WO2014017941A1 - Promoteur multiprofil et son utilisation dans la thérapie génique du cancer - Google Patents

Promoteur multiprofil et son utilisation dans la thérapie génique du cancer Download PDF

Info

Publication number
WO2014017941A1
WO2014017941A1 PCT/RU2012/000604 RU2012000604W WO2014017941A1 WO 2014017941 A1 WO2014017941 A1 WO 2014017941A1 RU 2012000604 W RU2012000604 W RU 2012000604W WO 2014017941 A1 WO2014017941 A1 WO 2014017941A1
Authority
WO
WIPO (PCT)
Prior art keywords
promoter
cells
gene
cancer
tumor
Prior art date
Application number
PCT/RU2012/000604
Other languages
English (en)
Russian (ru)
Inventor
Ирина Васильевна АЛЕКСЕЕНКО
Татьяна Викторовна ВИНОГРАДОВА
Илья Валерьевич ДЕМИДЮК
Сергей Викторович КОСТРОВ
Виктор Викторович ПЛЕШКАН
Игорь Павлович ЧЕРНОВ
Максим Вячеславович МИТЯЕВ
Марина Валерьевна ЗИНОВЬЕВА
Георгий Павлович ГЕОРГИЕВ
Александр Сергеевич СОБОЛЕВ
Андрей Александрович РОЗЕНКРАНЦ
Алексей Валентинович УЛАСОВ
Денис Владимирович КУЗЬМИН
Юрий Викторович ХРАМЦОВ
Евгений Павлович КОПАНЦЕВ
Наталия Яковлевна УСПЕНСКАЯ
Мария Борисовна КОСТИНА
Галина Сергеевна МОНАСТЫРСКАЯ
Евгений Давидович СВЕРДЛОВ
Original Assignee
Общество С Ограниченной Ответственностью "Ива"
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Общество С Ограниченной Ответственностью "Ива" filed Critical Общество С Ограниченной Ответственностью "Ива"
Priority to PCT/RU2012/000604 priority Critical patent/WO2014017941A1/fr
Publication of WO2014017941A1 publication Critical patent/WO2014017941A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A61K48/0058—Nucleic acids adapted for tissue specific expression, e.g. having tissue specific promoters as part of a contruct
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/007—Vector systems having a special element relevant for transcription cell cycle specific enhancer/promoter combination

