WO2013166004A2 - Organic compositions to treat kras-related diseases - Google Patents
Organic compositions to treat kras-related diseases Download PDFInfo
- Publication number
- WO2013166004A2 WO2013166004A2 PCT/US2013/038847 US2013038847W WO2013166004A2 WO 2013166004 A2 WO2013166004 A2 WO 2013166004A2 US 2013038847 W US2013038847 W US 2013038847W WO 2013166004 A2 WO2013166004 A2 WO 2013166004A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- strand
- kras
- rnai agent
- modified
- rnai
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/713—Double-stranded nucleic acids or oligonucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
- A61K47/549—Sugars, nucleosides, nucleotides or nucleic acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/02—Antineoplastic agents specific for leukemia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1135—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against oncogenes or tumor suppressor genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/34—Spatial arrangement of the modifications
- C12N2310/344—Position-specific modifications, e.g. on every purine, at the 3'-end
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/351—Conjugate
Definitions
- KRAS is a member of the RAS subfamily of small GTPases. It is involved in cellular signal transduction, growth, differentiation, survival and other cellular functions. Over-expression or hyper-activity of KRAS, along with RAS family members HRAS and NRAS, have been associated with a number of diseases, including various cancers. RAS mutations are found in approximately one-third of all human malignancies. Bos et al. 1989. Cancer Res. 49: 4682-4689. KRAS accounts for most of the RAS mutations found in the majority of human malignancies, including 90% of RAS mutations in lung adenocarcinomas. Forbes et al. 2006. Br. J. Cancer 94: 318-322.
- Mutations, hyper-activity and/or over-expression of KRAS in particular has been associated with cancer, including adenocarcinoma, colorectal cancer (including advanced and metastatic colorectal cancer), colon cancer, lung (including non-small cell lung cancer and lung adenocarcinoma), acute myelogenous lung, bladder, brain, breast, cervical, endometrial, gastric, head and neck, kidney, leukemia, myelodysplastic syndrome, myeloid leukemia, liver, melanoma, ovarian, pancreatic, prostate, testicular, thyroid cancers, and cardio-facio-cutaneous (CFC) syndrome and Noonan syndrome, and similar and related diseases.
- cancer including adenocarcinoma, colorectal cancer (including advanced and metastatic colorectal cancer), colon cancer, lung (including non-small cell lung cancer and lung adenocarcinoma), acute myelogenous lung, bladder, brain, breast, cervical, endometrial, gastric, head and neck
- RNAi RNA interference
- KRAS-related diseases such as cancer, cardio-facio-cutaneous (CFC) syndrome and Noonan syndrome, and similar and related diseases.
- the present disclosure also encompasses a method of treating a human subject having a pathological state mediated at least in part by KRAS expression, the method comprising the step of administering to the subject a therapeutically effective amount of a RNAi agent KRAS.
- the method also optionally further comprises the step of administering a second agent.
- this second agent is another RNAi agent to KRAS.
- the second agent is another treatment, such as one directed to another target, which is also hyperactive, mutated and/or over-expressed in the pathological state.
- the present disclosure provides specific RNAi agents and methods that are useful in reducing KRAS levels in a subject, e.g., a mammal, such as a human.
- the present disclosure specifically provides double-stranded RNAi agents comprising at least 15 to at least 19 or more contiguous nucleotides of KRAS.
- the present disclosure provides agents comprising sequences of 15 or more contiguous nucleotides differing by 0, 1 , 2 or 3 from those of the RNAi agents provided, e.g., in Tables 1 to 6.
- RNAi agents particularly can in one embodiment comprise less than 30 nucleotides per strand, e.g., such as 17 - 23 nucleotides, 15 - 19, 18-22 nucleotides, and/or 19-21 nucleotides, and/or such as those provided, e.g., in Tables 1 to 6, and modified and unmodified variants thereof (e.g., wherein the sense and/or anti-sense or first and/or second strand are modified or unmodified).
- nucleotides per strand e.g., such as 17 - 23 nucleotides, 15 - 19, 18-22 nucleotides, and/or 19-21 nucleotides, and/or such as those provided, e.g., in Tables 1 to 6, and modified and unmodified variants thereof (e.g., wherein the sense and/or anti-sense or first and/or second strand are modified or unmodified).
- the present disclosure also provides agents comprising a sense strand and an anti-sense strand, wherein the sense and/or the anti-sense strand comprise sequences of 19 or more contiguous nucleotides differing by 0, 1 , 2 or 3 from those of the RNAi agents provided, e.g., in Tables 1 to 6, and modified or unmodified variants thereof.
- the sense and anti-sense strand can be contiguous, or covalently bounds, e.g., via a loop or linker.
- RNAi agents particularly can in one embodiment comprise less than 30 nucleotides per strand, e.g., such as 17 to 23 nucleotides, 18 to 22 nucleotides, and/or 19 to 21 nucleotides, and/or sequences such as those provided, e.g., in Tables 1 to 6.
- the double-stranded RNAi agents can have 0, 1 or 2 blunt ends, and/or overhangs of 1 , 2, 3 or 4 nucleotides (i.e., 1 to 4 nt) from one or both 3' and/or 5' ends.
- the double-stranded RNAi agents can also optionally comprise one or two 3' caps and/or one or more modified nucleotides. Modified variants of sequences as provided herein include those that are otherwise identical but contain substitutions of a naturally-occurring nucleotide for a corresponding modified nucleotide.
- RNAi agent can either contain only naturally-occurring nucleotide subunits (e.g., ribonucleotides), or one or more modifications to the sugar, phosphate or base of one or more of the replacement nucleotide subunits, whether they comprise ribonucleotide subunits or deoxyribonucleotide subunits or other related modified variants.
- modified variants of the disclosed RNAi agents have a thymidine (as RNA, or, preferably, DNA) replacing a uridine, or have an inosine base.
- the modified variants of the disclosed RNAi agents can have a nick in the passenger strand, mismatches between the guide and passenger strand, DNA replacing the RNA of a portion of both the guide and passenger strand (e.g., the seed region), and/or a shortened passenger strand (e.g., 15, 16, 17 or 18 nt).
- a functional guide strand is identified, modifications and variants of the RNAi agent can be readily made. Any combination of modifications which is not mutually exclusive can be (e.g., the combination of base modifications with shortened passenger strand; or nicked passenger strand and base modifications; or DNA replacing part or all of the seed region and base modifications in the remaining RNA; etc.).
- modified variants of the disclosed RNAi agents include RNAi agents with the same sequence (e.g., the same sequence of bases) as disclosed in Tables 1 to 6, but with one or more modifications to one or more of the sugar or phosphate of one or more of the nucleotide subunits.
- the modifications improve efficacy, stability (e.g., against nucleases in, for example, blood serum or intestinal fluid), and/or reduce immunogenicity of the RNAi agent.
- One aspect of the present disclosure relates to a double-stranded oligonucleotide comprising at least one non-natural nucleobase.
- the non-natural nucleobase is difluorotolyl, nitroindolyl, nitropyrrolyl, or nitroimidazolyl. In a particular embodiment, the non-natural nucleobase is difluorotolyl. In certain embodiments, only one of the two
- oligonucleotide strands contains a non-natural nucleobase. In certain embodiments, both of the oligonucleotide strands contain a non-natural nucleobase.
- RNAi agent(s) can optionally be attached to a ligand selected to improve one or more characteristic, such as, e.g., stability, distribution and/or cellular uptake of the agent, e.g., cholesterol or a derivative thereof.
- the RNAi agent(s) can be isolated or be part of a ligand selected to improve one or more characteristic, such as, e.g., stability, distribution and/or cellular uptake of the agent, e.g., cholesterol or a derivative thereof.
- the RNAi agent(s) can be isolated or be part of a ligand selected to improve one or more characteristic, such as, e.g., stability, distribution and/or cellular uptake of the agent, e.g., cholesterol or a derivative thereof.
- the RNAi agent(s) can be isolated or be part of a ligand selected to improve one or more characteristic, such as, e.g., stability, distribution and/or cellular uptake of the agent, e.g., cholesterol
- the pharmaceutical composition used for the methods described herein.
- the pharmaceutical composition can be formulated for delivery to specific tissues (e.g., those afflicted with a KRAS- related disease) or formulated for parenteral administration.
- the pharmaceutical composition can optionally comprise two or more RNAi agents, each one directed to the same or a different segment of the KRAS mRNA.
- the pharmaceutical composition can further comprise or be used in conjunction with any known treatment for any KRAS-related disease.
- the present disclosure further provides methods for reducing the level of KRAS mRNA in a cell, particularly in the case of a disease characterized by over-expression or hyper-activity of KRAS.
- Cells comprising an alteration such as a mutation, over-expression and/or hyperactivity of KRAS are termed "KRAS-defective" cells.
- KRAS-defective cells Such methods comprise the step of administering one or more of the RNAi agents of the present disclosure to a cell, as further described below.
- the present methods utilize the cellular mechanisms involved in RNA interference to selectively degrade the target RNA in a cell and are comprised of the step of contacting a cell with one or more of the RNAi agents of the present disclosure.
- the present disclosure further provides methods for reducing the level of KRAS mRNA in a cell, particularly in the case of a disease characterized by over-expression, mutation or hyper- activity of KRAS.
- Such methods comprise the step of administering one or more of the RNAi agents of the present disclosure to a cell, as further described below.
- the present methods utilize the cellular mechanisms involved in RNA interference to selectively degrade the target RNA in a cell and are comprised of the step of contacting a cell with one or more of the RNAi agents of the present disclosure.
- the present disclosure also encompasses a method of treating a human subject having a pathological state mediated at least in part by KRAS expression, the method comprising the step of administering to the subject a therapeutically effective amount of a RNAi agent targeting KRAS. Additional methods involve preventing, treating, modulating and/or ameliorating a pathological state wherein disease progression (e.g., tumor growth) requires KRAS, although KRAS is not amplified, over-expressed or mis-localized. Such methods comprise the step of administering one or more of the RNAi agents of the present disclosure to a subject, as further described below.
- the present methods utilize the cellular mechanisms involved in RNA interference to selectively degrade the target RNA in a cell comprise the step of contacting a cell with one or more of the RNAi agents of the present disclosure.
- Such methods can be performed directly on a cell or can be performed on a mammalian subject by administering to a subject one or more of the RNAi agents/pharmaceutical compositions of the present disclosure.
- Reduction of target KRAS RNA in a cell results in a reduction in the amount of encoded KRAS protein produced.
- this can result in restoration of balance in a pathway involving KRAS, and/or prevention of KRAS accumulation, and/or a reduction in KRAS activity and/or expression, and/or prevention of KRAS -mediated activation of other genes, and/or amelioration, treatment and/or prevention of a KRAS-related disease.
- a reduction in KRAS expression, level or activity can limit tumor growth.
- compositions of the present disclosure can be used in any appropriate dosage and/or formulation described herein or known in the art, as well as with any suitable route of administration described herein or known in the art.
- the details of one or more embodiments of the present disclosure are set forth in the accompanying drawings and the description below. Elements of the various embodiments (e.g., sequences, modifications, endcaps, combinations of RNAi agents, combination therapy involving a KRAS RNAi agent and another agent, etc.) which are not mutually-exclusive can be combined with each other as described herein and as known or developed in the art.
- any RNAi agent sequence disclosed herein can be combined with any set of modifications or endcaps disclosed herein. Any combination of modifications, 5' end caps, and/or 3' end caps can be used with any RNAi agent sequence disclosed herein. Any RNAi agent disclosed herein (with any combination of modifications or endcaps or without either modifications or endcaps) can be combined with any other RNAi agent or other treatment composition or method disclosed herein.
- Figure 1 illustrates various modified nucleotides: U002, U003, U004, U005, C004,
- U005 indicates a 2'- deoxy-thymidine which is DNA.
- U003 indicates 2'-deoxy uridine.
- U004 indicates a nucleotide with a Uridine ("U") base with a 2'-0-methyl modification.
- U005 indicates a U base with a 2'-0-methoxyethyl (MOE) modification.
- C004 indicates a Cysteine ("C") base with a 2'-0-methyl modification.
- C005 indicates a C base with 2'-0-methoxyethyl modification.
- A004 indicates an Adenosine ("A”) base with a 2'-0-methyl modification.
- A005 indicates an A base with 2'-0- methoxyethyl modification.
- G005 indicates a Guanosine ("G") base with a 2'O-methyl modification.
- G004 indicates a G base with a 2'O-methyl modification.
- RNAi agents to KRAS for targeting and inhibition of the KRAS gene, which are useful in treatment of KRAS-related diseases (e.g., diseases associated with mutations in and/or altered expression, level and/or activity of KRAS, and/or diseases which require KRAS, and/or diseases treatable by modulating the expression, level and/or activity of KRAS), such as a proliferative disease, including without limitation a solid or liquid cancer, adenocarcinoma, colorectal cancer, advanced and/or metastatic colorectal cancer, colon cancer, lung, non-small cell lung cancer and lung adenocarcinoma, acute myelogenous lung, bladder, brain, breast, cervical, endometrial, gastric, head and neck, kidney, leukemia, myelodysplasia syndrome, myeloid leukemia, liver or hepatic, melanoma, ovarian, pancreatic, prostate, testicular, thyroid cancers, and cardio
- KRAS-related diseases e
- the present disclosure also provides methods of treating a human subject having a pathological state mediated at least in part by KRAS expression or over-expression or hyperactivity, the method comprising the step of administering to the subject a therapeutically effective amount of a RNAi agent to KRAS.
- the present disclosure relates to a composition
- a composition comprising a RNAi agent comprising a sense strand and an antisense strand, wherein the antisense strand comprises at least 15 contiguous nucleotides differing by 0, 1 , 2, or 3 nucleotides from the antisense strand of a RNAi agent specific to KRAS (or any set of overlapping RNAi agents specific to KRAS) provided, e.g., in any of Tables 1 to 6.
- the present disclosure relates to a composition
- a composition comprising a RNAi agent comprising a sense and an anti-sense strand, wherein the sense strand comprises at least 15 contiguous nucleotides differing by 0, 1 , 2, or 3 nucleotides from the sense strand of a RNAi agent from any sequence provided herein.
- the present disclosure relates to a composition
- a composition comprising a RNAi agent comprising a first strand and a second strand, wherein the first strand comprises at least 15 contiguous nucleotides differing by 0, 1 , 2, or 3 nucleotides from the sequence of the first strand, and the second strand comprises at least 15 contiguous nucleotides differing by 0, 1 , 2, or 3 nucleotides from the sequence of the second strand of any RNAi agent provided herein.
- duplexes include the example unmodified (e.g., "generic") and example modified sequences listed in Table 1.
- other modified variants are contemplated and can be made using the nucleotide sequences provided.
- the first and/or second strand are modified or unmodified or a combination of one modified and one unmodified.
- RNAi Agents comprising an antisense and a sense strand described herein
- the present disclosure relates to a composition
- a composition comprising a RNAi agent comprising an antisense strand, wherein the antisense strand comprises at least 15 contiguous nucleotides differing by 0, 1 , 2, or 3 nucleotides from the antisense strand of a RNAi agent to KRAS selected from any sequence (or overlapping set of sequences) provided in a table herein (e.g., any of Tables 1 to 6).
- the present disclosure relates to a composition comprising a RNAi agent comprising a sense strand and an antisense strand, wherein the antisense strand comprises at least 15 contiguous nucleotides differing by 0 nucleotides from the antisense strand of a RNAi agent to KRAS selected from any sequence (or overlapping set of sequences) provided in a table here (e.g., any of Tables 1 to 6).
