WO2013128204A1 - Method of identifying vdj recombination products - Google Patents
Method of identifying vdj recombination products Download PDFInfo
- Publication number
- WO2013128204A1 WO2013128204A1 PCT/GB2013/050516 GB2013050516W WO2013128204A1 WO 2013128204 A1 WO2013128204 A1 WO 2013128204A1 GB 2013050516 W GB2013050516 W GB 2013050516W WO 2013128204 A1 WO2013128204 A1 WO 2013128204A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- vdj
- vdj recombination
- nucleic acid
- pcr
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6881—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for tissue or cell typing, e.g. human leukocyte antigen [HLA] probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Definitions
- the invention relates to a method of identifying VDJ recombination products which comprises the use of sequence specific enrichment and specific restriction endonuclease enzymes or other DNA-shearing approaches to provide high resolution and high throughput interrogation of antigen receptor repertoires.
- VDJ recombination also known as somatic recombination, is a mechanism of genetic recombination in the early stages of immunoglobulin (Ig) and T cell receptor (TCR) production of the immune system .
- VDJ recombination nearly- randomly combines Variable (V), Diverse (D) and Joining (J) gene segments of vertebrates, and because of its randomness in choosing different genes, is able to diversely encode proteins to match antigens from bacteria, viruses, parasites, dysfunctional cells such as tumor cells and pollens.
- VDJ recombination of the mouse immunoglobulin heavy chain locus is pictorially shown in Figure 1.
- This is a large 3 Mb locus consisting of approximately 195 variable (V) genes, 10 diversity (D) genes and 4 joining (J) genes. These are the segments that participate in VDJ recombination.
- V variable
- D diversity
- J joining
- the first event in the VDJ recombination of this locus is that one of the D genes rearranges to one of the J genes. Following this, one of the V genes is appended to this DJ rearrangement to form the functional VDJ rearranged gene that then codes for the variable segment of the heavy chain protein.
- This recombination process takes place in a stepwise fashion in progenitor B cells to produce the diversity required for the antibody repertoire but there is another requirement - that of specificity such that each B cell only produces one antibody.
- This specificity is fundamental for the function of the immune system and is achieved by a process called allelic exclusion such that functional rearrangement of one allele signals via a currently unclear mechanism to prevent further recombination of the second allele.
- allelic exclusion such that functional rearrangement of one allele signals via a currently unclear mechanism to prevent further recombination of the second allele.
- the existing methodology uses PCR-based approaches to identify VDJ recombination products.
- This comprises pairs of primers, where one primer binds to one of the four J genes, common to all VDJ recombination products, or a sequence immediately downstream of a J gene, in combination with a primer or primers specific for the V gene component of the VDJ recombination product.
- V gene families (16 in the mouse Igh)
- V gene primers must be designed for each family. This introduces a bias in quantitative comparative analysis, since amplification of individual V gene families will depend on the relative efficiencies of the V gene primers designed for different V gene families, and differences in efficiency introduce inaccuracies in comparative analysis.
- V gene members have slightly different sequences and thus, unless a primer can be designed that matches each V gene member sequence 100%, this will introduce bias in comparative amplification of V genes within a family.
- V gene primer that can detect all V family members.
- the only way to circumvent this is to design primers to subsets of V genes within a family, but this introduces an additional bias again, due to different efficiency of amplification with different PCR primers.
- the combination of these two problems means that current methods cannot provide an unbiased and complete analysis of the VDJ recombination products in a sample.
- the current PCR-based methods also have a problem with scale.
- the usual step after PCR amplification is to clone and sequence the PCR products.
- V genes there are almost 200 V genes in the mouse Igh. The most frequent aim is to determine how often these are used relative to each other in the immunoglobulin repertoire.
- 200 clones would have to be sequenced.
