번의 SELEX round를 거친 후 결합 친화력 이 가장 높은 8 Round ssDNA Po이을 위에 언급한 QPCR 방법으로 double strand DNA로 증폭한 뒤 TA cloning kit(SolGent)를 이용하여 cloning하였다. 그리고 vector상에 존재하는 M13 primer(CAGGAAACAGCTATGAC; 서 열번호 67)을 가지고 sequencing하여 다음과 같은 sequence를 얻었다.
얻어진 인테그린 ανβ3에 매우 특이 적으로 결합하는 DNA aptamer는
5'- TCAGCCGCCAGCCAGTTC-[Core sequence]- GACCAGAGCACCACAGAG-3 ' (서 열번호 61)
의 염 기서 열을 가지며, 여기서 Core Sequence는 아래의 표 2에 나타낸 바와 같고, 이 증에서 5은 benzyl-dU를 나타낸다.
【표 2】
Figure imgf000020_0002
Figure imgf000021_0001
Figure imgf000022_0001
Figure imgf000023_0001
Figure imgf000024_0002
= Benzyl-dU(BzdU)： [5-(N-Benzylaminocarbonylamide)-2,-deoxyuridine]
Figure imgf000024_0001
A = 2 -deoxyAdenosine
G = 2'-deoxyGuanosine
C = 2'-deoxyCytidine
T = 2'-deoxyThymidine(Thymidine)
상기 발굴된 인테그린 ανβ3 압타머들을 다음과 같이 유사 family로 분류하였다 (서 열 상동성은 염기서 열의 85% 상동성을 기준으로 함):
【표 3】
Figure imgf000025_0001
Figure imgf000026_0001
#11 clone의 경우 56개의 sequence중 8번의 같은 염기서열이 반복되어 나타났다. 그리고 #21도 8번, #12, #25는 6번, #17은 3번， #2， #16， #19, #27은. 2번의 반복되는 염기서열이 나타났다.
상기 발굴된 압타머의 서열 상의 유사성을 clone들 간의 염기서열 중 반복적으로 나타나는 부분과 빈도를 측정하여 확인하였으며, 그 결과는 다음과 같다：
57.144% (32/56) Families
[44] S003-A4-044-T7_D06 Count: 10.02%
AGCTAACGACATTTTACATCGGTAAGTCAAACCTCAGCACT
TTTACATCGGTAA Pattern 6X6 times
ATTTTACAT Pattern_7 X 5 times
ACATAGGTAA _ Pattern_8 X 9 times
TTTTACATCGGTAA Pattern 13X5 times
ACTTTTACATCGGTAA Pattern 14 X 5 times
CATTTTACATCGGTAAG Pattern 15 X 3 times
Score: 33
[40] S003-A4-040-T7_H05 Count: 10.02%
TCGAGCCATGGTCGAGCCCCATTTTACATCGGTAAGGGCT
TTTACATCGGTAA Pattern 6X6 times
ATTTTACAT Pattern_7 X 5 times
ACATAGGTAA Pattern 8X9 times TTTTACATCGGTAA Pattern_13 X 5 times
ACTTTTACATCGGTAA Pattern_14 X 5 times
CATTTTACATCGGTAAG Pattern_15 X 3 times
Score: 33
[4] S003-A4-004-T7_D01 Count: 1 0.02%
TACTAAACACGCAGACTGAAATTTTACATCGGTAACAGTC TTTACATCGGTAA Pattern— 6 X 6 times ATTTTACAT Pattern_7 X 5 times ACATAGGTAA Patternᅳ 8 X 9 times TTTTACATCGGTAA Pattern_13 X 5 times
ACTTTTACATCGGTAA Pattern_14 X 5 times
GGTAACAG_ Pattern_16 X 3 times
Score: 33
[48] S003-A4-048-T7_H06 Count: 1 0.02%
TCTGGCAACTTTTACATCGGTAAGCCTATTGAGCGCGACT TTTACATCGGTAA Pattern_6 X 6 times ACATAGGTAA Pattern_8 X 9 times TTTTACATCGGTAA Pattern_13 X 5 times
ACTTTTACATCGGTAA Pattern_14 X 5 times CATTTTACATCGGTAAG Pattern 15 X 3 times
Score: 28
