WO2014014322A1 - 재발성 다형교아종 진단용 조성물 및 진단방법 - Google Patents

재발성 다형교아종 진단용 조성물 및 진단방법 Download PDF

Info

Publication number
WO2014014322A1
WO2014014322A1 PCT/KR2013/006519 KR2013006519W WO2014014322A1 WO 2014014322 A1 WO2014014322 A1 WO 2014014322A1 KR 2013006519 W KR2013006519 W KR 2013006519W WO 2014014322 A1 WO2014014322 A1 WO 2014014322A1
Authority
WO
WIPO (PCT)
Prior art keywords
mirna
seq
recurrent
gbm
mir
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2013/006519
Other languages
English (en)
French (fr)
Inventor
김건화
김지원
김수현
김승일
박창균
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Korea Basic Science Institute KBSI
Original Assignee
Korea Basic Science Institute KBSI
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Korea Basic Science Institute KBSI filed Critical Korea Basic Science Institute KBSI
Publication of WO2014014322A1 publication Critical patent/WO2014014322A1/ko
Priority to US14/600,419 priority Critical patent/US10266898B2/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/112—Disease subtyping, staging or classification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/118—Prognosis of disease development
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Definitions

  • compositions and methods for diagnosing recurrent glioblastoma Compositions and methods for diagnosing recurrent glioblastoma
  • the present invention relates to the use of recurrent glioblastoma marker miRNA for the diagnosis of recurrent glioblastoma, and more particularly, to an agent for selecting a miRNA marker specific for the recurrent glioblastoma and measuring the presence of the marker.
  • miRNAs control gene expression with a single base of unencoded small R A consisting of 18-25 nucleic acids.
  • One miRNA can directly control multiple target genes and thus regulate multiple protein expression in a variety of signaling pathways (Bartel DP. MicroRNAs: target recognition and regulatory functions. Cell 2009; 136: 215-233.) .
  • Expression of miRNAs depends on organ development and tissue differences (Rosenfeld N, Aharonov R, Meir i E, et al. MicroRNAs accurately identify cancer tissue origin. Nat Biotechnol 2008; 26: 462-469.). miRNAs are well known for controlling a variety of biological processes (Rosenfeld N, Aharonov R, Meiri E, et al. MicroRNAs accurately identify cancer tissue origin.
  • Glioblastoma is the most common and aggressive type of major adult brain cancer.
  • the treatment of newly diagnosed glioblastoma is surgical resection with a combination of chemoradiotherapy and radiotherapy (Stupp R, Mason WP, van den Bent MJ, et al. Radiotherapy lus concomitant and adjuvant temozolomide for ' glioblastoma. N Engl J Med 2005; 352: 987-996.
  • chemoradiotherapy and radiotherapy a combination of chemoradiotherapy and radiotherapy
  • Stupp R Mason WP
  • van den Bent MJ van den Bent MJ
  • Radiotherapy lus concomitant and adjuvant temozolomide for ' glioblastoma.
  • N Engl J Med 2005; 352: 987-996 Despite advances in therapies and in understanding the genetics and molecular metabolism of GBM (Bai RY, Staedtke V Riggins GJ.Molecular targeting of
  • an object of the present invention is to provide a composition for diagnosing recurrent glioblastoma comprising a miRNA represented by SEQ ID NO: 1.
  • Another object of the present invention is to provide a use of miRNA represented by SEQ ID NO: 1 for the preparation of diagnostic agents for recurrent glioblastoma.
  • Another object of the present invention is to measure the expression level of the miRNA of SEQ ID NO: 1 from a biological sample isolated from a patient with suspected recurrent glioblastoma;
  • Still another object of the present invention is to provide a kit for diagnosing recurrent glioblastoma, comprising an agent for measuring the level of miRNA represented by SEQ ID NO: 1.
  • the present invention provides a composition for diagnosing recurrent glioblastoma comprising a miRNA represented by SEQ ID NO: 1.
  • Another object of the present invention is to provide a use of miRNA represented by SEQ ID NO: 1 for the preparation of a diagnostic agent for recurrent glioblastoma.
  • Another object of the present invention is to measure the expression level of the miRNA of SEQ ID NO: 1 from a biological sample isolated from a patient with suspected recurrent glioblastoma;
  • the present invention provides a composition for diagnosing recurrent glioblastoma comprising a miRNA represented by SEQ ID NO: 1.
  • the composition may include one or more miRNAs selected from the group consisting of SEQ ID NOs: 1 to 29.
  • the present invention also provides the use of miRNA represented by SEQ ID NO: 1 for the preparation of a diagnostic agent for recurrent glioblastoma.
  • the recurrent gl ioblastoma mult i form is a recurrence of polyglioblastoma, a tumor occurring in the neuroblastoma cell, and recurs in or around the area where the glioblastoma occurs at the initial onset. It means a glioblastoma.
  • composition or formulation of the present invention may comprise one or more miRNA selected from the group consisting of SEQ ID NO: 2 to 29 in addition to the miRNA of SEQ ID NO: 1.
  • SEQ ID NO: 2 (hsa-miR-29b, tagcaccatttgaaatcagtgtt), SEQ ID NO: 3 (hsa-miR-34c-5p, aggcagtgtagttagctgattgc), and SEQ ID NO: 4 (hsa- miR-129-3p, aagcccttaccccaaaaagcat), SEQ ID NO: 5 (hsa-miR-218, ttgtgcttgatctaaccatgt), SEQ ID NO: 6 (hsa-miR-124, taaggcacgcggtgaatgcc), 'SEQ ID NO: 7 (hsa-miR-486-5p , tcctgtactgagctgccccgag), SEQ ID NO: 8 (hsa— miR-lOb, taccctg
  • Preferred use of the miRNA represented by the SEQ ID NO: 1 is the preparation of a preparation for diagnosing recurrent glioblastoma.
  • the diagnostic agent is the same as the description of the diagnostic composition described above.
  • the miRNA is a specific marker expressed more than two times more than a normal control group in recurrent glioblastoma, and can diagnose recurrent glioblastoma at the expression level.
  • miRNAs of SEQ ID NOs: 2 to 29 can also be used for the preparation of a diagnostic agent for recurrent polygliomas.
  • SEQ ID NOs 2 to 7, SEQ ID NO: 23, SEQ ID NO: 25, and SEQ ID NO: 27 and miRNA are expressed more than twice as much as the normal control group in patients with recurrent glioblastoma.
  • the miRNAs of SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, and SEQ ID NO: 29 are characterized by less than twice the expression of normal controls in patients with recurrent glioblastomas.
  • the miRNAs belonging to SEQ ID NOS: 1 to 29 of the present invention may be markers for diagnosing recurrent polygliomas. Accordingly, the present invention provides a recurrent glioblastoma diagnostic kit comprising an agent capable of detecting the marker, that is, a kit for diagnosing a recurrent glioblastoma comprising an agent for measuring the level of miRNA represented by SEQ ID NO: 1. to provide . In addition, the diagnostic kit of the present invention may further include an agent for measuring the level of one or more miRNAs selected from the group consisting of SEQ ID NOs: 2 to 29.
  • the agent may also confirm the expression level of miRNAs, a diagnostic marker for recurrent glioblastoma in a biological sample, and measure the amount of miRNA.
  • Analytical methods for this analysis include RT-PCR, Competitive Reverse Transcription Polymerase Response (RT-PCR), Real-Time Reverse Transcription Polymerase Response (RT-PCR), and RNase.
  • RNase protect ion assay (RPA) Northern blotting, DNA chips, etc., but are not limited thereto.
  • the agent may be a PCR primer that amplifies the miRNA.
  • the primer is preferably a primer for SEQ ID NO: 30 (hsa-miR-20a
  • Primer for SEQ ID NO: 37 (hsa-miR-582-5p) It may be a primer of (TTACAGTTGTTCAACCAGTTACT) (PCR primers for miRNA can be PCR with only one side because miRNA itself can act as a primer).
  • the primer is a nucleotide having a sequence specific to each miRNA and is about 16 bp to 30 bp in length, more preferably about 21 bp to 23 bp in length.
  • the primer may be a primer of SEQ ID NO: 22 to 29.
  • the kit for diagnosing recurrent glioblastoma of the present invention may further comprise one or more types of other component compositions, solutions or devices suitable for analytical methods.
  • the diagnostic kit may be a diagnostic kit comprising essential elements necessary to perform real-time RT-PCR.
  • the real time RT-PCR kit includes primers specific for the marker raiRNA. In the present invention, it may be a kit containing at least one primer of SEQ ID NO: 30 to 37.
  • other real-time RT-PCR kits include enzymes such as test tubes or other suitable containers, reaction fluids (pH and magnesium concentrations vary), deoxynucleotides (dNTPs), Taq-polymerases and reverse transcriptases, DNAse, RNAse inhibitor DEPC-water, sterile water and the like.
  • the present invention comprises the steps of (a) measuring the expression level of the miRNA of SEQ ID NO: 1 from a biological sample isolated from a patient with suspected recurrent glioblastoma; And (b) comparing the expression level of the miRNA with the expression level of the corresponding miRNA in the control sample.
  • miRNAs Separation of miRNAs from biological samples can be carried out using known processes and miRNA levels can be measured in a variety of ways.
  • the biological sample may include samples, such as tissues, cells, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid, or urine, which differ in miRNA expression levels of recurrent glioblastoma markers due to the onset of recurrent glioblastoma. This is not restrictive.