Definitions

  • the present invention relates to biotechnology, in particular genetic engineering, and can be used to treat neoplasms of various nature.
  • Cancer is currently the most serious medical problem.
  • the most common types of cancer are epithelial, the least susceptible to conventional treatment. Even when an epithelial tumor is treatable in the initial period, the tumor eventually returns.
  • the discoveries of various genetic determinants of cancer over the years have only had a negligible effect on the clinical effectiveness of the treatment.
  • the disease is obviously complicated. It is widespread and ranks second in mortality in the world and is likely to move to first place in the near future.
  • cancer is usually considered, at best, as only minimally controlled by modern medicine, especially when compared with other common diseases.
  • the first term refers to a new generation of anticancer agents aimed at a priory identified molecular unit, usually a protein, which supposedly plays an important role in tumor growth and progression.
  • This approach is logically opposite to the earlier traditional approaches used in the identification of cytotoxic chemotherapy drugs, which continue to be the main means of anticancer therapy.
  • these funds are defined as TNPK.
  • MTT is divided into 2 subcategories: (i) MTT aimed at a link whose immediate damage is one of the causes of cancer.
  • Such therapy can be defined as genetic targeted (Druker BJ (2004) Cell Cycle 3: 833-5) (MTTG).
  • the best-known agent of this type is the low molecular weight protein kinase inhibitor Imatinib, which inhibits the BCR-ABL chimeric kinase resulting from chromosomal rearrangement known as the Philadelphia chromosome (NCI (2010)).
  • BCR-ABL is the only molecular mutation that causes cell proliferation in cells containing the Philadelphia chromosome in chronic myeloid leukemia (CML) (NCI (2010)) (Druker B J (2004) Cell Cycle 3: 833-5).
  • TNPC agents are identified by their ability to exert a cytotoxic effect on cancer cell lines without prior knowledge of the target (Hait WN and Hambley TW (2009) Cancer Res 69: 1263-7).
  • TYPK agents act on rapidly dividing cells (although there are exceptions).
  • inhibition is aimed not at a single molecular unit, but at systems involved in DNA replication.
  • Ordinary agents of this type belong to several groups:
  • Alkylating agents damage directly the DNA and inhibit its replication.
  • Taxanes and vinca alkaloids which prevent the formation of microtubules necessary for mitotic cell division.
  • TNPC agents that are introduced into the patient’s body also affect all relatively rapidly dividing cells (for example, cells of the gastrointestinal epithelium, bone marrow cells, etc.) and therefore these agents are highly toxic (Gerber DE (2008) Am Fam Physician 77: 311-9; Hait WN and Hambley TW (2009) Cancer Res 69: 1263-7; discussion 1267).
  • MTT agents acting on specific molecular targets, are less toxic.
  • Imatinib (Gleevec), a low molecular weight inhibitor of protein kinase formed in cancer cells as a result of chromosome rearrangement resulting in a hybrid protein with kinase activity, is used as its paradigm.
  • This inhibitor has shown good results in the treatment of chronic myeloid leukemia and gastrointestinal stromal tumors.
  • this shows the wrong general direction in choosing the right cancer treatment strategies (Hambley TW and Hait WN (2009) Cancer Res 69: 1259-62; Murdoch DSager J ( 2008) Curr Opin Oncol 20: 104-11).
  • Herceptin Trastuzumab
  • This is a monoclonal antibody directed against the receptor.
  • HER-2 / Neu whose content is elevated on the surface of the cancer cells of some patients with breast cancer. However, it is applicable only to approximately 20% of such patients having the desired target receptor on the surface of tumor cells (Ross JS and Slodkowska EA et al. (2009) Oncologist 14: 320-68), and leads to an average increase in life expectancy of about 5 months (Bria E and Di Maio M et al. (2009) J Exp Clin Cancer Res 28:66).
  • each cell of a given cancer tumor is different from all other cells of the same tumor, and the tumor of one patient is different from the tumor of the same type in another patient (Glazier A (2007) www.curecancerproject.org/).
  • the tumor is similar to other complex multicellular evolving systems (Sverdlov ED (2009) Biochemistry (Mosc) 74: 939-44; Veitia RA (2005) J Biosci 30: 21-30).
  • tumors of different types differ from each other.
  • the process of tumor evolution begins with the first mutation, which (adhering to the cancer stem cell hypothesis - MS (Bjerkvig R and Tysnes BB et al. (2005) Nat Rev Cancer 5: 899- 904; Reya T and Morrison SJ et al. (2001) Nature 414: 105-11)) turns a normal stem cell into a cancerous one.
  • a newly formed cancer stem cell does not become one as a result of any mutation, but those mutations (which are called drivers) that give it advantages in the speed of division, the proportion of symmetrical divisions that increase the proportion of stem cells in the population, or some other advantages and, in addition, the normal differentiation of stem cells is prohibited or hindered.
  • DSC is self-renewing, i.e.
  • driver mutations should be limited (Armitage P and Doll R (2004) Br J Cancer 91: 1983-9) and that the set of driver mutations affects a certain limited range of cancer genes (for a review see (Salk J and Fox E et al. (2010) Annu. Rev. Pathol. Mech. Dis. 5: 51-75) (Stratton MR and Campbell PJ et al. (2009) Nature 458: 719-24)). If so, driver mutations could be identified by the genome-wide sequencing of several individual tumors as mutations systematically repeating from tumor to tumor (Wood LD and Parsons DW et al. (2007) Science 318: 1108-13); (Parmigiani G and Boca S et al.
  • GT gene therapy
  • the general principle of gene therapy (GT) is to deliver regulated genetic material to cancer cells, which produce products capable of killing cancer cells. It should be noted here that GT approaches can be divided into two broad categories (Sverdlov E (2009) Molecular Genetics, Microbiology and Virology English version 24: 93-113). The first uses a targeted therapy strategy. Moreover, the target product is the product of a gene introduced in some way into the tumor cell, which is an inhibitor of a product whose concentration in the cancer cell is increased, and this is one of the causes of the cancer process.
  • the reverse technology can be related to this category - delivery of a gene to a tumor, the product of which compensates for the lack of a specific protein in cancer cells.
  • Target-based GT options suffer from the same disadvantages as MTTs.
  • HT expands the scope of targeted therapy.
  • genes introduced into a cell can give this cell new phenotypic traits. This the possibility is widely used in gene therapy options such as cancer gene immunotherapy (Loisel-Meyer S and Foley R et al. (2008) Front Biosci 13: 3202-14; Seth P (2005) Cancer Biol Ther 4: 512-7) ( Collins SA and Guinn, A et al. (2008) Curr Gene Ther 8: 66-78).
  • GT allows delivery of cancer suppressor genes that have been inactivated during carcinogenesis, such as a gene encoding a suppressor that is often inactivated in cancer cells
  • cancer suppressor genes that have been inactivated during carcinogenesis, such as a gene encoding a suppressor that is often inactivated in cancer cells
  • GT also allows blocking several signaling pathways simultaneously using RNAi (WNA) (Wagner E (2007) J Buon 12 Suppl 1.S77-82) (Wang SL and Yao HH et al. (2009) Expert Opin Biol Ther 9: 1357 -68).
  • WNA RNAi
  • Clinical trials of GT drugs show their safety and positive clinical responses (Fang B and Roth JA (2003) Cancer Biol Ther 2: S115-21); (Huang CL and Yokomise H et al. (2007) Future Oncol 3: 83-93; Raty JK (2008) Current Molecular Pharmacology 1: 13-23; Xue W and Zender L et al. (2007) Nature 445: 656- 60).
  • the first gene-therapeutic virus for the treatment of head and neck cancer has been approved for clinical use in China in 2003 under the name Gendicine.
  • the virus contains p53 as a therapeutic gene (Peng Z (2005) Hum Gene Ther 16: 1016-27); (Wilson JM (2005) Hum Gene Ther 16: 1014-5).
  • Gendicin caused complete tumor regression in 64% of patients and partial in 29%, while one radiotherapy gave complete regression in 19% and partial in 60%, which apparently shows a noticeable improvement in the result of combination therapy (Peng Z (2005) Hum Gene Ther 16: 1016-27). But these results also show that only 64% respond to treatment, and the further behavior of their illness is unknown.
  • oncolytic viruses have been widely discussed, which, having the ability to selectively express themselves in tumor cells and lyse them, also infect and lyse neighboring tumor cells (Hall K and Blair Zajdel ME et al. (2010) Biochem J 431: 321-36; Liu TC and Kirn D (2008) Gene Ther 15: 877-84).
  • This approach It has a number of advantages, the main of which is a chain reaction of the spread of the virus in the tumor and the associated rapid destruction of those tumor cells that are sensitive to the virus. However, this leaves the cells resistant to the virus, which are highly likely to be present in the heterogeneous tumor population, resulting in its secondary growth after a period of decrease in the size of the tumor. The newly formed tumor is resistant to virus treatment.
  • oncolytic viruses are also MTT variants. But, in addition, they are expensive in production and immunogens, which makes it difficult to reintroduce them into the body.
  • the second strategy of gene therapy aimed at the destruction of tumor cells, as such, by using their properties that are characteristic of all cancer cells, for example, an increased rate of mitotic divisions, in this respect is similar to chemotherapy, or TNPC.
  • the toxin which kills cancer cells by inhibiting the replication systems, is formed inside them, so that the toxicity characteristic of TNPC is sharply reduced in this case.
  • GDEPT gene-directed enzyme prodrug therapy
  • suicide gene therapy Altaner C (2008) Cancer Lett 270: 191-201 ; Fillat C and Carrio M et al. (2003) Curr Gene Ther 3: 13-26; Portsmouth D and Hlavaty J et al.
  • the therapeutic effect should be on replicating DNA, the most universal and main element of cell replication, or on systems directly involved in replication.
  • FIG. 28 this approach is depicted in Figure 28 as an example of a system that includes a gene encoding the herpes simplex virus thymidine kinase enzyme (HSV-tk) and a prodrug, the well-known low-toxic antiherpetic drug ganciclovir (GCV).
  • HSV-tk herpes simplex virus thymidine kinase enzyme
  • GCV low-toxic antiherpetic drug ganciclovir
  • the HSV-tk gene is introduced into cancer cells, where it works and synthesizes an enzyme called viral thymidine kinase.
  • the patient then systemically receives GCV.
  • Viral thymidine kinase unlike cellular enzymes, phosphorylates GCV, turning it into monophosphate, which is then subsequently converted by cellular kinases into ganciclovir di- and triphosphates.
  • Triphosphate is incorporated into replicating DNA and breaks the synthesis of growing chains.
  • the cancer cell is dying.
  • the conversion of non-toxic GCV to toxic triphosphate occurs inside a cancer cell and therefore has no toxic effect on healthy cells.
  • principle 1, formulated above, is implemented.
  • Principle 2 is implemented through the so-called bystander effect.
  • Phosphorylated ganciclovir exits tumor cells and enters neighboring cells. There, it turns into triphosphate and, if it is replicating cells, it is incorporated into DNA and interrupts its synthesis. Neighboring cells die, although they may not have the HSV-tk gene. According to reports, it is enough that the gene enters only 10% of the tumor cells, so that all tumor cells are destroyed (Mesnil MYamasaki H (2000) Cancer Res 60: 3989-99). This is extremely important because it is practically impossible to deliver the gene to all tumor cells.
  • an antimetabolite that inhibits DNA replication is formed inside the cell and cannot show toxicity on cells remote from the tumor.
  • a similar system uses the bacterial or yeast cytosine deaminase gene. This is illustrated in Figure 29. In this case, the antimetabolite fluorouracil is formed from non-toxic fluorocytosine inside the cell.
  • killer genes are one of the most promising areas, it leads to a combination of the strong properties of chemotherapy with the strong properties and low toxicity of targeted therapy.
  • the specificity of expression in cancer cells can be specified either by its specific delivery to these cells, or by creating specific conditions for the expression of transgene in a given tissue.
  • the latter method due to its simplicity, is used more often under the name of transcriptional. targeting For this, in constructing vectors, promoters and enhancers that specifically work in tumors of a given tissue are used (Robson THirst DG (2003) J Biomed Biotechnol 2003: 110-137); (Saukkonen KHemminki A (2004) Expert Opin Biol Ther 4: 683-96) .
  • promoters must combine the ability to provide strong and specific transgene expression.
  • the natural cancer-specific promoters commonly used for these purposes are significantly weaker than strong constitutive promoters such as CMV or SV40 (Lu B and Makhija SK et al. (2005) Gene Ther 12: 330-8); (Rein DT and Breidenbach M et al. (2004) J Gene Med 6: 1281-9); (Van Houdt WJ and Haviv YS et al. (2006) J Neurosurg 104: 583-92).
  • they are usually active in a limited number of cancer cell types (Adachi Y and Reynolds PN et al.
  • the activity of promoters varies greatly in different tumors, making it difficult to select prodrug doses to obtain a therapeutic effect and changing the therapeutic index of the drug from tumor to tumor.
  • the activity of the phSurv promoter in different tumors varies from 0.3 to 16% relative to the CMV promoter (Chen JS and Liu JC et al. (2004) Cancer Gene Ther 11: 740-7); (Konopka K and Spain C et al. (2009) Cell Mol Biol Lett 14: 70-89), the phTERT promoter activity varies 20 times in different cell lines (Gu J and Fang B (2003) Cancer Biol Ther 2: S64- 70).
  • Bimodal therapeutic systems In one of these systems, the general principle, which is demonstrated in figure 26, two vectors are introduced into the cell. In one of them (activation), there is a gene encoding a transcription activator, for example, Tat protein of the immunodeficiency virus under the control of a cancer-specific promoter, while in the other (therapeutic) therapeutic transgene under the control of a promoter containing the TAR element of this virus. When TAT is co-expressed, the protein binds to the TAR element and activates the promoter that contains this element. Thus, it is possible to increase the expression level of the therapeutic transgene tenfold (Mingaleeva RN and Chernov IP et al.
  • the first contains the bacteriophage PI gene recombinase Cg (Kuzmin DV and Vinogradova TV et al. (2010) The Open Gene Therapy Journal 3: 31-39) under the control of a cancer-specific promoter.