[39] S003-A4-039-T7_G05 Count: 1 0.02%
GACTTTTACATCGGTAAAGAACTCAGATATGCACAAGTTA TTTACATCGGTAA Pattern_6 X 6 times
ACATAGGTAA Pattern 8 X 9 times ᅳ TTTTACATCGGTAA Pattern_13 X 5 times
ACTTTTACATCGGTAA Pattern_14 X 5 times
Score: 25
[54] S003-A4-054-T7_F07 Count: 1 0.02%
CGAACGGAATGGATCAGTCCTGGGCAATTTTACATAGGTAA
CAATTTTA Pattern 1 X 3 times
ATTTTACAT Pattern_7 X 5 times
ACATAGGTAA Pattern 8 X 9 times
GGCAATTTTACATAGGTAA Pattern 9 X 2 times
Score: 19
[20] S003-A4-020-T7_D03 Count: 1 0.02%
AGCGTGAGACAGGTGTGAGGAGGCAATTTTACATAGGTAA CAATTTTA Pattern_l X 3 times
ATTTTACAT Pattern 7 X 5 times ACATAGGTAA Pattern_8 X 9 times GGCAATTTTACATAGGTAA Pattern_9 X 2 times
Score: 19 fl] S003-A4-001-T7_A01 Count: 1 0.02%
TCGGAGGCTTTACATCGGTAACCGAGACTTAGGACTGTTG TTTACATCGGTAA Pattern_6 X 6 times ACATAGGTAA Pattern_8 X 9 times GGTAACAG Pattern 16 X 3 times
Score: 18
[15] S003-A4-015-T7_G02 Count: 1 0.02%
ACGTAAAGGAGACGGATTTTGACCCGTGTATACTCGACGC
CCCGTGTA Pattern_2 X 3 times
GATTTTGACCCGTGT Pattern_3 X 3 times
ATTTTGACCCGTGTAT Pattern 4 X 2 times
CTCGACGC Pattern 11 X 4 times
CCGTGTATCCTCGA Pattern 12 X 3 times
Score: 15
[25] S003-A4-025-T7_A04 Count: 60.11%
GTTTTAAGAAATTAGCACACCGTTGACTTGTTTAGTGGCG TTGTTTA Pattern— 10 X 14 times
Score: 14 ώο
[21] S003-A4-021-T7_E03 Count: 80.14%
CGAGGGAGTTATGGAGATTGTGTTGTTTAAGGTCGGAACT TTGTTTA Pattern一 10 X 14 times
Score: 14
[51] S003-A4-051-T7_C07 Count: 1 0.02%
TATTGGGAGGTGGGGGCCATTTACATAGGTAACAGCCACT ACATAGGTAA Pattern_8 X 9 times GGTAACAG _ _ Pattern— 16 X 3 times
Score: 12
[33] S003-A4-033-T7_A05 Count: 1 0.02%
TCGTATTTTGACCCGTGTATCCTCGATGCGGTTAGCAGCA CCCGTGTA Pattern_2 X 3 times ATTTTGACCCGTGTAT Pattern— 4 X 2 times
CCGTGTATCCTCGA Pattern_12 X 3 times
Score: 8
[56] S003-A4-056-T7_H07 Count: 1 0.02%
AGGCTAGCGGGACAGTATTTGAACCGTGTATCCTCGACGC CTCGACGC Pattern_ll X 4 times CCGTGTATCCTCGAᅳ Pattern_12 X 3 times %ΖΟΌ ΐ ioD~ .x-eoo-^v-eoos le] oc
sueqdjo (9S/e) %9 5
ssuip e X S «-»3»Bd 3VI13IX
92
I10VVV30VIOIOVVV1VOV3300VV3V3V1I3XIV3I3I
%W)OZ - oj xoa^x-zoo-frv-eoos [z]
ε :3Jo:>s
ssuiij e X I VIXIXVV3 02
OVVI30DIVOVXXXXVV3VIODVV03II003D30V3IODD
%30"0 ΐ ' uno3 ZOa JrOIO- ^OOS [Oil
Figure imgf000031_0001
VVID3ODVO3I3OIIXOXO333VOXXXXVOXVI0V0IO0V
%W0Z： iun(o ^03~iX-Z.∑0-frV-£00S Lll
:3403S 0/CT0ZaM/X3d 62 0£9U0/ 0Z OAV TAGTTGTACATTCTGAGTTTAGAGCAAATAATAGAGTCCA