  • Analytical methods for measuring miRNA levels include reverse transcriptase polymerase reaction, competitive reverse transcriptase polymerase reaction, real-time reverse transcriptase polymerase reaction, and RNase protection assay. Laws, northern blotting, DNA chips, etc., But are not limited to these.
  • miRNA expression levels in the normal control group and miRNA expression levels in patients with suspected recurrent glioblastoma can be compared, and recurrence is determined by the significant increase of miRNA expression level in the recurrent polyglioblastoma marker.
  • the diagnosis of actual recurrent glioblastoma in patients with suspected glioblastoma can be diagnosed.
  • the measurement of miRNA expression levels is preferably by using a real-time RT-PCR method or DNA chip using primers specific for the gene used as a recurrent glioblastoma marker.
  • the real-time RT-PCR can confirm the expression and extent of miRNAs used as diagnostic markers for recurrent glioblastoma by confirming the band pattern and bend thickness by electrophoresis after the reaction, and comparing them with the control group. It is easy to diagnose whether glioblastoma develops.
  • the normal control group refers to a person who is not a patient with recurrent glioblastoma.
  • Recurrent polyglioblastoma diagnostic method of the present invention can be diagnosed with the miRNA expression level of SEQ ID NO: 2 to 29 in addition to the miRNA of SEQ ID NO: 1.
  • the number of miRNAs selected from the group consisting of SEQ ID NO: 2-7, SEQ ID NO: 23, SEQ ID NO: 25, and SEQ ID NO: 27 is expressed more than twice as much as the normal control group, or SEQ ID NO: 8 To 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28 and if the miRNA selected from the group consisting of 29 or less times more than the normal control group is diagnosed as recurrent polymorphism can do.
  • the present invention provides a composition for diagnosing recurrent glioblastoma and a diagnostic method using the same.
  • a composition for diagnosing recurrent glioblastoma and a diagnostic method using the same are useful for the treatment and prognosis of recurrent glioblastoma by providing diagnostic markers for diagnosing the development of recurrent glioblastoma.
  • the recurrent polyglioblastoma diagnostic markers were developed for the development of anti-cancer drugs specific to recurrent glioblastoma. It can be used to.
  • R1 Recurrent GBM Patient 1
  • R2 Recurrent GBM Patient 2
  • P1 Superficial GM Patient 1
  • P2 Supercurrent GBM Patient 2.
  • FIG. 2 shows three upregulated miRNAs (A) and five down regulated miRNAs (B) in microarray analysis via real-time RT-PCR. Expression levels of miRNA were compared between primary and recurrent GBM. RNU6-1 RNA served as an internal control of miRNA expression.
  • Figure 3 shows the expression level of RNU6-1 RNA associated with the recurrent GBM and recurrent GBM via real-time RT-PCR.
  • P superficial GBM patient
  • R1 recurrent GBM patient 1
  • R2 recurrent GBM patient 2.
  • Figure 4 shows the degree of association of 43 miRNAs, expressed differently in recurrent GBM through IPAdngenuity Pathway Analysis.
  • FIG. 5 shows a global IPA miRNA-protein network analysis of 43 miRNAs expressed differently in recurrent GBM.
  • RNA extraction and miRNA microarray analysis are as described below. Samples were homogenized with TRI Reagent (Molecular Research Center, Cincinnati, OH) and the supernatant was mixed thoroughly with BCP 1—brotno-3-chloropropane, Molecular Research Center) for layer separation. After centrifugation at 12,000 rpm for 10 min at 4 ° C, the liquid layer was used for phenol-chloroform extraction. Total RNA was precipitated and dissolved in RNase-free water. The obtained RNA was quantified by Agilent 2100 Bioanalyzer CA Technologies, Santa Clara, CA).
  • RNA labeling Reagent and Hybridization kit 100 ng of total RNA was dephosphorylated with 15 units of calf intestine alkaline phosphatase and denatured RNA at 100 ° C for 10 min with 40% DMS0. Dephosphorylated RNA was bound to pCp-Cy3 mononucleotide ⁇ and purified by MicroBioS in 6 columns (Bio-Rad, Hercules, CA, USA).
  • the samples were boiled at 100 ° C for 5 minutes with Gene Express Blocking Reagent and Hi-RPM Hybridization Buffer, cooled on ice for 5 minutes and re-precipitated. All. Finally, the sections were collected toward the Agilent Microarray (15K), mixed with a pipette and hybridized to 20 rpm at 55 ° C for 20 hours in an Agilent Hybridization Oven. After washing, they were scanned with an Agilent G2404B Scanner. The scanned image was obtained with Feature Extraction soft are (Agi lent Technologies) using the parameters set by default for background correction.
  • Agilent Microarray 15K
  • Agilent G2404B Scanner After washing, they were scanned with an Agilent G2404B Scanner.
  • the scanned image was obtained with Feature Extraction soft are (Agi lent Technologies) using the parameters set by default for background correction.
  • PCR primers for miRNA can be PCR with only one side because the miRNA itself can act as a primer, and thus the miRNA can be synthesized using only a forward or reverse primer.
  • Targets for up and down controlled miRNAs are miRanda (ht tp: //www.microRNA. Org / mi croRNA / home.do) and
  • RT-PCR was performed to confirm the results of miRNA array analysis. Prior to RT-PCR, internal regulatory gene identification was essential for normalization of miRNA transcriptional expression. To this end, we compared R U6-1 RNA (regulating miRNA expression) genes in patients who first developed GBM and in relapsed patients. RNU6-1 RNA expression was similar between the relapsed patients and the first onset patients (FIG. 3).
  • miRNAs Eight randomly selected miRNAs were RT-PCR validated for miRNA expression changes found in microrea (8 miRNAs: has-miR-142-3p, has-mi-233, has-miR-451, has— miR-20a *, has-miR-196, has-miR— 450a, has-miR-542-3p, has-miR-582-5p).
  • the same results as the MiRNA microarray results indicate that has-miR-142-3p, has-miR-233, and has-miR-451 are up-regulated and have-miR-20a * (FIG. 2A) in GBM relapsed patients.
  • has-miR-196, has-miR-450a, has-miR-452-3p and has-miR-582-5p are down regulated (FIG. 2B).
  • IPA Ingenuity Pathway Analysi s
  • IPA identified apoptosis as a higher category following cell development and growth, and also identified (cell) spikes that are specifically associated with miRNAs (FIG. 4).
  • Core analysis using IPA created a network containing 12 miRNAs and key proteins involved in cancer and cell death (FIG. 5).
  • the tumor suppressor gene TP53 in this network has been identified as a key point in the network even if miRNAs do not directly control p53 expression.
  • p53 signal changes and p53 ef fector expression were presumed to be the cause of GBM recurrence.
  • Bioinformatics analysis of miRNA was performed to determine whether the above mentioned results were related to potential target genes in GBM relapse and resistance to chemoradiotherapy.
  • the potential target genes of 43 differently expressed miRNAs are in
  • the pathway enrichment analysis was performed using the KEGG Kyoto Encyclopedia of Genes and Genomes database to explore the potential biological effects of miRNA in GBM recurrence. As expected, cancer and . There were a large number of target genes of miRNA in related pathways (Table 2).
  • Target genes were analyzed by using Kyoto Encyclopedia of Genes and Genomes (KEGG) and National Cancer Institute (NCI) — Nature curated database.
  • KEGG Kyoto Encyclopedia of Genes and Genomes
  • NCI National Cancer Institute
  • Proportion of miRNA target genes from the total number of genes that belong to each pathway include (cell) proliferation, persistent angiogenesis, differential (ion) blocking, avoiding apoptosis, infection and metastasis of tissues, failure to repair genes, genetic damage, and insensitivity to non-growth signals.
  • Wnt and mitogen activating protein kinase (MAPR) signaling pathways are miRNA targets. Wnt signaling acts to maintain undifferentiated state of stem cells and MAPK regulates the signals of various growth factors.
  • cancer tissues may become more aggressive and proliferative in GBM recurrence after chemoradiation (growth factors: epidermal growth factor (EGF), fibroblast growth factor (FGF), and platelet-derived growth factor (PDGF)).
  • growth factors epidermal growth factor (EGF), fibroblast growth factor (FGF), and platelet-derived growth factor (PDGF)).
  • miRNA signaling pathways pathway analysis was extended to NCI-Nature curated databases to find signaling pathways for various growth factors that are primarily associated with miRNA target genes (Growth factor signaling pathways: ErbBl, Smad2 / 3 , Wnt .Notch).
  • miRNA targets the largest number of genes controlled by p53 signal, and the results were highly consistent with those using IPA (FIG. 4).
  • Predicted targets of miRNAs exhibit ing more than 2-fold expression increase in recurrent GBM.
  • miRNA and miRNA * are derived from same miRNA precursor.
  • Predicted targets of miR As exhibi t ing lower than 2-fold expression decrease in recurrent GBM.
  • the present invention provides a composition for diagnosing recurrent glioblastoma and a diagnostic method using the same.
  • a composition for diagnosing recurrent glioblastoma and a diagnostic method using the same are useful data for the treatment and prognosis of recurrent glioblastoma by providing diagnostic markers for diagnosing the occurrence of recurrent glioblastoma.
  • the recurrent glioblastoma diagnostic markers can be used for research on the development of recurrent glioblastoma specific anticancer drugs.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Description

