WO2013154766A1 - Régulation par micro-arn de la voie du récepteur des ldl - Google Patents

Régulation par micro-arn de la voie du récepteur des ldl Download PDF

Info

Publication number
WO2013154766A1
WO2013154766A1 PCT/US2013/032271 US2013032271W WO2013154766A1 WO 2013154766 A1 WO2013154766 A1 WO 2013154766A1 US 2013032271 W US2013032271 W US 2013032271W WO 2013154766 A1 WO2013154766 A1 WO 2013154766A1
Authority
WO
WIPO (PCT)
Prior art keywords
mir
mirna
pcsk9
idol
nucleic acid
Prior art date
Application number
PCT/US2013/032271
Other languages
English (en)
Inventor
Kathryn J. Moore
Katey J. Rayner
Original Assignee
New York University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by New York University filed Critical New York University
Publication of WO2013154766A1 publication Critical patent/WO2013154766A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/06—Antihyperlipidemics
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C12N2310/141—MicroRNAs, miRNAs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/323—Chemical structure of the sugar modified ring structure
    • C12N2310/3231—Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2330/00—Production
    • C12N2330/50—Biochemical production, i.e. in a transformed host cell
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01088—Hydroxymethylglutaryl-CoA reductase (1.1.1.88)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y304/00—Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
    • C12Y304/21—Serine endopeptidases (3.4.21)
    • C12Y304/21061—Kexin (3.4.21.61), i.e. proprotein convertase subtilisin/kexin type 9
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y603/00—Ligases forming carbon-nitrogen bonds (6.3)
    • C12Y603/02—Acid—amino-acid ligases (peptide synthases)(6.3.2)
    • C12Y603/02019—Ubiquitin-protein ligase (6.3.2.19), i.e. ubiquitin-conjugating enzyme