- a method of identifying a VDJ recombination product which comprises the following steps:
- nucleic acid sample comprises DNA
- fragmenting the VDJ recombination product either by sonication, shearing or performing a restriction endonuclease reaction at a first site downstream of each of the J genes or downstream of the constant region, and a second site within or immediately upstream of the V gene to generate digested VDJ recombined fragments and unrecombined J fragments;
- nucleic acid sample comprises DNA
- annealing oligonucleotides to the digested fragments at unique regions within or immediately downstream of each of the J genes
- nucleic acid sample is cDNA or RNA
- VDJ recombination product obtainable by the method as described herein.
- VDJ recombination product or a method of identifying a VDJ recombination product as described herein for use in monitoring an immunodeficiency disorder.
- Figures 1 and 2 provide an overview of the concept of VDJ recombination for the generation of antibody diversity.
- Figures 3-5 provide schematic overviews of alternative embodiments of the method of the invention.
- Figure 6 provides a schematic demonstrating the high resolution comparative frequency of recombination of V genes throughout the mouse Igh V region.
- Figure 7 provides a detailed picture of usage of each one of 195 individual V genes analysed by the method of the invention in accordance with the methodology described in Example 1.
- Figure 8 provides a detailed picture of the recombination frequency for Example 2 with sonication in Mouse proB cells and Igh; Bl, B2, B3 are replicate samples; J4 indicates VDJ recombined sequences including J4.
- a method of identifying a VDJ recombination product which comprises the following steps:
- nucleic acid sample comprises DNA
- fragmenting the VDJ recombination product either by sonication, shearing or performing a restriction endonuclease reaction at a first site downstream of each of the J genes or downstream of the constant region, and a second site within or immediately upstream of the V gene to generate digested VDJ recombined fragments and unrecombined J fragments;
- nucleic acid sample comprises DNA
- annealing oligonucleotides to the digested fragments at unique regions within or immediately downstream of each of the J genes
- nucleic acid sample is cDNA or RNA
- a method of identifying a VDJ recombination product which comprises the following steps:
- step (c) performing a primer extension reaction upon the primer annealed in step (b);
- the identification method of the invention provides a number of significant advantages over conventional techniques employed to determine the nature of a repertoire.
- the method of the invention offers a high resolution, high throughput interrogation of antigen receptor repertoires.
- the invention finds great utility in the interrogation of antigen receptor repertoires in mouse immunoglobulin heavy chain IgH and IgK and human heavy chain IgH, as described in the experimental procedure and data presented herein.
- the method has applicability to other repertoires and is also adaptable for other antigen receptor repertoires and other species, such as human, rabbit, rat and the like.
- the invention provides enrichment of VDJ and DJ recombined sequences along with the generation of large unbiased libraries of recombined sequences.
- the method of the invention allows the unambiguous identification of individual recombination events and complete details of V, D, J gene usage, N nucleotide addition and the like.
- the invention also has surprisingly high resolution and in particular has been able to identify a previously unknown recombination mechanism and chromosomal translocations. More particularly, the method of the invention offers advantages with respect to scalability.
- the method may be performed in a high throughput manner and as shown in the Examples described herein, approximately 100,000 unique VDJ recombinations were captured and identified which represents a 1000 fold increase over existing methods.
- the nucleic acid sample comprising a VDJ recombination product comprises a cell population. It will be appreciated that the cell population may be obtained from any species or organism containing transgenic antigen receptor loci . In one embodiment, the cell population is obtained from a mouse, such as a transgenic mouse. In an alternative embodiment, the cell population is obtained from a human.
- the cell population will comprise any suitable population of cells which would contain a VDJ recombination product.
- the cell population comprises an immunoglobulin containing cell.
- the immunoglobulin containing cell comprises a white blood cell .
- the white blood cell comprises a lymphocyte, such as a small lymphocyte.
- the small lymphocyte comprises a T cell or a B cell, such as a B cell .
- the VDJ recombination product is derived from a heavy chain immunoglobulin. In the developing B cell, the first recombination event to occur is between one D and one J gene segment of the heavy chain locus. Any DNA between these two genes is deleted.