【명세서】
【발명의 명칭】
재발성 다형교아종 진단용 조성물 및 진단 방법
【기술분야】
본 출원은 2012년 7월 20일에 출원된 대한민국 특허출원 계 10— 2012-0079314 호를 우선권으로 주장하고, 상기 명세서 전체는 본 출원의 참고문헌이다.
본 발명은 재발성 다형교아종 마커 miRNA의 재발성 다형교아종 진단 용도에 관한 것으로， 보다 상세하게는 재발성 다형교아종에 특이적인 miRNA 마커를 선별하 고 또한 상기 마커의 존재를 측정하는 제제를 포함하는 조성물, 키트 및 이를 사용 하여 재발성 다형교아종을진단하는 방법에 관한 것이다.
【배경기술】
miRNA는 18-25개의 핵산으로 이루어진 단일염기가닥의 비암호화 small R A로 유전자 발현을 제어한다. 하나의 miRNA는 직접적으로 여러 개의 타켓 유전자를 제 어할 수 있으며 이에 따라 다양한 신호경로의 여러 단백질 발현을 조절할 수 있다 (Bartel DP. MicroRNAs: target recognition and regulatory functions. Cell 2009;136:215-233.). miRNA의 발현은 기관의 발달과 조직의 차이에 따라 다르다 (Rosenfeld N, Aharonov R, Meir i E, et al . MicroRNAs accurately identify cancer tissue origin. Nat Biotechnol 2008;26:462-469. ) . miRNA는 다양한 생물학 적 과정을 제어하는 것으로 잘 알려져 있으며 (Rosenfeld N, Aharonov R, Meiri E, et al. MicroRNAs accurately identify cancer tissue origin. Nat Biotechnol 2008；26：462-469.), 종양 억제 유전자와 종양 유전자 번역 제어에 의해 암과 세포 소멸에 연관된다. (Lee YS Dutta A. MicroRNAs in cancer . Annu Rev Pathol 2009；4：199-227.). 최근의 연구에서는 다양한 암들의 시작과 진행에서의 miRNA 조 절장애를 보여주고 있다 (Lovat F, Valeri N Croce CM. MicroRNAs in the pathogenesis of cancer . Seminars in oncology 2011 ;38 :724-733. ) .
다형교아종 (GBM)은 가장 흔하고 공격적인 타입의 주요한 성인 뇌 암이다. 최 초 진단된 (newly diagnosed) 다형교아종의 치료법은 화학적방사선치료와 방사선치 료 조합을 통한 외과적 절제이다 (Stupp R, Mason WP, van den Bent MJ， et al. Radiotherapy lus concomitant and adjuvant temozolomide for 'glioblastoma. N Engl J Med 2005;352:987-996. ) . 치료법의 발전과 GBM의 유전학과 분자 대사 이해 의 발전에도 불구하고 (Bai RY, Staedtke V Riggins GJ. Molecular targeting of glioblastoma: Drug discovery and therapies. Trends in molecular medicine
대체용지 (규칙제 26조) 2011;17:301-312..Kesari S. Understanding gl ioblastoma tumor biology: the potential to improve current diagnosis and treatments. Seminars in oncology 2011；38 Suppl 4:S2-10.), 전반적인 생존율은 매우 낮으며 GBM 환자의 평균수명은 10-15개월로 제한되어있다. 이 수명은 치료를 함에도 불구하고 십년 동안 겨우 최 소한으로 개선되었다. 가장 주된 문제는 대부분의 GBM (약 90%의 경우)의 재발이 원 래 종양부위 내에 있거나 인접한다는 점이다 (Joki T, Carroll RS, Dunn IF, Zhang J, Abe T Black PM. Assessment of alterations in gene expression in recurrent malignant glioma after radiotherapy using complement ry deoxyribonucleic acid microarrays. Neurosurgery 2001 ;48 :195-201； discussion 201-192.). 현재까지는 재수술， 화학적방사선치료, 방사선치료를 쓰는 것 외에는 재발한 GBM을 치료하는 일반적인 방법이 없다. 따라서 GBM에 대한 새로운 분자적 타겟， 개념과 접근법이 시급하게 필요하다.
인간의 종양 세포가 발견된 후로, GBM저항 연구에 화학적방사선치료가사용 되어 왔다. 그 저항은 DNA복구 능숙도 (proficiency)와 비조절성 (dysregulated) 성 장 인자 신호 경로와 암즐기세포 (cancer stem-like cell)의 특별한 생물학적 습관 덕분이라고 할 수 있다 (Haar CP, Hebbar P, Wallace GCt, et al. Drug Resistance in Gl ioblastoma: A Mini Review. Neurochemical research 2012. ) . GBM 재발의 분 자적， 유전자적 변화가 연구되어 왔음에도 불구하고 GBM 재발의 이유와 저항적 발 병은 명확하게 확인되지 않았다.
수술 후의 방사선 치료가 GBM환자에게 별다른 효과를 내지 못하므로 GBM 재 발을 막기 위한 효과적이고 적합한 화학적방사선치료를 찾기 위한 여러 시도들이 있었다. 종양의 분자 특성을 정의하기 위한 새로운 접근법은 miRNA들의 발현 조사 에 바탕을 두고 있다. 지난 몇 년간， GBM의 발병과 관련된 여러 miRNA들이 알려졌 다 (Novakova J, Sl by 0， Vyzula R Michalek J. MicroRNA involvement in gl ioblastoma pathogenesis. Biochem Biophys Res Commun 2009:386： 1- 5. ,Srinivasan S, Patric IR Somasundaram K. A t en-mi croRNA expression signature predicts survival in gl ioblastoma. PLoS One 2011;6:el7438. ) · 그러나 알려진 miRNA의 겨우 작은 부분의 생리학적 역할을 파악하였다. 게다가 GBM 재발의 저항에 관여하는 전체적인 miRNA특징은 여태까지 조사된 적이 없다.
【발명의 상세한 설명】
【기술적 과제】
이에 본 발명자들은 재발성 다형교아종을 치료하고 예방하기 위한 효과적인 방법에 관하여 연구하던 중 , 재발성 다형교아종 세포에서 발현되는 miRNA를 통해 재발성 다형교아종을 진단하는 재발성 다형교아종에 특이 적 인 마커 들을 발견하여 본 발명을 완성하몄다 . 따라서 본 발명의 목적은 서 열번호 1로 표시되는 miRNA를 포함하는 재발성 다형교아종 진단용 조성물을 제공하는 것이다 .
본 발명 의 다른 목적은 재발성 다형교아종 진단용 제제의 제조를 위한 서 열 번호 1로 표시되는 miRNA의 용도를 제공하는 것 이다 .
본 발명의 다른 목적은 (a) 재발성 다형교아종 의심 환자로부터 분리된 생물 학적 시료로부터 서 열 번호 1의 miRNA의 발현 수준을 측정하는 단계 ; 및