  • the second is a therapeutic gene coupled with a constitutive strong promoter that is isolated from the gene by a transcriptional terminator located between the Cg recombinase sites.
  • the recombinase excludes the transcription terminator, the promoter of the second vector binds to the transgene and active transcription of the latter begins, the level of which is determined by the strength of the constitutive promoter connected to the transgene.
  • Both systems increase the efficiency of transcription, but its specificity is determined by the cancer promoter used in the activation vector. And if this promoter is limited in its activity to a narrow spectrum of cancerous tumors, then activation occurs only in them. In addition, such a dual system increases the cost and makes therapeutic use less convenient.
  • Chimeric promoters may include combinations of known promoters with each other or with individual heterologous regulatory elements in order to increase the strength and specificity of expression in cancer cells (Wu C and Lin J et al. (2009) Mol Ther 17: 2058-66).
  • An example of a chimeric promoter is a combination of phTERT with a minimal cytomegalovirus promoter (phTERT-CMV) (Davis JJ and Wang L et al. (2006) Cancer Gene Ther 13: 720-3); or with a TATA box that is not in native phTERT.
  • phTERT-CMV minimal cytomegalovirus promoter
  • the authors of various studies aimed at the efficient use of hybrid promoters go the way of maximizing the efficiency and specificity of expression in a particular type of cancer.
  • combined promoters consisting of two promoters, in Unlike previous works, active in a wide range of cancerous tumors, they are not functionally the mechanical sum of the two constituent promoters, but form a new functional multidisciplinary promoter that differs from all known promoters, both in terms of the start of transcription and in increased activity in a wide range of tumors.
  • artificial mutant variants of the human or mouse survivin gene promoter have an expanded spectrum of tumors in which they are active, and are also multidisciplinary promoters.
  • mutant (altered) promoters of genes involved in cell proliferation such as promoters of human PCNA, human PLK1, human MCM2, are more active than native variants of these promoters and are active in a wide range of tumors.
  • the authors also determined a strategy for constructing promoters active in a wide range of tumors, namely, the authors showed that tumor-specific promoters with a length not exceeding 3,000 bp, active in more than three types of cancer cells, having activity higher than the BIRC5 gene promoter containing an altered or an expanded, in comparison with the initial promoters, set of recognition sites for transcription factor proteins, the necessary set of which exists in most cancer cells, but not in normal cells, as well as gene promoters, those in the process of cell proliferation, with a length not exceeding 3,000 base pairs, active in more than three types of cancer cells, having activity in cancer cells higher than the BIRC5 gene promoter, containing a set of recognition sites for transcription factor proteins, changed or expanded as compared to the original promoters, the
  • the invention relates to multidisciplinary promoters that provide an expression of an enzyme gene inside a cancer cell that can convert a non-toxic compound (prodrug) into a toxin in most cancer cells, but not in normal cells, inside a cancer cell. This leads to the conversion of an externally supplied prodrug inside the cancer cell to a toxin that causes killing. expanded compared with known analogues of the spectrum of tumors, and the toxin synthesized inside the cancer cell diffuses into the surrounding cancer cells.
  • the invention also relates to multidisciplinary promoters that provide an expression of an enzyme gene inside a cancer cell that can convert a non-toxic compound (prodrug) into a toxin in most cancer cells, but not normal cells, and a cytokine gene that can activate cells of the immune system.
  • the invention relates to multidisciplinary promoters containing an expanded compared with known natural promoters, the set of recognition sites of transcription factor proteins, the necessary set of which exists in most cancer cells, but not in normal cells, and the combination of which, by binding to recognition sites of the promoter, provides a synergistic promoter activation in a wider spectrum of tumor cells than known promoters. It also refers to multidisciplinary promoters containing a changed, as compared to known promoters, set of recognition sites for transcription factor proteins, the necessary set of which exists in most cancer cells, but not in normal cells, and the combination of which, by binding to recognition sites of the promoter, provides synergistic activation of the promoter in a wider spectrum of tumor cells than known promoters.
  • the invention relates to multidisciplinary promoters, which are tumor-specific promoters with a length not exceeding 3,000 bp, active in more than three types of cancer cells, having higher activity in cancer cells than the native BIRC5 gene promoter, containing altered or expanded, compared with the initial promoters, a set of recognition sites for transcription factor proteins, the necessary set of which exists in most cancer cells, but not in normal cells; as well as promoters of genes involved in the process of cell proliferation, not exceeding 3,000 base pairs, active in more than three types of cancer cells, having higher activity in cancer cells than the native promoter of the BIRC5 gene, containing altered or expanded in comparison with the initial promoters, the totality of recognition sites for transcription factor proteins, the necessary set of which exists in most cancer cells, but not in normal cells; as well as promoters, which are a tandem combination of the above promoters or a tandem combination of the above promoters with a modified set of recognition sites for transcription factor proteins that are not active in normal cells, active in more than four types
  • the invention relates to an expression vector comprising the described multifunctional promoter. More specifically, the expression vector is a viral vector or the expression vector is a non-viral vector.
  • the invention in another aspect, relates to a method for selectively killing cancerous but not normal cells, comprising synthesizing toxins inside cancer cells, comprising delivering to a tumor a gene construct consisting of an enzyme gene capable of converting a non-toxic prodrug compound into a toxin inside a cancer cell, and the described multidisciplinary promoter, while the toxin synthesized inside the cancer cell diffuses into the surrounding cancer cells.
  • the encoded enzyme is a herpes simplex virus thymidine kinase. Or where the encoded enzyme is yeast cytosine deaminase. Or where the encoded enzyme is a yeast cytosine deaminase coupled into one protein with yeast uracil phosphoribosyl transferase.
  • the invention also relates to a method for the selective killing of cancerous, but not normal cells, comprising synthesizing toxins and cytokines inside cancer cells, comprising delivering to a tumor a gene construct consisting of an enzyme gene capable of converting a non-toxic compound-prodrug into a toxin inside a cancer cell and a gene a cytokine capable of activating cells of the immune system, as well as the described multidisciplinary promoter, while the toxin synthesized inside the cancer cell diffuses into the surrounding cancer cells ki, and synthesized in the cancer cell cytokine diffuses into the intercellular space.
  • the encoded enzyme is a herpes simplex virus thymidine kinase. Or where the encoded enzyme is yeast cytosine deaminase. Or where the encoded enzyme is a yeast cytosine deaminase coupled into one protein with yeast uracilphosphoribosyltransferase. And where the encoded cytokine is a granulocyte-macrophage colony stimulating factor. Or where the encoded cytokine is interleukin-2. Or where the encoded cytokine is interleukin-12.
  • a method for the selective killing of cancerous, but not normal cells, by synthesizing toxins inside the cancerous cells and spreading them into the surrounding cancerous cells which consists in delivering to the tumor a gene construct consisting of an enzyme gene capable of converting a non-toxic compound-prodrug into a toxin inside the cancerous cell, and a multidisciplinary promoter that provides expression of this gene in most cancer cells, but not in normal cells, due to the fact that the multidisciplinary promoter contains an expanded or altered compared with the known promoters, the set of recognition sites for transcription factor proteins, the necessary set of which exists in most cancer cells but not in normal cells, and the combination of which, by binding to the recognition sites of the promoter, provides synergistic activation of the promoter in a wider range of tumor cells than the known natural promoters, which causes the synthesis of the enzyme directed by the active promoter, the transformation of the prodrug into a toxin and the killing of an extended one, as compared with the known a ALOGIA, tumor spectrum ( Figure
  • two gene constructs are delivered to the tumor, one of which contains an enzyme gene capable of converting a non-toxic prodrug into a toxin inside a cancer cell or an enzyme gene capable of converting a non-toxic prodrug inside a cancer cell - a prodrug into a toxin and a cytokine gene capable of activating cells of the immune system and the activated promoter, when activated, providing the expression of these genes, while the second is an activating construct containing a multidisciplinary a promoter active in most cancer cells, but not in normal cells, attached to an activator gene that encodes a protein activator capable of activating an inactive promoter.
  • the multidisciplinary promoter in cancer cells transcribes the activator gene and activator protein synthesis, which binds to the corresponding sequence in the activated promoter, activates it and induces the synthesis of the enzyme directed by the active promoter or the synthesis of the enzyme and cytokine, the conversion of a prodrug to a toxin or the conversion of a prodrug to a toxin and cell activation the immune system and the killing of an expanded, compared with known analogues, spectrum of tumors (Fig.26).
  • the synthesis of toxins is carried out inside the cancer cells and spreads to the surrounding cancer cells.
  • Two genes are delivered to the tumor constructs, one of which contains an enzyme gene that can convert a non-toxic compound inside a cancer cell — a prodrug into a toxin or an enzyme gene that can convert a non-toxic compound inside a cancer cell — a prodrug into a toxin and a cytokine gene that can activate cells of the immune system and a blocked promoter when released providing the expression of these genes, while the second is a deblocking construct containing a multidisciplinary promoter that is active in most cancerous, but not normal nyh cells attached to deblockers gene encoding a protein deblockers capable unblock the blocked promoter.
  • the multidisciplinary promoter in cancer cells transcribes the unlocker gene, synthesis of the unlocker protein, which cuts out the blocking sequence from the blocked promoter, activates it and induces the synthesis of the enzyme or synthesis of the enzyme and cytokine directed by the unlocked promoter, converting the prodrug into a toxin or converting a prodrug into a toxin and activating immune cells systems and killing of an expanded, in comparison with known analogues, spectrum of tumors (Fig.27).
  • FIG. 1 Schematic representation of expression constructs. On the right is the name of the structures. phSurv - promoter of the human survivin gene; phTERT — promoter of the human telomerase reverse transcriptase gene; LUC - firefly luciferase gene.
  • FIG. 2 Schematic representation of expression constructs indicating identified transcription initiation starts. phSurv - promoter of the human survivin gene; phTERT — promoter of the human telomerase reverse transcriptase gene; LUC - firefly luciferase gene. Arrows indicate transcription initiation sites. The numbers above the arrows indicate the number of clones with this transcription initiation site. For each construct, 12 clones were analyzed.
  • FIG. 3 The activity of the double promoters phTERT-phSurv and phSurv-phTERT in various cell lines.
  • the ordinate shows the luciferase activity relative to basal activity in cells transfected with the non-promoter BV-pGL3 vector.
  • the abscissa indicates the types of cell lines in which promoter activity was measured.
  • In the upper right corner are the names of the structures used in the work.
  • the height of the columns reflects the average value of luciferase activity in four independent experiments; standard errors of the mean value (SEM) are given.
  • FIG. 4 Activity of the double promoters phTERT-pmSurv and pmSurv-phTERT in various cell lines.
  • the ordinate shows the luciferase activity relative to basal activity in cells transfected with the non-promoter BV-pGL3 vector.
  • the abscissa indicates the names of the structures used in the work.
  • the height of the columns reflects the average value of luciferase activity in two independent experiments.
  • pmSurv is the mouse survivin gene promoter
  • phSurv is the human survivin gene promoter
  • phTERT is the human telomerase reverse transcriptase promoter.
  • FIG. 5 Activity of mutant promoters of the human survivin gene.
  • the ordinate shows the luciferase activity relative to basal activity in cells transfected with the non-promoter BV-pGL3 vector.
  • the abscissa indicates the names of the structures used in the work.
  • the height of the columns reflects the average value of luciferase activity in three independent experiments.
  • FIG. 6 Detection of p53 protein in transfected cells.
  • the fraction corresponding in mass to 53 kDa is p53 protein, 36 kDa to GAPDH.
  • M is a set of proteins with molecular weights of 9-200 kDa, the molecular weights of marker proteins in kDa are indicated on the left.
  • the molecular weights of the p53 and GAPDH proteins are indicated on the right. Sample numbers are indicated above.
  • FIG. 7 Activity of multidisciplinary promoters pSurv4, ⁇ 1 1-13 and 20G / T in Calu-1 cells transfected with plasmid pCMV-p53.
  • Cells were cotransfected with reporter plasmids phSurv-pGL3, ⁇ 1 l-13-pGL3 and 20G / T-pGL3 together with different amounts (0, 1, 10 and 50 ng) of plasmid pCMV-p53.
  • the unit was taken relative luciferase activity in cells transfected with the corresponding plasmid in the absence of pCMV-p53.
  • the height of the bars reflects the average luciferase activity of at least three transfections; bars indicate the standard error of the mean (SEM).
  • FIG. 8 The activity of multidisciplinary promoters pPCNA, pPLK, rMSM in the following cell lines a) A549, b) HEK293, c) PANC-1.