- the present disclosure relates to a composition comprising a RNAi agent comprising a sense and an anti-sense strand, wherein the sequence of the anti-sense strand comprises the sequence of the anti-sense strand of a RNAi agent from any sequence provided herein.
- the present disclosure relates to a composition
- a composition comprising a RNAi agent comprising a first strand and a second strand, wherein the sequence of the first strand is the sequence of the first strand of any RNAi agent provided herein.
- Particular duplexes include those specific duplexes provided above and as listed in any one or more of Table 1. Additional modified sequences (e.g., sequences comprising one or more modified base) of each of the compositions above are also contemplated as part of the present disclosure.
- SEQ ID NOs. for RNAi Agents to KRAS [0031] Provided in Table 1 are the nickname of various KRAS RNAi duplexes; the SEQ ID NOs. of unmodified (e.g., "generic") sense and anti-sense sequences; and the SEQ ID NOs. for example sense and anti-sense strands.
- Table 1 provides the SEQ ID NOs for the unmodified and an example modified sequence of the sense and an anti-sense strands of various RNAi agents to KRAS.
- the base composition of each sequence represented by a SEQ ID NO is provided in more detail in Tables 2 and 3.
- Table 4 shows overlapping groups of these KRAS RNAi agents.
- Tables 5 and 6 show efficacy of various KRAS RNAi agents.
- Table 1. SEQ ID NOs for unmodified and example modified sequences of a first and a second strand (e.g., sense and anti-sense strand) for RNAi agents to KRAS
- Table 1 presents the SEQ ID identifiers of an example unmodified first and second strand of each KRAS RNAi agent; the Table also provides an example modified sequence for each KRAS RNAi agent.
- the unmodified sequences of example KRAS RNAi agent nicknamed AD-35523.3 are SEQ ID NOs: 1 and 428.
- An example set of modified sequences for this duplex is represented by SEQ ID NOs: 855 and 1282.
- the "AD" prefix of the nickname is on occasion replaced by "ND”.
- the name of the RNAi also sometimes has a suffix, such as .1. This indicates a particular variant of a duplex.
- AD-35523.1, AD-35523.2, AD- 35523.3, ND-35523 and the like all indicate KRAS RNAi agents of the same sequence, although they may differ in how they are modified.
- replacement of a U with a T is considered a modification that does not introduce a mismatch; thus, two otherwise identical sequences wherein one or more U bases are replaced by T are still considered to be identical and the same.
- RNAi agents also comprise the suffix "b1 ", indicating "batch 1 .”
- the various KRAS RNAi agents comprising the nickname AD-35523 thus all have the same base sequence (though not necessarily the same modification), and the suffix "b1 " (or “b2" or the like) may indicate a particular batch, though these also have the same sequence.
- RNAi agents in Table 1 have alternative names or nicknames. Some nicknames are derived from their position in the KRAS gene and, often, a code for the format for modifications. It is noted, however, that different methodologies are available for numbering the KRAS gene sequence. The numbering used herein for the KRAS gene is for illustration only. Alternative names of some duplexes are listed below:
- hs_KRAS 1273_A22S26, hs_KRAS 2892_A37S26, and hs_KRAS 4731_A22S26 are also sometimes alternatively designated KRAS1273, KRAS2892, and KRAS4731 , respectively.
- siRNAs include, for example, double-stranded RNA corresponding to the DNA sequences provided (e.g., as RNA with or without any of the following or combination of any of the following: modification(s), terminal TT or other overhang(s), endcap(s), alternative base (LNA, PNA, etc.), and/or a few DNA bases interspersed among the RNA or other bases, etc.).
- Tables 1.1 and 1.2 are continuations of Table 1 ; thus, references to any Table or Tables include references to additional Tables.
- references to Table 1 also include references to Tables 1.1 and 1.2; and references to Tables 1 to 6 include Tables 1 .1 , 1.2, 6.1 , 6.2, etc.
- RNAi agents to KRAS are disclosed in Tables 1 to 6.
- Tables 1 , 2 and 3 provide the sequence, SEQ ID NOs and relative positions of ⁇
- RNAi agents to KRAS including both unmodified sequences (listed in Table 2) and example modified sequences (listed in Table 3).
- lower-case letters e.g., c, u
- upper case letters e.g., C, U, A, G
- example modified versions of each of the sequences are shown.
- the present disclosure also contemplates and encompasses unmodified versions of these sequences and other versions which comprise additional or alternative modifications.
- AD-35523.3 can optionally have the unmodified sequences of SEQ ID NO: 1 in the sense strand and SEQ ID NO: 428 in the anti- sense strand.
- the present disclosure also encompasses alternative modified versions of the duplex comprising the modified sequences of SEQ ID NO: 855 in the sense strand and SEQ ID NO: 1282 in the anti-sense strand.
- the present disclosure also encompasses different modified variants of SEQ ID NO: 1 in the sense strand and SEQ ID NO: 428 in the anti-sense strand.
- the present disclosure also encompasses any modified variant of any unmodified sequence disclosed herein.
- the modified and unmodified sequences can optionally comprise the sequence "TT", “dTdT”, “dTsdT” or "UU” at the 3' end.
- AD-35523.3 can optionally have the modified sequences of SEQ ID NO: 855 in the sense strand and SEQ ID NO: 1282 in the anti-sense strand.
- SEQ ID NO: 855 and SEQ ID NO: 1282 include a terminal dTdT.
- dT is 2'-deoxy-thymidine-5'-phosphate
- sdT is 2'-deoxy Thymidine 5'-phosphorothioate.
- terminal dinucleotide "UU” is 2'-OMe-U 2'-OMe-U, and neither the terminal TT nor the terminal UU are in the inverted/reverse orientation.
- the terminal dithymidine (or UU) is not part of the KRAS target sequence, but is a modified variant of the dithymidine dinucleotide commonly placed as an overhang to protect the ends of siRNAs from nucleases (see, for example, Elbashir et al. 2001 Nature 41 1 : 494-498;
- the present disclosure also encompasses any modified or any unmodified sequence disclosed herein, wherein the modified sequence comprises a terminal TT, dTdT, sdT, dTsdT, sdTsdT, sdTdT, or the like which may be in either the inverted/reverse orientation or in the same 5' to 3' orientation as the KRAS specific sequence in the duplex.
- the KRAS portion of a RNAi agent sequence and the like indicate the portion of the sequence of a RNAi agent which is derived from KRAS (thus “the KRAS portion of a RNAi agent sequence” does not include, for example, a terminal dTdT, TT, UU, or the like, but does include the portion of the RNAi agent that corresponds to or is complementary to a portion of the KRAS gene sequence or mRNA sequence.
- a 3' end cap can be used instead of or in addition to a terminal dinucleotide to stabilize the end from nuclease degradation provided that the 3' end cap is able to both stablize the RNAi agent (e.g., against nucleases) and not interfere excessively with siRNA activity.
- the present disclosure also encompasses any modified or any unmodified sequence disclosed herein, wherein the modified sequence further comprises a terminal 3' end cap.
- Table 4 provides sets of overlapping RNAi agents to KRAS.
- RNAi agent comprising an anti-sense strand described herein
- the present disclosure relates to a composition
- a composition comprising a RNAi agent comprising an anti-sense strand, wherein the anti-sense strand comprises at least 15 contiguous nucleotides differing by 0, 1 , 2, or 3 nucleotides from the anti-sense strand of a RNAi agent to KRAS selected from those anti-sense strands in the specific duplexes provided herein and as listed, e.g., in Tables 1 to 6.
- the composition further comprises a second RNAi agent to KRAS.
- the second RNAi agent is physically separate from the first, or the two KRAS RNAi agents are physically connected (e.g., covalently linked or otherwise conjugated) or combined in the same pharmaceutical composition, or are both elements in the same treatment regimen.
- the composition comprises a RNAi agent comprising a first and an second strand, wherein the sequence of the first strand and the sequence of the second strand are the sequences of the first and second strand, respectively, of any RNAi agent provided herein.
- the composition comprises a RNAi agent comprising a first and an second strand, wherein the sequence of the first strand and the sequence of the second strand are the sequences of the first and second strand, respectively, of any RNAi agent provided herein, further comprising an additional about 6 to 20 nucleotides on one or both strands (e.g., about 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19 or 20 nt).
- the first and second strands are the sense and anti-sense strands listed in the Tables herein, respectively. In various embodiments, the first and second strands are the anti-sense and sense strands listed in the Tables herein, respectively.
- the antisense strand is about 30 or fewer nt in length.
- the sense strand and the antisense strand form a duplex region of about 15 to about 30 nucleotide pairs in length.
- the antisense strand is about 15 to about 36 nt in length, including about 18 to about 30 nt in length, and further including about 19 to about 21 nt in length and about 19 to about 23 nt in length.
- the antisense strand has at least the length selected from about 15 nt, about 16 nt, about 17 nt, about 18 nt, about 19 nt, about 20 nt, about 21 nt, about 22 nt, about 23 nt, about 24 nt, about 25 nt, about 26 nt, about 27 nt, about 28 nt, about 29 nt and about 30 nt.
- the RNAi agent comprises a modification that causes the RNAi agent to have increased stability in a biological sample or environment, e.g., cytoplasm, interstitial fluids, blood serum, lung or intestinal lavage fluid.
- the RNAi agent comprises at least one sugar backbone modification (e.g., phosphorothioate linkage) and/or at least one 2'-modified nucleotide.
- all the pyrimidines are 2' O-methyl-modified nucleotides.
- the RNAi agent comprises: at least one 5'-uridine-adenine-3' (5'- ua-3') dinucleotide, wherein the uridine is a 2'-modified nucleotide; and/or at least one 5'-uridine- guanine-3' (5'-ug-3') dinucleotide, wherein the 5'-uridine is a 2'-modified nucleotide; and/or at least one 5'-cytidine-adenine-3' (5'-ca-3') dinucleotide, wherein the 5'-cytidine is a 2'-modified nucleotide; and/or at least one 5'-uridine-uridine-3' (5'-uu-3') dinucleotide, wherein the 5'-uridine is a 2'-modified nucleotide.
- the RNAi agent comprises a 2'-modification selected from the group consisting of: 2'-deoxy, 2'-deoxy-2'-fluoro, 2'-0-methyl, 2'-0-methoxyethyl (2 -O-MOE), 2'-0- aminopropyl (2 -O-AP), 2'-0-dimethylaminoethyl (2 -O-DMAOE), 2'-0-dimethylaminopropyl (2 -0- DMAP), 2'-0-dimethylaminoethyloxyethyl (2 -O-DMAEOE), and 2'-0-N-methylacetamido (2'-0- NMA).
- all the pyrimidines are 2' O-methyl-modified nucleotides.
- the RNAi agent comprises a blunt end.
- the RNAi agent comprises an overhang having 1 to 4 unpaired nucleotides.
- the RNAi agent comprises an overhang at the 3'-end of the antisense strand of the RNAi agent.
- the RNAi agent is ligated to one or more diagnostic compound, reporter group, cross-linking agent, nuclease-resistance conferring moiety, natural or unusual nucleobase, lipophilic molecule, cholesterol, lipid, lectin, steroid, uvaol, hecigenin, diosgenin, terpene, triterpene, sarsasapogenin, Friedelin, epifriedelanol-derivatized lithocholic acid, vitamin, carbohydrate, dextran, pullulan, chitin, chitosan, synthetic carbohydrate, oligo lactate 15-mer, natural polymer, low- or medium-molecular weight polymer, inulin, cyclodextrin, hyaluronic acid, protein, protein-binding agent, integrin-targeting molecule, polycationic, peptide, polyamine, peptide mimic, and/or transferrin.
- the RNAi agent is capable of inhibiting expression of KRAS by at least about 60% at a concentration of 10 nM in RKO cells in vitro.
- the RNAi agent is capable of inhibiting expression of KRAS by at least about 70% at a concentration of 10 nM in RKO cells in vitro.
- the RNAi agent is capable of inhibiting expression of KRAS by at least about 80% at a concentration of 10 nM in RKO cells in vitro.
- the RNAi agent is capable of inhibiting expression of KRAS by at least about 90% at a concentration of 10 nM in RKO cells in vitro.
- the RNAi agent has an EC50 of no more than about 0.1 nM in MiaPaca2 cells.
- the RNAi agent has an EC50 of no more than about 0.01 nM in MiaPaca2 cells.
- the RNAi agent has an EC50 of no more than about 0.001 nM in MiaPaca2 cells.
- RNAi agent comprising a first and a second strand described herein
- the present disclosure relates to a composition
- a composition comprising a RNAi agent comprising a first strand and a second strand, wherein the sequence of the first strand strand comprises at least 15 contiguous nucleotides, differing by 0, 1 , 2, or 3 nucleotides from the sequence of the first strand of a RNAi agent to KRAS selected from the specific duplexes provided herein and listed, e.g., in Table 1.
- the present disclosure relates to a composition
- a composition comprising a RNAi agent comprising a first strand and a second strand, wherein the sequence of the first strand and/or second strand comprise at least 15 contiguous nucleotides, differing by 0, 1 , 2, or 3 nucleotides from the sequence of the first and/or second strand of a RNAi agent to KRAS selected from the specific duplexes provided herein and listed, e.g., in Table 1.
- the present disclosure relates to a composition
- a composition comprising a RNAi agent comprising a first strand and a second strand, wherein the sequence of the first strand and/or second strand comprise the sequence of the first and/or second strand, respectively, of a RNAi agent to KRAS selected from the specific duplexes provided herein and listed, e.g., in Table 1.
- the present disclosure relates to a composition
- a composition comprising a RNAi agent comprising a first strand and a second strand, wherein the sequence of the first strand and/or second strand are the sequence of the first and/or second strand, respectively, of a RNAi agent to KRAS selected from the specific duplexes provided herein and listed, e.g., in Table 1.
- the composition further comprises a second RNAi agent to KRAS.
- the second RNAi agent is physically separate from the first, or the two are physically connected (e.g., covalently linked or otherwise conjugated).
- the antisense strand is about 30 or fewer nt in length.
- the sense strand and the antisense strand form a duplex region of about 15 to about 30 nt pairs in length.
- the antisense strand is about 15 to about 36 nt in length including about 18 to about 23 nt in length, and including about 19 to about 21 nt in length and about 19 to about 23 nt in length. In one embodiment, the antisense strand has at least the length selected from about 15 nt, about 16 nt, about 17 nt, about 18 nt, about 19 nt, about 20 nt, about 21 nt, about 22 nt, about 23 nt, about 24 nt, about 25 nt, about 26 nt, about 27 nt, about 28 nt, about 29 nt and about 30 nt.
- the RNAi agent comprises a modification that causes the RNAi agent to have increased stability in a biological sample or environment, e.g., blood serum or intestinal lavage fluid.
- the RNAi agent comprises at least one sugar backbone modification (e.g., phosphorothioate linkage) and/or at least one 2'-modified nucleotide.
- all the pyrimidines are 2' O-methyl-modified nucleotides.
- the RNAi agent comprises: at least one 5'-uridine-adenine-3' (5'- ua-3') dinucleotide, wherein the uridine is a 2'-modified nucleotide; and/or at least one 5'-uridine- guanine-3' (5'-ug-3') dinucleotide, wherein the 5'-uridine is a 2'-modified nucleotide; and/or at least one 5'-cytidine-adenine-3' (5'-ca-3') dinucleotide, wherein the 5'-cytidine is a 2'-modified nucleotide; and/or at least one 5'-uridine-uridine-3' (5'-uu-3') dinucleotide, wherein the 5'-uridine is a 2'-modified nucleotide.