(b) 상기 miRNA의 발현 수준을 정상인 대조구 시료의 해당 miRNA의 발현 수 준과 비교하는 단계를 포함하는 재발성 다형교아종 진단 방법을 제공하는 것이다. 본 발명의 또다른 목적은 서 열번호 1로 표시되는 miRNA의 수준을 측정하는 제제를 포함하는 재발성 다형교아종 진단용 키트를 제공하는 것이 다 .
【기술적 해결방법】
본 발명의 목적을 달성하기 위하여， 본 발명은 서 열번호 1로 표시되는 miRNA 를 포함하는 재발성 다형교아종 진단용 조성물을 제공한다.
본 발명의 다른 목적은 재발성 다형교아종 진단용 제제의 제조를 위한 서 열 번호 1로 표시되는 miRNA의 용도를 제공하는 것이다 .
본 발명의 다른 목적은 (a) 재발성 다형교아종 의심 환자로부터 분리된 생물 학적 시료로부터 서 열 번호 1의 miRNA의 발현 수준을 측정하는 단계 ; 및
(b) 상기 miRNA의 발현 수준을 정상인 대조구 시료의 해당 miRNA의 발현 수 준과 비교하는 단계를 포함하는 재발성 다형교아종 진단 방법을 제공하는 것이다. 본 발명의 또다른 목적은 서 열번호 1로 표시되는 miRNA의 수준을 측정하는 제제를 포함하는 재발성 다형교아종 진단용 키트를 제공한다 . 이하 본 발명을 상세히 설명 한다. 본 발명은 서 열번호 1로 표시되는 miRNA를 포함하는 재발성 다형교아종 진단 용 조성물을 제공한다. 상기 조성물은 서 열번호 1 내지 29로 이루어진 군에서 선택 된 하나이상의 miRNA를 포함할 수 있다. 또한 , 본 발명은 재발성 다형교아종 진단 용 제제의 제조를 위한 서 열번호 1로 표시 되는 miRNA의 용도를 제공한다 . 상기의 재발성 다형교아종 (recurrent gl ioblastoma mult i form)은 뇌 신경세 포에 발생하는 종양인 다형교아종의 재발로 초기 발병 시 다형교아종이 생긴 부분 에 다시 재발하거나 그 주변에 재발한 다형교아종을 의미 한다.
상기 서 열번호 Khsa-miR-365, taatgcccctaaaaatccttat )은 실시 예에서 확인 된 재발성 GBM에서 다르게 발현되는 miRNA들 중 하나이며， 상기 서 열번호 1의 miRNA는 재발성 GBM의 miRNA의 변화를 정상 및 초발성 GBM과 비교했을 때 가장 많 이 나타난 것으로 확인되 었다. 한편 , 본 발명의 조성물 또는 제제는 서 열번호 1의 miRNA에 추가적으로 서 열 번호 2 내지 29로 이루어진 군에서 선택된 하나 이상의 miRNA를 포함할 수 있다. 각각의 서 열의 통상적 인 명 칭은 다음과 같다: 서 열번호 2(hsa-miR-29b, tagcaccatttgaaatcagtgtt ) , 서 열번호 3(hsa-miR-34c-5p , aggcagtgtagttagctgattgc) , 서 열번호 4(hsa-miR-129-3p, aagcccttaccccaaaaagcat ) , 서 열번호 5(hsa-miR-218, ttgtgcttgatctaaccatgt ) , 서 열번호 6(hsa-miR-124, taaggcacgcggtgaatgcc) , '서 열번호 7(hsa-miR-486-5p, tcctgtactgagctgccccgag) , 서 열번호 8(hsa— miR-lOb, taccctgtagaaccgaatttgtg) , 서열번호 9(hsa-miR-95, ttcaacgggtatttattgagca) , 서 열번호 10(hsa一 miR—154, taggttatccgtgttgccttcg) , 서열번호 ll(hsa-miR-224, caagtcactagtggttccgtt ) , 서 열번호 12(hsa-miR-299-3p, tatgtgggatggtaaaccgctt ) , 서 열번호 13 (hsa-m i R-299-5 , tggtttaccgtcccacatacat ) , 서 열번호 14(hsa-miR-376a, at cat agaggaaaat ccacgt ) , 서 열번호 15(hsa-miR-376c , aacat agaggaaat t ccacgt ) , 서 열번호 16 (hsa-m iR-379, tggtagactatggaacgtagg) , 서 열 번호 17(hsa-miR-571, tgagttggccatctgagtgag) , 서 열번호 18 (hsa-m iR-592, ttgtgtcaatatgcgatgatgt ) , 서 열번호 19(hsa-miR-629, tgggtttacgttgggagaact ) , 서 열번호 20 (hsa-m iR-654-3p , tatgtctgctgaccatcacct t ) , 서 열번호 21(hsa-miR-1271 , cttggcacctagcaagcactca) , 서 열번호 22(hsa-miR-20a, taaagttgcttatagtgcaggtag) , 서 열번호 23(hsa-miR-142-3p, tgtagtgtttcctactttatgga) , 서 열번호 24(hsa-miR- 196, taggtagtttcatgttgttggg) , 서 열번호 25(hsa-miR-223, tgtcagtttgtcaaatacccca) , 서 열번호 26 (hsa-m iR-450a, ttttgcgatgtgttcctaatat ) , 서 열번호 27(hsa-miR-451 , aaaccgt t accat t act agt t ) , 서 열번호 28(hsa-miR— 542— 3p, tgtgacagattgataactgaaa) , 서 열번호 29 (hsa-m i R-582-5 , 11 acagt tgt t caaccagt t act ) 이다 . 상기 서 열번호 1로 표시되는 miRNA의 바람직한 용도는 재발성 다형교아종 진 단용 제제의 제조이다 . 상기 진단용 제제는 상기 서술한 진단용 조성물에 대한 설 명과 동일하다 . 상기 miRNA는 재발성 다형교아종에서 정상 대조군보다 2배 이상 더 많이 발현되는 특이적 마커로서 , 발현 수준으로 재발성 다형교아종을 진단할 수 있 다. 또한， 서 열번호 2 내지 29의 miRNA도 재발성 다형교아종 진단용 제제의 제조에 이용할 수 있다. 서 열번호 2 내지 7, 서 열번호 23， 서 열번호 25 및 서 열번호 27와 miRNA는 재발성 다형교아종 환자에서 정상대조군보다 2배 이상 더 발현되고， 서 열 번호 8 내지 22 , 서 열번호 24， 서 열번호 26 , 서 열번호 28 및 서 열번호 29의 miRNA 는 재발성 다형교아종 환자에서 정상대조군보다 2배 이상으로 적 게 발현되는 특징 이 있다.
본 발명의 상기 서열번호 1 내지 29에 속하는 miRNA는 재발성 다형교아종을 진단하기 위한 마커가 될 수 있다. 따라서， 본 발명은 상기 마커를 검출할 수 있는 제제를 포함하는 재발성 다형교아종 진단 키트， 즉 서 열번호 1로 표시되는 miRNA의 수준을 측정하는 제제를 포함하는 재발성 다형교아종 진단용 키트를 제공한다 . 아 을러， 본 발명의 진단 키트는 서 열번호 2 내지 29로 이루어진 군에서 선택되는 하 나 이상의 miRNA의 수준을 측정하는 제제를 추가로 포함할 수 있다 . 바람직하게는 또한 상기 제제를 통해 생물학적 시료에서 재발성 다형교아종 진단 마커 인 miRNA들의 발현 정도를 확인할 수 있으며 , miRNA의 양을 측정할 수 있 다 . 이를 위 한 분석 방법으로는 역 전사중합효소반웅 (RT-PCR) , 경 쟁적 역 전사 중합 효소반웅 (Compet i t ive RT-PCR) , 실시간 역전사 중합효소반웅 (Real-t ime RT-PCR) , RNase 보호 분석 법 (RPA; RNase protect ion assay) , 노던 블랏팅 (Northern blott ing) , DNA 칩 등이 있으나 이로 제한되는 것은 아니다.