  • the ordinate shows the luciferase activity relative to basal activity in cells transfected with the non-promoter BV-pGL3 vector.
  • the abscissa marks the names of the structures used in work.
  • the height of the columns reflects the average value of luciferase activity in three independent experiments.
  • FIG. 9. Analysis of expression of the HSV thymidine kinase gene in transfected HEK293 cells.
  • HEK293 cells were transfected with the constructs TK_pGL3 (promoterless vector), pSV40_TK_pGL3 (SV40 promoter), pCMV_TK_pGL3 (CMV promoter with the TURV_v4 gene of TvvpVr4 and Tv_v4 gene potency of the Tv_v4 gene of Tvvp3v4 gene.
  • TK_pGL3 promoterless vector
  • pSV40_TK_pGL3 SV40 promoter
  • pCMV_TK_pGL3 CMV promoter with the TURV_v4 gene of TvvpVr4 and Tv_v4 gene potency of the Tv_v4 gene of Tvvp3v4 gene.
  • TK_pGL3 promoterless vector
  • SV40_TK_pGL3 SV40 promoter
  • pCMV_TK_pGL3 CMV promoter with the TURV_v4 gene of TvvpVr4 and T
  • FIG. 10 Micrographs of HT1080 cells transfected with the following constructs: A — pEGFP-Nl (negative control), B — pCMV-HSVtk-pGL3, C — phTERT-HSVtk-pGL3, D — phSurv-HSVtk-pGL3 after culturing for 72 hours in a nutrient medium containing a solution of ganciclovir at a concentration of 0, 20, 200 ⁇ M. Above the photographs are concentrations of ganciclovir.
  • FIG. 11 Survival of cells transfected with vectors expressing FCU1 in the presence of 5-FC.
  • Cells were transfected with vectors containing the FCU1 gene without a promoter (pGL3- (no promoterJ-Ct / i) under the control of the BIRC5 gene promoter (pGL3-pBIRC5-1.5-C £ / 7) or the CMV promoter (pGL3-pCMV-CW).
  • 5-fluorocytosine (5-FC) was added to the cells after transfection hours, after 120 hours of incubation in 5-FC medium, the cells were stained with MTS and measured the optical density of cell extracts. The column heights reflect the percentage of surviving cells 120 hours after the start of the experiment. Survival was calculated as the percentage of optical density in extracts of cells treated with 5-FC to optical density in extracts of cells not treated with 5-FC. Standard error of the mean (SEM) is shown.
  • FIG. 12 Western blot analysis of HSV-tk and GAPDH proteins in extracts of Calu-1 and HT1080 cells.
  • 1 non-transfected cells; 2 - cells transfected with the control plasmid pEGFP-Nl; 3, 4, 5, 6 - cells transfected with pCMV / E-tk, pSurv-tk, phTERT-CMV-tk, ALTRep-tk, respectively; 7 - cells transfected with pSurv-tat and ALTRep-tk; 8— phTERT-CMV-tat and ALTRep-tk.
  • FIG. 13 The effect of intratumoral injection of the polyplex with the HSVtk gene on the growth rate of tumors caused by inoculation of LLC1 cells in C57black mice.
  • the introduction of the polyplex was carried out on days 17 and 21 after cell inoculation, intraperitoneal injection of ganciclovir at a dose of 75 mg / kg (twice a day) was carried out for 10 days, starting from day 19 after cell inoculation with the exception of the day of repeated administration of polyplexes.
  • Data are mean values for a group of 8 animals; the scatter indicated on the graph represents the standard error of the mean.
  • the abscissa axis indicates the time elapsed since the inoculation of the cells.
  • FIG. 14 The effect of intratumoral injection of the HSV / & gene polyplex on the survival of mice with tumors caused by inoculation of LLC1 cells in C57black mice.
  • FIG. 15 The effect of intratumoral injection of the polyplex with the HSVtk gene on the growth rate of tumors caused by inoculation of mouse Cloudman S91 melanoma cells in DBA / 2y mice.
  • the cells were subcutaneously inoculated with DBA / 2y mice, 1 million cells per mouse, on day 14, when the tumors reached a size of 50 mm 3 , a solution of polyplexes was introduced into the tumors in a volume of 50 ⁇ l. Starting from the next day, mice received intraperitoneal injections of ganciclovir 9 mg / kg 2 times a day with an interval of 11-13 hours.
  • mice On the third day after intratumoral injection was repeated and ganciclovir was not administered on the evening of this day (all mice received an injection of 5 doses of polyplex and ganciclovir for 15 days).
  • the graph shows the results (mean + standard error of the mean) for mice treated with HSVf & survivin ( ⁇ ), 9 mice, and telomerase promoters (A), 10 mice, as well as control group (), 15 mice.
  • FIG. 16 The effect of intravenous administration of a polyplex based on the block copolymer PEI-PEG-MK1C and HSV / £ under the control of the telomerase promoter on the lifespan of mice with experimental Cloudman melanoma tumors.
  • the survival of mice in the group that received the HSVtk polyplex (7 animals) was significantly different according to the Mantel-Cox test (p ⁇ 0.03, determined using the GraphPad Prism 5 software package) from the survival of mice in the control group (9 animals) that received only ganciclovir the same scheme as the experimental group.
  • FIG. 17 Schematic representation of constructs based on the pGL3 vector (Promega, USA) for the joint expression of the herpes simplex virus thymidine kinase genes and human GM-CSF.
  • FIG. 18 Schematic representation of a construct based on the pGL3 vector (Promega, USA) for co-expression of the herpes simplex virus thymidine kinase genes and mouse GM-CSF.
  • FIG. 19 Determination of mGM-CSF level in FD3K293 cell supernatants by ELISA.
  • the ordinate shows the relative optical density of the samples.
  • the names of the genetically engineered constructs used are shown along the abscissa, and NK - untransfected HEK 293 cells (negative control).
  • CMV is the cytomegalovirus promoter
  • TK is the herpes simplex virus thymidine kinase gene
  • mGM-CSF is the promoter of the mouse granulocyte macrophage colony stimulating factor gene.
  • FIG. 20 Results of analysis of the expression of surface markers of differentiation by progenitor cells mouse bone marrow after incubation in an air-conditioned environment obtained by transfection of HEK293 cell line with pGL3-CMV-HSV-tk-mGM-CSF construct by flow cytometry.
  • GR-1 is a granulocyte marker
  • F4 / 80 is a marker of mature macrophages
  • IA-d is a class II MHC molecule, expressed on dendritic cells and macrophages
  • CDl lb is a macrophage marker.
  • Gray diagrams show the distribution diagrams of cells uncultured in an air-conditioned environment (negative control), without hatching, distribution diagrams of cells treated with an air-conditioned medium.
  • the abscissa shows the intensity of staining of cells with antibodies to the corresponding marker.
  • the y-axis is the number of events.
  • FIG. 21 Micrographs of mouse bone marrow progenitor cells cultured in GM-CSF-conditioned medium and stained with fluorescently-labeled antibodies A) anti-GRl, B), C) anti-CDl lb and D) anti-CD86. Cell nuclei are stained with 4,6-diamidino-2-phenylindole.
  • FIG. 22 The biological activity of the hGM-CSF construct CMV-HSV-tk-hGM-CSF-pGL3 compared with hGM-CSF construct CMV-hGM-CSF-pBK.
  • the number of living cells in the control was taken as 100% (cells cultured without the addition of hGM-CSF-conditioned medium).
  • FIG. 23 The effect of transformation of mouse Lewis lung carcinoma cells (LLC) by genetic engineering constructs on the growth rate of tumors caused by transplantation of these cells into C57B1 / 6 mice.
  • Transformed (Control) cells transformed with the pCMV-HSVtk-pGL3 construct (HSVtk) and transformed with the pCMV-HSVtk-mGM-CSF construct (HSVtk-mGM-CSF) were transplanted into mice.
  • Intraperitoneal injections of ganciclovir (GCV) in an amount of 75 mg / kg, twice a day, were performed for 10 days, starting from the third day after cell transplantation.
  • animals received phosphate buffer (PBS) as a prodrug.
  • PBS phosphate buffer
  • Tumor sizes were measured from day 6 after cell transplantation. Data are average values for a group of 6 (for Control) and 10 animals (for HSVtk and HSVtk-mGM-CSF). The abscissa indicates the time elapsed since the transplantation of the cells.
  • FIG. 24 Survival of animals after transplantation of LLC line cells (Lewis lung carcinoma) transfected with the following constructs pCMV-HSVtk-pGL3 (HSVtk), pCMV-HSVtk-mGM-CSF (HSVtk-mGM-CSF) or non-transfected (Control). Animals in groups starting on the third day after transplantation received d as a prodrug of ganciclovir (GCV) or phosphate buffer (PBS). The ordinate shows the percentage of surviving animals; the abscissa shows the time elapsed since the transplantation of the cells.
  • FIG. 25 shows the percentage of surviving animals; the abscissa shows the time elapsed since the transplantation of the cells.
  • a gene construct consisting of an enzyme gene capable of converting a nontoxic prodrug into a toxin inside a cancer cell and a multidisciplinary promoter that expresses this gene in most cancer cells, but not in normal cells, due to the fact that the multidisciplinary promoter contains an expanded or an altered, compared with the known promoters, set of recognition sites for transcription factor proteins, the necessary set of which exists in most cancer cells, but not in normal cells etc., the combination of which, by linking to the recognition sites of the promoter, provides synergistic activation of the promoter in a wider range of tumor cells than the known natural promoters, which causes the synthesis of the enzyme directed by the active promoter, the transformation of the prodrug into a toxin and the killing of an extended compared to known analogues spectrum of tumors.
  • FIG. 26 An example of a bimodal therapeutic system in which two vectors are introduced into a cell.
  • activation there is a gene encoding a transcription activator, for example, Tat protein of the immunodeficiency virus under the control of a cancer-specific promoter, while in the other (therapeutic), a therapeutic transgene under the control of a promoter containing the TAR element of this virus.
  • Tat protein of the immunodeficiency virus
  • a therapeutic transgene under the control of a promoter containing the TAR element of this virus.
  • co-expressing Tat protein binds to TAR element and activates the promoter that contains this element.
  • Another system also uses two vectors.
  • FIG. 27 The multidisciplinary promoter in cancer cells transcribes the unlocker gene, synthesis of the unlocker protein, which cuts the blocking sequence from the blocked promoter, activates it and induces the synthesis of the enzyme or synthesis of the enzyme and cytokine directed by the unlocked promoter, the conversion of a prodrug to a toxin or the conversion of a prodrug to a toxin and activation cells of the immune system and the killing of an expanded, compared with known analogues, spectrum of tumors.
  • FIG. 28 An example of a system comprising a gene encoding the herpes simplex virus thymidine kinase enzyme (HSV-tk) and a prodrug is a well-known low-toxic antiherpetic drug ganciclovir (GCV).
  • HSV-tk herpes simplex virus thymidine kinase enzyme
  • GCV low-toxic antiherpetic drug ganciclovir
  • FIG. 29 An example of using a bacterial or yeast cytosine deaminase gene system. Inside the cell, a non-toxic fluorocytosine antimetabolite fluorouracil is formed. Table 1. Relative activity of double phSurv-phTERT and phTERT-phSurv in different cell lines. The average luciferase activity of at least three transfections is shown ⁇ the standard error of the mean (SD). Table 2. The activity of the components of a multidisciplinary double promoter in various cell lines. Luciferase activity in extracts of cells bearing the phTERT-pGL3 expression construct was taken as a unit. The average luciferase activity of at least three transfections is shown ⁇ the standard error of the mean (SD).
  • SD standard error of the mean
  • Table 5 The average size of the tumors in animals on day 14 from the moment of the first injection of the polyplex.
  • the phTERT-phSurv-pGL3 vector was obtained, carrying the luciferase gene under the control of the double phTERT-phSurv promoter (group 3), where the phTERT promoter is located above the phSurv promoter relative to the start codon of the firefly luciferase gene.
  • the phSurv-phTERT-pGL3 vector was obtained, carrying the luciferase gene under the control of the phSurv-phTERT promoter (group 3), in this case, the phSurv promoter is located above the phTERT promoter relative to the start codon of the luciferase gene.
  • the structure of the obtained expression cassettes is illustrated in figure 1.
  • pmSurv promoter was cloned into the phTERT-pGL3 construct in a direct orientation in two positions relative to the phTERT promoter.
  • mouse survivin cDNA (pmSurv) was obtained by hydrolysis of the plasmid pmSurv-pGL3 with Hindlll restriction enzymes, followed by treatment with a Klenov fragment and Notl. Then, the resulting fragment containing mouse batch of survivin gene cDNA (420 bp) was ligated with the phTERT-pGL3 vector, preliminary linearized at the recognition site with Xhol restrictase and processed with a large subunit of E. coli polymerase I DNA, and then with Notl restriction enzyme.
  • the vector pmSurv-phTERT-pGL3 was obtained, carrying the luciferase gene under the control of the pmSurv-phTERT double promoter (group 3), where the phTERT promoter is located below the pmSurv promoter relative to the start codon of the firefly luciferase gene.
  • telomerase cDNA (phTERT) was obtained with a length of 243 bp as a result of hydrolysis of the plasmid phTERT-pGL3 by Hindlll restriction enzymes, followed by treatment with a Klenov fragment and Notl.
  • the resulting phTERT-containing fragment (437 bp) was ligated with the pmSurv-pGL3 vector pretreated with Bglll restriction enzymes, followed by treatment with the Klenov and Notl fragment.
  • the phTERT-pmSurv-pGL3 vector carrying the luciferase gene under the control of the double promoter phTERT was obtained -pmSurv, where the phTERT promoter is located above the pmSurv promoter relative to the start codon of the firefly luciferase gene.
  • plasmid phSurv-pGL3 [Mityaev MV, Functional significance of a putative spl transcription factor binding site in the survivin gene promoter. Biochemistry (Mosc) 2008; 73: 1183-1191] was hydrolyzed at recognition sites by the restriction enzyme SacII located within the phSurv promoter sequence followed by intramolecular ligation plasmids.
  • the resulting plasmid was obtained in preparative quantities, hydrolyzed at the SacII site and ligated with fragments of double-stranded DNA from paragraph 2) of this Example.
  • chemically synthesized oligonucleotides were used.
  • they were mixed in pairs in equimolar amounts and incubated at 100 ° C for 3 minutes, after which they were slowly cooled to 25 ° C.
  • the short double-stranded DNA fragments thus obtained contained modified p53 binding sites and recognition sites with the restriction enzyme SacII. 3)
  • SacII restriction enzyme