[32] S003-A4-032-T7_H04 1 0.02%
TTCAGACCAATTATGGTAATTTCTCAAATCTGAGTGTCAT
[45] S003-A4-045-T7_E06 1 0.02%
(7) Clone binding assay:
반복적으로 관찰된 염기서 열을 갖는 clone의 결합 친화력을 알아보기 위하여 위의 pool binding assay와 같은 방법으로 filter binding assay를 수행하였다. 상기 결합 친화력은 상기 filter binding assay를 통하여 얻어진 값을 SigmaPlot 11 (Systat Software Inc.)을 이용하여 구하였으며， 그 결과를 아래의 표 4에 나타내었다. 표 4 중 Bma> ^ input 대비 결합한 압타머의 양을 나타낸 것으로 , 1에 가까울수록 좋은 성능을 의 미하는 것 이고,
Kd(dissociation constant)는 친화력을 나타내는 수치로 수치가 낮을수록 결합력 이 높음을 나타낸다.
【표 4]
Figure imgf000032_0001
총 5종류의 clone을 가지고 assay하였고 이들 증 하나는 ¾를 얻을 수 없었고 #25 clone(S003-A4-025-T7_A04)의 ¾가 17.57nM로 표적 단백질에 가장 높은 친화력을 나타내는 결과를 보였다.
(8) Full length 압타머로부터 truncation을 통한 최적의 압타머 서열 결정 :
SELEX 과정을 통하여 cloning된 DNA 압타머는 sequence가 80mer 전후의 길이를 가지는데, 이 정도의 길이가 타겟 단백질과의 해리상수 (¾)가 적합한 범위 인 것으로 선별되 었다. 이 증 가장 좋게 평가되는 클론인 #25 Clone(2100-25-))을 가지고 프라이 머 영 역을 일부 포함한
5'-AGTTC-[Core sequence]- GACCA-3' (서 열번호 62)
의 염 기서 열을 가지는 50mer의 압타머 2100-25-02를 합성하였다 (표 5 참조). 표 5에서 염기서 열 내에 5는 benzyl-dU를 나타낸다.
【표 5]
Figure imgf000033_0001
(9) 인테그린 ανβ3 압타머 합성 :
압타머는 핵산전용 고정상합성기 인 Bioautomation사의 Mermade 12 합성 기를 사용하여 Solid Phase Oligo Synthesis 방법으로 자체 합성하였다.
(10) 인테그린 ανβ3 압타머 합성 분리 /정제 /동정 및 QC:
상기 변형 핵산체를 가지는 발굴된 압타머들을 oligonucleotide 합성기 (Bioautomation, Mermadel2)를 이용하여 so lide phase D-cyanoethyl phosphoramidite chemistry로 합성하였으며， 합성 후 CPG(200nmole synthesis column, ΙΟΟΟΑ(ΜΜΙ-ΙΟΟΟ-))를 cleavage 용액 [t-butylamine:methanol:water(l : l :2 부피 비)]에 넣고 70 °C에서 5시간 동안 cleavage/deprotection 후 진공 건조를 시 킨 다음, HPLC(GE, AKTA basic)를 이용하여 분리 /정 제하였다. 사용한 column은 RP-C 18 column (Waters, Xbridge OST C 18 10x50mm)이고 UV 254 nm/290nm,flow rate: 5ml/min, 온도: 65 °C의 조건으로 0.1M TEAB/Acetonitrile Buffer를 이용하였다. 이들 압타머들은 모두 LC-ESI MS spectrometer(Waters HPLC systems(Waters) + Qtrap2000(ABI))로 0.02% 오차범위 내에서 정확한 분자량을 측정하였으며 HPLC를 이용한 순도측정에서 80-90%를 얻을 수 있었다.
<실시예 1> 인테그린 ανβ3 압타머가 결합된 자성나노입자의 제조 2.1: 열분해 화학반웅을 이용한 고민감도 자성 나노크리스탈의 제조
7nm의 마그네틱 나노크리스탈 (magnetic nano-crystals, MNCs) 는 각각 0.6몰의 도데실산, 도데실 아민을 215 °C의 벤질에 테르 용매에서 철 트리아세틸아세토네 이트과 망가네즈 트리아세틸아세토네 이트 (Aldrich)를 2 시간 동안 가열하고， 315 °C에서 1시간 동안 열분해 화학반응 (thermal decomposition)하여 합성하였다.
상기 7nm의 MNCs (10 mg/ml) 및 도데실산 (0.2몰), 도데실 아민 (0.1몰)， 철 트리아세틸아세토네 이트과 망가네즈 트리 아세틸아세토네 이트 포함하는 벤질에 테르 용액을 1 15 °C에서 30분, 215 °C에서 2시간, 315 °C에서 1시 간 가열하여 12nm 의 MNCs 을 제조하였다.