Definitions

  • the invention is generally related to the field of molecular biology, more particularly to microRNA compositions for lowering LDL cholesterol.
  • LDL cholesterol Low density lipoprotein (LDL) cholesterol (LDL-C) is a strong, independent risk factor for coronary artery disease (CAD), the direct result of atherosclerosis.
  • CAD cardiovascular disease
  • the most common approach to decreasing CAD risk has been to lower LDL-C, particularly through the use of statins.
  • Clinical trials of these drugs, which target HMG-CoA reductase (HMGCR) to block cholesterol synthesis, have uniformly shown that lowering of LDL-C reduces event rates in all age groups (Grundy, S.M., et al. Circulation 1 10:227-239 (2004)).
  • HMGCR HMG-CoA reductase
  • LDL receptor is a cell-surface receptor that mediates endocytosis of LDL-C. While this occurs in all nucleated cells, liver cells remove approximately 70% of LDL from the circulation by this mechanism. Synthesis of LDLR in the cell is regulated by the level of free intracellular cholesterol. Recent studies have also uncovered roles for "accessory" proteins, such as PCSK9 and Idol, in regulating cell surface expression of the LDLR.
  • PCSK9 is a secreted protein that binds the LDLR at the cell surface, targeting it for degradation via the lysosomal pathway (Horton, J.D., et al. J Lipid Res 50 Suppl:S172-177 (2009)).
  • Gain of function mutations in PCSK9 cause autosomal dominant hypercholesterolemia (Abifadel, M., et al. Nat Genet 34: 154-156 (2003)), whereas PCSK9 loss-of-function is associated with a 29% decrease in LDLC and a striking 88% decrease in risk for CAD (Cohen, J.C., et al. N Engl J Med 354: 1264-1272 (2006)).
  • Idol A second accessory protein, triggers ubiquitination of the LDLR and targets it for degradation via the proteosomal pathway (Zelcer, N., et al. Science 325: 100-104 (2009)).
  • Idol is an intracellular E3 ubiquitin ligase expressed by the liver and other peripheral tissues (e.g. macrophages and intestine) that is induced by LXR under conditions of high sterol.
  • compositions and methods for increasing LDLR cell-surface expression in a cell It is a further object of the invention to provide compositions and methods to reduce LDL-C levels in the circulation.
  • the disclosed methods are based on the discovery of microR A (miRNA) that bind and inhibit the 3 ' untranslated region (3' UTR) of HMG- CoA reductase (HMGCR), PCSK9, and Idol, and thereby increase LDLR cell-surface expression.
  • the disclosed methods therefore involve administering to a subject in need thereof a composition that delivers to cells (e.g., liver cells) in the subject an effective amount of miRNA that bind and inhibit the 3 ' UTR of HMGCR, PCSK9, Idol, or a combination thereof.
  • the miRNA is miR-520d-5p (also referred to herein as miR-520d and miR-520), or a conservative variant or mimic thereof. In some embodiments, the miRNA is miR-224, or a conservative variant or mimic thereof.
  • the miRNA can be a natural or synthetic miRNA, e.g., an miRNA mimic.
  • the method involves administering a composition containing a vector containing a nucleic acid sequence encoding an miRNA operably linked to an expression control sequence.
  • the method involves administering a composition containing an miRNA oligonucleotide, such as an miRNA mimic.
  • a miRNA oligonucleotide preferably contains one or more modified nucleotides, such as one or more Locked Nucleic Acid (LNA), to increase stability and activity.
  • LNA Locked Nucleic Acid
  • the miRNA oligonucleotide may also be conjugated to agents, such as lipophilic moieties (e.g., cholesterol), to facilitate entry of the
  • compositions that contain an effective amount of a miR-520d-5p mimic, a miR-224 mimic, or a combination thereof, to lower LDL cholesterol levels in a subject by at least 10%.
  • Expression vectors containing a nucleic acid sequence encoding an miRNA that binds and inhibits the 3 ' UTR of HMGCR, PCSK9, Idol, or a combination thereof, operably linked to an expression control sequence are also disclosed.
  • Figures 1A and IB are line graphs showing the fold change of miR- 224 (Fig. 1A) and miR-520d-5p ("miR-520d”) (Fig. IB) in human THP-1 macrophages after treatment with a statin as a function of time (hours).
  • Figure 1C is a line graph showing the relative expression of miR224 (—A—), PCSK9 (- ⁇ -) and Idol (- -) in HepG2 cells as a function of time (hours) after treatment with T0901317.
  • Figure ID is a line graph showing the relative expression of miR224 (-- A -), miR520 (-- ⁇ --) PCSK9 (- ⁇ -), and Idol (- ⁇ -) in HepG2 cells as a function of time (hours) after treatment with statin.
  • Figures IE and IF are bar graphs showing relative levels of miR-224 (Fig. IE) and miR-520d (Fig. IF) in lung, liver, kidney, brain, spleen, heart, skeletal muscle, and adipose tissues of C57BL6 mice.
  • Figures 1G-1L are bar graphs showing relative levels of PCSK9 (Figs. 1G and 1J), Idol (Figs.
  • LDLR Figs. II and 1L in lung, liver, kidney, brain, spleen, heart, skeletal muscle, and adipose tissues of human (Figs. 1G-1I) and C57BL6 mice (Figs. 1K-1L).
  • Figures 2A, 2B and 2C are bar graphs showing the putative binding sites for human miR-520d and miR-224 in the 3 'UTR of human Idol (Fig. 2A), human PCSK9 (Fig. 2B), and human HMGCR (Fig. 2C).
  • hsa-miR-520d-5p SEQ ID NO: l
  • hsa-miR-224 SEQ ID NO:2
  • nucleotides 382-401 shown hybridization to SEQ ID NO: 1 over nucleotides 394-400 of Idol 3 'UTR (corresponding to nucleotides 1957-1976 of NM_013262.3) (SEQ ID NO:3)
  • Figures 2D-2F are line graphs showing 3'UTR activity of human Idol 3'UTR (Fig. 2D), human PCSK9 3'UTR (Fig. 2E), and human HMGCR (Fig. 2F) fused to a luciferase reporter plasmid and treated with control miR or treated with 5nM, 20nM, or 40nM miR-520 (- ⁇ -) or miR-224 (- ⁇ -) miRNA mimics.
  • Figure 2G is a bar graph showing relative 3'UTR activity of human 293T cells transfected with an HMGCR-3'UTR-luciferase reporter construct in the presence/absence of control miR (40nM), miR-224 (10, 20, or 40 nM) or miR-520d (10 or 20 nM) mimics.
  • Figures 2H-2L are bar graphs showing relative 3'UTR activity of human 293T cells transfected with an Idol-3 'UTR- luciferase (Figs. 2H- 21), PCSK9-3'UTR-luciferase (Figs. 2J-2K), or human HMGCR (Fig.
  • Figures 3A-3B are bar graphs showing relative mRNA levels of Idol
  • FIG. 3A or PCSK9 (Fig. 3B) in HepG2 cells transfected with control miR mimic (solid bar), miR-520d (open bar), or miR-224 (shaded bar).
  • Figures 3C-3D are bar graphs showing relative mRNA levels of PCSK9 (Fig. 3C) or Idol (Fig. 3D) in HEPG2 cells transfected with miR-520d (open bar) or control miR (solid bar) and treated with AcLDL or LXR ligand.
  • Figure 3E is a bar graph showing PCSK9 protein levels (arbitrary units) in HEPG2 cells transfected with miR-520d (bars 4-6) or control miR (bars 1-3) and treated with AcLDL (bars 2 and 5) or LXR ligand (bars 3 and 5).
  • Figure 3F is a bar graph showing relative change in PCSK9, IDOL, HMGCR, and LDLR mRNA in HEPG2 cells transfected with miR-224, miR-520d or control miR.
  • Figure 3G is bar graph showing the results of an ELISA assay detecting PCSK9 protein in supernatants of HepG2 cells transfected with miR-520d and miR-224.
  • Figure 3H is a bar graph showing the results of QRT-PCR analysis of PCSK9, IDOL, and HMGCR in Huh-7 cells transfected with miR-520d and miR-224.
  • Figure 31 is a bar graphs showing the results of
  • Figure 4 is a bar graph showing the results of QRT-PCR analysis of the expression (relative change in mRNA) of PCSK9, Idol, and Idol with
  • Figure 5 is a bar graph showing the results of QRT-PCR analysis (relative change in mRNA) of PCSK9, Idol and LDLR in control and 293T cells transfected with inhibitors of miR-224 (lnh-miR-224) and miR-520d (lnh-mi-520).
  • Figure 6A-6C are a series of fluorescence intensity plots (number of pixels vs. fluorescence intensity) showing control miR transfected cells (Fig. 6A), miR-224 transfected cells (Fig. 6B), and miR-540d transfected cells (Fig. 6C) untreated, treated with the LXR agonist, or treated with statin as labeled.
  • LDL cholesterol low density lipoprotein (LDL) cholesterol
  • LDL-C low density lipoprotein cholesterol
  • microR A refers to small, non-protein coding RNA molecule that binds complementary sequences on target messenger RNA transcripts (mRNAs), resulting in translational repression, mRNA cleavage, and/or deadenylation.
  • MicroRNAs are normally transcribed by RNA polymerase II as large RNA precursors called pri- miRNAs.
  • the pri-miRNAs are processed in the nucleus by a complex of the RNase III enzyme Drosha, and the double-stranded-RNA-binding protein, Pasha/DGCR85.
  • the resulting pre-miRNAs are aproximately 70-nucleotides in length and are folded into imperfect stem-loop structures.
  • the pre- miRNAs are then exported into the cytoplasm. Once in the cytoplasm, the pre-miRNAs undergo an additional processing step by the RNAse III enzyme Dicer generating the miRNA, a double-stranded RNA aproximately 22 nucleotides in length. Dicer also initiates the formation of the RNA- induced silencing complex (RISC). RISC is responsible for the gene silencing observed due to miRNA expression and RNA interference.
  • the disclosed miRNAs may be produced as pri-miRNA, pre-miRNA, or as mature miRNA.
  • nucleic acid or “polynucleotide” is used to refer to a natural or synthetic molecule comprising a two or more nucleotides linked by a phosphate group at the 3 ' position of one nucleotide to the 5 ' end of another nucleotide.
  • the nucleic acid can include deoxyribonucleic acid (DNA) or ribonucleic acid (RNA).
  • An "isolated” nucleic acid molecule or polynucleotide is a nucleic acid molecule that is identified and separated from at least one substance with which it is ordinarily associated in the natural source. The isolated nucleic can be, for example, free of association with all components with which it is naturally associated.
  • An isolated nucleic acid molecule is other than in the form or setting in which it is found in nature.
  • oligonucleotide refers to a short polynucleotide of a defined sequence.
  • An oligonucleotide typically contains less than 100 nucleotides, preferably less than 50 nucleotides, more preferably less than 25 nucleotides.
  • An oligonucleotide may be single-stranded or double-stranded.
  • oligoribonucleotide refers to an oligonucleotide containing ribonucleotides.
  • nucleotide refers to a monomeric subunit that polymerizes into a polynucleotide (e.g., DNA or RNA). Each nucleotide consists of a nitrogenous base; a sugar (e.g., ribose or deoxyribose); and one to three phosphate groups.
  • nucleotide includes natural and modified nucleotides.
  • ribonucleotide is a nucleotide in which the sugar is ribose molecule.
  • deoxyribonucleotide is a nucleotide in which the sugar is ribose.
  • duplex or “double-stranded” refers to the linkage of two nucleic acid polymers by complementary base pairing.
  • complementarity refers to the rules of Watson and Crick base pairing. For example, A (adenine) bonds with T (thymine) or U (uracil), G (guanine) bonds with C (cytosine).
  • DNA contains an antisense strand that is complementary to its sense strand. A nucleic acid that is 95% identical to a DNA antisense strand is therefore 95% complementary to the DNA sense strand.