- This D-J recombination is followed by the joining of one V gene, from a region upstream of the newly formed DJ complex, forming a rearranged VDJ gene. All other genes between V and D segments of the new VDJ gene are now deleted from the cell's genome.
- Primary transcript (unspliced RNA) is generated containing the VDJ region of the heavy chain and both the constant mu and delta chains (C and C 5 ). (i .e. the primary transcript contains the segments: V-D-J-C -C 5 ).
- the primary RNA is processed to add a polyadenylated (poly-A) tail after the C chain and to remove the
- the VDJ recombination product is derived from a light chain immunoglobulin.
- the kappa ( ⁇ ) and lambda ( ⁇ ) chains of the immunoglobulin light chain loci rearrange in a very similar manner to the heavy chain locus, except the light chains lack a D segment.
- the first step of recombination for the light chains involves the joining of the V and J chains to give a VJ complex before the addition of the constant chain gene during primary transcription.
- Translation of the spliced mRNA for either the kappa or lambda chains results in formation of the Ig ⁇ or Ig ⁇ light chain protein. Assembly of the Ig ⁇ heavy chain and one of the light chains results in the formation of membrane bound form of the immunoglobulin IgM that is expressed on the surface of the immature B cell.
- the cell population comprises a T cell .
- the VDJ recombination product is derived from a T cell receptor.
- TCR T cell receptor
- D-to-J recombination occurs first in the ⁇ chain of the TCR. This process can involve either the joining of the Dpi gene segment to one of six J p l segments or the joining of the D p 2 gene segment to one of seven J p 2 segments. DJ recombination is followed (as described above) with V p - to-DpJp rearrangements.
- Vp-D p -J p genes in the newly formed complex are deleted and the primary transcript is synthesized that incorporates the constant domain gene (Vp-D p -J p -Cp).
- mRNA transcription splices out any intervening sequence and allows translation of the full length protein for the TCR C p chain.
- T cell receptor (TCR) chains may also comprise gamma ( ⁇ ) and delta ( ⁇ ) chains which assemble to form ⁇ -TCR.
- the nucleic acid sample comprising a VDJ recombination product comprises a library of VDJ recombined nucleic acids obtained from an in vitro antibody production system, such as ribosome display.
- references herein to the term "identifying" refer to any step which enables one member of a repertoire of antigens to be differentially identified from that of another member of a repertoire of antigens.
- VDJ recombination product refers to the product of a recombination event between a variable (V), diversity (D) and joining (J) gene.
- the nucleic acid comprises DNA or RNA obtained from the sample.
- the nucleic acid comprises cDNA or mRNA.
- the nucleic acid comprises cDNA.
- the sample comprises a cell population, it will be appreciated that the process of obtaining nucleic acid from the cell population is readily apparent to the skilled person in accordance with standard molecular biology techniques.
- the nucleic acid sample is DNA.
- nucleic acid sample comprises cDNA or RNA (i.e. mRNA)
- steps (b) and (d) of the first aspect of the invention may be omitted.
- a method of identifying a VDJ recombination product which comprises the following steps:
- the oligonucleotide ⁇ e.g. a primer or in vitro transcribed RNA) used in step (c) is specific for a unique region within each of the J genes.
- the oligonucleotide used in step (c) is specific for a region immediately downstream of each of the J genes. It is beneficial for the oligonucleotide to be either within or very close to the J segment to prevent an excessive amount of bases being present when the final product is sequenced.
- the primer used in step (b) is specific for a unique region within each of the J genes.
- the primer used in step (b) is specific for a region immediately downstream of each of the J genes. It is beneficial for the primer to be either within or very close to the J segment to prevent an excessive amount of bases being present when the final product is sequenced.
- references herein to the term "unique" refer to a sequence which is not present within the remainder of the genome. This arrangement prevents other sequences being incorrectly identified by the method of the invention.
- the cell population comprises human cells
- 6 different primers will be required for each of the 6 different human J genes.
- the primers are selected from any of the primers described in SEQ ID NOS : 51 to 56.
- the 6 primers may be selected from other sequences within the six human J genes.