바람직하게는 상기 제제는 해당 miRNA를 증폭하는 PCR 프라이 머 일 수 있다. 프라이머는 바람직하게는 서 열번호 30(hsa-miR-20a에 대한 프라이머
； ACTGCATTATGAGCACTTAAAG)， 서 열번호 31(hsa-miR-142-3p에 대한 프라이머
； TGTAGTGTT CCTACTITATGGA) , 서 열번호 32(hsa-miR-196에 대한 프라이머
； TAGGTAGTTTCATGTTGTTGG)， 서 열번호 33(hsa-miR-223에 대한 프라이머
； TGTCAGTTTGTCAAATACCCCA) , 서 열번호 34(hsa-miR-450a에 대한 프라이머
； TTTTGCGATGTGnCCTAATAT)， 서열번호 35(hsa-miR-451에 대한 프라이머
； AAACCGTTACCATTACTGAGTT)， 서 열번호 36(hsa-miR-542-3p에 대한 프라이 머
； TGTGACAGATTGATAACTGAAA)， 서 열번호 37(hsa-miR-582-5p에 대한 프라이 머 ;TTACAGTTGTTCAACCAGTTACT)의 프라이머일 수 있다 (miRNA에 대한 PCR 프라이머는 miRNA 자체가 프라이머 역할을 할 수 있으므로 한 쪽만으로 PCR이 가능). 프라이머 는 각 miRNA에 특이적인 서열을 가지는 뉴클레오타이드로서 , 약 16 bp 내지 30 bp 의 길이, 보다 바람직하게는 약 21 bp 내지 23 bp 의 길이이다. 또한， 프라이머는 서열번호 22 내지 29의 프라이머일 수 있다. 또한ᅳ 본 발명의 재발성 다형교아종 진단용 키트는 분석 방법에 적합한 한 종류 또는 그 이상의 다른 구성성분 조성물, 용액 또는 장치를 더 포함하여 구성될 수 있다.
상기 진단 키트는 실시간 RT-PCR을 수행하기 위해 필요한 필수 요소를 포함 하는 것을 특징으로 하는 진단용 키트일 수 있다. 실시간 RT-PCR 키트는 마커 raiRNA에 대한 특이적인 프라이머들을 포함한다. 본 발명에서는 바람직하게 서열번 호 30 내지 37의 프라이머를 하나 이상 포함하는 키트일 수 있다. 또한 그 외 실 시간 RT-PCR 키트는 테스트 튜브 또는 다른 적절한 컨테이너, 반웅 완층액 (pH 및 마그네슴 농도는 다양), 데옥시뉴클레오타이드 (dNTPs), Taq-폴리머라아제 및 역전 사효소와 같은 효소， DNAse, RNAse 억제제 DEPC-수 (DEPC-water) , 멸균수 등을 포함 할 수 있다. 본 발명은 (a) 재발성 다형교아종 의심 환자로부터 분리된 생물학적 시료로 부터 서열 번호 1의 miRNA의 발현 수준을 측정하는 단계; 및 (b) 상기 miRNA의 발 현 수준을 대조구 시료의 해당 miRNA의 발현 수준과 비교하는 단계를 포함하는 재 발성 다형교아종 진단 방법을 제공한다.
(a) 재발성 다형교아종 의심 환자로부터 분리된 생물학적 시료로부터 서열 번호 1의 miRNA의 발현 수준을 측정하는 단계;
생물학적 시료에서 miRNA를 분리하는 과정은 공지의 공정을 이용하여 수행할 수 있으며 miRNA수준은 다양한 방법으로 측정할 수 있다.
상기의 생물학적 시료는 재발성 다형교아종 발병에 의해 재발성 다형교아종 마커의 miRNA 발현 수준이 차이나는 조직， 세포， 전혈, 혈청， 혈장， 타액， 객담， 뇌척수액 또는 뇨와 같은 시료 둥을 포함하나, 이에 제한되지 않는다.
miRNA 수준을 측정하기 위한 분석 방법으로는 역전사효소 중합효소반웅， 경 쟁적 역전사효소 중합효소반웅， 실시간 역전사효소 중합효소반웅, RNase 보호 분석 법， 노던 블랏팅 , DNA 칩 등이 있으나 이로 제한되는 것은 아니다 .
상기 검출 방법들을 통하여 , 정상 대조군에서의 miRNA 발현량과 재발성 다형 교아종 의심환자에서의 miRNA 발현량을 비교할 수 있고 ᅳ 재발성 다형교아종 마커의 miRNA의 유의 한 발현량의 증가여부를 판단하여 재발성 다형교아종 의심 환자의 실 제 재발성 다형교아종 발병 여부를 진단할 수 있다.
miRNA 발현수준 측정은 바람직하게는 , 재발성 다형교아종 마커로 사용되는 유전자에 특이적 인 프라이머를 이용하는 실시간 RT-PCR법 또는 DNA 칩을 이용하는 것이다.
상기의 실시간 RT-PCR은 반응 후 전기 영동하여 밴드 패턴과 벤드의 두께를 확인함으로써 재발성 다형교아종 진단 마커로 사용되는 miRNA의 발현 여부와 정도 를 확인 가능하고 이를 대조군과 비교함으로써 , 재발성 다형교아종 발병 여부를 간 편하게 진단할 수 있다.
(b) 상기 miRNA의 발현 수준을 정상인 대조구 시료의 해당 miRNA의 발현 수 준과 비교하는 달계 ;
정상인 대조군과 재발성 다형교아종 의심 환자의 서 열번호 1의 miRNA 발현수 준을 비교해보았을 때， 2배 이상 더 많이 발현되 었다면， 재발성 다형교아종으로 진 단할 수 있다. 상기 정상인 대조군이란, 재발성 다형교아종 환자가 아닌 사람을 총 칭 한다 .
본 발명의 재발성 다형교아종 진단 방법은 서 열번호 1의 miRNA 외에도 서 열 번호 2 내지 29의 miRNA 발현 수준으로 진단할 수 있다. 재발성 다형교아종 의심 환자에서 서 열번： 2 내지 7， 서 열번호 23, 서열번호 25 및 서열번호 27로 이루어 진 군에서 선택되는 miRNA가 정상대조군보다 2배 이상 더 발현되거나， 서 열번호 8 내지 22， 서 열번호 24， 서 열번호 26, 서 열번호 28 및 서 열번호 29로 이루어진 군에 서 선택되는 miRNA가 정상대조군보다 2배 이상으로 적 게 발현된다면， 재발성 다형 교아종으로 진단할 수 있다.
【유리한 효과】
따라서 본 발명은 재발성 다형교아종 진단용 조성물 및 이를 이용한 진단 방 법을 제공한다 . 이 러 한 본 발명의 재발성 다형교아종 진단용 조성물 및 이를 이용 한 진단 방법은 재발성 다형교아종의 발병을 진단할 수 있는 진단 마커들을 제공함 으로써， 재발성 다형교아종의 치료 및 예후관리에 유용한 자료를 제공한다 . 또한 , 상기 재발성 ᅵ다형교아종 진단 마커들은 재발성 다형교아종 특이 적 항암제 개발연구 에 이용될 수 있다.
【도면의 간단한 설명】
도 1은 재발성 GBM에서 다르게 발현되는 miRNA들의 Heat map분석이다. 각 열은 miRNA의 발현 수준을 나타내고 각 행들은 시료들의 발현 수준 정도를 나타낸 다. 빨간색은 과발현 정도를 나타내고 초록색은 저발현 '정도를 나타낸다. R1: 재발 성 GBM환자 1, R2:재발성 GBM환자 2， P1: 초발성 GM환자 1， P2: 초발성 GBM환 자 2.
도 2는 마이크로어레이 분석에서 3개의 상승 조절되는 miRNA들 (A)과 5개의 하락 조절된 miRNA들 (B)을 실시간 RT-PCR을 통해 확인한 것이다. miRNA의 발현 수 준은 초발성 GBM과 재발성 GBM을 비교하였다. RNU6-1 RNA는 miRNA 발현의 내부 통 제 (internal control) 역할을 하였다.
도 3은 초발성 GBM과 재발성 GBM에 연관된 RNU6-1 RNA의 발현 수준을 실시간 RT-PCR을 통해 확인한 것이다. P: 초발성 GBM환자， R1: 재발성 GBM환자 1, R2:재 발성 GBM환자 2 이다.