  • vector refers to a replicon, such as a plasmid, phage, or cosmid, into which another DNA segment may be inserted so as to bring about the replication of the inserted segment.
  • expression vector refers to a vector where the inserted DNA segment is operably linked to an expression control sequence.
  • expression control sequence refers to a DNA sequence that controls and regulates the transcription and/or translation of another DNA sequence. Control sequences that are suitable for eukaryotic cells include promoters and enhancers.
  • promoter refers to an expression control sequence, typically located upstream (5') of a DNA sequence, that, in conjunction with various elements, is responsible for regulating the transcription of the DNA sequence.
  • operably linked to refers to the functional relationship of a nucleic acid with another nucleic acid sequence. Promoters, enhancers, transcriptional and translational stop sites, and other signal sequences are examples of nucleic acid sequences operably linked to other sequences.
  • operable linkage of DNA to a promoter refers to the physical and functional relationship between the DNA and promoter such that the transcription of the DNA is initiated from the promoter by an RNA polymerase that specifically recognizes, binds to and transcribes the DNA.
  • percent (%) sequence identity is defined as the percentage of nucleotides or amino acids in a candidate sequence that are identical with the nucleotides or amino acids in a reference nucleic acid sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN, ALIGN-2 or Megalign (DNASTAR) software. Appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full-length of the sequences being compared can be determined by known methods.
  • % sequence identity of a given nucleotides or amino acids sequence C to, with, or against a given nucleic acid sequence D is calculated as follows:
  • treat means the medical management of a patient with the intent to cure, ameliorate, stabilize, or prevent a disease, pathological condition, or disorder.
  • This term includes active treatment, that is, treatment directed specifically toward the improvement of a disease, pathological condition, or disorder, and also includes causal treatment, that is, treatment directed toward removal of the cause of the associated disease, pathological condition, or disorder.
  • this term includes palliative treatment, that is, treatment designed for the relief of symptoms rather than the curing of the disease, pathological condition, or disorder; preventative treatment, that is, treatment directed to minimizing or partially or completely inhibiting the development of the associated disease, pathological condition, or disorder; and supportive treatment, that is, treatment employed to supplement another specific therapy directed toward the improvement of the associated disease, pathological condition, or disorder.
  • prevent does not require absolute forestalling of the condition or disease but can also include a delay in onset or a reduction in the severity of the disease or condition. Thus, if a therapy can treat a disease in a subject having symptoms of the disease, it can also prevent that disease in a subject who has yet to suffer some or all of the symptoms.
  • terapéuticaally effective means that the amount of the composition used is of sufficient quantity to ameliorate one or more causes or symptoms of a disease or disorder. Such amelioration only requires a reduction or alteration, not necessarily elimination.
  • inhibitor refers to a decrease in an activity, response, condition, disease, or other biological parameter. This can include but is not limited to the complete ablation of the activity, response, condition, or disease. This may also include, for example, a 10% reduction in the activity, response, condition, or disease as compared to the native or control level. Thus, the reduction can be a 10, 20, 30, 40, 50, 60, 70, 80, 90, 100%, or any amount of reduction in between as compared to native or control levels. II.
  • MicroR As that bind and inhibit the 3 'untranslated region (UTR) of HMGCR, PCSK9, Idol, or a combination thereof, are disclosed.
  • the miRNA is human miR-520d-5p, or a conservative variant or mimic thereof that inhibits 3'UTR activity of HMGCR, PCSK9, Idol, or a combination thereof.
  • the miRNA is human miR-224, or a conservative variant or mimic thereof that inhibits 3'UTR activity of HMGCR, PCSK9, Idol, or a combination thereof.
  • a predicted cDNA sequence for human pre-mir-520d is provided in Accession No. NR_030204 (TCTCAAGCTG TGAGTCTACA
  • the miR-520d-5p comprises the nucleic acid sequence CUACAAAGGGAAGCCCUUUC (SEQ ID NO: l).
  • a predicted cDNA sequence for human pre-mir-224 is provided in Accession No. NR_029638 (GGGCTTTCAA GTCACTAGTG
  • the miR-224 comprises the nucleic acid sequence
  • Natural miRNA is unstable and therefore difficult to use
  • the disclosed miRNA is a synthetic miRNA oligonucleotide, such as an miRNA mimic.
  • miRNA mimics are small, chemically-modified double-stranded RNA molecules, which are designed to mimic endogenous mature miRNAs. The chemical modifications ensure that the correct strand, representing the desired mature miRNA, is taken up into the RNA-induced silencing complex (RISC) responsible for miRNA activity. Thanks to their small size, they are easier to transfect than vectors, and can be delivered using conditions similar to those used for siRNAs by transfection or electroporation.
  • RISC RNA-induced silencing complex
  • miRNA mimics include mzVVanaTM miRNA mimics (Life Technologies), MISSION® miRNA mimics (Sigma-Aldrich®), miRIDIAN® microRNA Mimics (Dharmacon), and miScriptTM miRNA mimics (Qiagen).
  • compositions and methods for increasing stability of nucleic acid half-life and nuclease resistance are known in the art, and can include one or more modifications or substitutions to the nucleobases, sugars, or linkages of the polynucleotide.
  • the polynucleotide can be custom synthesized to contain properties that are tailored to fit a desired use.
  • LNAs locked nucleic acids
  • UNAs unlocked nucleic acids
  • PNA peptide nucleic acids
  • phosphorothioate linkages phosphonoacetate, linkages, propyne analogs, 2'-0-methyl RNA, 5-Me-dC, 2'-5' linked phosphodiester linage, chimeric Linkages (mixed phosphorothioate and phosphodiester linkages and modifications), conjugation with lipid and peptides, and combinations thereof.
  • the polynucleotide includes internucleotide linkage modifications such as phosphate analogs having achiral and uncharged intersubunit linkages, or uncharged morpholino-based polymers having achiral intersubunit linkages.
  • Some internucleotide linkage analogs include morpholidate, acetal, and polyamide-linked heterocycles.
  • a locked nucleic acid (LNA) often referred to as inaccessible RNA, is a modified RNA nucleotide where the ribose moiety is modified with an extra bridge connecting the 2' oxygen and 4' carbon. The bridge "locks" the ribose in the 3 '-endo (North) conformation, which is often found in the A-form duplexes.
  • LNA nucleotides can be mixed with DNA or RNA residues in the oligonucleotide whenever desired.
  • the locked ribose conformation enhances base stacking and backbone pre-organization.
  • Oligonucleotides incorporating LNAs have increased thermal stability and improved discriminative power with respect to their nucleic acid targets.
  • Commercial nucleic acid synthesizers and standard phosphoramidite chemistry are used to make LNAs.
  • backbone and linkage modifications include, but are not limited to, phosphorothioates, peptide nucleic acids, tricyclo-DNA, decoy oligonucleotide, ribozymes, spiegelmers (containing L nucleic acids, an apatamer with high binding affinity), or CpG oligomers.
  • Phosphorothioates are a variant of normal DNA in which one of the nonbridging oxygens is replaced by a sulfur.
  • the sulfurization of the internucleotide bond dramatically reduces the action of endonucleases and exonucleases including 5' to 3' and 3 ' to 5' DNA POL 1 exonuclease, nucleases S I and PI, RNases, serum nucleases and snake venom phosphodiesterase.
  • endonucleases and exonucleases including 5' to 3' and 3 ' to 5' DNA POL 1 exonuclease, nucleases S I and PI, RNases, serum nucleases and snake venom phosphodiesterase.
  • the potential for crossing the lipid bilayer increases. Because of these important improvements,
  • phosphorothioates have found increasing application in cell regulation.
  • Phosphorothioates are made by two principal routes: by the action of a solution of elemental sulfur in carbon disulfide on a hydrogen phosphonate, or by the more recent method of sulfurizing phosphite triesters with either tetraethylthiuram disulfide (TETD) or 3H-1, 2-bensodithiol-3-one 1, 1- dioxide (BDTD).
  • TETD tetraethylthiuram disulfide
  • BDTD 2-bensodithiol-3-one 1, 1- dioxide
  • PNA Peptide nucleic acids
  • the heterocyclic bases can be any of the standard bases (uracil, thymine, cytosine, adenine and guanine) or any of the modified heterocyclic bases described below.
  • a PNA can also have one or more peptide or amino acid variations and modifications.
  • the backbone constituents of PNAs may be peptide linkages, or alternatively, they may be non-peptide linkages. Examples include acetyl caps, amino spacers such as 8-amino-3,6-dioxaoctanoic acid (referred to herein as O-linkers), and the like. Methods for the chemical assembly of PNAs are well known.
  • the polynucleotide includes one or more chemically-modified heterocyclic bases including, but are not limited to, inosine, 5-(l-propynyl) uracil (pU), 5-(l-propynyl) cytosine (pC), 5- methylcytosine, 8-oxo-adenine, pseudocytosine, pseudoisocytosine, 5 and 2- amino-5-(2'-deoxy-P-D-ribofuranosyl)pyridine (2-aminopyridine), and various pyrrolo- and pyrazolopyrimidine derivatives, 4-acetylcytosine, 8- hydroxy-N-6-methyladenosine, aziridinylcytosine, 5- (carboxyhydroxylmethyl) uracil, 5-bromouracil, 5- carboxymethylaminomethyl-2-thiouracil, 5 - carboxymethylaminomethyluracil, dihydrouracil, N6-isopentenyladenine,
  • the polynucleotide include one or more sugar moiety modifications, including, but are not limited to, 2'-0-aminoethoxy, 2'-0-amonioethyl (2'-OAE), 2'-0-methoxy, 2 '-O-methyl, 2-guanidoethyl (2'-OGE), 2'-0,4'-C-methylene (LNA), 2'-0-(methoxyethyl) (2'-OME), and 2'-0-(N-(methyl)acetamido) (2'-OMA).
  • sugar moiety modifications including, but are not limited to, 2'-0-aminoethoxy, 2'-0-amonioethyl (2'-OAE), 2'-0-methoxy, 2 '-O-methyl, 2-guanidoethyl (2'-OGE), 2'-0,4'-C-methylene (LNA), 2'-0-(methoxyethyl) (2'-OME), and 2'-
  • DNA encoding the disclosed miRNA is incorporated into an expression vector.
  • An expression vector containing a DNA encoding human miR-520d-5p operably linked to an expression control sequence is disclosed.
  • the miR-520d DNA sequence is a pre-mir-520d sequence.
  • the miR-520d DNA sequence is SEQ ID NO: 10.
  • the miR-520d DNA sequence encodes the mature miRNA sequence SEQ ID NO: 1.
  • An expression vector containing a DNA encoding human miR-224 operably linked to an expression control sequence is also disclosed.
  • the miR-224 DNA sequence is a pre-mir-224 sequence.