  • 3) In L Yang, Z Cao, F Li, DE Post, EG Van Meir, H Zhong, and WC Wood. Tumor-specific gene expression using the survivin promoter is further increased by hypoxia. Gene Therapy (2004) 11, 1215-1223 and F Li, D Altieri. Transcriptional analysis of human gene expression. Biochem. J. (1999) 344, 305-311), it was shown that truncated fragments of the proximal region of the pSurv survivin gene promoter in tumor cells show promoter activity, comparable to the activity of full-size pSurv.
  • the resulting PCR DNA fragments were cloned into the pAL-TA vector, then the pAL-TA-phSurv269 and pAL-TA-phSurv399 constructs were sequenced to provide the structure structure. Then, the constructs pAL-TA-phSurv269 and pAL-TA-phSurv399 were treated with Bglll / Hindlll rektrktazy, the required insert length of 269 bp (phSurv 269) and 399 bp (phSurv399) was isolated from agarose gel and.
  • constructs carrying the firefly luciferase gene under control were obtained phSurv 269 promoter (group 1) or phSurv399 promoter (group 1).
  • PCNA proliferating cell nuclear antigen
  • PCNA is a nuclear antigen of proliferating cells, one of the key participants in the replication process.
  • PCNA is an auxiliary factor in delta DNA repair polymerase and forms a stable complex with it, and under certain conditions it also stimulates the activity of epsilon DNA polymerase. Protein is present in the cell as a trimmer, and according to some reports as a double trimmer.
  • PCNA is one of the most widespread and universally recognized markers of cancer cells and is present in a significant amount in almost all tumor cells, in contrast to normal ones, even if they have the same division rate.
  • pPCNAlong As a full-size promoter of the human PCNA gene (pPCNAlong), we selected a 1416 nucleotide DNA fragment located in the 5 'region of the PCNA gene limited by coordinates -1273 and +148 from the start of transcription. The promoter is located on chromosome 20 of the person and has coordinates 5101872-5100457.
  • PCNA-LL primers AAAGAATTCTGCTGACCAAGGTATT
  • PCNA-R GCAACAACGCCGCTACAG
  • the amplification matrix was genomic DNA from the human brain.
  • Amplification of a fragment with a length of 1420 bp was carried out for 23 cycles using Taq DNA polymerase at annealing temperature of primers 62 ° C.
  • the reaction mixture was ligated with the pAL-TA vector, and E. coli cells (strain DH5a) were transformed with the resulting ligase mixture.
  • the pAL-TA vector was chosen by us because it allows efficient cloning of PCR amplification products having an adenyl nucleotide protruding at the 3 'end of each of the chains. Plasmids isolated from individual bacterial clones for the presence of pPCNAlong insert were analyzed by PCR with primers Ml 3 -For (GTTTTCCCAGTCACGAC) and PCNA-R
  • the obtained cDNA fragment of the human PCNA gene was ligated with the pGL3 -basic vector previously linearized with Ncol restriction enzyme and treated with a large subunit of E. coli polymerase I DNA.
  • the pPCNAlong-pGL3 vector was obtained, carrying the luciferase gene under the control of the pPCNAlong promoter.
  • PCNAlong human PCNA gene promoter obtained as described above to obtain a modified human PCNA gene promoter (PCNAshort), which is a DNA fragment without the first 1027 nucleotides from the 5 'end of the full-length pPCNAlong promoter.
  • PCNAshort human PCNA gene promoter
  • PCNA-LS primers TCTCCACATATGCCCGGACT
  • PCNA-R GCAACAACGCCGCTACAG
  • the amplification matrix was genomic DNA from the human brain.
  • Amplification of a 389 bp fragment was carried out for 23 cycles using Taq DNA polymerase at annealing temperature of primers 62 ° C.
  • the reaction mixture was ligated with the pAL-TA vector, and E. coli cells (strain DH5a) were transformed with the resulting ligase mixture.
  • the pAL-TA vector was chosen by us because it allows efficient cloning of PCR amplification products having an adenyl nucleotide protruding at the 3 'end of each of the chains. Plasmids isolated from individual bacterial clones for the presence of the insert were analyzed by PCR with primers M13-For (GTTTTCCCAGTCACGAC) and PCNA-R (GCAACAACGCCGCTACAG) at an annealing temperature of 56 ° C for 20 cycles. Among the analyzed plasmids with an insert, the plasmid pPCNAshort-pAL-TA, which did not contain nucleotide substitutions, was selected.
  • pPCNAshort promoter Human PCNA gene promoter (pPCNAshort) 389 bp long cloned into the plasmid pGL3-basic (Promega, USA) carrying the firefly luciferase reporter gene.
  • the pPCNAshort promoter was inserted into the pGL3-basic construct in a direct orientation.
  • To obtain a design with direct orientation of the cNA promoter of the PCNA gene 389 bp in length plasmid pPCNAshort-pAL-TA was treated with restriction enzymes Ncol and Sacl.
  • the resulting cDNA fragment of the human PCNA gene was then ligated with the pGL3 -basic vector previously linearized with restriction enzymes Ncol and Sacl.
  • the pPCNAshort-pGL3 vector was obtained, carrying the luciferase gene under the control of the pPCNAshort promoter.
  • Protein Plkl (Polo-like kinase 1) - Polo-like kinase 1 - serine / threonine kinase is involved in the phosphorylation of microtubule proteins and in the regulation of division, (formation of a bipolar spindle, chromosome segregation, centrosome maturation, chromosome divergence to anaphase poles and triggering cytokines) .
  • Overexpression of the Plkl gene occurs in tissues with high proliferative potential, in contrast to differentiated cells, and positively correlates with aggressiveness and prognosis of many types of malignant neoplasms.
  • the amplification matrix was genomic DNA from the human brain. Amplification of a 2373 bp fragment was carried out for 20 cycles using Taq DNA polymerase at annealing temperature of primers 62 ° C. After PCR, the reaction mixture was ligated with the pAL-TA vector, and E. coli cells (strain DH5a) were transformed with the resulting ligase mixture.
  • the pAL-TA vector was chosen by us because it allows the efficient cloning of PCR amplification products, having a protruding adenyl nucleotide at the 3 'end of each chain. Plasmids isolated from individual bacterial clones for the presence of the pPLKlong insert were analyzed by PCR with M 13 -For primers (GTTTTCCCAGTCACGAC) and PLK-R
  • the obtained human Plkl gene cDNA fragment was subsidized with pGL3-bastc vector, preliminary linearized with Ncol restriction enzyme and treated with a large subunit of E. coli polymerase I DNA.
  • the pPLKlong-pGL3 vector was obtained, carrying the luciferase gene under the control of the pPLKlong promoter, Obtaining a modified promoter of the human PLK gene containing an altered set of recognition sites for transcription factor proteins (group 2).
  • the amplification matrix was genomic DNA from the human brain. Amplification of a 439 bp fragment was carried out for 20 cycles using Taq DNA polymerase at annealing temperature of primers 62 ° C. After PCR, the reaction mixture was ligated with the pAL-TA vector, and E. coli cells (strain DH5ct) were transformed with the resulting ligase mixture.
  • the pAL-TA vector was chosen by us because it allows efficient cloning of PCR amplification products having an adenyl nucleotide protruding at the 3 'end of each of the chains.
  • Plasmids isolated from individual bacterial clones for the presence of the pPLKshort insert were analyzed by PCR with M13-For primers (GTTTTCCCAGTCACGAC) and PLK-R (CAGACCTCGATCCGAGCAG) at an annealing temperature of 56 ° C for 20 cycles.
  • GTTTTCCCAGTCACGAC M13-For primers
  • PLK-R CAGACCTCGATCCGAGCAG
  • the obtained human Plkl gene cDNA fragment was ligated with the pGL3-basic vector, preliminary linearized with Ncol restriction enzyme and treated with a large subunit of E. coli polymerase I DNA.
  • the pPLKshort-pGL3 vector was obtained, carrying the luciferase gene under the control of the pPLKshort promoter.
  • the protein complex consists of 6 proteins - MSM 2-6 absolutely necessary for the initiation of replication, is assembled at the regions of the onset of replication and is an obligatory step in the initiation of replication, and it is necessary throughout the S phase for the elongation of chromosome replication, has helicase activity.
  • a key participant in this complex is the MCM2 protein.
  • the content of this component in the vast majority of tumor cells significantly exceeds its amount in normal non-proliferating cells.
  • Protein MCM2 is a marker of proliferating cells and its promoter represents a good target as a universal cancer-specific promoter.
  • pMCMlong As a full-size promoter of the human MCM2 gene (pMCMlong), we selected a 2005 nucleotide DNA fragment located in the 5 'region of the human MCM2 gene, limited by coordinates -1949 +57 from the start of transcription.
  • the promoter is located on chromosome 3 of the person and has coordinates 23687863 - 23690235.
  • the pAL-TA vector was chosen by us because it allows efficient cloning of PCR amplification products having an adenyl nucleotide protruding at the 3 'end of each of the chains. Plasmids isolated from individual bacterial clones for pMCMlong insert were analyzed by PCR with M13-For primers (GTTTTCCCAGTCACGAC) and MCM-R
  • the pMCMlong promoter was inserted into the pGL3-basic construct in a direct orientation.
  • pMCMlong-pAL-TA-1 1 and pMCMlong-pAL-TA-12 was treated with an EcoRI restriction enzyme, followed by treatment with a Klenov fragment.
  • the obtained human MCM2 gene cDNA fragments were ligated with the pGL3 -basic vector previously linearized with Ncol restriction enzyme and treated with a large subunit of E. coli polymerase I DNA.
  • pMCMlong-pGL3-l l and pMCMlong-pAL-TA-12 vectors carrying the luciferase gene under the control of the pMCMlong promoter were obtained.
  • MCMlong human MCM2 gene promoter obtained as described above to obtain a modified human MCM2 gene promoter (MCMshort), which is a DNA fragment without the first 1639 nucleotides from the 5 'end of the full-size pMCMlong promoter (see above).
  • the pAL-TA vector was chosen by us because it allows efficient cloning of PCR amplification products having an adenyl nucleotide protruding at the 3 'end of each of the chains. Plasmids isolated from individual bacterial clones for the presence of the pMCMshort insert were analyzed by PCR with M13-For primers (GTTTTCCCAGTCACGAC) and MCM-R
  • plasmids pMCMshort-pAL-TA-not containing nucleotide substitutions were selected.
  • 367 bp human MSM2 gene promoter (pMCMshort) cloned into the plasmid pGL3-basic (Promega, USA) carrying the firefly luciferase reporter gene.
  • the pMCMshort promoter was inserted into the pGL3-basic construct in the forward orientation.
  • 367 bp in length plasmid pMCMshort-pAL-TA was digested with restriction enzymes Ncol and Sacl.
  • the obtained cDNA fragment of the human MCM2 gene was ligated with the pGL3 -basic vector previously linearized with restriction enzymes Ncol and Sacl.
  • the vector was obtained pMCMshort-pGL3 carrying the luciferase gene under the control of the pMCMshort promoter.
  • the POLD1 gene encodes a catalytic subunit of delta polymerase DNA involved in the replication and repair of human genomic DNA. Increased expression of POLD1 is found in lymphoma, retinoblastoma and primitive neuroectodermal tumors, as well as in other neoplasms. These properties determined the choice of this promoter as a candidate for the control of therapeutic genes in tumor cells.
  • Two variants of the promoter were chosen for cloning: the long one with a size of 1404 nucleotides with coordinates (-1338; +66), and the short one with a length of 568 nucleotides with coordinates (-502; +66) with respect to the transcription start point.
  • coli cells (strain DH5a) were transformed with the obtained ligase mixture.
  • the pAL-TA vector was chosen by us because it allows efficient cloning of PCR amplification products having adenyl adenyl nucleotide at the 3'-end of each chain. Plasmids isolated from individual bacterial clones for the presence of the insert were analyzed by PCR, restriction analysis and sequencing. Among the analyzed plasmids with an insert, plasmid pPOLDl-1404-pAL-TA was selected, containing only one nucleotide substitution.
  • pPOLDl-1404-pGL3 vectors were obtained that carry the luciferase gene under the control of the pPOLDl promoter in the forward and reverse orientations.
  • the amplification matrix was genomic DNA from the human brain. Amplification of the promoter was carried out for 20 cycles using Tersus DNA polymerase (Eurogen) Taq at annealing temperature of primers 64 ° C. After
  • reaction mixture was ligated with the pAL-TA vector, and E. coli cells (strain DH5a) were transformed with the resulting ligase mixture. Plasmids isolated from individual bacterial clones for the presence of the insert were analyzed by PCR, restriction analysis and
  • the promoter of the human POLD1 gene (pPOLDl-568) is 568 bp long. cloned into the pGL3-basic plasmid (Promega, USA) carrying the firefly luciferase reporter gene at the Kpnl restriction site. For this, the promoter was excised from the plasmid pPOLDl-568-pAL-TA by the restriction enzyme Kpnl and ligated into the pGL3 -basic vector treated with the same restriction enzyme and alkaline phosphatase. Then, the reaction mixture of E. coli DH5a cells was transformed.
  • Clones containing the promoter in the desired orientation were selected from the obtained clones by the GSR method and restriction analysis, after which the constructs were checked by sequencing.
  • pPOLDl-568-pGL3 vectors were obtained that carry the luciferase gene under the control of the pPOLDl promoter in the forward and reverse orientations.
  • the product of the CDC6 gene is a homologue of the S. cerevisiae CDC6 protein, which is required to initiate DNA replication.
  • CDC6 serves a regulator of the early stages of DNA replication and is involved in the control of a reconciliation point that determines the completion of DNA replication before mitosis begins.
  • the CDC6 protein is located in the cell nucleus during the G1 division phase, but moves to the cytoplasm at the beginning of the S phase.
  • the expression of the CDC6 gene is increased in cancer of the uterus, bladder, neuroectodermal tumor, in tumors of the liver, pancreas and some other tissues. These properties made it possible to select this promoter as a candidate for the creation of therapeutic genetic engineering constructs.
  • the CDC6 gene is located on chromosome 17 (17q21.2) and has coordinates 17: 38,444,145 - 38,459,412.
  • Two variants of the promoter were chosen for cloning: the long one with the size of 1777 nucleotides with coordinates (- 1539; +238), and the short one with the length of 803 nucleotides with coordinates (-565; +238) with respect to the transcription start point.
  • CDC6-1777 The primers had additional Nhel restriction sites at the 5 'ends for ease of cloning.
  • the amplification matrix was genomic DNA from the human brain. Amplification of the promoter was carried out for 20 cycles using Tersus DNA- polymerase (Eurogen) Taq at annealing temperature of primers 64 ° C. After PCR, the reaction mixture was ligated with the pAL-TA vector, and E.