2.2: 친수성 부분에 인테그린 ανβ3 압타머를 결합시킬 수 있는 작용기가 결합된 양친매성 화합물의 중합
5g 의 폴리옥시에틸렌 솔비 탄 모노을레이트 (Polyoxyethylene sorbitan monooleate, Polysrobate 80), 1.5g 의 숙시닉 안하이드라이드 (succinic anhydride, SA), 1.8g 의 4-다이 메틸아미노피 리 딘 (4-dimetlaminopridine, DMAP), 1.5g 의 트리에 틸아민 (triethylamine, TEA) 을 120mL 의 1,4-다이옥센 (1,4-Dioxane) 용매에 첨가하여 48 시간 동안 마그네틱 바 (magnetic bar) 를 이용하여 교반시킨다. 반웅 종료 후 1,4-다이옥센을 동결건조를 통해 제거하고, 용매가 제거된 생성물은 사염화탄소 (CC ) 에 분산시 킨 후 필터 링을 통해 잔류하는 반웅물을 제거 한다. 필터 링 된 용액은 에 틸에스터 (ethyl ether) 를 통해 침전시 키고, 침 전물을 건조하여 인테그린 ανβ3 압타머 (AptameravP3, Apt„vp3) 가 결합할 수 있는 작용기 (COOH) 를 가지면서 동시에 양친매성을 나타내는 화합물 (tri-carboxylated olysorbate 80, P80-triCOOH) 을 얻는다. 적외선 스펙트럼을 통해 P80-triCOOH 의 제조 시 형성되는 에스터 (-COO-) 구조를 확인한 결과를 도 1 에 나타내었다.
2.3: 인테그린 (xv|33 압타머를 결합 시킬 수 있는 양친매성 화합물로 코팅된 자성 나노입자의 제조
오일상인 10mL 의 핵산 (n-hexane)에 용해된 실시 예 2.1 에서 제조한
MNCs 10mg 과 수용상에 용해된 실시 예 2.2 에서 제조한 P80-triCOOH lOOmg 를 흔합시 킨 후 이 흔합물을 450W 의 초음파에 의해 10분 동안 포화시 킨다. 상이 에멀견을 12시간 동안 상온에서 교반하여 오일상을 증발 시 키고 원심분리 필터 (centrif gal filter, Centriprep YM-3, 3 kDa NMWL) 를 사용하여 원심분리 (RPM: 18,000) 후 과량의 P80-triCOOHH 가 제거된 압타머 결합 가능 양친매성 화합물로 코팅 된 자성 나노입자 (magnetic nano-particles, MNPs) 를 제조하였다.
2.4: 암 및 암전이 진단이 가능한 인테그린 ανβ3 압타머가 결합된 자성나노입자의 제조
인테그린 ανβ3 압타머 (AptameravP3, AptavP3) 가 결합된 자성 나노입자
(aptamerav 3-conjugated magnetic nano-particles, Aptavp3-MNPs) 를 제조하기 위해 상기 실시 예 2.3 에서 제조된 MNPs 표면의 작용기 (COOH) 에 Aptavp3 를 결합하여 시 키는 과정을 도 2 에 나타내었다. 2.5mL 의 포스페 이트 버퍼 용액 (phosphate buffer solution, 10mM, pH7.4) 에 상기 실시 예 2.3 에서 제조된 MNPs 와 38.2 μιηο1 의 l-ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC), 38.2 μχηοΐ 의 sulfo—n-hydroxysuccinimide (sulfo-NHS), 0.2 mg (1 1.5 nmol) 의
AptavP3 를 용해 시 킨 후 4 °C 에서 4시간 동안 반응시 켰다. 4시간 뒤 , 이 흔합물서 Centrifogal filter (Amicon Ultra) 를 이용하여 결합하지 않은 Aptav|33 를 분리하였다.
동적 레이 저 광 산란법을 사용하여 Aptavp3-MNPs 의 크기를 측정하고, 투과 전자 현미경을 통해 입자의 형 태를 확인하였으며 , 진동 시료
마그네토미터 (vibration sample magnetometer, VSM) 을 이용하여 초상자성을 확인한 후, 열분석기 (thermogravimetric analyzer, TGA) 를 통해 자성
나노크리스탈의 함량을 측정， 이를 도 3a, 3b, 3c, 3d 에 도시하였다.
<실시 예 3> 인테그린 ανρ3 압타머가 결합된 자성나노입자를 이용한 동물 모델에서의 암세포 영상화
3.1: 인테그린 ανβ3 압타머가 결합된 자성나노입자의 MR 조영 효과 분석
제조된 인테그린 ανβ3 압타머가 결합된 자성 나노입자 (Aptav)33-MNPs) 의 MRI 조영제로서의 활용 가능성을 확인하기 위하여 r2 (T2 rekxvity