  • the miR-224 DNA sequence is SEQ ID NO: 11.
  • the miR-224 DNA sequence encodes the mature miRNA sequence SEQ ID NO:2.
  • Vectors include but are not limited to plasmids, viral nucleic acids, viruses, phage nucleic acids, phages, cosmids, and artificial chromosomes.
  • the vector is derived from either a virus or a retrovirus.
  • Viral vectors include adenovirus, adeno-associated virus, herpes virus, vaccinia virus, polio virus, HIV virus, neuronal trophic virus, Sindbis and other RNA viruses.
  • viral vectors contain, nonstructural early genes, structural late genes, an RNA polymerase III transcript, inverted terminal repeats necessary for replication and encapsidation, and promoters to control the transcription and replication of the viral genome.
  • viruses When engineered as vectors, viruses typically have one or more of the early genes removed and a gene or gene/promoter cassette is inserted into the viral genome in place of the removed viral DNA.
  • the necessary functions of the removed early genes are typically supplied by cell lines which have been engineered to express the gene products of the early genes in trans.
  • Expression vectors generally contain regulatory sequences necessary elements for the translation and/or transcription of the inserted coding sequence.
  • the coding sequence is preferably operably linked to a promoter and/or enhancer to control the expression of the desired gene product.
  • the selection of the promoter to express the gene of interest will depend on the vector, the nucleic acid cassette, the cell type to be targeted, and the desired biological effect.
  • the parameters can include: achieving sufficiently high levels of gene expression to achieve a physiological effect; maintaining a critical level of gene expression; achieving temporal regulation of gene expression; achieving cell type specific expression; achieving pharmacological, endocrine, paracrine, or autocrine regulation of gene expression; and preventing inappropriate or undesirable levels of expression. Any given set of selection requirements will depend on the conditions but can be readily determined once the specific requirements are determined.
  • Promoters can generally be divided into constitutive promoters, tissue-specific or development-stage-specific promoters, inducible promoters, and synthetic promoters. Constitutive promoters direct expression in virtually all tissues and are largely, if not entirely, independent of environmental and developmental factors. As their expression is normally not conditioned by endogenous factors, constitutive promoters are usually active across species and even across kingdoms. A preferred promoter of this type is the CMV promoter (650 bases).
  • Tissue-specific or development-stage-specific promoters direct the expression of a gene in specific tissue(s) or at certain stages of development.
  • inducible promoters The performance of inducible promoters is not conditioned to endogenous factors but to environmental conditions and external stimuli that can be artificially controlled.
  • promoters modulated by abiotic factors such as light, oxygen levels, heat, cold, and wounding. Since some of these factors are difficult to control outside an experimental setting, promoters that respond to chemical compounds, not found naturally in the organism of interest, are of particular interest.
  • An enhancer is a sequence of DNA that functions at no fixed distance from the transcription start site and can be either 5 ' or 3 ' to the transcription unit. Furthermore, enhancers can be within the coding sequence itself. They are usually between 10 and 300 bp in length, and they function in cis.
  • Enhancers function to increase transcription from nearby promoters.
  • Enhancers also often contain response elements that mediate the regulation of transcription. Enhancers often determine the regulation of expression of a gene. While many enhancer sequences are now known from mammalian genes (globin, elastase, albumin, a-fetoprotein and insulin), typically one will use an enhancer from a eukaryotic cell virus for general expression. Preferred examples are the SV40 enhancer on the late side of the replication origin (bp 100-270), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
  • the promotor and/or enhancer may be specifically activated either by light or specific chemical events which trigger their function.
  • Systems can be regulated by reagents such as tetracycline and dexamethasone.
  • reagents such as tetracycline and dexamethasone.
  • irradiation such as gamma irradiation, or alkylating chemotherapy drugs.
  • Expression vectors used in eukaryotic host cells may also contain sequences necessary for the termination of transcription which may affect mRNA expression. These regions are transcribed as polyadenylated segments in the untranslated portion of the mRNA encoding tissue factor protein. The 3' untranslated regions also include transcription termination sites. It is preferred that the transcription unit also contain a polyadenylation region. One benefit of this region is that it increases the likelihood that the transcribed unit will be processed and transported like mRNA. The identification and use of polyadenylation signals in expression constructs is well established. It is preferred that homologous polyadenylation signals be used in the transgene constructs.
  • the polyadenylation region is derived from the SV40 early polyadenylation signal and consists of about 400 bases. It is also preferred that the transcribed units contain other standard sequences alone or in combination with the above sequences improve expression from, or stability of, the construct.
  • the disclosed polynucleotides can be formulated for administration to a subject.
  • the disclosed formulation contains one or more polynucleotides (e.g., 0.1 to 90% by weight) mixed with
  • physiologically acceptable carrier excipients for injection are water, buffered water, normal saline, 0.4% saline, or 0.3% glycine.
  • Suitable pharmaceutical excipients include stabilizers, antioxidants, osmolality adjusting agents, buffers, and pH adjusting agents.
  • the polynucleotide formulation is suitable for delivery to a cell in vivo, e.g., to a cell in an organism.
  • the polynucleotide formulation is suitable for delivery to a cell in vitro, e.g., to a cell in a cell line in culture or a suspension.
  • the polynucleotide formulation can include a ligand that is selected to improve stability, distribution or cellular uptake of the agent.
  • the ligand can be a lipophilic moiety, e.g., cholesterol, which enhances entry of the polynucleotide into a cell.
  • DOPE 1,2-dioleoyl-sn- glycero-3-phosphoethanolamine
  • DOPE 1,2-dioleoyl-sn- glycero-3-phosphoethanolamine
  • lysosomatropic agents such as monensin and chloroquine, which raise the endosomal pH, block acidification, and thus inhibit lysozyme activity, have also been used to facilitate endosomal release of DNA.
  • Endosomal degradation of DNA- based therapeutics can also be circumvented by the incorporation of viral peptides such as hemagglutinin HA2 and those derived from adenoviruses in their delivery systems.
  • Hemagglutinin HA2 undergoes conformational transition and leads to the destruction of the endosome, thereby facilitating the release of the DNA-based therapeutic.
  • Enhanced rapid endosomal escape and enhanced transfection have also been achieved using fusogenic peptides such as poly(L-lysine) (PLL) and cationic polymers such as
  • PEI polyethylenimine
  • Polymer-DNA complexes can also be used to deliver DNA into cells.
  • the polyplexes involve an electrostatic interaction between cationic polymers and anionic DNA.
  • the cationic polyplex can then interact with the negatively charged cell surface to improve DNA uptake.
  • Polymeric matrices with varying properties can be designed by choosing an appropriate distribution of different molecular weights and degree of cross-linking of the polymer, and/or by the incorporation of targeting ligands. Commonly used polymers include polyethylenimine, polylysine, chitosans, and dendrimers.
  • Agents such as folates, transferrin, antibodies, or sugars such as galactose and mannose can be incorporated for tissue targeting.
  • the disclosed polynucleotides can be incorporated into a delivery vehicle, e.g., a liposome or a particle (e.g., a microparticle).
  • a delivery vehicle e.g., a liposome or a particle (e.g., a microparticle).
  • Liposomes can be used as DNA drug delivery systems either by entrapping the
  • phospholipid composition in the liposome bilayers can be varied, liposomal delivery systems can be easily engineered to yield a desired size, surface charge, composition, and morphology.
  • a variety of cationic, anionic, synthetically modified lipids, and combinations thereof have been used to deliver a wide range of DNA-based therapeutics.
  • Cationic liposomal formulations generally contain mixtures of cationic and zwitterionic lipids.
  • Cationic lipids commonly used are 1,2- dioleoyl-3-trimethylammonium propane (DOTAP), N-[l-(2,3- dioleyloxy)propyl]-N,N,Ntrimethylammonium chloride (DOTMA), 2,3- dioleoyloxyN-[2-( spermine carboxamido)ethyl]-N,N-dimethyl-l- propanaminium (DOSPA), dioctadecyl amido glycil spermine (DOGS), 1,2- distearyloxy-N,N-dimethyl-3-aminopropane (DSDMA), 1 ,2-dioleyloxy-N,N- dimethyl-3-aminopropane (DODMA), l,2-dilinoleyloxy-N,N-dimethyl-3- aminopropane (DLinDMA
  • zwitterionic lipids also known as helper lipids
  • DOPE cationic lipids
  • the cationic lipids in the liposomal formulation serve as a DNA complexation and DNA condensation agent during the formation of the lipoplex.
  • the positive charge also helps in cellular association.
  • the zwitterionic lipids help in membrane perturbation and fusion.
  • Proprietary formulations of cationic lipids such as Lipofectamine (Invitrogen Carlsbad, CA), Effectene (Qiagen, Valencia, CA), and
  • the disclosed polynucleotide formulation can include an aminoglycoside ligand, which can cause the polynucleotides to have improved hybridization properties or improved sequence specificity.
  • aminoglycosides include glycosylated polylysine; galactosylated poly lysine; neomycin B; tobramycin; kanamycin A; and acridine conjugates of aminoglycosides, such as Neo-N-acridine, Neo-S-acridine, Neo-C- acridine, Tobra-N-acridine, and KanaA-N-acridine.
  • Use of an acridine analog can increase sequence specificity.
  • neomycin B has a high affinity for RNA as compared to DNA, but low sequence-specificity.
  • the guanidine analog (the guanidinoglycoside) of an aminoglycoside ligand is tethered to an oligonucleotide agent.
  • the amine group on the amino acid is exchanged for a guanidine group. Attachment of a guanidine analog can enhance cell permeability of an oligonucleotide agent.
  • the disclosed polynucleotides can be formulated in combination with one or more additional agents, e.g., another therapeutic agent or an agent that stabilizes the polynucleotides.
  • additional agents e.g., another therapeutic agent or an agent that stabilizes the polynucleotides.
  • the disclosed compositions contain chelators, salts, and RNAse inhibitors.
  • the disclosed formulations contain a combination of polynucleotides.