  • coli cells (strain DH5a) were transformed with the resulting ligase mixture.
  • the pAL-TA vector was chosen by us because it allows efficient cloning of PCR amplification products having an adenyl nucleotide protruding at the 3 'end of each of the chains. Plasmids isolated from individual bacterial clones for the presence of the insert were analyzed by PCR, restriction analysis and sequencing. Among the analyzed plasmids with an insert, plasmid pCDC6-1777-pAL-TA was selected that did not contain nucleotide substitutions.
  • Human CDC6 gene promoter (pCDC6-1777) 1777 bp long cloned into the plasmid pGL3-basic (Promega, USA) carrying the firefly luciferase reporter gene at the Nhel restriction site.
  • the promoter was excised from the plasmid pCDC6-1777-pAL-TA by the Nhel restriction enzyme and ligated into the pGL3 -basic vector treated with the same restriction enzyme and alkaline phosphatase, after which the reaction mixture of E. coli DH5a cells was transformed. From the obtained clones by PCR and restriction analysis, clones containing the promoter in the desired orientation were selected, after which the constructs checked by sequencing. Thus, pCDC6-1777-pGL3 vectors were obtained that carry the luciferase gene under the control of the pCDC6 promoter in the forward and reverse orientations.
  • CDC6-803 The primers had additional Nhel restriction sites at the 5 'ends for ease of cloning.
  • the amplification matrix was genomic DNA from the human brain. Amplification of the promoter was carried out for 20 cycles using Tersus DNA polymerase (Eurogen) Taq at annealing temperature of primers 64 ° C. After PCR, the reaction mixture was ligated with the pAL-TA vector, and E.
  • Plasmids isolated from individual bacterial clones for the presence of the insert were analyzed by PCR, restriction analysis and sequencing. Among the analyzed plasmids with an insert, plasmid pCDC6-1777-pAL-TA was selected that did not contain nucleotide substitutions.
  • pCDC6-803 promoter 803 bp human CDC6 gene promoter (pCDC6-803) cloned into the pGL3-basic plasmid (Promega, USA) carrying the firefly luciferase reporter gene at the Nhel restriction site.
  • the promoter was excised from the plasmid pCDC6-803-pAL-TA by the Nhel restriction enzyme and ligated into the pGL3-basic vector treated with the same restriction enzyme and alkaline phosphatase. Then, the reaction mixture of E. coli DH5a cells was transformed. Clones containing the promoter in the desired orientation were selected from the obtained clones by PCR and restriction analysis, after which the constructs were checked by sequencing.
  • pCDC6-803-pGL3 vectors were obtained that carry the luciferase gene under the control of the pCDC6 promoter in the forward and reverse orientations.
  • CKS1B The main role of the CKS1B protein is to stimulate mitosis by modulating the transcriptional activation of CDC20.
  • CKS1B provides the activity of cyclin-dependent kinases by binding to their catalytic subunit. Increased expression activity of the CKS1B gene is found in lymphoma, tumors of the adrenal gland, mammary, salivary glands and in a number of other neoplasms ..
  • the CSK1B gene is located on chromosome 1 (lq21.3) and has coordinates 1: 154,947,117 - 154,951,724.
  • the reaction mixture was ligated with the pAL-TA vector, and E. coli cells (strain DH5a) were transformed with the resulting ligase mixture.
  • the pAL-TA vector was chosen by us because it allows the efficient cloning of GSHR amplification products having a protruding adenyl nucleotide at the 3 'end of each chain. Plasmids isolated from individual bacterial clones for the presence of the insert were analyzed by PCR, restriction analysis and sequencing. Among the analyzed plasmids with an insert, plasmid pCKSlB-1016-pAL-TA was selected that did not contain nucleotide substitutions. Construction of an expression vector based on the pCKSlB-1016 promoter
  • Human CKS1B gene promoter (pCKSlB-1016) 1016 long cloned into the pGL3-basic plasmid (Promega, USA) carrying the firefly luciferase reporter gene at the Kpnl restriction site.
  • the promoter was excised from the plasmid pCKSlB-1016-pAL-TA by the restriction enzyme Kpnl and ligated into the pGL3 -basic vector treated with the same restriction enzyme and alkaline phosphatase. Then what was the transformation carried out with the reaction mixture of E. coli DH5a cells.
  • Clones containing the promoter in the desired orientation were selected from the obtained clones by PCR and restriction analysis, after which the constructs were checked by sequencing.
  • pCKSlB-1016-pGL3 vectors were obtained that carry the luciferase gene under the control of the pCKSIB promoter in the forward and reverse orientations.
  • coli cells (strain DH5a) were transformed with the resulting ligase mixture. Plasmids isolated from individual bacterial clones for the presence of the insert were analyzed by PCR, restriction analysis and sequencing. Among the analyzed plasmids with an insert, the pCKSlB-332-pAL-TA plasmid was selected that did not contain nucleotide substitutions.
  • the promoter of the human CKS1B gene (pCKS lB-332) 332 bp in length cloned into the pGL3-basic plasmid (Promega, USA) carrying the firefly luciferase reporter gene at the Kpnl restriction site.
  • the promoter was excised from the plasmid pCKSlB-332-pAL-TA by the restriction enzyme Kpnl and ligated into the pGL3 -basic vector treated with the same restriction enzyme and alkaline phosphatase. Then what was the transformation carried out with the reaction mixture of E. coli DH5a cells.
  • Clones containing the promoter in the desired orientation were selected from the obtained clones by PCR and restriction analysis, after which the constructs were checked by sequencing. Thus, were obtained pCKSlB-332-pGL3 vectors carrying the luciferase gene under the control of the pCDC6 promoter in the forward and reverse orientations.
  • Example 9 Delivery of genetic constructs to eukaryotic cells.
  • the phTERT-phSurv promoter contained five transcription initiation points, phSurv-phTERT six (Fig. 2).
  • the phTERT-phSurv promoter lacks a “major" transcription initiation point and the total number of transcription starts increases.
  • the presence of a dominant transcription initiation site is also not observed, and the number of transcription initiation points increases three times in the Calu-1 cell line relative to the phTERT promoter.
  • the activity of the phTERT-phSurv tandem in two cases is noticeably lower and does not exceed the activity of even individual promoters.
  • the phSurv-phTERT promoter activity averaged over cell lines is slightly lower than the averaged activity of the sum of individual promoters.
  • the phTERT-phSurv tandem activity is lower than the phSurv-phTERT tandem activity. It was also shown that the pmSurvphTERT double promoter (group 4) is more active than the phSurv promoter, the activity of this double promoter is 10 times higher than the activity of the SV40 virus promoter (Fig. 4).
  • the base phTERT promoter is the least active among the promoters based on it, and the most optimal version of the phTERT promoter is its modification phTERT-CMV, which showed the maximum activity in 8 out of 10 cell lines (table 2).
  • a similar analysis for the survivin promoter and its variants showed that the pmSurv mouse survivin promoter was the most active variant in the vast majority of cell lines (in 8 out of 10), while the base human survivin promoter phSurv4 showed the least activity.
  • fractionated proteins were transferred from the gel to the membrane and analyzed by Western blotting with monoclonal antibodies that specifically recognized p53 protein.
  • monoclonal antibodies that specifically recognized p53 protein.
  • GPDH glyceraldehyde-3-phosphate dehydrogenase
  • Protein p53 was not found in untransfected and Calu-1 cells transfected with plasmids containing various variants of the survivin promoter, without transfection with plasmid pCMV-p53 (Fig. 6). This result is explained by the absence in the cells of the gene encoding the p53 protein. Upon transfection of cells with an increasing amount of pCMV-p53 plasmid, a corresponding significant increase in p53 content in cells occurred. The content of GAPDH was slightly different in different samples, which indicates a small difference in the content of total protein in the studied samples.
  • One of the constructs from Example 2 (paragraphs 1-2) and the standard construct pCMV-p53 (p53 Dominant Negative Vector Set) carrying the gene encoding the p53 protein were delivered to cancer cells that normally do not produce p53 protein. under the control of a strong cytomegalovirus promoter.
  • the constructs were delivered to the cells together with the normalizing plasmid pRL-TK. 48 hours after the introduction of the constructs into the cells, the activity of the mutant forms of the human survivin promoter was determined using the firefly luciferase reporter gene.
  • the activity of the promoters pPCNAlong, pPLKlong (group 2), pMCMshort, pPLKshort (group 3) in the studied cell lines A549, PANC-1, HEK293 is higher than the activity of the SV40 virus control promoter and also higher than the activity of the phSurv survivin gene promoter , while the activity of the pPCNAshort promoter exceeds the activity of all studied promoters in this experiment and reaches 40% of the activity of the constitutive promoter of cytomegalovirus in some cancer cell lines (Fig. 8).
  • HSVtk protein in cells into which constructs containing the HSVtk gene were previously introduced under the control of various promoters, in particular the phSurv promoter, was detected using Western blot analysis as described in Example 7, except for the use of monoclonal antibodies that specifically recognize the HSV-protein tk.
  • the amount of recombinant herpes simplex thymidine kinase in cells transfected with the phSurv-HSVtk-pGL3 construct is significantly higher than the amount of thymidine kinase in cells transfected with the control plasmid pSV40-HSVtk-pGL3 containing the HSVtk gene under the control of the constitutive promoto virus (Fig.9).
  • the efficiency of the expression construct pSurv-HSVtk-pGL3 is lower than the efficiency of the construction pGL3-pCMV-HSVtk, which due to the difference in activity of the phSurv promoter and the CMV promoter.
  • Example 17 Determination of the activity of herpes simplex virus thymidine inase
  • the ability of cell extracts containing herpes simplex virus thymidine kinase to phosphorylate ganciclovir was tested by the method described [Mercer K. 2002. Mutation of herpesvirus thymidine kinase to generate ganciclovir-speciflc kinases for use in cancer gene therapies. Protein Eng. 15. 903-11.].
  • the incubation sample contained: H 3 -GCV, ATP, BSA, buffer B and cell extract.
  • the reaction was started by the addition of a cell extract. Cell extracts were incubated at 37 ° C for 1-24 hours depending on the type of cells. The reaction was stopped by applying the incubation mixture to anion exchange paper targets.
  • the dried targets were lowered into a solution of ammonium formate, then washed with 70% ethanol, dried in air, and their radioactivity was determined in a scintillator. Differences between the radioactivity of samples with extracts of transfected and non-transfected eukaryotic cells were calculated. The values obtained were reflected in the amount of phosphorylated ganciclovir (GCV) in samples in pulses / min. Their conversion to the amount of phosphorylated GCV formed was carried out using a calibration curve reflecting the dependence of the radioactivity (cpm) of H-GCV on its amount.
  • GCV phosphorylated ganciclovir
  • MTS dye CellTiter 96 Non-Radioactive Cell Proliferation Assay (MTS), Promega, USA
  • the cytotoxic effect on cancer cells of the pGL3-pBIRC5-1.5-FCUl construct in combination with 5-fluorocytosine is comparable to the effect exerted by the control construct pGL3-pCMV-FCUl (in the case of the pG13-pBIRC5-1.5-FCUl construct, 70% of cancer cells die pGL3-pCMV-FCUl - 85%).
  • Example 20 Evaluation of the ability of the Tat-TAR system of HIV-1 to enhance the expression of the HSVtk gene in tumor cells
  • 5'LTR HIV-1 has the properties of an inducible promoter system in which the tat viral protein binds to the mRNA region corresponding to the LTR TAR sequence, which leads to transactivation of the LTR promoter and to increased transcription of controlled genes. In the absence of tat protein, gene expression is minimal.
  • the following constructs were obtained: ALTRep-HSVtk carrying the HSVtk gene under HIV-1 LTR control, phSurv-tat and phTERT-CMV-tat containing the tumor-specific virus gene tat under the tumor-specific promoters phSurv and phTERT-CMV, respectively.
  • Either binary ALTRep-HSVtk + systems were introduced into the cells of the Calul and HT1080 line phSurv-tat or ALTRep-HSVtk + phTERT-CMV-tat or separate constructs pSurv-HSVtk, phTERT-CMV-HSVtk, pCMV-HSVtk, as described in Example 9, p. 48 hours after the introduction of the constructs into the cells, cell extracts were prepared and the level of transgene expression was analyzed by immunoblotting using antibodies to HSV-tk, as described in Example 16.
  • the expression level of the HSY-tk gene in the binary system with tumor-specific promoters phTERT-CMV and phSurv was comparable with the expression level of this gene in the pCMV-HSVtk construct (Fig. 12, d.8 and 3).
  • the tat-TAR bimodal system allows one to obtain a high level of expression of a controlled gene, comparable to the level of one of the strongest promoter systems pCMV.
  • Suicide gene therapy was performed using the HSVtk therapeutic gene delivered to the cells of experimental mouse tumors using polyplexes and the prodrug ganciclovir.
  • mice of the C57black / 6J line (Stolbovaya Branch, GU NTsMT RAMS), the average weight at the beginning of the experiment was 19.8 + 0.2 (hereinafter the mean + standard error of the mean). Animals were kept on standard granular dry food.
  • LLC1 lung carcinoma cell lines Lewis carcinoma, were cultured on DMEM / F12 medium (Gibco) with 10% cattle embryonic serum in a C0 2 incubator in a gas mixture consisting of air with 5% CO-.
  • DMEM / F12 medium Gibco
  • the hair was removed under avertine anesthesia from the area into which the cells were injected (1.5 - 2 cm 2 ).
  • plasmids were used to prepare polyplexes: as a control, pGL3 basic vector, (Promega, contains the Photinus pyralis luciferase gene, does not contain a promoter); pSurv4_TK_pGL3 (contains the KSYtk gene, under the control of the promoter region of the human survivin gene); phTERT_TK (contains the HSVtk gene under the control of the human telomerase promoter). All plasmids were isolated using the EndoFree Plasmid Maxi Kit (Qiagen).
  • Polyplexes were prepared using the polyethyleneimine-polyethylene glycol- (TAT-peptide) block copolymer (PEI-PEG-TAT), synthesized in the Laboratory of Molecular Genetics of Intracellular Transport, IBG RAS.