coefficients)의 측정을 통해 자성 나노복합체의 MR 조영 효과를 조사하였다. 구체적으로， MR 영상 시험은, Micro-47 surface coil을 갖는 1.5 T clinical MRI instrument(Intera, Philips Medical System)를 사용하여 수행하였다. 자성
나노복합체의 r2 (unit of mM"Vl)값은 실온에서
CPMG(Carr-Purcell-Meiboom-Gill) 시퀀스 (sequence)를 사용하여 측정하였다 (TR = 10s, 32 echoes with 12 ms even echo space, number of acquisitions = 1, point resolution of 156 x 156 μχΆ, section thickness of 0.6 mm).
도 4a 에 나타난 바와 같이 , L5T에서, Aptav(i3-MNPs 농도가 증가하면서 현저히 어두운 MR contrast를 제공하였고, 또한 도 4b 에서 농도가 증가함에 따라 r2가 명 백히 증가하였다. 따라서 , MR 영상 프로브 (MR imaging probe)로서의 Aptav(33-MNPs 는 분자 영상 (molecular imaging)용으로 충분한 자기적 특성올 보유하고 있음을 확인할 수 있었다.
3.2: 인테그린 ανβ3 압타머가 결합된 자성나노입자의 안정성 평가 제조된 인테그린 ανβ3 압타머 가 결합된 자성 나노입자 (Aptavp3— MNPs)와 의 안정성 평가를 위하여 다양한 농도별로 세 럼 이 포함된 조건에 분산시킨 후, 입자의 크기를 측정하였다. 이 미 잘 알려져 있는 펩타이드인 cyclo (Arg-Gly-Asp-D-Phe-Lys) (cRGD) 가 결합 되어 있는 MNPs (cRGD-MNPs) 어) 대한 세포 친화도 시험도 동시에 수행하였다.
도 5에 나타난 바와 같이 , 농도 조건이 변하여도 입자 크기는 변함이 없음을 확인 하여 , 세포 내 조건에서도 입자가 안정성을 가질 수 있음을 ■ 확인 하였다.
3.3: 인테그린 ανβ3 압타머가 결합된 자성나노입자의 세포 친화도 확인 상기 실시 예 3.1 에서 제조된 인테그린 ανβ3 압타머가 결합된 자성나노입자 (Aptav(i3-MNPs) 의 세포 친화도 시험을 실시하였고， 안정성의 비교를 위해 인테그린 ανβ3에 대한 표적지 향성 이 이미 잘 알려져 있는 펩타이드인 cyclo (Arg-Gly-Asp-D-Phe-Lys) (cRGD) 가 결합되어 있는 MNPs (cRGD-MNPs) 에 대한 세포 친화도 시험도 동시 에 수행하였다. 96-웰에 세포 (PAE/KDR) 를 웰당 Ι χ ΙΟ4개를 분주하여 , 5% 의 소태아혈청 (fetal bovine serum, FBS) 과 1% 의 항생물질 (antibiotics) 를 함유하는 MEM culture medium 에서 37°C , 5% 이산화탄소 조건에서 배양하였다. 그 후 다양한 농도의 Apt«vP3-MNPs 와 cRGD-MNPs 를 세포에 처 리 한 후 24 시간 동안 추가 배양하였다.
AptavP3-MNPs 와 cRGD-MNPs 의 세포 독성 은
3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay 를 사용하여 세포 성장 저해 정도를 측정하였다. 도 6 에 나타난 바와 같이 AptavP3-MNPs 와 cRGD-MNPs 모두 높은 농도에서도 세포 독성을 나타내지 않음을 확인하였다.
3.4: 인테그린 ανβ3 압타머가 결합된 자성나노입자의 표적지향성 확인 상기 실시 예 2.4 에서 제조된 인테그린 ανβ3 압타머가 결합된
자성나노입자 (Aptavp3-MNPs) 의 인테그린 ανβ3에 대한 표적지향성을 확인하고 이를 cRGD-MNPs 의 표적지 향성과 비교하였다.
PAE/KDR (인테그린 ανβ3 과발현， 실험군) 세포와 A431 (인테그린 ανβ3 저 발현, 대조군) 세포를 각각 1.0 χ ΐθ7 개씩 채취하여 입자의 non-specific 결합을 줄이기 위해 blocking buffer (0.2% FBS and 0.02% NaN3 in
phosphate-buffered solution, pH 7.4, 10 mM) 를 통해서 3회 세척한다. 그 후, Aptavp3-MNPs 과 cRGD-MNPs 를 각각 처 리 하여 4°C 에서 2 시간 동안 배양한 후, 세척을 통해 세포에 담지 되지 않은 AptavP3-MNPs 과
cRGD-MNPs 를 제거 한다.
도 7a 에서 나타난 바와 같이 , 실험군 세포에서 Aptavp3-MNPs 과 cRGD-MNPs 는 모두 표적지향성을 나타내어 어두운 대조 효과를