  • miR- 520d and miR-224 polynucleotides are combined in the same formulation.
  • the disclosed formulations contain one or more therapeutic or diagnostic compounds.
  • Compounds that are involved in inhibition of cholesterol synthesis or uptake such as a statin, bile acid sequestrants, and cholesterol absorption inhibitors such as fibrate and nicotinic acid, are particularly preferred.
  • microRNA compositions that inhibits post-transcriptional expression of HMGCR, PCSK9, Idol, or a combination thereof.
  • the microRNA composition contains or encodes one or more miRNA that bind the 3'UTR of HMGCR, PCSK9, Idol, or a combination thereof, and inhibit gene expression.
  • the microRNA composition contains natural or synthetic miRNA oligonucleotides (e.g., miRNA mimic).
  • the microRNA composition contains a vector encoding an miRNA, wherein the miRNA binds the 3'UTR of HMGCR, PCSK9, Idol, or a combination thereof, and inhibits gene expression.
  • the method reduces LDL-C levels in the circulation of a subject by at least 20%, preferably by at least 40%, more preferably by at least 60%.
  • the microRNA composition increases LDLR levels in liver cells of the subject by at least 10%, preferably by at least 20%, more preferably by at least 30%.
  • the disclosed miRNA compositions can be used to treat one or more lipid disorders in a subject.
  • Lipid disorders are associated with an increased risk for vascular disease, and especially heart attacks and strokes.
  • Lipid disorders may also be associated with other diseases including diabetes, metabolic syndrome, underactive thyroid, or the result of certain
  • the disclosed miRNA compositions are used to treat hypercholesterolemia or hyperlipoproteinemia in a subject in need thereof.
  • Hypercholesterolemia is the presence of high levels of cholesterol in the blood.
  • Hyperlipoproteinemia is the presence of elevated levels of lipoproteins in the blood).
  • hypercholesterolemia itself is asymptomatic, longstanding elevation of serum cholesterol can lead to atherosclerosis and coronary artery disease (CAD).
  • CAD coronary artery disease
  • Hypercholesterolemia is typically due to a combination of environmental and genetic factors.
  • hypercholesterolaemia Secondary causes include diabetes mellitus type 2, obesity, alcohol, monoclonal gammopathy, dialysis, nephrotic syndrome, obstructive jaundice, hypothyroidism, Cushing's syndrome, anorexia nervosa, and certain medications (e.g., thiazide diuretics, ciclosporin, glucocorticoids, beta blockers, retinoic acid).
  • medications e.g., thiazide diuretics, ciclosporin, glucocorticoids, beta blockers, retinoic acid.
  • the disclosed miR A compositions are used to treat atherosclerosis in a subject in need thereof.
  • Atherosclerosis is a disorder of the arteries in which fatty substances, cholesterol, cellular waste products, calcium and other substances collect in deposits along an artery wall, resulting in the formation of atherosclerotic plaques.
  • an atherosclerotic plaque may grow large enough that blood flow is restricted. Additionally atherosclerotic plaques may become fragile and rupture, causing blood clots to form or causing a piece of a plaque to dissociate and move through the bloodstream.
  • Atherosclerosis can lead to serious health problems, including heart attack and stroke.
  • the disclosed method reduces atherosclerotic plaque size or prevents an increase in atherosclerotic plaque size in the subject.
  • the method can involve a 5%, 6%, 7%, 8%, 9%, 10%, 1 1%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, or higher decrease in plaque size.
  • Atherosclerosis develops from LDL becoming oxidized by free radicals, particularly reactive oxygen species (ROS).
  • ROS reactive oxygen species
  • oxidized LDL comes in contact with an artery wall
  • a series of reactions occur to repair the damage to the artery wall caused by oxidized LDL.
  • the body's immune system responds to the damage to the artery wall caused by oxidized LDL by sending specialized white blood cells (macrophages and T-lymphocytes) to absorb the oxidized-LDL forming specialized foam cells.
  • white blood cells are not able to process the oxidized-LDL, and ultimately grow then rupture, depositing a greater amount of oxidized cholesterol into the artery wall. This triggers more white blood cells, continuing the cycle.
  • the disclosed method can prevent atherosclerotic plaque rupture in a subject.
  • Coronary artery disease is the end result of the accumulation of atheromatous plaques within the walls of the coronary arteries that supply the myocardium with oxygen and nutrients. CAD is the leading cause of death worldwide. While the symptoms and signs of coronary artery disease are noted in the advanced state of disease, most individuals with coronary artery disease show no evidence of disease for decades as the disease progresses before the first onset of symptoms, often a sudden heart attack, finally arises. After decades of progression, some of these atheromatous plaques may rupture and (along with the activation of the blood clotting system) start limiting blood flow to the heart muscle. Therefore, methods for treating or preventing CAD in a subject in need thereof are also disclosed that involve administering an effective amount of a disclosed miRNA composition to the subject.
  • Atherosclerosis may be detected in subjects by angiography or stress- testing. Additional methods of detection include anatomic methods such as coronary calcium scoring by computerized tomography, carotid IMT (intimal media thickness) measurement by ultrasound, intravascular ultrasound. Physiologic methods of detection include lipoprotein subclass analysis, and measurements of HbAlc, high sensitivity C-reactive protein, and
  • a polynucleotide formulation may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated.
  • the polynucleotide can be administered to the subject either as an oligonucleotide in conjunction with a delivery reagent, or as a recombinant plasmid or viral vector that expresses the polynucleotide.
  • Nucleic acid molecules can be administered to cells by a variety of methods known to those of skill in the art, including, but not restricted to,
  • liposomes by ionophoresis, or by incorporation into other vehicles, such as hydrogels, biodegradable nanocapsules, and bioadhesive microspheres, or by proteinaceous vectors.
  • the polynucleotide formulation can be administered to the subject by any means suitable for delivering the agent to the cells of the tissue at or near the area of unwanted HMGCR, PCSK9, and/or Idol expression.
  • a disclosed polynucleotide formulation can be delivered directly to the liver, or can be conjugated to a molecule that targets the liver.
  • Suitable parenteral administration routes include intravascular administration (e.g., intravenous bolus injection, intravenous infusion, intraarterial bolus injection, intra-arterial infusion and catheter instillation into the vasculature); peri- and intra-tissue injection (e.g., intraocular injection, intra- retinal injection, or sub-retinal injection); subcutaneous injection or deposition including subcutaneous infusion (such as by osmotic pumps); direct application by a catheter or other placement device (e.g., an implant comprising a porous, non-porous, or gelatinous material).
  • intravascular administration e.g., intravenous bolus injection, intravenous infusion, intraarterial bolus injection, intra-arterial infusion and catheter instillation into the vasculature
  • peri- and intra-tissue injection e.g., intraocular injection, intra- retinal injection, or sub-retinal injection
  • subcutaneous injection or deposition including subcutaneous infusion
  • the polynucleotide formulation can be provided in sustained release composition.
  • immediate or sustained release compositions depends on the nature of the condition being treated. If the condition consists of an acute or over-acute disorder, treatment with an immediate release form will be preferred over a prolonged release composition. Alternatively, for certain preventative or long-term treatments, a sustained release composition may be appropriate.
  • the polynucleotide formulation can be administered in a single dose or in multiple doses. Certain factors may influence the dosage required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present. It will also be appreciated that the effective dosage of the oligonucleotide used for treatment may increase or decrease over the course of a particular treatment. Changes in dosage may result and become apparent from the results of diagnostic assays. For example, the subject can be monitored after administering an oligonucleotide composition. Based on information from the monitoring, an additional amount of the oligonucleotide composition can be administered.
  • Dosing is dependent on severity and responsiveness of the disease condition to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of disease state is achieved.
  • Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Optimum dosages may vary depending on the relative potency of individual polynucleotides, and can generally be estimated based on EC5 0 S found to be effective in in vitro and in vivo animal models.
  • Dosage levels on the order of about ⁇ g/kg to 100 mg/kg of body weight per administration are useful in the treatment of a disease.
  • One skilled in the art can also readily determine an appropriate dosage regimen for administering the disclosed polynucleotides to a given subject.
  • the polynucleotides can be administered to the subject once, e.g., as a single injection.
  • the polynucleotides can be administered once or twice daily to a subject for a period of from about three to about twenty-eight days, or from about seven to about ten days.
  • the disclosed polynucleotides formulations can be administered at a unit dose less than about 75 mg per kg of bodyweight, or less than about 70, 60, 50, 40, 30, 20, 10, 5, 2, 1, 0.5, 0.1, 0.05, 0.01, 0.005, 0.001, or 0.0005 mg per kg of bodyweight, and less than 200 nmol of polynucleotidesper kg of bodyweight, or less than 1500, 750, 300, 150, 75, 15, 7.5, 1.5, 0.75, 0.15, 0.075, 0.015, 0.0075, 0.0015, 0.00075, 0.00015 nmol of polynucleotidesper kg of bodyweight.
  • Delivery of a polynucleotides formulation directly to an organ can be at a dosage on the order of about 0.00001 mg to about 3 mg per organ, or preferably about 0.0001-0.001 mg per organ, about 0.03-3.0 mg per organ, about 0.1-3.0 mg per organ or about 0.3-3.0 mg per organ.
  • the effective amount of polynucleotides administered to the subject can include the total amount of polynucleotides administered over the entire dosage regimen.
  • the exact individual dosages may be adjusted somewhat depending on a variety of factors, including the specific polynucleotides being administered, the time of administration, the route of administration, the nature of the formulation, the rate of excretion, the particular disorder being treated, the severity of the disorder, the pharmacodynamics of the polynucleotides, and the age, sex, weight, and general health of the patient. Wide variations in the necessary dosage level are to be expected in view of the differing efficiencies of the various routes of administration. Variations in these dosage levels can be adjusted using standard empirical routines of optimization, which are well- known in the art. The precise therapeutically effective dosage levels and patterns are preferably determined by the attending physician in