도 4는 IPAdngenuity Pathway Analysis)를 통한 재발성 GBM에서 다르게 발 현되는 43개 miRNA들、의 관련 정도를 나타낸 것이다.
도 5는 재발성 GBM에서 다른게 발현되는 43개 miRNA들을 Global IPA miRNA- 단백질 네트워크 분석을 한 것이다.
【발명의 실시를 위한 최선의 형태】
이하， 본 발명을 실시예에 의해 상세히 설명한다.
단， 하기 실시예는 본 발명을 예시하는 것일 뿐， 본 발명의 내용이 하기 실 시예에 한정되는 것은 아니다.
<실험 방법 >
1. 환자시료
본 연구는 가를릭대학교 심의회의 승인 (KC10SISI042)을 얻은 것이다. 인간 GBM 시료는 2명의 GBM첫 발병 환자들로부터 수술 (definitive surgery) 중 얻고, 2 명의 GBM 재발 환자의 구제 수술 (salvage surgery) 중 얻었다. GBM 재발 시료는 테 모졸로마이드 (temozolomide) 기반 화학적방사선치료 후 종양제거 치료를 받은 환자 들에게서 얻었다. 방사선 치료는 등각 기술 (conformal technique)에 의해 수술용 침대에서 전체 59.5Gy범위로 주었다. 환자들의 특성은 표 1과 같다.
【표 1】 Patient characteristics.
Figure imgf000011_0001
MGMT, 으 me thy 1 guanine一 DNA methyltransf erase.
Not available.
CCRT, Concurrent chemor ad i o t her apy , temozolomide based. 2. RNA분리
전체 RNA 추출과 miRNA마이크로어레이 분석은 다음에 기재된 것과 같다. 시 료들은 TRI Reagent (Molecular Research Center , Cincinnati, OH)로 균질화하고 상등액은 층분리를 위해 BCP 1— brotno-3-chloropropane, Molecular Research Center)를 넣고 세게 섞었다. 4°C에서 10분 동안 12,000rpm으로 원심분리한 후 액 체 층은 페놀 -클로로포름 추출에 사용하였다. 전체 RNA는 침전시킨 후， RNase-free water로 용해시켰다. 얻어진 RNA는 Agilent 2100 BioanalyzerCAgi lent Technologies, Santa Clara, CA)로 정량화 하였다.
3. MiRNA마이크로어레이 분석
타겟 miRNA 절편의 합성과 흔성화0 1)^(^23 011)는 Agilent's mi RNA Labeling Reagent and Hybridization kit을 사용하였다. 총 RNA를 각각 100ng씩 calf intestine alkaline phosphatase 15 unit으로 탈인산화 시키고 40% DMS0로 10 분간 100°C에서 RNA를 변성 (denaturation)시켰다. 탈인산화된 RNA는 pCp-Cy3 mononucleotide^} 결합되며, MicroBioS in 6 columns(Bio-Rad, Hercules, CA, USA) 로 정제시켰다. 정제한 뒤 시료들은 Gene Express Blocking Reagent와 Hi-RPM Hybridization Buffer로 5분간 100°C에서 끓이고 5분간 얼음에 식혀서 재 침전시켰 다. 마지막으로 Agilent Microarray(15K)쪽으로 절편들을 모아주고 파이펫으로 섞 고 Agilent Hybridization Oven에서 20시간 동안 55°C에서 20rpm으로 hybridization 시켰다. 세척 한 뒤 Agilent G2404B Scanner로 스캔하였다. 스캔한 이미지는 배경 수정을 위해 기본적으로 세팅된 파라미터를 사용해 Feature Extraction soft are(Agi lent Technologies)로 얻었다.
4. MiRNA단일 가닥 cDNA합성과정량적 실시간 PCR
R A에서 miRNA first-strand cDNA를 합성하기 위해서 Mir-X miRNA first- strand synthesis KitCTAkara Bio, Shiga, Japan)를 사용해 miRNA의 polyadenylation과 역전사를 수행하였다. 타겟 miRNA의 정량화하기 위해서
SmartCyclerSystem(Cepheid)와 SYBRPremix Ex Taq™n(Takara Bio)를 이용해 실시간 PCR을 수행하였다. 각 타겟 miRNA의 forwar^i primer들은 서열번호 22 내지 29이고， reverse primer는 서열번호 30 내지 37이다. miRNA에 대한 PCR 프라이머는 miRNA 자체가 프라이머 역할을 할 수 있으므로 한 쪽만으로 PCR이 가능하고, 따라서 포워 드또는 리버스프라이머만으로 miRNA를 합성할수 있다.
5. MiRNA타겟들의 생물정보학적 분석과관련된 경로
상승 및 하락 조절된 miRNA를 위한 타겟은 miRanda(ht tp： //www.microRNA . org/mi croRNA/home . do)와
miRbase(http://www. mirbase.org/)의 공개된 데이타베이스를 이용해서 찾았다. 경 로 분석을 위해서 KEGG(http://www. genome.jp/kegg/)와 NCI-Nature curated(http://pid.nci.nih. gov/br ows e_pa t h ays . sht m 1 ) °1] 주요 경로를 수집하 였다. 각 경로 데이타베이스는 하나의 파일에 누적하고, 상승 또는 하락 조절된 miRNA로부터 얻은 타겟 유전자를 이용해 각 경로와 일치하는 유전자의 수를 주어진 경로의 전체 유전자와 함께 계산해서 일치한 유전자를 기준으로 분류한 뒤 상위 10개 경로를 선정하였다.
<실험결과>
1. 재발된 GBM에서 다르게 발현되는 miRNA확인
GBM 재발의 저항에 관여하는 miRNA을 알기 위해 수술 후 화학적방사선치료를 받은 GBM재발과 처음 발병된 GBM 간 miRNA 전사 프로파일을 분석 하였다. 인간 뇌 조직은 처음으로 GBM이 발병된 환자 2명과 GBM이 재발한 환자 2명으로부터 얻었다. GBM환자들에 게서 총 318개의 miRNA가 발현됐다. 재발 환자 2명 모두 발현 단계에서 miRNA 318개 증 적어도 2-fold와 변화를 나타낸 것은 43개였다 . GBM 재발 환자에서 18개의 miRNA가 up regulated되 었고 25개는 down regulated 되 었다 (도 1) .
2. 정량화 RT-PCR을 이용한 miRNA 발현 검증
miRNA 어 레이 분석 결과를 확인하기 위해 RT— PCR을 실행하였다 . RT-PCR을 하 기 전에 앞서 , miRNA 전사 발현의 표준화를 위해서 내부 조절 유전자 확인이 필수 적이었다 . 이를 위해 GBM 처음 발병된 환자와 재발 환자에서 R U6— 1 RNA(miRNA 발 현 조절을 함) 유전자를 비교하였다. 재발 환자와 처음 발병한 환자 간의 RNU6-1 RNA 발현은 서로 비슷하였다 (도 3) . 마이크로어 레아에서 발견한 miRNA발현 변화를 검증하기 위해 무작위적으로 선택한 8개의 miRNA를 RT-PCR 하였다 (8개 miRNA:has- miR-142-3p, has-mi -233, has-miR-451, has— miR-20a*， has-miR- 196, has-miR— 450a, has-miR-542-3p, has-miR-582-5p) . MiRNA 마이크로어 레이결과와 동일한 결과 를 나타낸 것으로는 GBM재발 환자에서 has-miR-142-3p, has-miR-233, has-miR-451 가 up regulated 되었고 has-miR-20a* (도 2A) , has-miR- 196, has-miR-450a, has- miR-452-3p, has-miR-582-5p가 down regulated 되 었다 (도 2B) .