  • Polyplex preparations were prepared on the day of the experiment under sterile conditions. Before by administering to animals, gentamicin was added to the preparations to a final concentration of 50 ⁇ g / ml.
  • the introduction of the polyplex was carried out by intratumoral injection in a volume of 50 ⁇ l per animal using an insulin syringe (BD Micro-Fine Plus 0.5 ml, 12.7 mm x 0.33 mm) on days 17 and 21 after cell inoculation with animals.
  • Ganciclovir (Hoffmann-La Roche, 4 mg / ml in Hanks sterile solution with 50 ⁇ g / ml gentamicin) was administered intraperitoneally twice a day for 10 days at a dose of 75 mg / kg per administration, starting the day after administration of the polyplex. On the day of repeated administration of the polyplex, ganciclovir was not administered.
  • the average tumor size over the treatment time in the groups receiving the HSV / & polyplex under the control of various promoters significantly differed from the average tumor size in the animals of the control group (table 4).
  • the average tumor size at the time of death of the first animal in the control group (14 days after the first injection of the polyplex) is shown in Table 5.
  • the average tumor size in animals treated with HSVtk polyplex under the control of telomerase and cytomegalovirus promoters significantly differed from the average tumor size in the control group.
  • the obtained data indicate the presence of a reliable antitumor effect of thymidine kinase under tumor-specific promoters in combination with the introduction of ganciclovir during gene delivery to tumor cells of Lewis carcinoma with intratumoral administration of a polyplex with a therapeutic gene.
  • mice Twice intratumoral administration of polyplexes with plasmids carrying the HSVtk gene under the control of tumor-specific promoters, and a 10-day course of ganciclovir (the experimental conditions are described in Example 20) led to a significant increase in the life expectancy of mice with experimental Lewis carcinoma tumors.
  • the average life expectancy of mice treated with a polyplex with the HSVtk gene and subsequent administration of ganciclovir increased by 30–40 percent compared with the control group and significantly differed from it (Fig. 14).
  • Claudman S91 melanoma cells (clone MOH) were cultured on DMEM / F12 medium (Gibco) with 10% fetal cow serum in a COg incubator in a gas mixture consisting of air with 5% COg.
  • DMEM / F12 medium Gibco
  • tumor volume was calculated using the ellipsoid formula.
  • a criterion for euthanasia was the achievement of a tumor volume of 1500
  • Polyplexes with a nitrogen: phosphate ratio of 10 were prepared using the block copolymer polyethyleneimine-polyethylene glycol-TAT peptide (PEI-PEG-TAT), synthesized in the Laboratory of Molecular Genetics of Intracellular Transport, IBG RAS.
  • PEI-PEG-TAT polyethyleneimine-polyethylene glycol-TAT peptide
  • Plasmids were isolated using the kit
  • Polyplexes were prepared at by quickly mixing a solution of a block copolymer with a solution of DNA in an isotonic glucose solution with 10 mM 4- (2-hydroxyethyl) -1-piperazine ethanesulfonate, pH 7, at a final polypex concentration of 80 ⁇ g DNA per milliliter. Polyplex preparations were prepared on the day of the experiment under sterile conditions. Before administration to animals, gentamicin was added to the preparations to a final concentration of 50 ⁇ g / ml.
  • HSV r controlled by a tumor-specific promoter on life expectancy of tumor-bearing animals during suicide gene therapy in mice with Cloudman melanoma.
  • D-MSH melanocyte-stimulating hormone receptor
  • M1R melanocortin receptor 1 receptor
  • M1R melanocortin 1 receptor
  • D-MSH can bind to four human melanocortin receptors (with all except MC2R), however, it has the highest affinity for MC1R and is most specific for it, its affinity for MC3R is 260 times lower, for MC4R - 5500 times and for MC5R in 47500 times.
  • MC2R human melanocortin receptors
  • the sequence of one of these peptides was used to create a melanoma-specific polyplex.
  • the block copolymer PEI-PEG- (specific MK1c peptide) was synthesized according to the scheme used to create polyplexes with a TAT peptide.
  • mice of the DBA / 2y line were used (Stolbovaya Branch, GU NTsBMT RAMS). Animals were kept on standard granular dry food. Melanoma cells Klaudmana S91 (MOH clone) were cultured in DMEM / F12 medium (Gibco) with 10% fetal bovine serum in an incubator of CO in the gas mixture consisting of air with 5% C0 2. To obtain experimental tumors, cells were inoculated subcutaneously in the posterior right part of the back in an amount of NO 6 per animal in a volume of 20 ⁇ l in DMEM / F12 medium.
  • Tumor volume was calculated by the ellipsoid formula according to the measurement of tumor size (length, width, height) using an electronic caliper. The criterion for euthanasia was the achievement of a tumor volume of 1500 mm 3 .
  • Polyplexes with a nitrogen: phosphate ratio of 20 were prepared using the PEI-PEG-MK1s block copolymer, synthesized in the laboratory of molecular genetics of intracellular transport IBG RAS
  • intravenous administration of polyplex was used on days 3 and 8 after subcutaneous inoculation of the tumor and intraperitoneal administration of ganciclovir, 25 mg / kg, 2 times a day, 7 injections after polyplex administration, with a one-day interval between courses.
  • the introduction of a specific polyplex (with the PEI-PEG-MK1C block copolymer) carrying the HSVtk gene under the control of the telomerase promoter led to inhibition of tumor growth compared to the control by 42%.
  • Suicide therapy with HSVtk under the control of a tumor-specific promoter also led to a significant increase in the life expectancy of mice bearing experimental melanoma tumors (Fig, 16).
  • the median survival in the group of animals treated with the therapeutic gene polyplex and ganciclovir was 39 days compared to 25 days in the control group treated with ganciclovir alone (1.56 times difference).
  • the bicistronic construct carrying the herpes simplex virus thymidine kinase gene and granulocyte macrophage colony stimulating factor (GM-CSF) under the control of HIV LTR was obtained as follows: the human GM-CSF gene was amplified by PCR using hGM-for primers (TTATCGATATGTGGCCGC) and (TTGGATCCTCACTCCTGGACTGG), containing at the 5'end of the sequence the recognition sites of the restriction enzymes Clal and Batt, respectively (the sequence of sites is underlined).
  • the amplification matrix was plasmid pBK-CMV-hGM-CSF carrying the cDN of the hGM-CSF gene.
  • the purified PCR product was ligated with the pAL-TA vector, and E. coli cells (strain DH5a) were transformed with the obtained ligase mixture. Plasmids isolated from individual bacterial clones for the presence of hGM-CSF insert in pAL-TA were analyzed by PCR with M13-For primers (GTTTTCCCAGTCACGAC) and hGM-for (TTATCGATATGTGGCTGCAGAGC).
  • hGM-CSF fragment clal and Sphl restriction enzyme recognition sites were cut from the pAL-TA vector and cloned into the retroviral vector pFB-neo (Stratagene, USA) containing the picornovirus ribosome (IRES) site at sticky ends.
  • Recombinant plasmids for the presence of an insert were analyzed by PCR with hGM-for and hGM-rev primers.
  • the IRES-hGM-CSF cassette was excised from the pFB-neo-hGM-CSF construct from Notl and Batch restriction enzyme recognition sites and cloned at the “sticky” ends into a pQCXIX retroviral vector carrying the herpes simplex virus thymidine kinase gene under 5'LTR control HIV-1.
  • the final construct pQCXIX-HSVtk-hGM-CSF was verified by PCR and restriction analysis, and the nucleotide sequence of the IRES-hGM-CSF-polyA cassette was analyzed as part of the pQC-XIX retroviral vector.
  • the pQCXIX-HSVtk-hGM vector was hydrolyzed Xhol restriction enzyme and was treated with a Klenov fragment, then the resulting linearized vector was hydrolyzed at the Sphl site located inside the HSVtk gene, thereby obtaining a fragment of 2100 bp containing 800 bp HSVtk gene and IRES-hGM-CSF-polyA cassette.
  • the plasmid CMV-HSVtk-hGM-CSF-pGL3 was digested with restriction enzymes Xhol and Ncol, recognition sites of which flank the cytomegalovirus promoter, and the modified human survivin gene promoter obtained by hydrolysis of the plasmid pGL3-Psurv4-HSVtk at Xhol and Ncol restriction enzyme recognition sites was cloned at the sticky ends.
  • the presence of the insert in the desired direction was confirmed by PCR using Survfor primer (AGATCTAAATCTGGGTGAAGGGTATATGAGT),
  • TATCTAGATCAGTTAGCCTCCCCCATC the complementary sequence of the herpes simplex virus thymidine kinase gene.
  • the obtained plasmids pGL3-Psurv4-HSVtk-hGM-CSF and pGL3-CMV-HSVtk-hGM-CSF were prepared in preparative quantities, purified using QIAGEN Plasmid Midi Kit (Qiagen, Germany) and used for expression of HSV thymidine kinase genes and granulocyte macrophage colony stimulating factor Example 26.
  • CSF _BatH1 was cloned into the pSurv4_N vector (Co / _HSVtk_mGM-CSF_pGL3 at the “blunt” and “sticky” - Ncol ends.
  • the presence of the insert in the desired direction was confirmed by PCR using the mGMCSF-for primer (TTATCGATATGCGtGene fragment).
  • - macrophage colony-stimulating factor mouse and primer RV4 (GACGATAGTCATGCCCCGCG), a complementary sequence of the vector pGL3.
  • GM-CSF Granulocyte-macrophage colony stimulating factor
  • Eukaryotic cells were transfected with the obtained constructs in culture bottles (20 cm 3 ) using liposome transfer using lipofectamine-2000 (Invitrogene) according to the manufacturer's procedure. 48 hours after transfection, mGM-CSF-containing conditioned medium was collected to analyze the expression level and biological activity of mGM-CSF. The expression level of mGM-CSF was determined using a commercial ELISA kit manufactured by R&D Systems (USA).
  • Figure 19 shows the increase in optical density of the test sample (pGL3-CMV-HSV-tk-mGM-CSF) relative to the controls.
  • mGM-CSF granulocyte macrophage colony stimulating mouse factor
  • the biological activity of mGM-CSF was determined by the ability of the mGM-CSF-containing conditioned medium to differentiate mouse bone marrow progenitor cells. MGM-CSF has been shown to induce growth and differentiation of immature bone marrow cells into different types of cells of the myeloid series, while accelerating the maturation of granulocyte precursors and mononuclear macrophages.
  • mouse bone marrow progenitor cells were cultured in medium supplemented with conditioned medium obtained from HEK293 cells transfected with pSurv4-HSVtk-mGM-CSF-pGL3 and HSVtk-mGM-CSF-pGL3 constructs. The cells were then stained with FITC-labeled (fluorescein isothiocyanate) antibodies to the mature macrophage marker F4 / 80, the macrophage and dendritic cell marker IA-d and the granulocyte marker GR-1, or PE (phycoerythrin) -labeled antibodies to the CD86 dendritic cell marker.
  • FITC-labeled fluorescein isothiocyanate
  • Figure 20 shows an increase in the number of cells containing the corresponding differentiation antigens in the experiment compared with the control.
  • FIG. 21 presents micrographs confirming the presence of differentiated cells - granulocytes, macrophages and immature dendritic cells, after culturing mouse bone marrow progenitor cells in air-conditioned medium containing granulocyte-macrophage colony stimulating factor mouse.
  • eukaryotic cells of the HEK 293 line transformed human embryonic kidney cells
  • Calul epidermoid lung carcinoma
  • hGM-CSF was determined by the level of stimulation of proliferation of the human erythroleukemia cell line TF-1.
  • TF-1 cells were scattered into a 96-well plate at 20,000 cells per well. Cells were cultured for 48 hours in the conditioned medium obtained as described above, diluted 50, 100, 250 and 500 times or in a medium not containing GM-CSF (negative control). The degree of stimulation of proliferation of TF-1 cells was determined using a commercial kit for the MTS test (Promega, USA), the results of which are shown in figure 22.
  • Figure 22 shows that the level of proliferation of TF-1 cells in the conditioned medium increases dramatically compared to the negative control, while increasing the dilution of the conditioned medium leads to a decrease in cell proliferation.
  • the proliferative effect of hGM-CSF, TKhGM constructs was shown to be higher than the GM-CSF of the control hGM plasmid.
  • Transfection was carried out for 3 h 40 min, 24 hours after transfection, the cells were detached from the surface of the plate using trypsin (2 ml per plate) and suspended in antibiotic DMEM / F12 medium, the cells were transferred to Falcons and centrifuged (1000 rpm, 160g, ) 5 minutes. Then the cells were washed twice with PBS and a suspension of LLC cells was prepared in PBS with a concentration of 2 * 10 6 cells / ml for administration to animals.
  • Cell transplantation to female C57B1 / 6 is performed on day 0 (07.27.2011 d 16.30) subcutaneously in the back of the back in an amount of 2 * 10 5 cells in 100 ⁇ l of PBS.
  • 48 hours after Tumor inoculation we begin the introduction of a solution of ganciclovir (GCV) intraperitoneally for 10 days at the rate of 75 ⁇ g per gram of weight (2 injections of 100 D1 per 1 mouse per day, the concentration of ganciclovir 5 mg / ml) 2 times a day.
  • GCV ganciclovir
  • PBS phosphate buffer
  • the tumor size was measured in 2 dimensions (smaller (A) and larger (B) tumor diameter) using an electronic caliper and animal mass. Tumor size was calculated by the formula A * B 12. Tumor diameters were measured every other day. The criterion for euthanasia was the achievement of a tumor of 10% by weight of the animal.
  • Each experimental group of animals that received LLC line cells transiently transfected with the obtained constructs containing the HSVtk gene or a combination of HSV-tk / GM-CSF genes consisted of 10 animals; control groups (6 animals each) received ⁇ transformed LLC cells. Animals were evenly distributed in groups according to their weights. The results of the experiment are shown in figure 23. As can be seen in figure 23 on the 18th day of the experiment, the maximum tumor size was observed in animals in the control groups (1530 and 1200 mm, respectively). Tumors were slightly smaller in animals of the group receiving the HSVtk / PBS system (595 mm).
  • the proposed group of inventions ensures that the synthesis of the enzyme directed by a multidisciplinary promoter leads to the conversion of an externally supplied prodrug inside the cancer cell into a toxin and causes the killing of an expanded tumor spectrum compared to known analogues.
  • the synthesis of the enzyme and the cytokine directed by the multidisciplinary promoter leads to the transformation of the prodrug into a toxin and activation of the cells of the immune system and causes the killing of an expanded, in comparison with known analogues, tumor spectrum.
  • the invention relates to biotechnology, in particular genetic engineering, and can be used for the effective treatment of tumors of various nature.