- the 4 primers may be selected from any of the primers described in SEQ ID NOS : 1 to 4. In an additional embodiment where the cell population comprises mouse cells, the 4 primers may be selected from any of the primers described in SEQ ID NOS : 47 to 50. In a further embodiment, where the cell population comprises mouse cells, the 4 primers may be selected from any of the primers described in SEQ ID NOS : 1 to 4. In an alternative embodiment where the cell population comprises mouse cells, the 4 primers may be selected from other sequences within the four mouse J genes.
- a single primer is used ⁇ e.g. in step (c) of the first aspect or in step (b) of the second aspect of the invention) which is specific for a region within an exon ⁇ i.e. any specific exon) of the constant region and thus all successfully VDJ recombined (and transcribed) products are captured regardless of J gene usage.
- step (c) of the first aspect of the invention comprises tagging the digested fragments with one member of a binding pair.
- the primer additionally comprises one member of a binding pair. This embodiment provides the advantage of allowing enrichment of the target J sequences over other sequences.
- binding pairs examples include biotin and streptavidin or an antigen and an antibody.
- the tag or primer additionally comprises biotin or streptavidin, such as biotin . It will be appreciated that enrichment of a biotinylated fragment will require a streptavidin containing moiety, such as a magnetic bead containing streptavidin, for example Dynabeads from the kilobaseBIN DER kit (Invitrogen) .
- step (c) of the first aspect of the invention additionally comprises the step of performing primer extension, oligonucleotide hybridization and/or reverse transcription .
- step (c) of the first aspect of the invention are readily apparent to the skilled person in accordance with standard molecular biology techniques.
- the nucleic acid sample is fragmented by sonication .
- the nucleic acid sample is fragmented by performing a restriction endonuclease reaction .
- the restriction endonuclease enzyme is selected from DpnII and/or Nlalll.
- the restriction endonuclease enzyme used is selected from DpnII and/or Nlalll.
- Restriction endonucleases are selected upon the following criteria : 4bp cutters are preferred to generate fragment sizes suitable for enrichment by magnetic beads. The restriction endonucleases must not cut anywhere within the J gene, or constant region, or 5' of the primers used in step (b) of the second aspect of the invention.
- the method comprises the use of a third restriction endonuclease enzyme.
- the third restriction endonuclease enzyme will be specific for a region upstream of the V gene.
- the sequencing method described herein comprises an Illumina sequencing method, such as the Illumina sequencing by synthesis (SBS) technology which is available from Illumina.
- SBS Illumina sequencing by synthesis
- the procedure will typically comprise addition of adapter molecules to each end of the VDJ recombination product, e.g. following restriction endonuclease treatment in step (d) of the second aspect of the invention.
- the method additionally comprises the addition of a first adapter molecule to one end of the VDJ recombination product.
- the method additionally comprises the addition of a first adapter molecule to one end of the VDJ recombination product following restriction endonuclease treatment.
- the first adapter is added to the VDJ recombination product by ligation. It will be appreciated that the adapter molecule will be selected depending upon the restriction
- restriction endonuclease used is any restriction endonuclease used.
- restriction endonuclease used is any restriction endonuclease used.
- the adapter molecule will comprise a complementary paired end with
- the adapter molecule when the restriction endonuclease used is Nlalll, the adapter molecule may be selected from SEQ ID NO : 5. In an alternative embodiment, when the restriction endonuclease used is DpnII, the adapter molecule may be selected from SEQ ID NO : 6. In one embodiment, when sonication is used to fragment the DNA, the T- overhang adapter is ligated to the sonicated DNA following end repair and A- tailing. In a further embodiment, when sonication is used to fragment the DNA, the adapter molecule may be selected from SEQ ID NOS : 22 and 23.
- the method additionally comprises the addition of a second adapter molecule to a second end of the VDJ recombination product.
- the second adapter is incorporated into the VDJ
- the primers for the addition of the second adaptor may be selected from SEQ ID NOS : 7 to 11 or 57 to 65.