나타내었으나, 같은 농도로 물질올 처 리하였올 경우 Aptavp3-MNPs 가 더 높은 표적지향성을 나타내어 cRGD-MNPs 의 영상보다 더 어두운 대조 효과를 나타내는 것을 확인하였다. 대조군 세포에서는 낮은 IntegrinavD3 발현율로 인해 Aptavp3-MNPs 과 cRGD-MNPs 모두 대조효과를 보이지 않았다. 도 7b 에서는 도 7a 에서 측정된 영상결과로부터 MR signal intensity (R2) 를 측정하여 물질을 처 리하지 않은 (non-treat) 세포의 R2 값을 기준으로, 신호 증가율 그래프를 도시하였으며 이는 도 7a 의 영상 결과와 같은 경향성을 나타낸다.
상기 결과를 통해, 효과적으로 Aptavp3-MNPs 가 표적지향됨을 확인할 수 있었고, cRGD-MNPs 보다 높은 표적지향성을 나타냄을 확인하였다.
3.5: 인테그린 ανβ3 압타머가 결합된 자성나노입자를 이용한 동물 모델에서의 암세포 영상화
상기 실시 예 2.4 에서 제조된 인테그린 ανβ3 압타머가 결합된
자성나노입자 (AptavprMNPs) 의 암세포에 대한 표적지향성과 암세포내의 분포를 측정하기 위해 1.0 χ ΐθ7 개의 A431 세포를 4-5 주령의 수컷 BALB/C-Slc nude mouse 에 이식하여 제조한 동물 모델을 바탕으로, in vivo MR 영상을 위해서 3T clinical MRI 장비 및 micro-47 surface coil (Intera; Philips Medical Systems, Best, The Netherlands) 를 사용하였고 , T2 강조 영상을 얻기 위해 다음의 parameter 를 사용하였다: resolution of 234 χ234 mm, section thickness of 2.0 mm, TE = 60 ms, TR = 4000 ms, number of acquisitions = 1.
200 lig 의 Fe+Mn 이온 농도의 AptaV|33-MNPs 와 cRGD-MNPs 를 tail vein 에 주사하기 전 (pre-injectkm; Pre) 과 주사한 직푸 (immediately; Imm), 1시간， 3시간 24시간의 MR 영상을 측정하였다.
도 8a 에서 나타난 바와 같이 Aptav(53-MNPs 를 주사한 결과 암세포 조직에서 형성된 신생혈관이 매우 어두운 영상 대조를 보여주었고 color mapping 을 통해 더욱 뚜렷하게 영상 대조가 나타남을 확인하였다. 또한 영상 대조 효과가 시간이 흐름에 따라 더욱 높아져 24시간의 MR 영상에서 가장 어두운 대조도가 나타남을 확인하였다. 이를 통해 Aptav(i3-MNPS 가 암 조직의 신생혈관에서 발현되는 인테그린 ανβ3 올 표적지향할 수 있고, 암 조직 내에 축적되어 효과적으로 암 조직올 영상화 있음을 확인하였다.
도 8a 에서 나타난 바와 같이 cRGD-MNPs 를 주사한 결과
Aptavp3-MNPs 와 같이 암세포 조직에서 영상 대조 효과가 나타나는 것을 알 수 있으나, Aptav(33-MNPS 를 주사한 경우 24시간 까지 지속적으로 영상 대조 효과가 증가하는 반면, cRGD-MNPs 를 주사한 경우 1시간이 지난 후 영상의 대조도가 감소하는 것을 확인하였다. 이를 통해 cRGD-MNPs 가
Aptavp3-MNPs 에 비해 인테그린 ανβ3 에 대한 표적지향성 이 낮음을
확인하였다.
도 8b 에서는 도 8a 의 영상 결과로부터 측정 한 암 조직의 MR signal intensity (ᅀ R2/R2Pre; ᅀ R2 = R2 - R2Pre) 를 그래프로 표현하였다. 영상 결과에서 나타난 바와 같이 Aptav(i3-MNPs 를 주사한 경우 signal intensity 가 24시간 까지 지속적으로 증가하여 최 대 ~33.7% 증가하는 반면 cRGD-MNPs 를 주사한 경우 signal intensity 는 1시간 에서 최 대 ~30.0% 는 나타낸 후 시 간이 흐름에 따라 감소함을 확인하였다.
Aptavp3-MNPs 와 cRGD-MNPs 을 주사하여 24시간 영상 확인 후, 각각의 mouse 는 희생하여 암 조직과 간, 뇌 , 신장, 비장을 적출하고, 각 장기 내에 축적된 AptavprMNPs 와 cRGD-MNPs 의 양을 유도결합 플라스마 -원자 방출 분광법 (ICP-AES) 을 통해 측정하였다. 각 장기의 상대적 MNCs (Fe + Mn) 농도 (ᅀ C/Csaline; ᅀ C = C - Csa,ine) 를 도 9 에서 도시하였다.
도 9 에 나타난 바와 같이 암 조직에 축적된 Aptavp3-MNPs (129 ±
34.3%) 는 cRGD-MNPs (17.6 ± 15.4 %) 보다 매우 높은 값을 나타냄을 확인하였고, 이는 Aptavp3-MNPs 이 암 조직 에 발현된 인테그린 ανβ3 를 더욱 효과적으로 표적 지향함을 확인하였다.