- the RNAi agent comprises a 2'-modification selected from the group consisting of: 2'-deoxy, 2'-deoxy-2'-fluoro, 2'-0-methyl, 2'-0-methoxyethyl (2 -O-MOE), 2'-0- aminopropyl (2 -O-AP), 2'-0-dimethylaminoethyl (2 -O-DMAOE), 2'-0-dimethylaminopropyl (2 -0- DMAP), 2'-0-dimethylaminoethyloxyethyl (2 -O-DMAEOE), and 2'-0-N-methylacetamido (2 -0- NMA).
- the RNAi agent comprises a blunt end.
- the RNAi agent comprises an overhang having 1 to 4 unpaired nucleotides.
- the RNAi agent comprises an overhang at the 3'-end of the antisense strand of the RNAi agent.
- the RNAi agent is ligated to one or more diagnostic compound, reporter group, cross-linking agent, nuclease-resistance conferring moiety, natural or unusual nucleobase, lipophilic molecule, cholesterol, lipid, lectin, steroid, uvaol, hecigenin, diosgenin, terpene, triterpene, sarsasapogenin, Friedelin, epifriedelanol-derivatized lithocholic acid, vitamin, carbohydrate, dextran, pullulan, chitin, chitosan, synthetic carbohydrate, oligo lactate 15-mer, natural polymer, low- or medium-molecular weight polymer, inulin, cyclodextrin, hyaluronic acid, protein, protein-binding agent, integrin-targeting molecule, polycationic, peptide, polyamine, peptide mimic, and/or transferrin.
- the RNAi agent is capable of inhibiting expression of KRAS by at least about 60% at a concentration of 10 nM in RKO cells in vitro.
- the RNAi agent is capable of inhibiting expression of KRAS by at least about 70% at a concentration of 10 nM in RKO cells in vitro.
- the RNAi agent is capable of inhibiting expression of KRAS by at least about 80% at a concentration of 10 nM in RKO cells in vitro.
- the RNAi agent is capable of inhibiting expression of KRAS by at least about 90% at a concentration of 10 nM in RKO cells in vitro.
- the RNAi agent has an EC50 of no more than about 0.1 nM in MiaPaca2 cells.
- the RNAi agent has an EC50 of no more than about 0.01 nM in MiaPaca2 cells.
- the RNAi agent has an EC50 of no more than about 0.001 nM in MiaPaca2 cells.
- the present disclosure relates to a method of treating a KRAS-related disease in an individual, comprising the step of administering to the individual a therapeutically effective amount of a composition comprising a RNAi agent comprising at least an antisense strand, wherein the antisense strand comprises at least 15 to 19 contiguous nucleotides differing by 0, 1 , 2, or 3 nucleotides from the antisense strand of a RNAi agent to KRAS selected from the specific duplexes provided herein and as listed, e.g., in Table 1.
- the present disclosure relates to such a method, wherein the composition comprising a RNAi agent further comprises a sense strand, wherein the sense strand comprises at least 15 contiguous nucleotides differing by 0, 1 , 2, or 3 nucleotides from the sense strand of a RNAi agent to KRAS selected from the specific duplexes provided herein and as listed, e.g., in Table 1.
- the RNAi agent comprises at least an anti-sense strand, and/or comprises a sense and an anti-sense strand, wherein the sequence of the sense and/or anti-sense strand is the sequence of the sense and/or the anti-sense strand of a RNAi agent to KRAS selected from those specific duplex provided herein and as listed, e.g., in Table 1 , wherein the composition further comprises a pharmaceutically effective formulation.
- the RNAi agent comprises at least an anti-sense strand, and/or comprises a sense and an anti-sense strand, wherein the sequence of the sense and/or anti-sense strand comprises the sequence of the sense and/or the anti-sense strand of a RNAi agent to KRAS selected from those specific duplex provided herein and as listed, e.g., in Table 1 , wherein the composition further comprises a pharmaceutically effective formulation.
- the KRAS-related disease is a proliferative disease, or cardio- facio-cutaneous (CFC) syndrome or Noonan syndrome.
- the KRAS-related disease is a proliferative disease, including without limitation a solid or liquid cancer, adenocarcinoma, colorectal cancer, advanced and/or metastatic colorectal cancer, colon cancer, lung, non-small cell lung cancer and lung
- adenocarcinoma acute myelogenous lung, bladder, brain, breast, cervical, endometrial, gastric, head and neck, kidney, leukemia, myelodysplastic syndrome, myeloid leukemia, liver, melanoma, ovarian, pancreatic, prostate, testicular, thyroid cancers, or cardio-facio-cutaneous (CFC) syndrome or Noonan syndrome.
- CFC cardio-facio-cutaneous
- the method further comprises the administration of an additional treatment.
- the additional treatment is a therapeutically effective amount of a composition.
- the additional treatment is a method (or procedure).
- the additional treatment and the RNAi agent can be administered in any order, or can be administered simultaneously.
- the method further comprises the step of administering an additional treatment for a proliferative disease, cardio-facio-cutaneous (CFC) syndrome or Noonan syndrome.
- CFC cardio-facio-cutaneous
- the method further comprises the step of administering an additional treatment or therapy selected from the list of an additional antagonist to a KRAS-related disease.
- the composition comprises a second RNAi agent to KRAS.
- the second RNAi agent is physically separate from the first, or the two are physically connected (e.g., covalently linked or otherwise conjugated).
- the method further comprises the step of administering an additional RNAi agent which comprises at least 15 contiguous nucleotides differing by 0, 1 , 2, or 3 nucleotides from the antisense strand of a RNAi agent to KRAS selected from the specific duplexes provided herein and as listed, e.g., in Table 1.
- an additional RNAi agent which comprises at least 15 contiguous nucleotides differing by 0, 1 , 2, or 3 nucleotides from the antisense strand of a RNAi agent to KRAS selected from the specific duplexes provided herein and as listed, e.g., in Table 1.
- the present disclosure relates to a method of inhibiting the expression of KRAS in an individual, comprising the step of administering to the individual a therapeutically effective amount of a composition comprising a RNAi agent of the present disclosure.
- the RNAi agent comprises at least an anti-sense strand, and/or comprises a sense and an anti-sense strand, wherein the anti-sense strand comprises at least 15 contiguous nucleotides differing by 0, 1 , 2, or 3 nucleotides from the anti- sense strand of a RNAi agent to KRAS selected from those specific duplex provided herein and as listed, e.g., in Table 1.
- the RNAi agent comprises at least an anti-sense strand, and/or comprises a sense and an anti-sense strand, wherein the sequence of the sense and/or anti-sense strand is the sequence of the sense and/or the anti-sense strand of a RNAi agent to KRAS selected from those specific duplex provided herein and as listed, e.g., in Table 1 , wherein the composition is in a pharmaceutically effective formulation.
- the RNAi agent comprises at least an anti-sense strand, and/or comprises a sense and an anti-sense strand, wherein the sequence of the sense and/or anti-sense strand comprises the sequence of the sense and/or the anti-sense strand of a RNAi agent to KRAS selected from those specific duplex provided herein and as listed, e.g., in Table 1 , wherein the composition is in a pharmaceutically effective formulation.
- the individual is afflicted with or susceptible to a KRAS-related disease.
- the KRAS-related disease is a proliferative disease, or cardio- facio-cutaneous (CFC) syndrome or Noonan syndrome.
- the KRAS-related disease is a proliferative disease, including without limitation a solid or liquid cancer, e.g., adenocarcinoma, colorectal cancer, advanced and/or metastatic colorectal cancer, colon cancer, lung, non-small cell lung cancer and lung
- a proliferative disease including without limitation a solid or liquid cancer, e.g., adenocarcinoma, colorectal cancer, advanced and/or metastatic colorectal cancer, colon cancer, lung, non-small cell lung cancer and lung
- the method further comprises the administration of an additional treatment.
- the additional treatment is a therapeutically effective amount of a composition.
- the additional treatment is a therapeutically relevant method (or procedure).
- the additional treatment and the RNAi agent can be administered in any order or can be administered simultaneously.
- the method further comprises the step of administering an additional treatment for a proliferative disease, cardio-facio-cutaneous (CFC) syndrome or Noonan syndrome.
- CFC cardio-facio-cutaneous
- the composition comprises a second RNAi agent to KRAS.
- the second RNAi agent is physically separate from the first, or the two are physically connected (e.g., covalently linked or otherwise conjugated).
- the method further comprises the step of administering an additional RNAi agent which comprises at least 15 contiguous nucleotides differing by 0, 1 , 2, or 3 nucleotides from the antisense strand of a RNAi agent to KRAS selected from the specific duplexes provided herein and as listed, e.g., in Table 1.
- an additional RNAi agent which comprises at least 15 contiguous nucleotides differing by 0, 1 , 2, or 3 nucleotides from the antisense strand of a RNAi agent to KRAS selected from the specific duplexes provided herein and as listed, e.g., in Table 1.
- compositions of a RNAi agent to KRAS [00127]
- the present disclosure relates to a composition comprising a RNAi agent of the present disclosure.
- the RNAi agent comprises at least an anti-sense strand, and/or comprises a sense and an anti-sense strand, wherein the anti- sense strand comprises at least 15 contiguous nucleotides differing by 0, 1 , 2, or 3 nucleotides from the anti-sense strand of a RNAi agent to KRAS selected from those specific duplex provided herein and as listed, e.g., in Table 1 , wherein the composition is in a pharmaceutically effective formulation.
- the RNAi agent comprises at least an anti-sense strand, and/or comprises a sense and an anti-sense strand, wherein the sequence of the sense and/or anti-sense strand is the sequence of the sense and/or the anti-sense strand of a RNAi agent to KRAS selected from those specific duplex provided herein and as listed, e.g., in Table 1 , wherein the composition is in a pharmaceutically effective formulation.
- the RNAi agent comprises at least an anti-sense strand, and/or comprises a sense and an anti-sense strand, wherein the sequence of the sense and/or anti-sense strand comprises the sequence of the sense and/or the anti-sense strand of a RNAi agent to KRAS selected from those specific duplex provided herein and as listed, e.g., in Table 1 , wherein the composition is in a pharmaceutically effective formulation.
- the present disclosure pertains to the use of a RNAi agent in the manufacture of a medicament for treatment of a KRAS-related disease, wherein the RNAi agent comprises a sense strand and an antisense strand, wherein the antisense strand comprises at least 15 contiguous nucleotides differing by 0, 1 , 2, or 3 nucleotides from the antisense strand of a RNAi agent to KRAS selected from those specific duplex provided herein and as listed, e.g., in Table 1.
- RNAi agent to KRAS Various specific embodiments of a RNAi agent to KRAS are disclosed herein.
- the present disclosure encompasses the example modified sequences provided in Tables 1 to 6, and the corresponding unmodified sequences and other modified sequences (e.g., modified and unmodified variants).
- Specific embodiments of the present disclosure include RNAi agents which comprise sequences differing by 0, 1 , 2, or 3 nt (nucleotides) or bp [basepair(s)] (e.g., with 0, 1 , 2 or 3 mismatches) from any of the RNAi agents listed in Table 1 , and modified and unmodified variants thereof.
- a mismatch is defined herein as a difference between the base sequence (e.g., A instead of G) or length when two sequences are maximally aligned and compared.
- an "unmodified variant” is a variant in which the base sequence is identical, but none of the bases are modified; this includes, for example, a sequence identical to the corresponding portion of the wild-type KRAS mRNA or gene.
- a "modified variant” contains one or more modifications (or one or more fewer or different modifications) to a nucleotide, sugar, phosphate or backbone, and/or addition of one or more moieties; but without a change, substitution, addition, or deletion to the base sequence.
- a particular sequence and its modified or unmodified variants have 0 mismatches among them.
- the present disclosure comprises a RNAi agent comprising a sense and an anti-sense strand, wherein the sense and/or anti-sense strand comprises at least 15 contiguous nucleotides differing by 0, 1 , 2, or 3 nt from the sequence of the sense and/or anti-sense strand of: any of the RNAi agents listed in Tables 1 to 6, and modified and unmodified variants thereof.
- the RNAi agent comprises a sense strand comprising at least 15 contiguous nucleotides differing by 0, 1 , 2, or 3 nt from the sense strand of any of the RNAi agents listed in Tables 1 to 6, and modified and unmodified variants thereof.
- the disclosure pertains to a composition according to any of the embodiments described herein, for use in a method of treating a KRAS-related disease in an individual, the method comprising the step of administering to the individual a therapeutically effective amount of a composition according to any of the claims.
- One embodiment of the disclosure is the use of a composition according to any of these embodiments, in the manufacture of a medicament for treatment of an KRAS-related disease.
- the KRAS-related disease is a proliferative disease, or cardio- facio-cutaneous (CFC) syndrome or Noonan syndrome.
- the KRAS-related disease is a proliferative disease, including without limitation a solid or liquid cancer, adenocarcinoma, colorectal cancer, advanced and/or metastatic colorectal cancer, colon cancer, lung, non-small cell lung cancer and lung
- adenocarcinoma acute myelogenous lung, bladder, brain, breast, cervical, endometrial, gastric, head and neck, kidney, leukemia, myelodysplastic syndrome, myeloid leukemia, liver, melanoma, ovarian, pancreatic, prostate, testicular, thyroid cancers, or cardio-facio-cutaneous (CFC) syndrome or Noonan syndrome.
- CFC cardio-facio-cutaneous
- the disclosure pertains to the composition of any of the above embodiments, for use in the treatment of an KRAS-related disease.
- KRAS is meant the gene, mRNA, and/or protein, or any nucleic acid encoding the protein, or any mutant, variant or modified version thereof, designated by the Approved Gene Symbol: KRAS; Cytogenetic location: 12p12.1 ; Genomic coordinates (GRCh37): 12:25,358, 179 - 25,403,853 (from NCBI), which also variously designated: KRas, K-ras, K-RAS, GTPase KRas, and V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog, C-K-RAS; K-RAS2A; K-RAS2B; K-RAS4A; K-RAS4B; KI-RAS; KRAS2; RASK2; v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog [Source: MGI Symbol; Acc: MGI: 96680];
- Species-Mouse Entrez-16653; Ensembl-ENSMUSG00000030265; UniProt-070564; RefSeq (mRNA)-NM_021284.6; RefSeq (protein)-NP_067259.4; Location (UCSC)-Chr 6: 145.17 - 145.2 Mb.
- the Ras subfamily (an abbreviation of RAt Sarcoma) is a protein subfamily of small GTPases that are involved in cellular signal transduction and other processes. Activation of Ras signaling causes cell growth, differentiation and survival.
- Ras communicates signals from outside the cell to the nucleus
- mutations in ras genes can cause permanent activation and inappropriate transmission inside the cell, even in the absence of extracellular signals. Because these signals result in cell growth and division, dysregulated or otherwise aberrant Ras signaling can ultimately lead to oncogenesis and cancer.