  • a subject is administered an initial dose, and one or more maintenance doses of an oligonucleotide formulation.
  • the maintenance dose or doses are generally lower than the initial dose, e.g., one- half less of the initial dose.
  • a maintenance regimen can include treating the subject with a dose or doses ranging from 0.01 ⁇ g to 75 mg/kg of body weight per day, e.g., 70, 60, 50, 40, 30, 20, 10, 5, 2, 1, 0.5, 0.1, 0.05, 0.01, 0.005, 0.001, or 0.0005 mg per kg of bodyweight per day.
  • the maintenance doses are preferably administered no more than once every 5, 10, or 30 days.
  • the treatment regimen may last for a period of time which will vary depending upon the nature of the particular disease, its severity and the overall condition of the patient.
  • the dosage may be delivered no more than once per day, e.g., no more than once per 24, 36, 48, or more hours, e.g., no more than once every 5 or 8 days.
  • the patient can be monitored for changes in his condition and for alleviation of the symptoms of the disease state.
  • the dosage of the compound may either be increased in the event the patient does not respond significantly to current dosage levels, or the dose may be decreased if an alleviation of the symptoms of the disease state is observed, if the disease state has been ablated, or if undesired side-effects are observed.
  • the oligonucleotide formulations can be administered prophylactically in order to prevent or slow the onset of a particular disease or disorder.
  • miRNAs were identified in a genome-wide screen of miRNAs altered by cellular cholesterol content whose expression were altered by cholesterol status.
  • miR-520d-5p (herein referred to as miR-520d) was upregulated 3.6-fold in cholesterol depleted vs.
  • miRNA target prediction algorithms TargetScan, miRANDA. Putative binding sites were identified for miR-520d in the 3'UTR of PCSK9, Idol, and HMGCR (Figs. 2A, 2B, and 2C, respectively), two proteins that regulate the LDL-R. Further analysis uncovered sites for a second miRNA, miR-224, also predicted to target the 3 'UTR of PCSK9, Idol, and HMGCR (Figs. 2A, 2B, and 2C respectively), suggesting that these microRNAs contribute to LDL-C homeostasis by regulating the LDL-R.
  • Figures 1A-1L show that miR-224 and miR-520 and target transcripts expressed in human and mouse tissues.
  • Figures 1A and IB are line graphs showing the fold change of miR-224 (Fig. 1A) and miR-520d-5p ("miR- 520d") (Fig. IB) in human THP-1 macrophages after treatment with a statin as a function of time (hours).
  • Figures 1C and ID show the results of QRT- PCR analysis of miR-224, miR-520, PCSK9 and Idol expression in HepG2 cells treated by T090 (Fig. 1C) or statin (Fig. ID).
  • Figures IE and IF show the results of QRT-PCR analysis of miR-224 (Fig.
  • FIG. 1G-1H show the results of QRT-PCR analysis of PCSK9 (Fig 1G), Idol (Fig 1H) and LDLR (Fig. II) expression in various human tissues (lung, liver, kidney, brain, spleen, heart, skeletal muscle, and adipose).
  • Figures 1I-1K show the results of QRT-PCR analysis of PCSK9 (Fig II), Idol (Fig 1J) and LDLR (Fig. IK) expression in various human tissues (lung, liver, kidney, brain, spleen, heart, skeletal muscle, and adipose).
  • Data for Figure 1C-1H are the mean ⁇ s.e.m. and are representative of > 3 experiments.
  • Figures 2A-2C show the predicted target sites of miR-520d and miR- 224 in the 3 'UTRs of PCSK9, Idol and HMGCR.
  • Idol has 2 putative binding sites for miR-520d and 1 for miR-224;
  • PCSK9 has 2 putative binding sites for miR-520d and miR-224;
  • HMGCR has 2 putative binding sites for miR- 520d and 3 for miR-224.
  • Site prediction is based on analysis using
  • FIGs. 2D-2G are lines graphs showing the activity of a luciferase reporter fused to the 3 'UTR of Idol (Fig. 2D), PCSK9 (Fig. 2E) or HMGCR (Fig. 2F) in HEK293T cells transfected with increasing concentrations of the indicated miRNAs.
  • miRNA mimics it was determined that as little as 5nM of either miR-520d or miR-224 reduced 3'UTR activities of both PCSK9 and Idol by 50-70% compared to control miR (Figs. 2D and 2E).
  • Human 293T cells were also transfected with a HMGCR-3'UTR- luciferase reporter construct in the presence/absence of control miR, miR- 224 or miR-520d mimics at the indicated concentration, and luciferase activity was measured (Fig. 2G).
  • luciferase activity is reduced by miR-224 and miR- 520d treatment, indicating that they target the 3 'UTR of HMGCR (Fig. 2G).
  • Example 3 miR-520d and miR-224 post-transcriptionally regulate PCSK9, Idol, HMGCR and LDLR
  • Figures 3A-3F are bar graphs showing relative mRNA levels of Idol (Fig. 3A) or PCSK9 (Fig. 3B) in HepG2 cells transfected with control miR mimic, miR-520d, or miR-224.
  • Figures 3C-3D are bar graphs showing relative mRNA levels of PCSK9 (Fig. 3C) or Idol (Fig. 3D) in HEPG2 cells transfected with miR-520d or control miR and treated with AcLDL or LXR ligand.
  • Figure 3E is a bar graph showing PCSK9 protein levels in HEPG2 cells transfected with miR-520d (bars 4-6) or control miR (bars 1-3) and treated with AcLDL (bars 2 and 5) or LXR ligand (bars 3 and 5)
  • Figure 3F is a bar graph showing the results for PCSK9, Idol, HMGCR, LDLR presented in as relative change in mRNA level. The results indicated that transfection of HepG2 cells with miR-520d inhibited Idol and PCSK9 mRNA levels by approximately 30% compared to a control miRNA (Figs. 3A and 3B, respectively). These cells showed an approximate 40% decrease in PCSK9 protein in basal and AcLDL and LXR treated cells (Fig. 3F).
  • Table 2 Western blot analysis of PCSK9 and LDLR in HepG2 cells transfected with miR-540
  • Table 3 Western blot analysis of IDOL in HepG2 cells transfected with miR-224 or miR-540
  • Figure 3G is bar graph showing the results of an ELISA assay detecting PCSK9 protein in supernatants of HepG2 cells transfected with miR-520d and miR-224.
  • Figure 3H is a bar graph showing the results of QRT-PCR analysis of expression of PCSK9, IDOL, and HMGCR in Huh-7 cells transfected with miR-520d and miR-224.
  • Huh-7 cells untreated or treated with 5 ⁇ statin or ⁇ ⁇ GW3965 and transfected with miR-520d and miR-224 were analyzed by Western blot analysis for expression of PCSK9, HMGCR, and LDLR. The results are presented as relative density (AU) compared to untreated control miR (1.00) in Tables 4 and 5 below:
  • Table 4 Western blot analysis of PCSK9, HMGCR, and LDLR in Huh-7 cells transfected with miR-224
  • Table 5 Western blot analysis of PCSK9 and LDLR in Huh-7 cells transfected with miR-540
  • Figure 31 is a bar graphs showing the results of QRT-PCR analysis of expression of PCSK9 in HEPA cells transfected with miR-520d and loaded with cholesterol by acLDL treatment and by LXR agonist treatment (*p ⁇ 0.05). Protein levels were also Western blot analysis. The results are presented as relative density (AU) compared to untreated control miR (1.00) in Table 6 below:
  • Table 6 Western blot analysis of PCSK9 in HEPA cells transfected with miR-520d and loaded with cholesterol by acLDL treatment and by LXR agonist treatment
  • Example 4 miR-520d and miR-224 Post-transcriptionally Regulate PCSK9, Idol, HMGCR and LDLR in peritoneal macrophages
  • Figure 4 is a bar graph showing the results of QRT-PCR analysis of the expression (relative change in mRNA) of PCSK9, Idol, and Idol with GW3965 treatment in peritoneal macrophages transfected with control, miR- 224, miR-520d.
  • GW3965 and transfected with miR-520d and miR-224 were analyzed by Western blot analysis for expression of pro-PCSK9, PCSK9, HMGCR, and LDLR. The results are presented as relative density (AU) compared to untreated control miR (1.00) in Tables 7 and 8 below:
  • Table 7 Western blot analysis of PCSK9, HMGCR, and LDLR in peritoneal macrophages transfected with miR-224
  • Table 8 Western blot analysis of PCSK9, HMGCR, and LDLR in peritoneal macrophages transfected with miR-540d
  • Peritoneal macrophages untreated or treated with GW3965 and transfected with miR-520d and miR-224 were analyzed by Western blot analysis for expression of IDOL and LDLR. The results are presented as relative density (AU) compared to untreated control miR (1.00) in Tables 9 below: Table 9: Western blot analysis of IDOL and LDLR in peritoneal macrophages transfected with miRNA-224 or miR-540d
  • THP- 1 cells Human acute monocytic leukemia cell line
  • miR-520d or miR-224 were transfected with miR-520d or miR-224 and stimulated by acLDL treatment (Table 10) and by LXR agonist (Table 11), respectively, and analyzed by Western blot analysis for expression of PCSK9.
  • the results are presented as relative density (AU) compared to untreated control miR (1.00) in Tables 10 and 11 below:
  • Table 10 Western blot analysis of PCSK9 in THP-1 cells (Human acute monocytic leukemia cell line) transfected with miR-224 or miR-520d and stimulated by acLDL treatment
  • Table 11 Western blot analysis of PCSK9 in THP-1 cells (Human acute monocytic leukemia cell line) transfected with miR-224 or miR-520d and stimulated by LXR agonist
  • Example 5 Inhibitors of miR-224 and miR-520d Increase Expression of PCSK9, IDOL, and HMGCR.
  • Figure 5 is a bar graph showing the results of QRT-PCR analysis
  • 293T cells transfected with inhibitors of miR-224 (lnh-miR-224) and miR-520d (lnh-mi-520) were analyzed by Western blot analysis for
  • Table 12 Western blot analysis of 293T cells transfected with inhibitors of miR-224 (lnh-miR-224) and miR-520d (lnh-mi-520)
  • Peritoneal macrophages untreated or treated with LXR or statin and transfected with inhibitors of miR-224 (lnh-miR-224) and miR-520d (lnh- mi-520) were analyzed by Western blot analysis for expression of pro- PCSK9, PCSK9, HMGCR, and LDLR. The results are presented as relative density (AU) compared to untreated control inhibitor (Inh) (1.00) in Table 13 below:
  • HepG2 cells stably expressing LDLR-GFP and transfected with control miR or miR-224 or miR-520d were analyzed by
  • Figure 6A-6C are a series of fluorescence intensity plots (number of pixels vs. fluorescence intensity) showing control miR transfected cells (Fig. 6A), miR-224 transfected cells (Fig. 6B), and miR- 540d transfected cells (Fig. 6C) untreated, treated with the LXR agonist, or treated with statin as labeled.
  • GW3965 which upregulates Idol, caused internalization of LDLR-GFP.
  • the graphs in Figs. 6A-6C show the mean fluorescence intensity across a line drawn through an immunofluorescent image of plated cells ( ⁇ ).
  • Example 7 miR-224 and miR-520d Increase dil-LDL Binding to LDLR
  • HepG2 cells were transfected with control miR or miR-224 or miR- 520d were analyzed by immunofluorescence and left untreated, treated with the LXR agonist (GW3965) which upregulate Idol or treated with statin, or incubated with 5 ⁇ g/ml of dil-LDL for 30 min at 4°C. Dil-LDL binding was shown in red and nuclei stained with DAPI (blue). Cells transfected with miR-224 and miR-520d showed increased dil-LDL binding to LDLR.
  • LXR agonist GW3965