3. 지식기반 (knowledge-based) 생불정보학적 분석
화학적방사선치료 후 GBM 재발에서 다르게 발현되는 miRNA와 관련된 분자적 , 세포적 네트워크를 알아보기 위해 , 발현 단계에서 2-fold 변화 이상 나타내는 43개 의 tniRNA를 사용해 지식기 반 (knowledge— based)의 IPA( Ingenuity Pathway Analysi s) 를 수행하였다. IPA는 세포사멸을 세포 발달과 성장의 뒤를 잇는 상위 카테고리로 써 알아냈고 , 특수하게 miRNA와 연관되는 (세포)급증도 알아냈다 (도 4) . IPA을 이 용한 핵심 분석은 12개의 miRNA와 암과 세포 사멸에 연관되는 핵심 단백질을 포함 한 네트워크를 만들었다 (도 5) . 이 네트워크에서 종양 억제 유전자 TP53는 miRNA가 직접 적으로 p53발현을 제어하지 않더라도 네트워크의 핵심 지점으로 확인됐다 . 게 다가 p53신호변화와 p53 ef fector의 발현은 GBM 재발의 원인으로 추정되 었다.
4. MiRNA 타겟 유전자와 연관 경로에 대한 생물정보학적 분석
GBM의 재발과정과 화학적방사선치료에 대한 저항에서 앞에서 언급한 결과들 이 잠재적 타겟 유전자와 관련되어 있는지 알아보기 위해 miRNA의 생물정보학적 분 석을 실시하였다. 43개의 다르게 발현되는 miRNA의 잠재적 타겟 유전자는 in si l ico에서 알아냈고， pathway enrichment 분석은 GBM 재발에 있어서 miRNA의 생물 학적 영향 가능성 탐색을 위해 KEGG Kyoto Encyclopedia of Genes and Genomes) 데 이타베이스를 이용해 실행하였다. 예상대로 암과. 관련된 경로에서 miRNA의 타켓 유 전자가 다량 있었다 (표 2) .
【표 2】
Analysis of pathways associated with target genes of miRNAs in recurrent GBM.
Figure imgf000015_0001
Figure imgf000016_0001
Target genes were analyzed by using Kyoto Encyclopedia of Genes and Genomes (KEGG) and National Cancer Institute (NCI)— Nature curated database.
b
Number of miRNA target genes among number of genes that are involved in each pathway. A full list of miRNAs and their target genes are shown in Sup lementary Table 2 and 3.
c
Proportion of miRNA target genes from the total number of genes that belong to each pathway. 이러한 결과는 (세포)급증, 지속적인 혈관형성， 분화 (differential; ion) 차 단, 세포소멸 회피， 조직의 감염과 전이, 유전자 복구 실패， 유전적 손상， 비성장 신호에 대한 둔감을 포함하고 있다. 추가적으로 Wnt과 미토겐 활성 단백질 kinase (MAPR) 신호 경로에 연관된 다수의 유전자들은 miRNA의 타겟이다. Wnt 신호 는 줄기세포의 미분화 상태를 유지시키는 작용을 하고 MAPK는 다양한 성장 인자의 신호를 조절한다. 화학적방사선치료 후의 GBM 재발에서 암 조직이 더 공격적으로 되고 급증할 수 있음이 제시됐다 (성장인자: epidermal growth factor(EGF), fibroblast growth factor (FGF) , platelet-derived growth factor(PDGF)) .
좀 더 자세한 miRNA의 신호 경로 조사를 위해, 경로분석을 NCI-Nature curated 데이타베이스로 확장시켜 miRNA 타겟 유전자들이 주요하게 연관된 다양한 성장 인자의 신호 경로들을 찾아냈다 (성장 인자 신호 경로: ErbBl,Smad2/3, Wnt .Notch). 또한 miRNA가 p53신호로 제어되는 유전자들의 가장 많 은 수를 타겟으로 하고 있는 것도 찾아냈으며 이 결과는 IPA를 이용한 결과와 높게 일치하였다 (도 4).
마지막으로 GBM 재발 원인이 있다고 여겨지는 새로운 miRNA를 찾아내기 위해 miRNA 타겟 예측으로부터 추정 유전자들과 경로분석의 유전자 reference 세트를 비 교하였다. 그래서 세트와 겹치는 유전자들은 목톡으로 만들었다. 72개의 직접적인 p53 effector 유전자들은 재발 환자의 18개의 up regulated miRNA에 의해 확인되 었다 (표 3) .
【표 3】
Predicted targets of miRNAs exhibit ing more than 2-fold expression increase in recurrent GBM.
Figure imgf000018_0001
Average fold change (recurrent/primary) .
b
Abbreviat ions are shown in Supplementary Table 4.
c
miRNA and miRNA* are derived from same miRNA precursor .
GBM재발의 25개의 down-regulated miRNA로부터 ErbBl의 downstream 신호과 관련된 72개 유전자, Samd2/3 신호의 54개 유전자, Wnt-mediatedP -catenin 신호의 48개 유전자, Notch 신호 경로의 44개 유전자를 확인했으며 다음에 기 재하였다 (표 4) .
【표 4】
Predicted targets of miR As exhibi t ing lower than 2-fold expression decrease in recurrent GBM.
Figure imgf000020_0001
Figure imgf000021_0001
6T
61S900/£10ZHM/X3d «: 0/H0Z OAV
Figure imgf000022_0001
Figure imgf000023_0001
6lS900/CT0ZaM/X3d ΖΖε Ο/ ΟΖ OAV
Figure imgf000024_0001
Average fold change (recurrent /primary) .
Abbreviations are shown in Sup lement ary Table 4.
【산업상 이용가능성】
이상 살펴본 바와 같이, 본 발명은 재발성 다형교아종 진단용 조성물 및 이 를 이용한 진단 방법을 제공한다. 이러한 본 발명의 재발성 다형교아종 진단용 조 성물 및 이를 이용한 진단 방법은 재발성 다형교아종의 발병을 진단할 수 있는 진 단 마커들을 제공함으로써， 재발성 다형교아종의 치료 및 예후관리에 유용한 자료 를 제공한다. 또한, 상기 재발성 다형교아종 진단 마커들은 재발성 다형교아종 특 이적 항암제 개발연구에 이용될 수 있다.