- Activating mutations in Ras are found in a third of all human tumors and up to 90% in specific tumor types. Downward. 2003. Nat. Rev. Cancer 3. 1 : 1 1- 22; Bos et al. 1989 Cancer Res. 49: 4682-4689; and Forbes et al. 2006 Br. J. Cancer 94: 318-322
- the ras genes were first identified as the transforming oncogenes [Malumbres et al. 2003. Nat. Rev. Cancer 3. 6: 459-65] responsible for the cancer-causing activities of the Harvey (the HRAS oncogene) and Kirsten (KRAS) sarcoma viruses, by Scolnick and colleagues at the National Institutes of Health (NIH). Chang et al. 1982. Proc. Natl. Acad. Sci. U.S.A. 79. 16: 4848-52. These viruses were discovered originally in rats during the 1960s by Jennifer Harvey [Harvey. 1964. Nature 204. 4963: 1 104-5] and Werner Kirsten [Kirsten et al. 1970.
- the three human KRAS genes encode highly related 188 to 189 amino acid proteins, designated H-Ras, N-Ras and K-Ras4A and K-Ras4B (the two K-Ras proteins arise from alternative gene splicing).
- H-Ras highly related 188 to 189 amino acid proteins
- N-Ras amino acid proteins
- K-Ras4A the two K-Ras proteins arise from alternative gene splicing.
- KRAS cloning and isoforms see, for example, Der et al. 1982 Proc. Nat. Acad. Sci. 79: 3637-3640; Chang et al. 1982 Proc. Nat. Acad. Sci. 79: 4848-4852; McCoy et al. 1983 Nature 302: 79-81 ; McGrath et al. 1983 Nature 304: 501- 506; and Carta et al. 2006 Am. J. Hum. Genet. 79: 129-135.
- Ras proteins function as binary molecular switches that control intracellular signaling networks. Ras-regulated signal pathways, control such processes as actin cytoskeletal integrity, proliferation, differentiation, cell adhesion, apoptosis, and cell migration. Ras and ras-related proteins are often deregulated in cancers, leading to increased invasion and metastasis and decreased apoptosis.
- Ras activates several pathways, of which the mitogen-activated protein (MAP) kinase cascade has been well-studied. This cascade transmits signals downstream and results in the transcription of genes involved in cell growth and division. There is a separate AKT pathway that inhibits apoptosis.
- MAP mitogen-activated protein
- the RNAi agents can be used to treat KRAS-related diseases in which any one or more of these pathways or functions is altered.
- the present disclosure encompasses KRAS RNAi agents that modulate or alter Ras-regulated signal pathways, including the MAP kinase cascade, and/or modulate or alter processes such as actin cytoskeletal integrity, proliferation, differentiation, cell adhesion, apoptosis, and cell migration. Ras and ras-related proteins are often deregulated in cancers, leading to increased invasion and metastasis and decreased apoptosis.
- Ras is a G protein, or a guanosine-nucleotide-binding protein. Specifically, it is a single- subunit small GTPase, which is related in structure to the G a subunit of heterotrimeric G proteins (large GTPases). G proteins function as binary signaling switches with “on” and “off states. In the “off state it is bound to the nucleotide guanosine diphosphate (GDP), while in the "on” state, Ras is bound to guanosine triphosphate (GTP), which has an extra phosphate group as compared to GDP. This extra phosphate holds the two switch regions in a "loaded-spring" configuration (specifically the Thr-35 and Gly-60). When released, the switch regions relax which causes a conformational change into the inactivate state. Hence, activation and deactivation of Ras and other small G proteins are controlled by cycling between the active GTP-bound and inactive GDP-bound forms.
- GDP nucleotide guanos
- Critical regions of KRAS for oncogenic activity include codons 12, 13, 59, 60, 61 , 63 and 153.
- Some KRAS mutations cause RAS to accumulate in the GTP-bound state by impairing intrinsic GTPase activity and conferring resistance to GTPase-activating proteins. Zenker et al. 2007 J. Med. Genet. 44: 131-135.
- the sequence of the KRAS RNAi agent encompasses the portion of the coding segment corresponding to any of the above-listed codons.
- the KRAS RNAi agent has a mismatch to the wild-type (wt) KRAS sequence, such that the sequence of the KRAS RNAi agent matches the sequence of a mutated portion of the KRAS gene.
- the disclosure encompasses the administration to a patient of a KRAS RNAi agent with a sequence corresponding to that of a particular mutation found in the patient, optionally combined with the administration of a KRAS RNAi agent with a sequence encompassing the wt sequence.
- the KRAS RNAi agents correspond to different portions of the KRAS mRNA.
- the patient may have one or more mutations corresponding to particular codons of KRAS (e.g., codons 12, 13 and/or 59), but the remainder of the KRAS gene is wild type, and thus the patient can be administered a KRAS RNAi agent with a wild-type sequence which does not span the mutation, and/or administered a KRAS RNAi agent with a sequence corresponding to the one or more mutations.
- the disclosure encompasses a method involving the steps of identifying a patient with a KRAS-related disease, isolating a nucleic acid encoding or corresponding to the KRAS protein or gene from the patient, determining the sequence of the nucleic acid to determine if there is a mutation in the KRAS gene, and, if the sequence indicates a mutation in KRAS, producing a KRAS RNAi agent with a sequence which corresponds to the mutation, and administering the KRAS RNAi agent in a therapeutically effective amount to treat or ameliorate the KRAS-related disease.
- the KRAS RNAi agent is administered along with or as part of a treatment regimen with another disease treatment appropriate to the KRAS-related disease.
- GEFs guanine nucleotide exchange factors
- GAPs GTPase activating proteins
- Ras has an intrinsic GTPase activity, which means that the protein on its own will hydrolyze a bound GTP molecule into GDP.
- this process is too slow for efficient function, and hence the GAP for Ras, RasGAP, may bind to and stabilize the catalytic machinery of Ras, supplying additional catalytic residues ("arginine finger") such that a water molecule is optimally positioned for nucleophilic attack on the gamma-phosphate of GTP.
- An inorganic phosphate is released and the Ras molecule is now bound to a GDP. Since the GDP-bound form is "off” or "inactive" for signaling, GTPase Activating Protein inactivates Ras by activating its GTPase activity.
- GAPs accelerate Ras inactivation.
- GEFs catalyze a "push and pull" reaction which releases GDP from Ras. They insert close to the P-loop and magnesium cation binding site and inhibit the interaction of these with the gamma phosphate anion. Acidic (negative) residues in switch II "pull” a lysine in the P-loop away from the GDP, which "pushes” switch I away from the guanine. The contacts holding GDP in place are broken and it is released into the cytoplasm. Because intracellular GTP is abundant relative to GDP (approximately 10 fold more). GTP predominantly re-enters the nucleotide binding pocket of Ras and reloads the spring. Thus GEFs facilitate Ras activation. Well known GEFs include Son of Sevenless (Sos) and cdc25 which include the RasGEF domain.
- Ras has high affinity for numerous effectors which allow it to carry out its functions. These include PI3K.
- Other small GTPases may bind adaptors such as arfaptin or second messenger systems such as adenylyl cyclase.
- the Ras binding domain is found in many effectors and invariably binds to one of the switch regions, because these change conformation between the active and inactive forms. However, they may also bind to the rest of the protein surface.
- the present disclosure encompasses KRAS RNAi agents that modulate the amount of KRAS and/or the amount of activated KRAS in a cell.
- the present disclosure encompasses a composition or pharmaceutical composition comprising and/or a method of treatment involving one or more KRAS RNAi agents and a second agent (e.g., another RNAi agent, antibody, or small molecule) which targets a factor which interacts with KRAS (e.g., PI3K, GAP, etc.).
- a second agent e.g., another RNAi agent, antibody, or small molecule
- Ras inhibitor trans-farnesylthiosalicylic acid exhibits profound anti- oncogenic effects in many cancer cell lines. Rotblat et al. 2008. Methods Enzymol 439: 467-89; and Blum et al. 2005. Cancer Research 65. 3: 999-1006.
- KRAS RNAi agents disclosed herein can be introduced into tumor cells with a point mutation in KRAS or other mutation causing an over-expression or hyperactivity of KRAS. Such cells are termed "KRAS-defective" cells.
- Mutations in a number of different genes as well as KRAS itself can also have this effect.
- Oncogenes such as p210BCR-ABL or the growth receptor erbB are upstream of Ras, so if they are constitutively activated their signals will transduce through Ras.
- tumour suppressor gene NF1 encodes a Ras-GAP - its mutation in
- Ras oncogenes can be activated by point mutations so that the GTPase reaction can no longer be stimulated by GAP - this increases the half life of active Ras-GTP mutants.
- the KRAS RNAi agent can be administered to patients having a KRAS-related diseases involving a mutation outside KRAS, such as in p210BCR-ABL, erbB, or NF1.
- the present disclosure encompasses a composition or pharmaceutical composition or treatment method involving both one or more KRAS RNAi agents and one or more agents (e.g., a RNAi agent, antibody or small molecule) which targets another factor which causes inappropriate activation of KRAS, such as in p210BCR-ABL, erbB, or NF1.
- Ras D Constitutively active Ras is one which contains mutations that prevent GTP hydrolysis, thus locking Ras in a permanently 'On' state.
- the glycine to valine mutation at residue 12 renders the GTPase domain of Ras insensitive to inactivation by GAP and thus stuck in the "on state". Ras requires a GAP for inactivation as it is a relatively poor catalyst on its own, as opposed to other G-domain-containing proteins such as the alpha subunit of heterotrimeric G proteins.
- Residue 61 is responsible for stabilizing the transition state for GTP hydrolysis.
- the present disclosure pertains to a method of treatment of a patient having or susceptible to a KRAS-related disease, wherein the KRAS is constitutively active.
- the sequence of KRAS gene has determined for various species, including Human (HGNC: 6407; NM_004985.3); Mouse (MGI:96680); and Rat (RGD:2981 ).
- a RNAi agent specific to KRAS can be designed such that the sequence thereof completely matches that of the mRNA corresponding to the human KRAS gene and the homologous gene from a test animal. This is advantageous when developing a therapeutic RNAi agent since the same RNAi agent can be used in both a test animal (e.g., rat, mouse, or cynomolgus monkey, etc.) and a human.
- KRAS cynomolgus sequence NNNNNNNNNNNN NNNNNNNNNN NNNNNNNNNNNN NNNNNNNNNNNN 60 NNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGCACTG 120 AAGGCGGCGG CGGGGCCAGA GGCTCAGCGG CTCCCCGGGG CGGGAGAGAG NNNNNNNN 180 NNNNNNNN NNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTTGG AGCTGGTGGG GTAGGCAAGA GTGCCTTGAC 240 NNNNGCTA ATTCAGAATC ATTTTGTGGA CGAATATGAT C CAAC AATAG AGGATTCCTA 300 CAGGAAGCAA GTAGTAATTG ATGGAGAAAC CTGTCTCTTG GATATTCTCG ACACAGCAGG 360 TCAAGAGGAG TACAGTGCAA TGAGGGACCA GT AC AT GAGG ACTGGGGAGG
- Cyno 1253 TCCCTGATGAATGTAAAGTTACACTGTTCACAAAGGTTTTGTTCCCTTTCCACTGCTATT 1312 Human 1313 AGTCATGGTCACTCTCCCCAAAATATTATATTTTTTCTATaaaaagaaaaaatggaaaA 1372
- Cyno 1433 TATAAAGACTCCTAATAGCTTTTCCTGTTAAGGCAGACCCAGTATGAAATGGGGATTNNN 1492 Human 1493 ATAGCAACCATTTTGGGGCTATATTTACATGCTACTAAATTTTTATAATAATTGAAAAGA 1552
- Cyno 2304 TTGAGGACATCACTTACTATCCATTTCTTCATGTTAANNNNNNNNNNNNNNNNNNNNN 2363 Human 2364 ttttttttttACAACTATGTAATTTATATTCCATTTACATAAGGATACACTTATTTGT 2423
- Cyno 2364 NNNNNNNTTTTTACAACTATGTGATTTATATTCCGTTTACATGAGGATACACTTATTTGT 2423 Human 2424 CAAGCTCAGCACAATCTGTAAATTTTTAACCTATGTTACACCATCTTCAGTGCCAGTCTT 2483
- Cyno 2844 TATGAATAGACAGAACCCTATCCAGTGGAAGGAGAATTTAATAAAGATAGTACTGAAATA 2903 Human 2904 ATTCCTTAGGTAATCTATAACTAGGACTACTCCTGGTAACAGTAATACATTCCATTGTTT 2963
- Cyno 3113 GCGATTCTCGTGCCTCGGCATCCTGAGTAGCTGGGATTACAGGCATGTGCCNCCACACTC 3172 Human 3173 AACTAATTTTTGTATTTTTAGGAGAGACGGGGTTTCACCCTGTTGGCCAGGCTGGTCTCG 3232
- Cyno 3233 AACTCCTGACCTCAAGTGATTCACCCACCTNNNCCTCATAAAGCCGTTTTGCAGAACTCA 3292 Human 3293 TTTATTCAGCAAATATTTATTGAGTGCCTACCAGATGCCAGTCACCGCACAAGGCACTGG 3352
- Cyno 4003 GGTANNTGGTAATTACCTTTATGTGAACTTTGAATGGTTTAACAAAAGATTTGTTTTTGT 4062 Human 4063 AGAGATTTTAAAGGGGGAGAATTCTAGAAATAAATGTTACCTAATTATTACAGCCTTAAA 4122
- Cyno 4063 AGAGATTTTAAAGGGGGAGAATGCTAGAAATAAATGTTATCTAANNNNNCGCCTTAAA 4122 Human 4123 GACAAAAATCCTTGTTGAAGtttttttaaaaaaGCTAAATTACATAGACTTAGGCATTA 4182
- Cyno 4303 TATAGGTTATCAAAACTGTTGCCTCCATTGCACAATTTTGTCCTAATACATACATGGAGA 4362
- the lowercase letters in the KRAS sequence are an NCBI convention for low- complexity sequences.
- the matching algorithm frequently excludes these when calculating match scores, as they tend to match against large numbers of things in the genome.
- the KRAS RNAi agent of the present disclosure comprises a sequence which is identical in the all three of human, rat and cyno KRAS mRNAs. This sequence identity across species facilitates animal testing prior to human testing, since the sequence of the RNAi does not need to be modified due to species-specific differences in the target sequence.
- the KRAS RNAi agent comprises a sequence which is identical in the human, mouse and cyno KRAS mRNAs.
- the KRAS RNAi agent comprises a sequence which is identical in human and mouse, human and rat, and/or human and cyno.
- the KRAS RNAi agent comprises a sequence which does not match that of any other mRNA or gene.
- the KRAS RNAi agent comprises a sequence which differs from all other known non-KRAS mRNAs or genes by at least 0, 1 , 2 or 3 nucleotides.
- An increase in the number of mismatches between the KRAS RNAi sequence and that of any other gene can decrease the amount of "off-target effects" or the RNAi agent targeting a non-target gene (e.g., a gene that is not KRAS).
- the KRAS RNAi agent of the present disclosure is administered to a patient in need thereof (e.g., a patient suffering from a KRAS-related disease).
- the patient can also be administered more than one RNAi agent specific to KRAS.
- the KRAS RNAi agent(s) of the present disclosure can optionally be administered along with one or more additional pharmaceutical agent appropriate for that disease.
- the KRAS RNAi agent(s) of the present disclosure can be optionally administered along with any other appropriate additional treatment, wherein the additional treatment can be a composition (e.g., another agent that can treat a KRAS-related disease such as a cancer treatment) or a method (e.g., surgery to remove a tumor if the KRAS-related disease is a cancer).
- the RNAi agent(s) and additional disease treatment(s) can be administered in any order, simultaneously, concurrently, separately, or sequentially, or in one or multiple doses over time. [00196] Additional Definitions
- articles such as “a” and “an” refer to one or more than one (at least one) of the grammatical object of the article.