Claims

【청구의 범위】
【청구항 11
인테그린 ανβ3 에 특이적으로 결합 하고, dU(deoxyuracil)의 5-위치가 나프틸기, 벤질기, 피롤벤질기， 및 트립토판으로 이루어진 군에서 선택된 소수성 작용기로 치환되어 있는 변형된 염기를 5 내지 20개 포함하고, 총 염기 길이가 25 내지 100개인 압타머.
【청구항 2】
거 U항에 있어서,
상기 압타머는 서열번호 1 내지 서열번호 56 으로 이루어진 군에서 선택된 염기서열을 포함하고, 총 염기 길이가 25 내지 100개인 압타머.
【청구항 3]
거 항에 있어서,
상기 서열번호 1 내지 서열번호 56 으로 이루어진 군에서 선택된 염기서열의 5' 말단， 3' 말단, 또는 양 말단에 각각 3 내지 25개의 염기로 . 이루어진 염기서열을 추가로 포함하고， 총 염기길이가 30 내지 120개인 압타머.
【청구항 4】
제 3항에 있어서, 상기 5' 말단, 3' 말단또는 양 말단에 추가로 포함되는 염기서열은 서열번호 57 내지 서열번호 60으로 이루어진 군에서 선택된 것인 압타머.
【청구항 5】
제 4항에 있어서,
다음의 서열번호 61 또는 서열번호 62의 염기서열을 가지는 압타머 : 5'- TCAGCCGCCAGCCAGTTC-[N]- GACCAGAGCACCACAGAG-3 '(서열번호 61)
5'- AGTTC-[N]- GACCA-3' (서열번호 62),
상기 염기서열에서 *Ν'은 서열번호 1 내지 서열번호 56 으로 이루어진 군에서 선택된 염기서열로 이루어지며, 각 염기는 A,C, G,T, 이들의 deoxy 형태, 및 dU(deoxyuracil)의 5-위치가 벤질기로 치환되어 변형된 염기로 이루어진 군에서 독립적으로 선택됨.
【청구항 6】
제 5항에 있어서 , 서 열번호 63의 염기서 열을 가지는 압타머 .
【청구항 7]
제 2항에 있어서 ,
상기 압타머 는 5' 말단, 3' 말단， 또는 양 말단에 각각 PEG(polyethylene glycol), idT(inverted deoxythymidine), LNA(Locked Nucleic Acid), 2'-메톡시 뉴클레오사이드， 2'-아미 노 뉴클레오사이드， 2Τ-뉴클레오사이드, 아민 링 커， 티올 링 커 , 및 콜레스테롤로 이루어진 군에서 선택된 1종 이상이 결합되어 변형된 것을 특징으로 하는 압타머 .
【청구항 8]
제 1항 내지 게 7항 중 어느 한 항의 압타머를 유효성분으로 포함하는, 암 또는 암 전이 진단용 조성물.
【청구항 9】
제 8항에 있어서，
상기 암은 피부암, 전립선암, 유방암, 자궁경부암, 대장암， 폐암， 담낭암, 췌장암, 및 위 암으로 이루어 진 군에서 선택된 1종 이상인，
암 또는 암 전이 진단용 조성물.
【청구항 10】
제 1항 내지 제 7항 증 어느 한 항의 압타머를 유효성분으로 포함하는， 종양성 질환 부위의 영상화용 조성물.
【청구항 1 1】
제 10항에 있어서 , 방사선 동위원소， 플루오로포어， 양자점 (quantum dot), 상자성 입자 (super paramagnetic particles) 또는 초상자성 입자 (ultrasuper paramagnetic particles) 를 더 포함하는 것 인 조성물.
【청구항 12】
제 10항의 종양성 질환 부위의 영상화용 조성물을 포함하는 나노입자 조영 제.
【청구항 13]
환자의 생물학적 시료에 제 1항 내지 제 7항 증 어 느 한 항의 압타머를 반웅시키는 단계, 및 상기 생물학적 시료에서의 압타머의 결합 정도를 측정하는 단계를 포함하고,
환자의 생물학적 시료에서의 압타머의 결합 정도가 정상 시료보다 높은 경우, 상기 환자를 암 환자로 판단하는 것을 특징으로 하는，
암 또는 암 전이 진단 정보를 제공하는 방법.
PCT/KR2013/006889 2012-07-31 2013-07-31 인테그린αvβ3에 특이적 압타머 및 이의 용도 WO2014021630A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US14/418,266 US20150359911A1 (en) 2012-07-31 2013-07-31 Aptamer Specific to Integrin alpha-v-beta-3 and Use Thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020120084069A KR101405440B1 (ko) 2012-07-31 2012-07-31 인테그린αｖβ３에 특이적 압타머 및 이의 용도
KR10-2012-0084069 2012-07-31

Publications (1)

Publication Number Publication Date
WO2014021630A1 true WO2014021630A1 (ko) 2014-02-06

Family

ID=50028242

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2013/006889 WO2014021630A1 (ko) 2012-07-31 2013-07-31 인테그린αvβ3에 특이적 압타머 및 이의 용도

Country Status (3)

Country Link
US (1) US20150359911A1 (ko)
KR (1) KR101405440B1 (ko)
WO (1) WO2014021630A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104988154A (zh) * 2015-06-24 2015-10-21 中国科学院化学研究所 核酸适配体在识别并结合整合素α4中的应用

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102062115B1 (ko) 2017-04-26 2020-01-03 인터올리고 주식회사 압타머를 이용한 생체 분자 영상화 방법
KR20190081963A (ko) * 2017-12-29 2019-07-09 광주과학기술원 조영제용 생체 적합성 고분자 복합체 및 이를 포함하는 조영제
CN112771165A (zh) 2018-08-30 2021-05-07 (株)纳斯摩仕 通过血脑屏障的核酸适配体及其应用