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Plant Pathology (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Virology (AREA)
  • Diabetes (AREA)
  • Hematology (AREA)
  • Obesity (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention concerne des procédés de réduction des niveaux de cholestérol lipoprotéique à faible densité dans la circulation sanguine d'un sujet. Les procédés entraînent l'administration, à un sujet qui en a besoin, d'une composition qui administre aux cellules chez le sujet une quantité efficace de micro-ARN qui lie et inhibe la région 3' non traduite de l'HMG-CoA réductase, de PCSK9, d'Idol ou d'une combinaison de ceux-ci. L'invention concerne également des compositions pharmaceutiques et des vecteurs d'expression pour leur utilisation dans les procédés de l'invention.
PCT/US2013/032271 2012-04-13 2013-03-15 Régulation par micro-arn de la voie du récepteur des ldl WO2013154766A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201261623920P 2012-04-13 2012-04-13
US61/623,920 2012-04-13

Publications (1)

Publication Number Publication Date
WO2013154766A1 true WO2013154766A1 (fr) 2013-10-17

Family

ID=48040457

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2013/032271 WO2013154766A1 (fr) 2012-04-13 2013-03-15 Régulation par micro-arn de la voie du récepteur des ldl

Country Status (1)

Country Link
WO (1) WO2013154766A1 (fr)

Cited By (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8822663B2 (en) 2010-08-06 2014-09-02 Moderna Therapeutics, Inc. Engineered nucleic acids and methods of use thereof
WO2014152540A1 (fr) 2013-03-15 2014-09-25 Moderna Therapeutics, Inc. Compositions et procédés de modification des taux de cholestérol
US8999380B2 (en) 2012-04-02 2015-04-07 Moderna Therapeutics, Inc. Modified polynucleotides for the production of biologics and proteins associated with human disease
WO2015051214A1 (fr) 2013-10-03 2015-04-09 Moderna Therapeutics, Inc. Polynucléotides codant pour un récepteur de lipoprotéines de faible densité
US9107886B2 (en) 2012-04-02 2015-08-18 Moderna Therapeutics, Inc. Modified polynucleotides encoding basic helix-loop-helix family member E41
US9186372B2 (en) 2011-12-16 2015-11-17 Moderna Therapeutics, Inc. Split dose administration
US9227956B2 (en) 2013-04-17 2016-01-05 Pfizer Inc. Substituted amide compounds
US9283287B2 (en) 2012-04-02 2016-03-15 Moderna Therapeutics, Inc. Modified polynucleotides for the production of nuclear proteins
US9334328B2 (en) 2010-10-01 2016-05-10 Moderna Therapeutics, Inc. Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
US9428535B2 (en) 2011-10-03 2016-08-30 Moderna Therapeutics, Inc. Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
US9464124B2 (en) 2011-09-12 2016-10-11 Moderna Therapeutics, Inc. Engineered nucleic acids and methods of use thereof
US9533047B2 (en) 2011-03-31 2017-01-03 Modernatx, Inc. Delivery and formulation of engineered nucleic acids
US9572897B2 (en) 2012-04-02 2017-02-21 Modernatx, Inc. Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins
US9597380B2 (en) 2012-11-26 2017-03-21 Modernatx, Inc. Terminally modified RNA
WO2018189705A1 (fr) 2017-04-13 2018-10-18 Cadila Healthcare Limited Vaccin pcsk9 à base de nouveaux peptides
US10815291B2 (en) 2013-09-30 2020-10-27 Modernatx, Inc. Polynucleotides encoding immune modulating polypeptides
WO2021037972A1 (fr) * 2019-08-27 2021-03-04 Sanofi Compositions et procédés d'inhibition de pcsk9

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010100328A1 (fr) * 2009-03-06 2010-09-10 Valtion Teknillinen Tutkimuskeskus Acides nucléiques régulant la signalisation par le récepteur aux œstrogènes α (er) dans le cancer du sein
EP2298359A1 (fr) * 2008-06-04 2011-03-23 Kyowa Hakko Kirin Co., Ltd. Acide nucléique capable de réguler la dégranulation d'un mastocyte
WO2011048125A1 (fr) * 2009-10-20 2011-04-28 Santaris Pharma A/S Administration orale d'oligonucléotides de lna thérapeutiquement efficaces

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2298359A1 (fr) * 2008-06-04 2011-03-23 Kyowa Hakko Kirin Co., Ltd. Acide nucléique capable de réguler la dégranulation d'un mastocyte
WO2010100328A1 (fr) * 2009-03-06 2010-09-10 Valtion Teknillinen Tutkimuskeskus Acides nucléiques régulant la signalisation par le récepteur aux œstrogènes α (er) dans le cancer du sein
WO2011048125A1 (fr) * 2009-10-20 2011-04-28 Santaris Pharma A/S Administration orale d'oligonucléotides de lna thérapeutiquement efficaces

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
ABIFADEL, M. ET AL., NAT GENET, vol. 34, 2003, pages 154 - 156
COHEN, J.C. ET AL., NENGL JMED, vol. 354, 2006, pages 1264 - 1272
GRUNDY, S.M. ET AL., CIRCULATION, vol. 110, 2004, pages 227 - 239
HORTON, J.D. ET AL., J LIPID RES, vol. 50, 2009, pages 172 - 177
LEIGH GOEDEKE ET AL: "Regulation of cholesterol homeostasis", CMLS : CELLULAR AND MOLECULAR LIFE SCIENCES, vol. 69, no. 6, 19 October 2011 (2011-10-19), pages 915 - 930, XP035019642, ISSN: 1420-9071, DOI: 10.1007/S00018-011-0857-5 *
NOAM ZELCER ET AL: "LXR Regulates Cholesterol Uptake Through Idol-Dependent Ubiquitination of the LDL Receptor", SCIENCE, vol. 325, 3 July 2009 (2009-07-03), pages 100 - 104, XP008150976, ISSN: 0036-8075 *
O HIBBITT ET AL: "RNAi-mediated knockdown of HMG CoA reductase enhances gene expression from physiologically regulated low-density lipoprotein receptor therapeutic vectors in vivo", GENE THERAPY, vol. 19, no. 4, 1 April 2012 (2012-04-01), pages 463 - 467, XP055073263, ISSN: 0969-7128, DOI: 10.1038/gt.2011.103 *
RAYNER, K.J. ET AL., SCIENCE, vol. 328, no. 5985, 2010, pages 1570 - 3
ZELCER, N. ET AL., SCIENCE, vol. 325, 2009, pages 100 - 104