- the present disclosure pertains to a KRAS RNAi agent or other composition comprising at least an antisense nucleic acid sequence complementary to a KRAS nucleic acid (or portion thereof), or pertains to a recombinant expression vector encoding an shRNA or composition comprising the antisense nucleic acid that can function as an RNAi as defined below.
- an "antisense" nucleic acid comprises a nucleotide sequence complementary to a "sense" nucleic acid encoding the KRAS protein (e.g., complementary to the coding strand of a double-stranded DNA, complementary to an mRNA or complementary to the coding strand of a KRAS gene or nucleic acid).
- RNAi agents include, as non-limiting examples, siRNAs (small interfering RNAs), dsRNAs (double stranded RNAs), shRNAs (short hairpin RNAs) and miRNAs (micro RNAs).
- the present disclosure pertains to any RNAi agent comprising a RNA sequence corresponding to any DNA sequences disclosed herein (e.g., wherein the DNA nucleotides are replaced by the corresponding RNA nucleotide, for example, with T in DNA replaced by U in RNA, and with ribose instead of deoxyribose in the sugar-phosphate backbone).
- the RNAi comprises a single strand.
- This single-stranded RNAi agent oligonucleotide or polynucleotide can comprise the sense or antisense strand, as described by Sioud 2005 J. Mol. Biol. 348:1079-1090, and references therein.
- the disclosure encompasses RNAi agents with a single strand comprising either the sense or antisense strand of an RNAi agent described herein.
- RNAi agents comprising a single strand, wherein the single strand comprises the sequences of both the antisense and sense strands of any RNAi agent disclosed herein, e.g., wherein the strands are contiguous, connected by a loop or otherwise linked.
- RNAi agents include those with a hairpin between the sense and anti-sense sequences (e.g., shRNA).
- the RNAi agent(s) of the present disclosure target (e.g., bind to, anneal to, hybridize, etc.) the KRAS mRNA.
- the use of the RNAi agent specific to KRAS results in a decrease of KRAS activity, level and/or expression, e.g., a "knock-down" (KD) or "knock-out" of the target gene or target sequence.
- KD knock-down
- administration of a RNAi agent to KRAS knocks down the KRAS target enough to provide a more normal or therapeutic level of KRAS activity or expression.
- the RNAi comprises a single strand (such as an shRNA, as described herein).
- one or both strands contain one or more nicks, i.e., a break or missing bond in the phosphate backbone, such that at least one nucleotide subunit is not covalently linked to the adjacent nucleotide subunit in any given sequence.
- the passenger strand is nicked (see, for example, WO 2007/107162).
- one or both strands contain one or more gaps, e.g., wherein at least one entire nucleotide subunit is absent from the disclosed sequence. Where a sense or antisense sequence contains a gap, that strand is envisioned to comprise two separate oligonucleotides.
- Particularly useful siRNAs include those which can bind specifically to those regions of the KRAS mRNA that have one or more of the following qualities: binding in the coding segment of KRAS; binding at or near the junction of the 5' untranslated region and the start of the coding segment; binding at or near the translational start site of the mRNA; binding at, across or near junctions of exons and introns; little or no binding to the mRNAs or transcripts of other genes (little or no "off-target effects"); binding to the KRAS mRNA in or near a region or regions that is not double-stranded or a stem region, e.g., those in a loop or single-stranded portion; eliciting little or no immunogenicity; binding in a segment of the KRAS mRNA sequence which is conserved among various animal species (including human, mouse, rat, cyno, etc.), as the presence of a conserved sequence facilitates testing using various laboratory animals; binding to double-strande
- double-stranded RNA refers to a RNAi agent comprising a first and a second strand; e.g., a composition that includes an RNA molecule or complex of molecules having a hybridized duplex region (i.e., a region where the nucleotide bases from the first strand and the second strand are paired) that comprises two anti-parallel and substantially complementary nucleic acid strands, which will be referred to as having "sense” and “antisense” orientations with respect to a target RNA.
- a hybridized duplex region i.e., a region where the nucleotide bases from the first strand and the second strand are paired
- the antisense strand with respect to the mRNA target, is also called the "guide” strand, and the sense strand is also called the “passenger” or “anti-guide” strand.
- the passenger strand can include at least one or more of the following: one or more extra nucleotides (e.g., a bulge or 1 nt loop) compared to the other strand, a nick, a gap, a mismatch, etc., compared to the other strand.
- the RNAi agent comprises a first strand and a second strand.
- first strand refers to the sense strand and the second strand refers to the anti-sense strand as listed in any Table herein.
- first strand refers to the anti-sense strand
- second strand refers to the sense strand as listed in any Table herein.
- the duplex region can be of any length that permits specific degradation of a desired target RNA through a RISC pathway, but will typically range from 9 to 36 base pairs ("bp") in length, e.g., 15-30 bp in length.
- the duplex can be any length in this range, for example, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, or 36 bp and any sub-range therebetween, including, but not limited to 15-30 bp, 15-26 bp, 15-23 bp, 15-22 bp, 15-21 bp, 15-20 bp, 15-19 bp, 15-18 bp, 15-17 bp, 18-30 bp, 18-26 bp, 18-23 bp, 18-22 bp, 18-21 bp, 18-20 bp, 19-30 bp, 19-26 bp, 19-23 bp, 19-22 bp, 19- 21 bp, 19-20 bp, 19 bp, 20-30 bp, 20-26 bp, 20-25 bp, 20-24 bp, 20-23 bp, 20
- the dsRNAs generated in the cell by processing with Dicer and similar enzymes are generally in the range of about 19 to about 22 bp in length.
- One strand of the duplex region of a dsRNA comprises a sequence that is substantially complementary to a region of a target RNA.
- the two strands forming the duplex structure can be from a single RNA molecule having at least one self-complementary duplex region, or can be formed from two or more separate RNA molecules that hybridize to form the duplex.
- the molecule can have a duplex region separated by a single-stranded chain of nucleotides (herein referred to as a "hairpin loop", e.g., such as found in an shRNA construct) between the 3'-end of one strand and the 5'-end of the respective other strand forming the duplex structure.
- the hairpin loop can comprise at least one unpaired nucleotide; in some embodiments the hairpin loop can comprise at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 23 or more unpaired nucleotides.
- dsRNA substantially complementary strands of a dsRNA
- those molecules need not, but can, be covalently connected.
- the construct is generally referred to herein and in the art as a "shRNA".
- the connecting structure is referred to as a "linker.”
- RNAi Agents to KRAS comprising mismatches from the disclosed sequences
- RNAi agent to KRAS Various specific embodiments of a RNAi agent to KRAS are disclosed herein; example sequences are provided in Tables 1 , 2 and 3. Specific embodiments of the present disclosure include RNAi agents which comprise sequences differing by 0, 1 , 2, or 3 nt (nucleotides) or bp [basepair(s)] (e.g., with 0, 1 , 2 or 3 mismatches) from any of the RNAi agents listed in Tables 1 to 6, and modified and unmodified variants thereof.
- a mismatch is defined herein as a difference between the base sequence or length when two sequences are maximally aligned and compared.
- a mismatch is defined as a position wherein the base of one sequence does not match the base of the other sequence.
- a mismatch is counted, for example, if a position in one sequence has a particular base (e.g., A), and the corresponding position on the other sequence has a different base (e.g., G).
- Substitution of A for example, with T, C, G or U would constitute a mismatch.
- substitution of G with T, A, C or U would also constitute a mismatch.
- C with T, G, A or U would also constitute a mismatch.
- RNAi agent can thus comprise one or more DNA bases, e.g., T.
- DNA can be used in place of RNA (e.g., in the seed region), to form a DNA-RNA hybrid. See, for example, Yamato et al. 201 1 cancer Gene Ther.
- a mismatch is also counted, e.g., if a position in one sequence has a base (e.g., A), and the corresponding position on the other sequence has no base (e.g., that position is an abasic nucleotide, which comprises a phosphate-sugar backbone but no base).
- a single-stranded nick in either sequence (or in the sense or anti-sense strand) is not counted as mismatch.
- no mismatch would be counted if one sequence comprises the sequence AG, but the other sequence comprises the sequence AG with a single-stranded nick between the A and the G.
- a nucleotide modification in the sugar or phosphate is also not considered a mismatch.
- one sequence comprises a C
- the other sequence comprises a modified C (e.g., 2'-modification) at the same position, no mismatch would be counted.
- GGACGAAUAUGAUCCAACA SEQ ID NO: 1
- PNA peptide nucleic acid
- sequences of the RNAi agents in Tables 1 to 6 include sequences which comprise modifications, as detailed in Table 3. It is noted that dTdT (2'-deoxy- thymidine-5'-phosphate and 2'-deoxy-thymidine-5'-phosphate), or in some cases, TT or UU, is added as a cap or extension to both 3'-ends, but this cap or extension is not included in the calculation of the total number of mismatches. In addition, in Table 3, a modified sequence can comprise one or more modifications from the corresponding unmodified sequence.
- lowercase “c” represents 2'-0-methylcytidine-5'-phosphate
- lowercase “u” represents 2'-0- methyluridine-5'-phosphate
- Uppercase “A”, “C”, “G” and “U” represent the un-modified adenosine- 5'-phosphate, cytidine-5'-phosphate, guanosine-5'-phosphate, and uridine-5'-phosphate, respectively.
- the substitution of modified c for unmodified C does not count as a mismatch in numbering the 0, 1 , 2, or 3 mismatches between sequences. This nomenclature is used for all sequences in Tables 1 to 6.
- an equal number of mismatches would be calculated (a) between a test sequence and a modified sequence, and (b) between the same test sequence and the corresponding unmodified sequence from the KRAS gene, and (c) between a modified sequence and a differently modified sequence which have the same base sequence.
- the present disclosure comprises a RNAi agent comprising a anti-sense strand comprising at least 15 to 19 contiguous nucleotides differing by 0, 1 , 2, or 3 nt from the sequence of the anti-sense strand of: any of the RNAi agents listed in Tables 1 to 6, and modified and unmodified variants thereof.
- the present disclosure pertains to "modified and unmodified variants" of the disclosed sequences.
- An "unmodified variant" of a particular sequence is the corresponding portion of KRAS without any modifications.
- Example modified sequences are listed in Tables 1 , 2 and 3.
- the "unmodified variants" of the sequences of Tables 1 to 6 have the identical sequence, without base modifications or terminal dTdT.
- a given sequence and an "unmodified variant” of it differ by 0 nt (and have no mismatches).
- a "modified variant" of a particular sequence comprises one or more (or one or more fewer) modifications to the backbone, sugar, phosphate or base, but do not have any base substitutions (e.g., G for C, or A for G); thus a given sequence and a modified variant thereof differ by 0 nt (and have no mismatches).
- a given sequence as a RNA and the same sequence as a PNA are modified variants of each other and differ by 0 nt (and have no mismatches).
- LNA locked nucleic acid
- TAA threose nucleic acid
- GNA glycol nucleic acid
- the RNAi agent comprises a sense strand comprising at least 15 contiguous nucleotides differing by 0, 1 , 2, or 3 nt from the sense strand of any of the RNAi agents listed in Tables 1 to 6and modified and unmodified variants thereof.
- RNAi agents to KRAS of the present disclosure can be used in RNA interference.
- the present disclosure encompasses both unmodified sequences and example modified sequences, such as those disclosed in Tables 1 , 2 and 3.
- the present disclosure further encompasses any other modification of a disclosed sequence (e.g., a modified variant).
- the disclosure encompasses a RNAi agent with a substitution of a single nucleotide at a given position with a modified version of the same nucleotide.
- a nucleotide (A, G, C or U) can be replaced by the corresponding 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5- iodouracil, hypoxanthine, xantine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5- carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D- galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2- dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6- adenine, 7
- Additional modified variants include the addition of any other moiety (e.g., a radiolabel or other tag or conjugate) to the RNAi agent; provided that the base sequence is identical, the addition of other moieties produces a "modified variant" (with no mismatches).
- any other moiety e.g., a radiolabel or other tag or conjugate
- RNA interference is a post-transcriptional, targeted gene-silencing technique that uses double-stranded RNA (dsRNA) to degrade messenger RNA (mRNA) containing the same sequence as the dsRNA.
- dsRNA double-stranded RNA
- mRNA messenger RNA
- RNAi ribonuclease III
- Dicer ribonuclease III
- siRNAs small interfering RNAs
- Dicer are typically about 21 to 23 nucleotides long and comprise about 19 base pair duplexes (though artificial siRNAs or RNAi agents can be shorter or longer, and/or blunt-ended, and/or comprises one or more endcaps).
- RNA-induced silencing complex RISC
- an RNA interference agent includes a single-stranded RNA that interacts with a target RNA sequence to direct the cleavage of the target RNA.
- a target RNA sequence to direct the cleavage of the target RNA.
- Dicer Type III endonuclease known as Dicer. Sharp et al. 2001 Genes Dev. 15:485.
- Dicer a ribonuclease-lll-like enzyme, processes the dsRNA into 19- 23 base pair short interfering RNAs with characteristic two base 3' overhangs. Bernstein, et al. 2001 Nature 409:363.
- RNA-induced silencing complex RISC
- one or more helicases unwind the siRNA duplex, enabling one of the now unpaired siRNA strands to act as a "guide" strand to guide target recognition.
- Nykanen et al. 2001 Cell 107:309.
- one or more endonucleases within the RISC cleaves the target to induce silencing.
- the present disclosure relates to a single-stranded RNA that promotes the formation of a RISC complex to effect silencing of the target gene.
- Kits for RNAi synthesis are commercially available, e.g., from New England Biolabs and Ambion.
- the RNAi agent(s) of the present disclosure target (e.g., bind to, anneal to, etc.) the KRAS imRNA.
- the use of the RNAi agent to KRAS results in a decrease of KRAS activity, level and/or expression, e.g., a "knock-down" or "knock-out" of the target gene or target sequence.
- administration of a RNAi agent to KRAS knocks down the KRAS target enough to restore a normal level of KRAS activity.
- RNAi agent can be selected by any process known in the art or conceivable by one of ordinary skill in the art.
- the selection criteria can include one or more of the following steps: initial analysis of the KRAS gene sequence and design of RNAi agents; this design can take into consideration sequence similarity across species (human, cynomolgus, mouse, etc.) and dissimilarity to other (non-KRAS) genes; screening of RNAi agents in vitro (e.g., at 10 nM in RKO cells); determination of EC50 in RKO cells; determination of viability of cells treated with RNAi agents, including insensitive cells which do not require KRAS for survival, or sensitive cells, which do require KRAS for survival; testing with human PBMC (peripheral blood mononuclear cells), e.g., to test levels of TNF-alpha to estimate immunogenicity, wherein immunostimulatory sequences are less desired; testing in human whole blood assay, wherein fresh human blood is treated with an
- RNAi agents RNAi agents described herein are thus useful in RNA interference of KRAS.
- RNAi Agent Sense strand, Antisense Strand and (Optional) Overhangs
- the RNAi agents comprise a first strand and a second strand, e.g., a sense strand and an antisense strand (or an antisense and a sense strand) and, optionally, one or both ends of the duplex containing unpaired nucleotides referred to herein as overhangs.
- antisense strand refers to the strand of a RNAi agent which includes a region that is substantially complementary to a target sequence.
- region of complementarity refers to the region on the antisense strand that is substantially complementary to a sequence, for example a target sequence, as defined herein.