Abstract

L'invention concerne la biotechnologie et notamment le génie génétique et porte sur un promoteur à profils multiples (et variantes), actif dans plus de trois types de cellules cancéreuses d'étiologies différentes et possédant une activité supérieure que le promoteur natif du gène BIRC5 et comprenant un ensemble élargi ou modifié par rapport aux promoteurs initiaux de sites de reconnaissance de protéines facteurs de transcription. L'invention concerne également un vecteur d'expression qui comprend ce promoteur, un procédé de suppression sélective de cellules cancéreuses mais pas de cellules normales, qui provoque la synthèse dans les cellules cancéreuses d'une toxine utilisant le promoteur ainsi qu'un procédé de traitement du cancer chez les mammifères par l'administration à l'animal dudit vecteur. L'invention permet de diriger la synthèse du ferment et de cytokine utilisant le promoteur selon l'invention de manière à ce que le promédicament fourni de l'extérieur se transforme en une toxine, et d'activer les cellules du système immunitaire.
PCT/RU2012/000604 2012-07-24 2012-07-24 Promoteur multiprofil et son utilisation dans la thérapie génique du cancer WO2014017941A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/RU2012/000604 WO2014017941A1 (fr) 2012-07-24 2012-07-24 Promoteur multiprofil et son utilisation dans la thérapie génique du cancer

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/RU2012/000604 WO2014017941A1 (fr) 2012-07-24 2012-07-24 Promoteur multiprofil et son utilisation dans la thérapie génique du cancer

Publications (1)

Publication Number Publication Date
WO2014017941A1 true WO2014017941A1 (fr) 2014-01-30

Family

ID=49997623

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/RU2012/000604 WO2014017941A1 (fr) 2012-07-24 2012-07-24 Promoteur multiprofil et son utilisation dans la thérapie génique du cancer

Country Status (1)

Country Link
WO (1) WO2014017941A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB2617512A (en) * 2019-04-05 2023-10-11 Earli Inc Improved methods and compositions for synthetic biomarkers

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2007137122A (ru) * 2005-03-09 2009-04-20 Борд Оф Риджентс, Дзе Юниверсити Оф Техас Систем (Us) НОВЫЙ ПРОМОТОР hTMC И ВЕКТОРЫ ДЛЯ ОПУХОЛЕСЕЛЕКТИВНОЙ И ВЫСОКОЭФФЕКТИВНОЙ ЭКСПРЕССИИ ТЕРАПЕВТИЧЕСКИХ ПРОТИВОРАКОВЫХ ГЕНОВ

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2007137122A (ru) * 2005-03-09 2009-04-20 Борд Оф Риджентс, Дзе Юниверсити Оф Техас Систем (Us) НОВЫЙ ПРОМОТОР hTMC И ВЕКТОРЫ ДЛЯ ОПУХОЛЕСЕЛЕКТИВНОЙ И ВЫСОКОЭФФЕКТИВНОЙ ЭКСПРЕССИИ ТЕРАПЕВТИЧЕСКИХ ПРОТИВОРАКОВЫХ ГЕНОВ

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
LI FENGZHI ET AL.: "Transcription analysis of human survivin gene expression.", BIOCHEM. J., vol. 344, 1 December 1999 (1999-12-01), pages 305 - 311 *
UCHIUMI TAKESHI ET AL.: "Cell Cycle Regulation of the Human Polo-like Kinase (PLK) Promoter", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 272, no. 14, 4 April 1997 (1997-04-04), pages 9166 - 9174 *
ZELENIN A. V.: "Gennaia terapiia na granitse tretego tysiacheletiia.", VESTNIK ROSSIISKOI AKADEMII NAUK, vol. 71, no. 5, 2001, pages 387 - 395 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB2617512A (en) * 2019-04-05 2023-10-11 Earli Inc Improved methods and compositions for synthetic biomarkers
GB2617512B (en) * 2019-04-05 2023-12-27 Earli Inc Improved methods and compositions for synthetic biomarkers

Similar Documents

Publication Publication Date Title
JP6946486B2 (ja) コードされている腫瘍抗原の発現を増加させるための、ヒストンステムループとポリ（ａ）配列又はポリアデニル化シグナルとを含むか又はコードしている核酸
US10543233B2 (en) Drug resistant immunotherapy for treatment of a cancer
JP2021098735A (ja) 治療用ｒｎａ
CA3136740A1 (fr) Compositions et methodes pour le traitement du cancer utilisant une therapie cellulaire par des lymphocytes t modifies par des cd8
Alekseenko et al. Therapeutic properties of a vector carrying the HSV thymidine kinase and GM-CSF genes and delivered as a complex with a cationic copolymer
KR101354995B1 (ko) 임파구계 혈구계 세포에 유전자 도입을 위한 프로모터 및 그의 이용 방법
ES2806605T3 (es) Cepas bacterianas que expresan genes de metilasa y sus usos
WO2020103777A1 (fr) Mutant de la protéine interleukine 21 (il21) et son utilisation
WO2014017941A1 (fr) Promoteur multiprofil et son utilisation dans la thérapie génique du cancer
RU2476596C1 (ru) Многопрофильный промотор, экспрессирующий вектор и способ избирательного убийства раковых клеток с их использованием
Shaw et al. Ganciclovir and penciclovir, but not acyclovir, induce apoptosis in herpes simplex virus thymidine kinasetransformed baby hamster kidney cells
US20240043866A1 (en) Treatment of autoimmune diseases
US20230257713A1 (en) Immunotherapy method of targeted chemokine and cytokine delivery by mesenchymal stem cell
US20230355762A1 (en) Compositions and methods for the treatment of cancer using next generation engineered t cell therapy
US20230270855A1 (en) Genetically Modified T-Cells and PI3K/AKT Inhibitors For Cancer Treatment
RU2447150C1 (ru) Средство для генной терапии злокачественных опухолей
Ahmad Creating a built-in suicide system in Adeno associated viral constructs as a safety check mechanism for treatment of possible tumor development in long term gene therapy studies.
CN116801890A (zh) 用于增强治疗性免疫细胞功效的方法和组合物
Lawler Gene Therapy for Cancer: Deceiving the malignant cell
Gazit The glucose-regulated proteins: Altered expression in human breast cancer cell lines and applications in cancer gene therapy in an in vivo mouse model system

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12881594

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 12881594

Country of ref document: EP

Kind code of ref document: A1