- the primers for the addition of the second adaptor may be selected from SEQ ID NOS : 7 to 11.
- the primers for the addition of the second adaptor are selected from SEQ ID NOS : 66 to 72.
- the advantage of incorporating the second adapter by PCR is that the resultant amplified products will be free of the binding pair complexes if used for enrichment of the recombined VDJ products.
- Step (d) of the first aspect of the invention typically comprises the separation, or depletion, of the
- the methodology described herein relates to primer extension (performed in an analogous manner to that described for step (c) of the second aspect of the invention) of
- step (d) of the first aspect of the invention comprises the use of oligonucleotides specific to the upstream region of each of the 4 or 6 J genes on both strands.
- the oligonucleotides used in step (d) of the first aspect of the invention may be selected from SEQ ID NOS : 12 to 19 or 24 to 34.
- the oligonucleotides used in step (d) of the first aspect of the invention (or step (e) of the second aspect of the invention) may be selected from SEQ ID NOS : 12 to 19.
- the cell population comprises human cells and the oligonucleotides used in step (d) of the first aspect of the invention (or step (e) of the second aspect of the invention) are selected from SEQ ID NOS : 35 to 46.
- the primer additionally comprises one member of a binding pair.
- This embodiment provides the advantage of allowing depletion of the unrecombined J fragments over the recombined VDJ sequences.
- suitable binding pairs include biotin and streptavidin or an antigen and an antibody.
- the primer additionally comprises biotin or streptavidin, such as biotin. It will be appreciated that depletion of a biotinylated fragment will require a streptavidin containing moiety, such as a magnetic bead containing streptavidin, for example
- the resultant VDJ recombination products may then be sequenced.
- the sequencing step comprises standard Illumina 36bp paired end sequencing.
- the sequencing step comprises Illumina MiSeq 250bp single end sequencing.
- the procedure will typically require a sticky-end PCR reaction prior to sequence analysis in order to ensure sufficient binding to the flow cell .
- sticky-end PCR reactions may be conducted in accordance with the manufacturers protocol.
- the primers may be selected from SEQ ID NOS : 20 and 21.
- sequencing may require the addition of paired end adapters, e.g. for paired-end sequencing. These adapters may be used to attach to an Illumina flow cell.
- the primers may be selected from SEQ ID NOS : 73 to 85 or 98 to 106.
- Data may be processed in accordance with four main steps. Firstly the paired end reads are classified according to J segment identity and restriction
- the classified reads are filtered to identify unique recombination events and to exclude unrecombined reads and PCR duplicates.
- the reads are mapped to either the genome or to a virtual array of known V, D and J segment sequences to identify the recombined V or D segments in each read.
- the number of reads assigned to each V or D segment are quantified and displayed as a bar chart similar to Figure 7 or Figure 8.
- the kit additionally comprises nucleic acid extraction reagents configured to obtain the nucleic acid sample required for step (a) of the method of the invention.
- the kit additionally comprises oligonucleotides or primers specific for a unique region within or immediately downstream of each of the J genes or within the constant region as defined herein. In a further embodiment, the kit additionally comprises oligonucleotides or primers specific for a unique region within or immediately downstream of each of the J genes as defined herein. In one embodiment, the kit additionally comprises primer extension reagents configured to perform the primer extension process of step (c) of the second aspect of the invention. In one embodiment, the kit additionally comprises one or more restriction endonuclease enzymes as defined herein.
- the kit additionally comprises a computer readable storage medium configured to process the sequencing data obtained and generate a visual representation of VDJ recombination frequencies in the sample.
- VDJ recombination product obtainable by the method as described herein.
- VDJ recombination product or a method of identifying a VDJ recombination product as described herein for use in monitoring an immunodeficiency disorder.
- the immunodeficiency disorder is selected from a lymphoma or leukemia.
- the immunodeficiency disorder is selected from a clinically defined immunodeficiency disorder.
- the immunodeficiency disorder is selected from an ageing-related impairment of immune function.