- the mismatches may be in the internal or terminal regions of the molecule. Generally, the most tolerated mismatches are in the terminal regions, e.g., within 5, 4, 3, or 2 nucleotides of the 5' and/or 3' terminus.
- sense strand refers to the strand of a RNAi agent that includes a region that is substantially complementary to a region of the antisense strand as that term is defined herein.
- sequence of a gene may vary from individual to individual, especially at wobble positions within the coding segment, or in the untranslated region; individuals may also differ from each other in coding sequence, resulting in additional differences in mRNA.
- the sequence of the sense and antisense strands of the RNAi agent can thus be designed to correspond to that of an individual patient, if and where needed.
- RNAi agents can also be modified in sequence to reduce immunogenicity, binding to undesired mRNAs (e.g., "off-target effects") or to increase stability in the blood. These sequence variants are independent of chemical modification of the bases or 5' or 3' or other end-caps of the RNAi agents.
- RNAi agents can also have overhangs of 0, 1 , or 2 overhangs; in the case of a 0 nt overhang, they are blunt-ended.
- a RNAi agent can have 0, 1 or 2 blunt ends.
- blunt-ended RNAi agent both strands terminate in a base-pair; thus a blunt-ended molecule lacks either 3' or 5' single-stranded nucleotide overhangs.
- RNAi agents can comprise overhang(s), blunt end(s), and/or 5' and 3' endcap(s).
- the term "overhang” or “nucleotide overhang” refer to at least one unpaired nucleotide that protrudes from the end of at least one of the two strands of the duplex structure of a RNAi agent. For example, when a 3'-end of one strand of a dsRNA extends beyond the 5'-end of the other strand, or vice versa, the unpaired nucleotide(s) form the overhang.
- a dsRNA can comprise an overhang of at least one nucleotide; alternatively the overhang can comprise at least two nucleotides, at least three nucleotides, at least four nucleotides, at least five nucleotides or more.
- An overhang can comprise or consist of a nucleotide/nucleoside analog, including a deoxynucleotide/nucleoside.
- the overhang(s) may be on the sense strand, the antisense strand or any combination thereof.
- the nucleotide(s) of an overhang can be present on the 5' end, 3' end or both ends of either an antisense or sense strand of a dsRNA.
- the RNAi agent can also optionally comprise a cap.
- Cap and the like include a chemical moiety attached to the end of a double-stranded nucleotide duplex, but is used herein to exclude a chemical moiety that is a nucleotide or nucleoside.
- a "3' Cap” is attached at the 3' end of a nucleotide or oligonucleotide and protects the molecule from degradation, e.g., from nucleases, such as those in blood serum or intestinal fluid.
- a 3' cap can replace a TT or UU dinucleotide at the end of a blunt-ended RNAi agent.
- 3' end caps are as disclosed in, for example, WO 2005/021749 and WO 2007/128477.
- a "5' cap” is attached at the 5' end of a nucleotide or oligonucleotide. A cap should not interfere (or unduly interfere) with RNAi activity.
- RNAi agent specific to KRAS comprising an antisense strand (which may be contiguous or connected via a linker or loop) in a RNAi agent.
- an RNAi agent comprises an antisense strand and a sense strand which together comprise a double-stranded or complementary region. In one embodiment, it can also optionally comprise one or two overhangs and/or one or two caps.
- the RNAi agent is used to induce RNA interference of the target gene, KRAS.
- RNAi agents of the present disclosure target (e.g., specifically bind to, anneal to, etc.) the imRNA encoding the gene KRAS.
- the use of the RNAi agent specific to KRAS results in a decrease of KRAS activity, level and/or expression, e.g., a "knock-down" or "knock-out” of the target gene or target sequence.
- administration of a RNAi agent to KRAS knocks down the KRAS gene enough to restore a normal level of KRAS activity or expression.
- the first or second strand of the RNAi comprises a sequence complementary to that of the target nucleic acid, KRAS.
- strand comprising a sequence refers to an oligonucleotide comprising a chain of nucleotides that is described by the sequence referred to using the standard nucleotide nomenclature.
- target sequence or "target gene” refer to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of a gene, e.g., a KRAS gene, including mRNA that is a product of RNA processing of a primary transcription product.
- the target portion of the sequence will be at least long enough to serve as a substrate for iRNA-directed cleavage at or near that portion.
- the target sequence will generally be from 9-36 nucleotides (“nt”) in length, e.g., 15-30 nt in length, including all sub-ranges therebetween.
- the target sequence can be from 15-30 nt, 15-26 nt, 15-23 nt, 15-22 nt, 15-21 nt, 15-20 nt, 15-19 nt, 15-18 nt, 15-17 nt, 18-30 nt, 18-26 nt, 18-23 nt, 18-22 nt, 18-21 nt, 18-20 nt, 19- 30 nt, 19-26 nt, 19-23 nt, 19-22 nt, 19-21 nt, 19-20 nt, 19 nt, 20-30 nt, 20-26 nt, 20-25 nt, 20-24 nt, 20-23 nt, 20-22 nt, 20-21 nt, 20 nt, 21-30 nt, 21 -26 nt, 21-25 nt, 21-24 nt, 21 -23 nt, or 21-22 nt, 21 nt, 22 nt, or 23 nt,
- the term “complementary” refers to the ability of an oligonucleotide or polynucleotide comprising a first nucleotide sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide comprising a second nucleotide sequence.
- Such conditions can, for example, be stringent, e.g., 400 mM NaCI, 40 mM PIPES pH 6.4, 1 mM EDTA, 50°C or 70°C for 12-16 hours followed by washing.
- Other conditions such as physiologically relevant conditions as may be encountered inside an organism, can apply. The skilled person will be able to determine the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the hybridized nucleotides.
- RNAi agent e.g., within a dsRNA as described herein
- oligonucleotides or polynucleotides comprising a first nucleotide sequence to an oligonucleotide or polynucleotide comprising a second nucleotide sequence over the entire length of one or both nucleotide sequences.
- sequences can be referred to as "fully complementary” with respect to each other herein.
- first sequence is referred to as “substantially complementary” with respect to a second sequence herein
- the two sequences can be fully complementary, or they may form one or more, but generally not more than 5, 4, 3 or 2 mismatched base pairs upon hybridization for a duplex up to 30 base pairs, while retaining the ability to hybridize under the conditions most relevant to their ultimate application, e.g., inhibition of gene expression via a RISC pathway.
- two oligonucleotides are designed to form, upon hybridization, one or more single-stranded overhangs, such overhangs shall not be regarded as mismatches with regard to the determination of complementarity.
- a dsRNA comprising one oligonucleotide 21 nucleotides in length and another oligonucleotide 23 nucleotides in length, wherein the longer oligonucleotide comprises a sequence of 21 nucleotides that is fully complementary to the shorter oligonucleotide, may yet be referred to as "fully complementary” for the purposes described herein.
- the term "overhang” describes an unpaired nucleotide at the 3' or 5' end of a double-stranded nucleotide duplex, as described above. In one embodiment, the overhang is 1 to 4 nt long and is on the 3' end.
- “Complementary” sequences may also include, or be formed entirely from, non-Watson-Crick base pairs and/or base pairs formed from non-natural and modified nucleotides, in as far as the above requirements with respect to their ability to hybridize are fulfilled.
- non-Watson-Crick base pairs includes, but are not limited to, Wobble or Hoogstein base pairing.
- a polynucleotide that is “substantially complementary to at least part of” a messenger RNA (mRNA) refers to a polynucleotide that is substantially complementary to a contiguous portion of the mRNA of interest (e.g., an mRNA encoding KRAS).
- mRNA messenger RNA
- a polynucleotide is complementary to at least a part of a KRAS mRNA if the sequence is substantially complementary to a non-interrupted portion of an mRNA encoding KRAS.
- the RNAi agent of the present disclosure is complimentary or substantially complimentary to a target sequence in the target KRAS and is double-stranded, comprising a sense and an antisense strand (which can be contiguous, linked via a loop, or otherwise joined), where the double-stranded region an be 9 to 36 bp long (particularly for example, 19-22 bp or 19-23 bp long), and can furthermore optionally comprise a 3' or 5' overhang, and the RNAi agent can furthermore comprise a 3' cap.
- RNAi agent mediates RNA interference, down-regulating or inhibiting the level, expression and/or activity of KRAS, and/or establishing or re-establishing an approximately normal level of KRAS and/or KRAS activity, or other biological function related to KRAS.
- the RNAi agent of the present disclosure is complimentary or substantially complimentary to a target sequence in the target KRAS and is double-stranded, comprising a sense and an antisense strand (which can be contiguous, linked via a loop, or otherwise joined), where the double-stranded region an be 9 to 36 bp long (particularly for example, 19-22 bp or 19-23 bp long), and can furthermore optionally comprise a 3' or 5' overhang, and the RNAi agent can furthermore comprise a 3' cap.
- the RNAi agent mediates RNA interference, down-regulating or inhibiting the level, expression and/or activity of KRAS, and/or establishing or re-establishing an approximately normal level of KRAS activity or expression.
- double-stranded RNA refers to an RNAi agent comprising a first and a second strand; e.g., a composition that includes an RNA molecule or complex of molecules having a hybridized duplex region that comprises two anti-parallel and substantially complementary nucleic acid strands, which will be referred to as having "sense” and “antisense” orientations with respect to a target RNA.
- the antisense strand, with respect to the mRNA target is also called the “guide” strand, and the sense strand is also called the “passenger” strand.
- the "first" strand can be the guide or antisense strand
- the "second” strand can be the passenger or sense strand
- the "first” strand can be the passenger or sense strand
- the "second” strand can be the guide or antisense.
- the passenger strand can include at least one or more of the following: one or more extra nucleotides (e.g., a bulge or 1 nt loop) compared to the other strand, a nick, a gap, etc., compared to the other strand.
- the first strand is the sense strand and the second strand is the anti-sense strand.
- the first strand is the anti-sense strand
- the second strand is the sense strand.
- the duplex region can be of any length that permits loading into the RISC complex and subsequent specific degradation of a desired target RNA through a RISC pathway, but will typically range from 9 to 36 base pairs ("bp") in length, e.g., 15-30 base pairs in length.
- the duplex can be any length in this range, for example, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, or 36 bp and any sub-range therebetween, including, but not limited to 15-30 base pairs, 15-26 bp, 15-23 bp, 15- 22 bp, 15-21 bp, 15-20 bp, 15-19 bp, 15-18 bp, 15-17 bp, 18-30 bp, 18-26 bp, 18-23 bp, 18-22 bp, 18-21 bp, 18-20 bp, 19-30 bp, 19-26 bp, 19-23 bp, 19-22 bp, 19-21 bp, 19-20 bp, 19 bp, 20-30 bp,
- the dsRNAs generated in the cell by processing with Dicer and similar enzymes are generally in the range of about 19 to about 22 base pairs in length, although artificial RNAi agents can be synethesized or made by any method known in the art.
- One strand of the duplex region of a dsRNA comprises a sequence that is substantially complementary to a region of a target RNA.
- the two strands forming the duplex structure can be from a single RNA molecule having at least one self-complementary duplex region, or can be formed from two or more separate RNA molecules that hybridize to form the duplex.
- the molecule can have a duplex region separated by a single stranded chain of nucleotides (herein referred to as a "hairpin loop", e.g., such as found in an shRNA construct) between the 3'-end of one strand and the 5'-end of the respective other strand forming the duplex structure.
- the hairpin loop can comprise at least one unpaired nucleotide; in some embodiments the hairpin loop can comprise at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 23 or more unpaired nucleotides.
- RNA molecules where the two substantially complementary strands of a dsRNA are comprised by separate RNA molecules, those molecules need not, but can be covalently connected.
- the construct is generally referred to herein and in the art as a "shRNA".
- the connecting structure is referred to as a "linker.”
- siRNA is also used herein to refer to a dsRNA as described above.
- RNAi agents for targeting KRAS include those which bind to a KRAS sequence provided herein and which work to reduce KRAS through a RNAi mechanism.
- Example RNAi agents (e.g., siRNAs) to KRAS are provided, e.g., in Table 1.
- Any method known in the art can be use to measure changes in KRAS activity, level, and/or expression induced by a KRAS RNAi agent. Measurements can be performed at multiple timepoints, prior to, during and after administration of the RNAi agent, to determine the effect of the RNAi agent.
- RNAi agents of the present disclosure silence, inhibit the expression of, down- regulate the expression of, and/or suppress the expression of KRAS, such that an approximately normal level of KRAS activity or expression is restored.