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20080035926A (ko) * 2006-10-20 2008-04-24 재단법인서울대학교산학협력재단 자성체 나노입자를 함유한 코어-외각 구조의 금 나노입자의자기공명영상의 티2 조영제, 암 진단제 및 암치료제로서의 용도

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0973550B1 (en) 1997-04-11 2002-10-09 G.D. SEARLE &amp; CO. Antagonistic anti-avb3 integrin antibodies
CN102532264A (zh) 2004-06-16 2012-07-04 通用电气医疗集团股份有限公司 基于肽的化合物
US8569252B2 (en) * 2009-04-15 2013-10-29 Postech Academy-Industry Foundation Nucleolin specific aptamer and use thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20080035926A (ko) * 2006-10-20 2008-04-24 재단법인서울대학교산학협력재단 자성체 나노입자를 함유한 코어-외각 구조의 금 나노입자의자기공명영상의 티2 조영제, 암 진단제 및 암치료제로서의 용도

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
CHEN, T. ET AL.: "Aptamer-conjugated nanomaterials for bioanalysis and biotechnology applications", NANOSCALE, vol. 3, pages 546 - 556 *
MI, J. ET AL.: "Targeted inhibition of a v beta 3 integrin with an RNA aptamer impairs endothelial cell growth and survival", BIOCHEM. BIOPHYS. RES. COMMUN., vol. 338, 2005, pages 956 - 963 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104988154A (zh) * 2015-06-24 2015-10-21 中国科学院化学研究所 核酸适配体在识别并结合整合素α4中的应用
CN104988154B (zh) * 2015-06-24 2017-12-08 中国科学院化学研究所 核酸适配体在识别并结合整合素α4中的应用

Also Published As

Publication number Publication date
KR20140019091A (ko) 2014-02-14
US20150359911A1 (en) 2015-12-17
KR101405440B1 (ko) 2014-06-20

Similar Documents

Publication Publication Date Title
Yen et al. Multifunctional iron oxide nanoparticles for diagnostics, therapy and macromolecule delivery
Sánchez et al. Hybrid decorated core@ shell janus nanoparticles as a flexible platform for targeted multimodal molecular bioimaging of cancer
Thiruppathi et al. Nanoparticle functionalization and its potentials for molecular imaging
Elias et al. Effect of ligand density, receptor density, and nanoparticle size on cell targeting
Li et al. Gold‐coated Fe3O4 nanoroses with five unique functions for cancer cell targeting, imaging, and therapy
Hong et al. Molecular imaging with nucleic acid aptamers
Ko et al. A multimodal nanoparticle-based cancer imaging probe simultaneously targeting nucleolin, integrin αvβ3 and tenascin-C proteins
Park et al. A new atherosclerotic lesion probe based on hydrophobically modified chitosan nanoparticles functionalized by the atherosclerotic plaque targeted peptides
US20070154965A1 (en) Chlorotoxin-labeled nanoparticle compositions and methods for targeting primary brain tumors
US20100081130A1 (en) Multifunctional particles providing cellular uptake and magnetic motor effect
Otis et al. Dendrimer antibody conjugate to target and image HER-2 overexpressing cancer cells
Huang et al. Integrin α 2 β 1-targeting ferritin nanocarrier traverses the blood–brain barrier for effective glioma chemotherapy
WO2008054523A9 (en) Nanostructures, methods of synthesizing thereof, and methods of use thereof
EP1988928A1 (en) Magnetic nano-composite for contrast agent, intelligent contrast agent, drug delivery agent for simultaneous diagnosis and treatment, and separation agent for target substance
Ding et al. Recent progresses in biomedical applications of aptamer-functionalized systems
Ma et al. Phage display-derived oligopeptide-functionalized probes for in vivo specific photoacoustic imaging of osteosarcoma
Oghabian et al. Detectability of Her2 positive tumors using monoclonal antibody conjugated iron oxide nanoparticles in MRI
US10201622B2 (en) Tumour-targeted theranostic
WO2015150502A1 (en) Dendronized metallic oxide nanoparticles, a process for preparing the same and their uses
Kang et al. Multimodal imaging probe for targeting cancer cells using uMUC-1 aptamer
TW200928353A (en) Imaging nucleic acid binding proteins
WO2014021630A1 (ko) 인테그린αvβ3에 특이적 압타머 및 이의 용도
Kim et al. Target-switchable Gd (III)-DOTA/protein cage nanoparticle conjugates with multiple targeting affibody molecules as target selective T1 contrast agents for high-field MRI
Kwon et al. In vitro and in vivo imaging of prostate cancer angiogenesis using anti-vascular endothelial growth factor receptor 2 antibody-conjugated quantum dot
Xu et al. Biomedical applications of nanodiamonds: from drug-delivery to diagnostics

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13825430

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 14418266

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13825430

Country of ref document: EP

Kind code of ref document: A1