Claims

【청구의 범위】
【청구항 1】
서 열번호 1로 표시되는 miRNA를 포함하는 재발성 다형교아종 진단용 조성물 .
【청구항 2】
제 1항에 있어서 , 상기 조성물은 서 열번호 2 내지 29로 이루어진 군에서 선택 되는 하나 이상의 miRNA를 추가로 포함하는 것인 재발성 다형교아종 진단용 조성 물 .
【청구항 3】
재발성 다형교아종 진단용 제제의 제조를 위 한 서 열번호 1로 표시되는 miRNA 의 용도 .
【청구항 4】
(a) 재발성 다형교아종 의심 환자로부터 분리된 생물학적 시료로부터 서 열 번호 1의 miRNA의 발현 수준을 측정하는 단계 ; 및
(b) 상기 miRNA의 발현 수준을 정상인 대조구 시료의 해당 miRNA의 발현 수 준과 비교하는 단계를 포함하는 재발성 다형교아종 진단 방법 .
【청구항 5】
서 열번호 1로 표시되는 miRNA의 수준을 측정하는 제제를 포함하는 재발성 다 형교아종 진단용 키트 .
【청구항 6】
제 5항에 있어서， 상기 키트는 서 열번호 2 내지 29로 이루어진 군에서 선택되 는 하나 이상꾀 miRNA의 수준을 측정하는' 제제를 추가로 포함하는 것인 재발성 다 형교아종 진단용 키트 .
【청구항 7]
제 5항 또는 제 6항에 있어서， 상기 제제는 서 열번호 30 내지 37로 이루어진 군에서 선택된 프라이 머 인 것을 특징으로 하는 키트 .
PCT/KR2013/006519 2012-07-20 2013-07-22 재발성 다형교아종 진단용 조성물 및 진단방법 Ceased WO2014014322A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US14/600,419 US10266898B2 (en) 2012-07-20 2015-01-20 Composition for diagnosing recurring glioblastoma multiforme and method for diagnosing same

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020120079314A KR101398074B1 (ko) 2012-07-20 2012-07-20 재발성 다형교아종 진단용 조성물 및 진단 방법
KR10-2012-0079314 2012-07-20

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US14/600,419 Continuation US10266898B2 (en) 2012-07-20 2015-01-20 Composition for diagnosing recurring glioblastoma multiforme and method for diagnosing same

Publications (1)

Publication Number Publication Date
WO2014014322A1 true WO2014014322A1 (ko) 2014-01-23

Family

ID=49949070

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2013/006519 Ceased WO2014014322A1 (ko) 2012-07-20 2013-07-22 재발성 다형교아종 진단용 조성물 및 진단방법

Country Status (3)

Country Link
US (1) US10266898B2 (ko)
KR (1) KR101398074B1 (ko)
WO (1) WO2014014322A1 (ko)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019158512A1 (en) * 2018-02-13 2019-08-22 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for the prognosis and the treatment of glioblastoma
CN114921541B (zh) * 2022-05-24 2026-02-03 中国人民解放军总医院第一医学中心 一种用于预测IgA肾病肾功能进展的尿液PCR试剂盒

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110301221A1 (en) * 2008-10-10 2011-12-08 Swedish Health Services Diagnosis, prognosis and treatment of glioblastoma multiforme

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102985558B (zh) * 2008-11-13 2015-08-19 复旦大学 用于肝细胞癌症的微rna表达谱分析的组合物和方法

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110301221A1 (en) * 2008-10-10 2011-12-08 Swedish Health Services Diagnosis, prognosis and treatment of glioblastoma multiforme

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
MALZKORN, B. ET AL.: "Identification and functional characterization of microRNAs involved in the malignant progression of gliomas", BRAIN PATHOLOGY, vol. 20, May 2010 (2010-05-01), pages 539 - 550 *
MATHUPALA, S. P. ET AL.: "MicroRNA and brain tumors: A cause and a cure?", DNA AND CELL BIOLOGY, vol. 26, no. 5, May 2007 (2007-05-01), pages 301 - 310 *
NIYAZI, M. ET AL.: "miRNA expression patterns predict survival in glioblastoma", RADIATION ONCOLOGY, vol. 6, no. 153, 10 November 2011 (2011-11-10) *

Also Published As

Publication number Publication date
KR20140012426A (ko) 2014-02-03
US10266898B2 (en) 2019-04-23
KR101398074B1 (ko) 2014-05-27
US20150232946A1 (en) 2015-08-20

Similar Documents

Publication Publication Date Title
CN103930563B (zh) 用于预测癌症复发的方法和装置
US20160222468A1 (en) Diagnosis, prognosis and treatment of glioblastoma multiforme
Childs et al. Low-level expression of microRNAs let-7d and miR-205 are prognostic markers of head and neck squamous cell carcinoma
Ho et al. MicroRNA profiling in pediatric pilocytic astrocytoma reveals biologically relevant targets, including PBX3, NFIB, and METAP2
Nassar et al. microRNA expression in ethnic specific early stage breast cancer: an integration and comparative analysis
JP2022188086A (ja) 子宮内膜症についてのバイオマーカーとしてのマイクロｒｎａ
US20170211147A1 (en) Method of predicting reaction to sorafenib treatment using gene polymorphism
AU2012265177A1 (en) Methods and devices for prognosis of cancer relapse
Bakhsh et al. Molecular detection of exosomal miRNAs of blood serum for prognosis of colorectal cancer
Schmidt et al. Treatment of prostate cancer cells with S-adenosylmethionine leads to genome-wide alterations in transcription profiles
Ak et al. MicroRNA expression patterns of tumors in early-onset colorectal cancer patients
Chao et al. Serum microRNAs in clear cell carcinoma of the ovary
CN104508149A (zh) 对jak/stat抑制剂治疗响应的预测
Zhang et al. MicroRNA expression profiles in benign prostatic hyperplasia
Solayman et al. Effect of plasma MicroRNA on antihypertensive response to beta blockers in the Pharmacogenomic Evaluation of Antihypertensive Responses (PEAR) studies
Yap et al. MicroRNAs that affect the Fanconi Anemia/BRCA pathway are downregulated in imatinib-resistant chronic myeloid leukemia patients without detectable BCR-ABL kinase domain mutations
Kook et al. Serum miR‐214 as a novel biomarker for ankylosing spondylitis
KR102101807B1 (ko) 인슐린 저항성 진단용 조성물 및 이의 용도
EP2657354A1 (en) Microrna expression signature in peripheral blood of patients affected by hepatocarcinoma or hepatic cirrhosis and uses thereof
WO2014014322A1 (ko) 재발성 다형교아종 진단용 조성물 및 진단방법
WO2010076887A1 (en) Predictive biomarkers useful for cancer therapy mediated by a wee1 inhibitor
Li et al. A comprehensive evaluation of differentially expressed mRNAs and lncRNAs in cystitis glandularis with gene ontology, KEGG pathway, and ceRNA network analysis
CN110055333B (zh) Rp11-116o18.1作为分子标志物在肺癌中的应用
CN110656162A (zh) 一种循环miR-1290的检测方法
Mitiushkina et al. Biased detection of guanine-rich microRNAs by array profiling: Systematic error or biological phenomenon?

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13819643

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13819643

Country of ref document: EP

Kind code of ref document: A1