- RNAi agents of the present disclosure it is acceptable to use to establish a level of KRAS expression, activity and/or level which is below the normal level, or above the normal level, depending on the therapeutic outcome that is desired.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Medicinal Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Epidemiology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Oncology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Hematology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicinal Preparation (AREA)
- Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
Priority Applications (14)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA2872304A CA2872304C (en) | 2012-05-02 | 2013-04-30 | Organic compositions to treat kras-related diseases |
| JP2015510380A JP2015517466A (ja) | 2012-05-02 | 2013-04-30 | Kras関連疾患を処置するための有機組成物 |
| KR1020147033421A KR20150004414A (ko) | 2012-05-02 | 2013-04-30 | Kras-관련 질환을 치료하기 위한 유기 조성물 |
| BR112014027337A BR112014027337A2 (pt) | 2012-05-02 | 2013-04-30 | composições orgânicas para tratar doenças relacionadas com kras |
| CN201380035099.2A CN104583406A (zh) | 2012-05-02 | 2013-04-30 | 治疗kras相关疾病的有机组合物 |
| EP20178501.1A EP3736333A1 (en) | 2012-05-02 | 2013-04-30 | Organic compositions to treat kras-related diseases |
| MX2014013367A MX2014013367A (es) | 2012-05-02 | 2013-04-30 | Composiciones organicas para tratar enfermedades relacionadas con kras. |
| HK15106884.9A HK1206387A1 (en) | 2012-05-02 | 2013-04-30 | Organic compositions to treat kras-related diseases |
| AU2013256471A AU2013256471A1 (en) | 2012-05-02 | 2013-04-30 | Organic compositions to treat KRAS-related diseases |
| EP13721578.6A EP2844757A2 (en) | 2012-05-02 | 2013-04-30 | Organic compositions to treat kras-related diseases |
| US14/397,815 US20150238515A1 (en) | 2012-05-02 | 2013-04-30 | Organic compositions to treat kras-related diseases |
| EA201492004A EA201492004A1 (ru) | 2012-05-02 | 2013-04-30 | Органические композиции для лечения kras-ассоциированных заболеваний |
| US15/258,042 US20180153919A1 (en) | 2012-05-02 | 2016-09-07 | Organic compositions to treat kras-related diseases |
| US18/954,771 US20260069625A1 (en) | 2012-05-02 | 2024-11-21 | Organic compositions to treat kras-related diseases |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201261641588P | 2012-05-02 | 2012-05-02 | |
| US61/641,588 | 2012-05-02 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US14/397,815 A-371-Of-International US20150238515A1 (en) | 2012-05-02 | 2013-04-30 | Organic compositions to treat kras-related diseases |
| US15/258,042 Division US20180153919A1 (en) | 2012-05-02 | 2016-09-07 | Organic compositions to treat kras-related diseases |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2013166004A2 true WO2013166004A2 (en) | 2013-11-07 |
| WO2013166004A3 WO2013166004A3 (en) | 2014-01-03 |
Family
ID=48366565
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2013/038847 Ceased WO2013166004A2 (en) | 2012-05-02 | 2013-04-30 | Organic compositions to treat kras-related diseases |
Country Status (12)
| Country | Link |
|---|---|
| US (3) | US20150238515A1 (cg-RX-API-DMAC7.html) |
| EP (3) | EP2844757A2 (cg-RX-API-DMAC7.html) |
| JP (1) | JP2015517466A (cg-RX-API-DMAC7.html) |
| KR (1) | KR20150004414A (cg-RX-API-DMAC7.html) |
| CN (2) | CN109481455A (cg-RX-API-DMAC7.html) |
| AU (5) | AU2013256471A1 (cg-RX-API-DMAC7.html) |
| BR (1) | BR112014027337A2 (cg-RX-API-DMAC7.html) |
| CA (2) | CA2872304C (cg-RX-API-DMAC7.html) |
| EA (1) | EA201492004A1 (cg-RX-API-DMAC7.html) |
| HK (1) | HK1206387A1 (cg-RX-API-DMAC7.html) |
| MX (1) | MX2014013367A (cg-RX-API-DMAC7.html) |
| WO (1) | WO2013166004A2 (cg-RX-API-DMAC7.html) |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20170016001A1 (en) * | 2014-03-14 | 2017-01-19 | Boston Biomedical, Inc. | Asymmetric interfering rna compositions that silence k-ras and methods of uses thereof |
| EP3436585A4 (en) * | 2016-04-01 | 2019-11-13 | Avidity Biosciences LLC | KRAS NUCLEIC ACIDS AND USES THEREOF |
| US10487149B2 (en) | 2016-04-01 | 2019-11-26 | Avidity Biosciences, Inc. | Nucleic acid-polypeptide compositions and uses thereof |
| US10881743B2 (en) | 2017-12-06 | 2021-01-05 | Avidity Biosciences, Inc. | Compositions and methods of treating muscle atrophy and myotonic dystrophy |
| US20220275374A1 (en) * | 2019-11-14 | 2022-09-01 | The Board Of Regents Of The University Of Oklahoma | Oligonucleotide interference treatments of prostate cancer |
| US11525137B2 (en) | 2020-03-19 | 2022-12-13 | Avidity Biosciences, Inc. | Compositions and methods of treating Facioscapulohumeral muscular dystrophy |
| US11912779B2 (en) | 2021-09-16 | 2024-02-27 | Avidity Biosciences, Inc. | Compositions and methods of treating facioscapulohumeral muscular dystrophy |
| WO2024176153A1 (en) * | 2023-02-22 | 2024-08-29 | Auris Medical Ag | Compositions and methods for kras inhibition for the treatment of disease |
| EP4395901A4 (en) * | 2021-09-02 | 2025-10-01 | Molecular Axiom Llc | COMPOSITIONS AND METHODS FOR MODULATING KRAS EXPRESSION |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR102589295B1 (ko) | 2014-05-14 | 2023-10-13 | 타르그이뮨 테라퓨틱스 아게 | 개선된 폴리에틸렌이민 폴리에틸렌글리콜 벡터 |
| US11180759B2 (en) * | 2016-01-19 | 2021-11-23 | The University Of North Carolina At Chapel Hill | Methods and compositions using RNA interference and antisense oligonucleotides for inhibition of KRAS |
| KR102543645B1 (ko) * | 2016-07-20 | 2023-06-16 | 주식회사 지씨지놈 | 유전성 발달장애 진단용 조성물 및 이의 용도 |
| EP3993806A4 (en) * | 2019-06-05 | 2023-09-13 | Southern Research Institute | Thiarabine- and thiarabine prodrug-based treatments |
| JP7839554B2 (ja) * | 2020-04-07 | 2026-04-02 | ザ・ユニヴァーシティ・オヴ・ノース・キャロライナ・アト・チャペル・ヒル | Krasの阻害のためのrna干渉およびアンチセンスオリゴヌクレオチドを使用する方法および組成物 |
| EP4652279A2 (en) * | 2023-01-18 | 2025-11-26 | Molecular Axiom, LLC | Compositions for modulating kras expression and uses thereof |
| WO2026026715A1 (zh) * | 2024-07-31 | 2026-02-05 | 前沿生物药业(南京)股份有限公司 | 一种用于抑制KRAS基因表达的siRNA及其修饰物与应用 |
Citations (22)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5030453A (en) | 1983-03-24 | 1991-07-09 | The Liposome Company, Inc. | Stable plurilamellar vesicles |
| US5962016A (en) | 1997-01-31 | 1999-10-05 | Depotech Corporation | Multivesicular liposomes utilizing neutral lipids to modify in vivo release |
| CA2359180A1 (en) | 1999-01-30 | 2000-08-03 | Roland Kreutzer | Method and medicament for inhibiting the expression of a given gene |
| WO2000044914A1 (en) | 1999-01-28 | 2000-08-03 | Medical College Of Georgia Research Institute, Inc. | Composition and method for in vivo and in vitro attenuation of gene expression using double stranded rna |
| WO2001068836A2 (en) | 2000-03-16 | 2001-09-20 | Genetica, Inc. | Methods and compositions for rna interference |
| WO2002100435A1 (en) | 2001-06-11 | 2002-12-19 | Centre Hospitalier Universitaire De Montreal | Compositions and methods for enhancing nucleic acid transfer into cells |
| US20030012812A1 (en) | 1996-10-04 | 2003-01-16 | Mar Tormo | Inhibition of bcl-2 protein expression by liposomal antisense oligodeoxynucleotides |
| WO2003015757A1 (en) | 2001-08-16 | 2003-02-27 | The Trustees Of The University Of Pennsylvania | Synthesis and use of reagents for improved dna lipofection and/or slow release prodrug and drug therapies |
| WO2004002453A1 (en) | 2002-06-28 | 2004-01-08 | Protiva Biotherapeutics Ltd. | Method and apparatus for producing liposomes |
| US6680068B2 (en) | 2000-07-06 | 2004-01-20 | The General Hospital Corporation | Drug delivery formulations and targeting |
| WO2004029213A2 (en) | 2002-09-28 | 2004-04-08 | Massachusetts Institute Of Technology | Compositions and methods for delivery of short interfering rna and short hairpin rna |
| US20040204377A1 (en) | 2002-11-26 | 2004-10-14 | University Of Massachusetts | Delivery of siRNAs |
| US20040208921A1 (en) | 2003-01-14 | 2004-10-21 | Ho Rodney J. Y. | Lipid-drug formulations and methods for targeted delivery of lipid-drug complexes to lymphoid tissues |
| WO2005021749A1 (en) | 2003-08-28 | 2005-03-10 | Novartis Ag | Interfering rna duplex having blunt-ends and 3’-modifications |
| US20060240093A1 (en) | 2003-07-16 | 2006-10-26 | Protiva Biotherapeutics, Inc. | Lipid encapsulated interfering rna |
| US20070135372A1 (en) | 2005-11-02 | 2007-06-14 | Protiva Biotherapeutics, Inc. | Modified siRNA molecules and uses thereof |
| WO2007107162A2 (en) | 2006-03-23 | 2007-09-27 | Santaris Pharma A/S | Small internally segmented interfering rna |
| WO2007128477A2 (en) | 2006-05-04 | 2007-11-15 | Novartis Ag | SHORT INTERFERING RIBONUCLEIC ACID (siRNA) FOR ORAL ADMINISTRATION |
| WO2008147824A2 (en) | 2007-05-22 | 2008-12-04 | Mdrna, Inc. | Hydroxymethyl substituted rna oligonucleotides and rna complexes |
| WO2009082817A1 (en) | 2007-12-27 | 2009-07-09 | Protiva Biotherapeutics, Inc. | Silencing of polo-like kinase expression using interfering rna |
| US20090209626A1 (en) | 2008-02-11 | 2009-08-20 | Dharmacon, Inc. | Duplex Oligonucleotides with Enhanced Functionality in Gene Regulation |
| WO2011076807A2 (en) | 2009-12-23 | 2011-06-30 | Novartis Ag | Lipids, lipid compositions, and methods of using them |
Family Cites Families (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2003295600A1 (en) * | 2002-11-14 | 2004-06-15 | Dharmacon, Inc. | Functional and hyperfunctional sirna |
| WO2005044981A2 (en) * | 2003-10-23 | 2005-05-19 | Sirna Therapeutics, Inc. | Rna interference mediated inhibition of gene expression using short interfering nucleic acid (sina) |
| EP1714970A1 (en) * | 2005-04-22 | 2006-10-25 | Universität des Saarlandes | Use of inhibitors of RNAse A-family enzymes for stabilizing oligonucleotides having RNA interfering activity |
| AU2007299705B2 (en) * | 2006-09-22 | 2012-09-06 | Dharmacon, Inc. | Duplex oligonucleotide complexes and methods for gene silencing by RNA interference |
| EP2121925A2 (en) * | 2007-03-02 | 2009-11-25 | MDRNA, Inc. | Nucleic acid compounds for inhibiting ras gene expression and uses thereof |
| JP2010538678A (ja) * | 2007-09-18 | 2010-12-16 | イントラドイグム コーポレーション | K−rassiRNA含有組成物及びそれらの使用法 |
| WO2009062199A1 (en) * | 2007-11-09 | 2009-05-14 | Fox Chase Cancer Center | EGFR/NEDD9/TGF-β LNTERACTOME AND METHODS OF USE THEREOF FOR THE IDENTIFICATION OF AGENTS HAVING EFFICACY IN THE TREATMENT OF HYPERPROLIFERATIVE DISORDERS |
| US20110218334A1 (en) * | 2008-07-11 | 2011-09-08 | Alnylam Pharmaceuticals, Inc. | PHOSPHOROTHIOATE OLIGONUCLEOTIDES AND NON-NUCLEOSIDIC PHOSPHOROTHIOATES AS DELIVERY AGENTS FOR iRNA AGENTS |
| WO2010115202A2 (en) * | 2009-04-03 | 2010-10-07 | Dicerna Pharmaceuticals, Inc. | Methods and compositions for the specific inhibition of kras by blunt ended double-stranded rna |
| CN103555722B (zh) * | 2009-04-03 | 2016-08-31 | 戴瑟纳制药公司 | 利用不对称双链rna特异性抑制kras的方法和组合物 |
| WO2011110671A2 (en) * | 2010-03-12 | 2011-09-15 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | Pharmaceutical composition for the treatment of chlamydial infection |
-
2013
- 2013-04-30 EA EA201492004A patent/EA201492004A1/ru unknown
- 2013-04-30 CN CN201811456141.9A patent/CN109481455A/zh active Pending
- 2013-04-30 EP EP13721578.6A patent/EP2844757A2/en not_active Withdrawn
- 2013-04-30 BR BR112014027337A patent/BR112014027337A2/pt not_active IP Right Cessation
- 2013-04-30 CA CA2872304A patent/CA2872304C/en active Active
- 2013-04-30 MX MX2014013367A patent/MX2014013367A/es unknown
- 2013-04-30 KR KR1020147033421A patent/KR20150004414A/ko not_active Withdrawn
- 2013-04-30 AU AU2013256471A patent/AU2013256471A1/en not_active Abandoned
- 2013-04-30 JP JP2015510380A patent/JP2015517466A/ja active Pending
- 2013-04-30 EP EP20178501.1A patent/EP3736333A1/en active Pending
- 2013-04-30 EP EP17187348.2A patent/EP3272868A1/en not_active Ceased
- 2013-04-30 WO PCT/US2013/038847 patent/WO2013166004A2/en not_active Ceased
- 2013-04-30 CN CN201380035099.2A patent/CN104583406A/zh active Pending
- 2013-04-30 US US14/397,815 patent/US20150238515A1/en not_active Abandoned
- 2013-04-30 CA CA3173610A patent/CA3173610A1/en active Pending
- 2013-04-30 HK HK15106884.9A patent/HK1206387A1/xx unknown
-
2016
- 2016-07-11 AU AU2016204832A patent/AU2016204832A1/en not_active Abandoned
- 2016-09-07 US US15/258,042 patent/US20180153919A1/en not_active Abandoned
-
2017
- 2017-11-14 AU AU2017261481A patent/AU2017261481A1/en not_active Abandoned
-
2020
- 2020-01-14 AU AU2020200247A patent/AU2020200247A1/en not_active Abandoned
-
2022
- 2022-05-04 AU AU2022202991A patent/AU2022202991A1/en not_active Abandoned
-
2024
- 2024-11-21 US US18/954,771 patent/US20260069625A1/en active Pending
Patent Citations (22)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5030453A (en) | 1983-03-24 | 1991-07-09 | The Liposome Company, Inc. | Stable plurilamellar vesicles |
| US20030012812A1 (en) | 1996-10-04 | 2003-01-16 | Mar Tormo | Inhibition of bcl-2 protein expression by liposomal antisense oligodeoxynucleotides |
| US5962016A (en) | 1997-01-31 | 1999-10-05 | Depotech Corporation | Multivesicular liposomes utilizing neutral lipids to modify in vivo release |
| WO2000044914A1 (en) | 1999-01-28 | 2000-08-03 | Medical College Of Georgia Research Institute, Inc. | Composition and method for in vivo and in vitro attenuation of gene expression using double stranded rna |
| CA2359180A1 (en) | 1999-01-30 | 2000-08-03 | Roland Kreutzer | Method and medicament for inhibiting the expression of a given gene |
| WO2001068836A2 (en) | 2000-03-16 | 2001-09-20 | Genetica, Inc. | Methods and compositions for rna interference |