Cited By (53)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9447164B2 (en) 2010-08-06 2016-09-20 Moderna Therapeutics, Inc. Engineered nucleic acids and methods of use thereof
US9181319B2 (en) 2010-08-06 2015-11-10 Moderna Therapeutics, Inc. Engineered nucleic acids and methods of use thereof
US8822663B2 (en) 2010-08-06 2014-09-02 Moderna Therapeutics, Inc. Engineered nucleic acids and methods of use thereof
US9937233B2 (en) 2010-08-06 2018-04-10 Modernatx, Inc. Engineered nucleic acids and methods of use thereof
US10064959B2 (en) 2010-10-01 2018-09-04 Modernatx, Inc. Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
US9334328B2 (en) 2010-10-01 2016-05-10 Moderna Therapeutics, Inc. Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
US9657295B2 (en) 2010-10-01 2017-05-23 Modernatx, Inc. Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
US9950068B2 (en) 2011-03-31 2018-04-24 Modernatx, Inc. Delivery and formulation of engineered nucleic acids
US9533047B2 (en) 2011-03-31 2017-01-03 Modernatx, Inc. Delivery and formulation of engineered nucleic acids
US10022425B2 (en) 2011-09-12 2018-07-17 Modernatx, Inc. Engineered nucleic acids and methods of use thereof
US9464124B2 (en) 2011-09-12 2016-10-11 Moderna Therapeutics, Inc. Engineered nucleic acids and methods of use thereof
US10751386B2 (en) 2011-09-12 2020-08-25 Modernatx, Inc. Engineered nucleic acids and methods of use thereof
US9428535B2 (en) 2011-10-03 2016-08-30 Moderna Therapeutics, Inc. Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
US9186372B2 (en) 2011-12-16 2015-11-17 Moderna Therapeutics, Inc. Split dose administration
US9271996B2 (en) 2011-12-16 2016-03-01 Moderna Therapeutics, Inc. Formulation and delivery of PLGA microspheres
US9295689B2 (en) 2011-12-16 2016-03-29 Moderna Therapeutics, Inc. Formulation and delivery of PLGA microspheres
US9303079B2 (en) 2012-04-02 2016-04-05 Moderna Therapeutics, Inc. Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins
US9107886B2 (en) 2012-04-02 2015-08-18 Moderna Therapeutics, Inc. Modified polynucleotides encoding basic helix-loop-helix family member E41
US8999380B2 (en) 2012-04-02 2015-04-07 Moderna Therapeutics, Inc. Modified polynucleotides for the production of biologics and proteins associated with human disease
US9233141B2 (en) 2012-04-02 2016-01-12 Moderna Therapeutics, Inc. Modified polynucleotides for the production of proteins associated with blood and lymphatic disorders
US9254311B2 (en) 2012-04-02 2016-02-09 Moderna Therapeutics, Inc. Modified polynucleotides for the production of proteins
US9255129B2 (en) 2012-04-02 2016-02-09 Moderna Therapeutics, Inc. Modified polynucleotides encoding SIAH E3 ubiquitin protein ligase 1
US10501512B2 (en) 2012-04-02 2019-12-10 Modernatx, Inc. Modified polynucleotides
US9283287B2 (en) 2012-04-02 2016-03-15 Moderna Therapeutics, Inc. Modified polynucleotides for the production of nuclear proteins
US9220792B2 (en) 2012-04-02 2015-12-29 Moderna Therapeutics, Inc. Modified polynucleotides encoding aquaporin-5
US9301993B2 (en) 2012-04-02 2016-04-05 Moderna Therapeutics, Inc. Modified polynucleotides encoding apoptosis inducing factor 1
US9220755B2 (en) 2012-04-02 2015-12-29 Moderna Therapeutics, Inc. Modified polynucleotides for the production of proteins associated with blood and lymphatic disorders
US9221891B2 (en) 2012-04-02 2015-12-29 Moderna Therapeutics, Inc. In vivo production of proteins
US9216205B2 (en) 2012-04-02 2015-12-22 Moderna Therapeutics, Inc. Modified polynucleotides encoding granulysin
US9192651B2 (en) 2012-04-02 2015-11-24 Moderna Therapeutics, Inc. Modified polynucleotides for the production of secreted proteins
US9149506B2 (en) 2012-04-02 2015-10-06 Moderna Therapeutics, Inc. Modified polynucleotides encoding septin-4
US9114113B2 (en) 2012-04-02 2015-08-25 Moderna Therapeutics, Inc. Modified polynucleotides encoding citeD4
US9572897B2 (en) 2012-04-02 2017-02-21 Modernatx, Inc. Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins
US9587003B2 (en) 2012-04-02 2017-03-07 Modernatx, Inc. Modified polynucleotides for the production of oncology-related proteins and peptides
US9050297B2 (en) 2012-04-02 2015-06-09 Moderna Therapeutics, Inc. Modified polynucleotides encoding aryl hydrocarbon receptor nuclear translocator
US9061059B2 (en) 2012-04-02 2015-06-23 Moderna Therapeutics, Inc. Modified polynucleotides for treating protein deficiency
US9675668B2 (en) 2012-04-02 2017-06-13 Moderna Therapeutics, Inc. Modified polynucleotides encoding hepatitis A virus cellular receptor 2
US9782462B2 (en) 2012-04-02 2017-10-10 Modernatx, Inc. Modified polynucleotides for the production of proteins associated with human disease
US9814760B2 (en) 2012-04-02 2017-11-14 Modernatx, Inc. Modified polynucleotides for the production of biologics and proteins associated with human disease
US9828416B2 (en) 2012-04-02 2017-11-28 Modernatx, Inc. Modified polynucleotides for the production of secreted proteins
US9827332B2 (en) 2012-04-02 2017-11-28 Modernatx, Inc. Modified polynucleotides for the production of proteins
US9878056B2 (en) 2012-04-02 2018-01-30 Modernatx, Inc. Modified polynucleotides for the production of cosmetic proteins and peptides
US9095552B2 (en) 2012-04-02 2015-08-04 Moderna Therapeutics, Inc. Modified polynucleotides encoding copper metabolism (MURR1) domain containing 1
US9089604B2 (en) 2012-04-02 2015-07-28 Moderna Therapeutics, Inc. Modified polynucleotides for treating galactosylceramidase protein deficiency
US9597380B2 (en) 2012-11-26 2017-03-21 Modernatx, Inc. Terminally modified RNA
US8980864B2 (en) 2013-03-15 2015-03-17 Moderna Therapeutics, Inc. Compositions and methods of altering cholesterol levels
WO2014152540A1 (fr) 2013-03-15 2014-09-25 Moderna Therapeutics, Inc. Compositions et procédés de modification des taux de cholestérol
US9227956B2 (en) 2013-04-17 2016-01-05 Pfizer Inc. Substituted amide compounds
US10815291B2 (en) 2013-09-30 2020-10-27 Modernatx, Inc. Polynucleotides encoding immune modulating polypeptides
WO2015051214A1 (fr) 2013-10-03 2015-04-09 Moderna Therapeutics, Inc. Polynucléotides codant pour un récepteur de lipoprotéines de faible densité
US10323076B2 (en) 2013-10-03 2019-06-18 Modernatx, Inc. Polynucleotides encoding low density lipoprotein receptor
WO2018189705A1 (fr) 2017-04-13 2018-10-18 Cadila Healthcare Limited Vaccin pcsk9 à base de nouveaux peptides
WO2021037972A1 (fr) * 2019-08-27 2021-03-04 Sanofi Compositions et procédés d'inhibition de pcsk9

Similar Documents

Publication Publication Date Title
WO2013154766A1 (fr) Régulation par micro-arn de la voie du récepteur des ldl
US11851655B2 (en) Compositions and methods for modulating apolipoprotein (a) expression
Khorkova et al. Oligonucleotide therapies for disorders of the nervous system
JP7504482B2 (ja) ハンチンチンｍＲＮＡをターゲティングするオリゴヌクレオチド化合物
Koller et al. Mechanisms of single-stranded phosphorothioate modified antisense oligonucleotide accumulation in hepatocytes
Deng et al. Therapeutic potentials of gene silencing by RNA interference: principles, challenges, and new strategies
AU2020257111A1 (en) RNA modulating oligonucleotides with improved characteristics for the treatment of Duchenne and Becker muscular dystrophy
EP2281041B1 (fr) Réduction au silence de l'expression du gène csn5 au moyen d'arn interférant
US9023820B2 (en) Compositions and methods for silencing apolipoprotein C-III expression
JP7406793B2 (ja) ２テイル自己デリバリー型ｓｉＲＮＡおよび関連方法
EP2911695B1 (fr) Compositions et procédés pour le traitement de la maladie de parkinson par l'administration sélective de molécules oligonucléotidiques à des types de neurones spécifiques
JP2011507534A (ja) 干渉ｒｎａを使用したポロ様キナーゼ発現のサイレンシング方法
JP2022528487A (ja) Ｃ９ｏｒｆ７２のオリゴヌクレオチドベースの調節
CN113811311A (zh) 用于组织特异性apoe调节的寡核苷酸
JP2023545502A (ja) リポタンパク質（ａ）を阻害するためのｒｎａ組成物および方法
WO2015051135A2 (fr) Compositions organiques destinées au traitement de maladies associées à l'hepcidine
Morin et al. Systemic delivery and quantification of unformulated interfering RNAs in vivo
CA3163139A1 (fr) Compositions et methodes pour le traitement du cancer
Denti et al. Oligonucleotide Therapy
WO2024026565A1 (fr) Compositions et procédés d'inhibition de l'adénylate cyclase 9 (ac9)
Yang Development and evaluation of nano-scale systems for targeted delivery to treat liver fibrosis

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13713320

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13713320

Country of ref document: EP

Kind code of ref document: A1