| US6680068B2 (en) | 2000-07-06 | 2004-01-20 | The General Hospital Corporation | Drug delivery formulations and targeting |
| WO2002100435A1 (en) | 2001-06-11 | 2002-12-19 | Centre Hospitalier Universitaire De Montreal | Compositions and methods for enhancing nucleic acid transfer into cells |
| WO2003015757A1 (en) | 2001-08-16 | 2003-02-27 | The Trustees Of The University Of Pennsylvania | Synthesis and use of reagents for improved dna lipofection and/or slow release prodrug and drug therapies |
| WO2004002453A1 (en) | 2002-06-28 | 2004-01-08 | Protiva Biotherapeutics Ltd. | Method and apparatus for producing liposomes |
| WO2004029213A2 (en) | 2002-09-28 | 2004-04-08 | Massachusetts Institute Of Technology | Compositions and methods for delivery of short interfering rna and short hairpin rna |
| US20040204377A1 (en) | 2002-11-26 | 2004-10-14 | University Of Massachusetts | Delivery of siRNAs |
| US20040208921A1 (en) | 2003-01-14 | 2004-10-21 | Ho Rodney J. Y. | Lipid-drug formulations and methods for targeted delivery of lipid-drug complexes to lymphoid tissues |
| US20060240093A1 (en) | 2003-07-16 | 2006-10-26 | Protiva Biotherapeutics, Inc. | Lipid encapsulated interfering rna |
| WO2005021749A1 (en) | 2003-08-28 | 2005-03-10 | Novartis Ag | Interfering rna duplex having blunt-ends and 3’-modifications |
| US20070135372A1 (en) | 2005-11-02 | 2007-06-14 | Protiva Biotherapeutics, Inc. | Modified siRNA molecules and uses thereof |
| WO2007107162A2 (en) | 2006-03-23 | 2007-09-27 | Santaris Pharma A/S | Small internally segmented interfering rna |
| WO2007128477A2 (en) | 2006-05-04 | 2007-11-15 | Novartis Ag | SHORT INTERFERING RIBONUCLEIC ACID (siRNA) FOR ORAL ADMINISTRATION |
| WO2008147824A2 (en) | 2007-05-22 | 2008-12-04 | Mdrna, Inc. | Hydroxymethyl substituted rna oligonucleotides and rna complexes |
| WO2009082817A1 (en) | 2007-12-27 | 2009-07-09 | Protiva Biotherapeutics, Inc. | Silencing of polo-like kinase expression using interfering rna |
| US20090209626A1 (en) | 2008-02-11 | 2009-08-20 | Dharmacon, Inc. | Duplex Oligonucleotides with Enhanced Functionality in Gene Regulation |
| WO2011076807A2 (en) | 2009-12-23 | 2011-06-30 | Novartis Ag | Lipids, lipid compositions, and methods of using them |
Non-Patent Citations (63)
| Title |
|---|
| ADACHI ET AL., SEIZURE: EUR. J. EPILEPSY, vol. 21, 2012, pages 55 - 60 |
| BARBIE ET AL., NATURE, vol. 462, 2009, pages 108 - 112 |
| BERNSTEIN ET AL., NATURE, vol. 409, 2001, pages 363 |
| BLUM ET AL., CANCER RESEARCH, vol. 65, no. 3, 2005, pages 999 - 1006 |
| BOS ET AL., CANCER RES., vol. 49, 1989, pages 4682 - 4689 |
| BOS, CANCER RES., vol. 49, no. 17, 1989, pages 4682 - 9 |
| BURGIN ET AL., BIOCHEMISTRY, vol. 35, 1996, pages 14090 |
| BURMER ET AL., PROC. NATL. ACAD. SCI., vol. 86, 1989, pages 2403 - 2407 |
| CAO ET AL., AM. J. PHYSIOL. RENAL PHYSIOL., 2006 |
| CARTA ET AL., AM. J. HUM. GENET., vol. 79, 2006, pages 129 - 135 |
| CHANG ET AL., PROC. NAT. ACAD. SCI., vol. 79, 1982, pages 4848 - 4852 |
| CHANG ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 79, no. 16, 1982, pages 4848 - 52 |
| CHU; RANA, RNA, vol. 14, 2008, pages 1714 - 1719 |
| DER ET AL., PROC. NAT. ACAD. SCI., vol. 79, 1982, pages 3637 - 3640 |
| DOWLER ET AL., NUCL. ACIDS RES., vol. 34, 2006, pages 1669 - 1675 |
| DOWNWARD, NAT. REV. CANCER, vol. 3, no. 1, 2003, pages 11 - 22 |
| ELBASHIR ET AL., EMBO J., vol. 20, 2001, pages 6877 - 6888 |
| ELBASHIR ET AL., GENES DEV., vol. 15, 2001, pages 188 |
| ELBASHIR ET AL., NATURE, vol. 411, 2001, pages 494 - 498 |
| ENGELMAN ET AL., NATURE MED., vol. 14, 2008, pages 1351 - 1356 |
| FORBES ET AL., BR. J. CANCER, vol. 94, 2006, pages 318 - 322 |
| GAMBLING ET AL., KIDNEY INTL., vol. 65, 2004, pages 1774 - 1781 |
| GAULTIER ET AL., NUCLEIC ACIDS. RES., vol. 15, 1987, pages 6625 - 6641 |
| GOODSELL ET AL., ONCOLOGIST, vol. 4, no. 3, 1999, pages 263 - 4 |
| GRIMMOND ET AL., UROL. RES., vol. 20, 1992, pages 121 - 126 |
| HAIGIS ET AL., NATURE GEN., vol. 40, 2008, pages 600 - 608 |
| HARVEY, NATURE, vol. 204, no. 4963, 1964, pages 1104 - 5 |
| HUMMER ET AL., J. AM. SOC. NEPHROL., vol. 16, 2005, pages 3160 - 3166 |
| HUTVAGNER ET AL., SCIENCE, vol. 293, 2001, pages 834 |
| INOUE ET AL., FEBS LETT., vol. 215, 1987, pages 327 - 330 |
| INOUE ET AL., NUCLEIC ACIDS RES., vol. 15, 1987, pages 6131 - 6148 |
| KARAPETIS ET AL., N. E. J. MED., vol. 359, 2008, pages 1757 - 1765 |
| KIARIS ET AL., INT. J. ONCOL., vol. 7, 1995, pages 413 - 421 |
| KIM ET AL., J. KOREAN SOC. NEONATOL., vol. 18, 2011, pages 374 - 378 |
| KIRSTEN ET AL., BIB HAEMATOL., vol. 36, 1970, pages 246 - 9 |
| KRAYNACK ET AL., RNA, vol. 12, 2006, pages 163 - 176 |
| LIU ET AL., NATURE, vol. 330, 1987, pages 186 - 188 |
| LODISH ET AL.: "Cancer. Molecular cell biology 4th ed.", 2000, W.H. FREEMAN |
| MALUMBRES ET AL., NAT. REV. CANCER, vol. 3, no. 6, 2003, pages 459 - 65 |
| MCCAFFREY ET AL., NATURE, vol. 414, pages 34 - 39 |
| MCCOY ET AL., NATURE, vol. 302, 1983, pages 79 - 81 |
| MCGRATH ET AL., NATURE, vol. 304, 1983, pages 501 - 506 |
| MEYLAN ET AL., NATURE, vol. 462, 2009, pages 104 - 107 |
| NYKANEN ET AL., CELL, vol. 107, 2001, pages 309 |
| OVCHARENKO D: "Efficient delivery of siRNAs to human primary cells", AMBION TECHNOTES, vol. 10, no. 5, 2003, pages 15 - 16 |
| PARADA ET AL., NATURE, vol. 297, no. 5866, 1982, pages 474 - 8 |
| PARRISH ET AL., MOLECULAR CELL, vol. 6, 2000, pages 1077 - 1087 |
| RANDRIANARISON ET AL., AM. J. PHYSIOL. LUNG CELL. MOL. PHYSIOL., vol. 294, 2007, pages 409 - 416 |
| RIELY ET AL., CLIN. CANCER RES., vol. 14, 2008, pages 5731 |
| RIELY ET AL., PROC. AM. THORAC. SOC., vol. 6, 2009, pages 201 - 205 |
| ROTBLAT ET AL., METHODS ENZYMOL, vol. 439, 2008, pages 467 - 89 |
| SANTOS ET AL., NATURE, vol. 298, no. 5872, 1982, pages 343 - 7 |
| SCIENCE, vol. 325, 2009, pages 1555 - 1559 |
| SHARP ET AL., GENES DEV., vol. 15, 2001, pages 485 |
| SIOUD, J. MOL. BIOL., vol. 348, 2005, pages 1079 - 1090 |
| SONG ET AL., NAT BIOTECH., vol. 23, 2005, pages 709 - 717 |
| SONG ET AL., NAT MED. |
| SOUTSCHEK ET AL., NATURE, vol. 432, 2004, pages 173 - 178 |
| SUN ET AL., NATURE BIOTECH, vol. 26, 2008, pages 1379 - 1382 |
| USMAN ET AL., NUCLEIC ACIDS SYMP. SER., vol. 31, 1994, pages 163 |
| USMAN; CEDERGREN, TIBS, vol. 17, 1992, pages 34 |
| YAMATO ET AL., CANCER GENE THER., vol. 18, 2011, pages 587 - 597 |
| ZENKER ET AL., J. MED. GENET., vol. 44, 2007, pages 131 - 135 |
Cited By (32)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20170016001A1 (en) * | 2014-03-14 | 2017-01-19 | Boston Biomedical, Inc. | Asymmetric interfering rna compositions that silence k-ras and methods of uses thereof |
| EP3436585A4 (en) * | 2016-04-01 | 2019-11-13 | Avidity Biosciences LLC | KRAS NUCLEIC ACIDS AND USES THEREOF |
| US10487149B2 (en) | 2016-04-01 | 2019-11-26 | Avidity Biosciences, Inc. | Nucleic acid-polypeptide compositions and uses thereof |
| US10550188B2 (en) | 2016-04-01 | 2020-02-04 | Avidity Biosciences, Inc. | Nucleic acid-polypeptide compositions and uses thereof |
| US10787519B2 (en) | 2016-04-01 | 2020-09-29 | Avidity Biosciences, Inc. | Nucleic acid-polypeptide compositions and uses thereof |
| US10800848B2 (en) | 2016-04-01 | 2020-10-13 | Avidity Biosciences, Inc. | Nucleic acid-polypeptide compositions and uses thereof |
| US12351637B2 (en) | 2016-04-01 | 2025-07-08 | Avidity Biosciences, Inc. | Nucleic acid-polypeptide compositions and uses thereof |
| US20210179720A1 (en) * | 2016-04-01 | 2021-06-17 | Avidity Biosciences, Inc. | Nucleic acid-polypeptide compositions and uses thereof |
| US12234290B2 (en) * | 2016-04-01 | 2025-02-25 | Avidity Biosciences, Inc. | Nucleic acid-polypeptide compositions and uses thereof |
| US11583591B2 (en) | 2017-12-06 | 2023-02-21 | Avidity Biosciences Llc | Compositions and methods of treating muscle atrophy and myotonic dystrophy |
| US11246941B2 (en) | 2017-12-06 | 2022-02-15 | Avidity Biosciences, Inc. | Compositions and methods of treating muscle atrophy and myotonic dystrophy |
| US11497814B2 (en) | 2017-12-06 | 2022-11-15 | Avidity Biosciences, Inc. | Compositions and methods of treating muscle atrophy and myotonic dystrophy |
| US10881743B2 (en) | 2017-12-06 | 2021-01-05 | Avidity Biosciences, Inc. | Compositions and methods of treating muscle atrophy and myotonic dystrophy |
| US11554176B2 (en) | 2017-12-06 | 2023-01-17 | Avidity Biosciences, Inc. | Compositions and methods of treating muscle atrophy and myotonic dystrophy |
| US12263224B2 (en) | 2017-12-06 | 2025-04-01 | Avidity Biosciences, Inc. | Compositions and methods of treating muscle atrophy and myotonic dystrophy |
| US11576980B2 (en) | 2017-12-06 | 2023-02-14 | Avidity Biosciences, Inc. | Compositions and methods of treating muscle atrophy and myotonic dystrophy |
| US11253607B2 (en) | 2017-12-06 | 2022-02-22 | Avidity Biosciences, Inc. | Compositions and methods of treating muscle atrophy and myotonic dystrophy |
| US11712478B2 (en) | 2017-12-06 | 2023-08-01 | Avidity Biosciences, Inc. | Compositions and methods of treating muscle atrophy and myotonic dystrophy |
| US11872287B2 (en) | 2017-12-06 | 2024-01-16 | Avidity Biosciences, Inc. | Compositions and methods of treating muscle atrophy and myotonic dystrophy |
| US12146139B2 (en) * | 2019-11-14 | 2024-11-19 | The Board Of Regents Of The University Of Oklahoma | Oligonucleotide interference treatments of prostate cancer |
| US20220275374A1 (en) * | 2019-11-14 | 2022-09-01 | The Board Of Regents Of The University Of Oklahoma | Oligonucleotide interference treatments of prostate cancer |
| US11999955B2 (en) | 2020-03-19 | 2024-06-04 | Avidity Biosciences, Inc. | Compositions and methods of treating facioscapulohumeral muscular dystrophy |
| US12049629B2 (en) | 2020-03-19 | 2024-07-30 | Avidity Biosciences, Inc. | Compositions and methods of treating Facioscapulohumeral muscular dystrophy |
| US12104156B2 (en) | 2020-03-19 | 2024-10-01 | Avidity Biosciences, Inc. | Compositions and methods of treating facioscapulohumeral muscular dystrophy |
| US11555190B2 (en) | 2020-03-19 | 2023-01-17 | Avidity Biosciences, Inc. | Compositions and methods of treating Facioscapulohumeral muscular dystrophy |
| US11525137B2 (en) | 2020-03-19 | 2022-12-13 | Avidity Biosciences, Inc. | Compositions and methods of treating Facioscapulohumeral muscular dystrophy |
| US12529056B2 (en) | 2020-03-19 | 2026-01-20 | Avidity Biosciences, Inc. | Compositions and methods of treating facioscapulohumeral muscular dystrophy |
| EP4395901A4 (en) * | 2021-09-02 | 2025-10-01 | Molecular Axiom Llc | COMPOSITIONS AND METHODS FOR MODULATING KRAS EXPRESSION |
| US12071485B2 (en) | 2021-09-16 | 2024-08-27 | Avidity Biosciences, Inc. | Compositions and methods of treating facioscapulohumeral muscular dystrophy |
| US12157774B2 (en) | 2021-09-16 | 2024-12-03 | Avidity Biosciences, Inc. | Compositions and methods of treating facioscapulohumeral muscular dystrophy |
| US11912779B2 (en) | 2021-09-16 | 2024-02-27 | Avidity Biosciences, Inc. | Compositions and methods of treating facioscapulohumeral muscular dystrophy |
| WO2024176153A1 (en) * | 2023-02-22 | 2024-08-29 | Auris Medical Ag | Compositions and methods for kras inhibition for the treatment of disease |
Also Published As
| Publication number | Publication date |
|---|---|
| EA201492004A1 (ru) | 2015-08-31 |
| AU2020200247A1 (en) | 2020-02-06 |
| HK1206387A1 (en) | 2016-01-08 |
| AU2013256471A1 (en) | 2014-11-13 |
| JP2015517466A (ja) | 2015-06-22 |
| MX2014013367A (es) | 2014-12-08 |
| BR112014027337A2 (pt) | 2017-07-18 |
| AU2017261481A1 (en) | 2017-11-30 |
| WO2013166004A3 (en) | 2014-01-03 |
| AU2022202991A1 (en) | 2022-05-26 |
| CA2872304A1 (en) | 2013-11-07 |
| CN104583406A (zh) | 2015-04-29 |
| EP2844757A2 (en) | 2015-03-11 |
| CN109481455A (zh) | 2019-03-19 |
| AU2016204832A1 (en) | 2016-07-28 |
| US20180153919A1 (en) | 2018-06-07 |
| US20150238515A1 (en) | 2015-08-27 |
| US20260069625A1 (en) | 2026-03-12 |
| EP3272868A1 (en) | 2018-01-24 |
| CA3173610A1 (en) | 2013-11-07 |
| KR20150004414A (ko) | 2015-01-12 |
| CA2872304C (en) | 2022-12-06 |
| EP3736333A1 (en) | 2020-11-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20260069625A1 (en) | Organic compositions to treat kras-related diseases | |
| US11261444B2 (en) | Organic compositions to treat EPAS1-related diseases | |
| CA2797051C (en) | Organic compositions to treat beta-enac-related diseases | |
| AU2011244335A1 (en) | Organic compositions to treat Beta-ENaC-related diseases | |
| AU2021240326A1 (en) | Organic compositions to treat Beta-ENac-related diseases |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 13721578 Country of ref document: EP Kind code of ref document: A2 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 14397815 Country of ref document: US |
|
| ENP | Entry into the national phase |
Ref document number: 2872304 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2013721578 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2014/013367 Country of ref document: MX |
|
| ENP | Entry into the national phase |
Ref document number: 2015510380 Country of ref document: JP Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2013256471 Country of ref document: AU Date of ref document: 20130430 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 20147033421 Country of ref document: KR Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 201492004 Country of ref document: EA |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112014027337 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 112014027337 Country of ref document: BR Kind code of ref document: A2 Effective date: 20141031 |