- VDJ recombination products By monitoring VDJ recombination products in accordance with methods of the invention, patient care can be tailored precisely to match the needs determined by the disorder and the pharmacogenomic profile of the patient.
- the invention will now be described in more detail with reference to the following non-limiting Examples:
- ⁇ 7.5 of DNA was isolated from ⁇ 2 x 10 6 FACS sorted fraction B/C B cells and was divided into 8 aliquots to give ⁇ 1 pg per reaction.
- Primer extension reactions were assembled in 50 ⁇ volumes using 2U of Vent (exo-) DNA polymerase (NEB) in the supplied lx reaction buffer and 200 ⁇ of dNTPs.
- a cocktail of 4 biotinylated oligonucleotides were used in the reaction and they were designed to anneal to each of the four J segments in the Igh locus:
- the primer extension reaction was denatured at 94°C for 4 mins, annealed at 60 °C for 2 mins, and extended at 72 °C for 10 mins, then chilled on ice.
- the primer extension reactions were combined and magnetically purified using 720 ⁇ of Agencourt AMPure XP SPRI beads (Beckman Coulter) according to the manufacturers protocol, and eluted into 208 ⁇ of water.
- the biotinylated VDJ recombined DNA fragments were enriched using
- the digestion reactions were cleaned up by removal of the supernatant on a magnet, followed by 2 washes of 100 ⁇ of kilobaseBINDER kit wash buffer, and one wash in 100 ⁇ of lOmM Tris-CI, pH 8.5.
- the beads were resuspended in 50 ⁇ of lxN EB ligase buffer and incubated at 55 °C for 5 minutes, then rapidly chilled on ice.
- Master mix 1 contained the following per reaction : 21 ⁇ of water, 1 ⁇ of lOmM dNTP mix, 1.5 ⁇ of 10 ⁇ Illumina paired end adaptor 1 forward primer, and 1.5 ⁇ of a 10 ⁇ mix of 4 J segment specific reverse primers incorporating the Illumina paired end adapter 2 sequence at the 5' end.
- CTCGGCATTCCTGCTGAACCGCTCTTCCGATCTCCCAGACATCGAAGTACCAG (SEQ ID NO : 8)
- J2 PE PCR adapter 2 reverse CTCGGCATTCCTGCTGAACCGCTCTTCCGATCTTTGGCCCCAGTAGTCAAAG (SEQ ID NO : 9)
- CTCGGCATTCCTGCTGAACCGCTCTTCCGATCTTGGCCCCAGTAAGCAAAC (SEQ ID NO : 10)
- Master mix 2 contained the following per reaction : 19.25 ⁇ of water, 5 ⁇ of lOx Expand high fidelity buffer (Roche) and 0.75 ⁇ of Expand high fidelity Taq (Roche, 2.6U).
- the samples were placed on a magnet and the supernatant was removed.
- the beads were resuspended in 200 ⁇ of Master mix 1 and 25 ⁇ was aliquoted into 8 PCR tubes. 25 ⁇ of Master mix 2 was added to each tube and mixed.
- the PCR reaction was initially denatured at 94 °C for 2 minutes, but during the PCR cycling was denatured for 15 seconds.
- the primers were annealed at 60 °C for 30 seconds, and elongated for 1 minute at 72 °C.
- the PCR was cycled 15 times followed by a final elongation step of 5 minutes at 72 °C.
- the 8 PCR reactions were pooled into a single Eppendorf and placed on the magnet. The 400 ⁇ supernatant was removed and placed in a fresh tube and the beads were discarded.
- the pooled PCR reaction was cleaned up using 720 ⁇ of SPRI beads according to the manufacturers protocol and eluted into 200 ⁇ of water.
- a primer extension reaction was assembled using 5 ⁇ of the supplied NEB buffer, 1 ⁇ of lOmM dNTP mix, ⁇ (2U) of Vent (exo-) DNA polymerase (NEB), 17 ⁇ of water and 1 ⁇ of a 10 ⁇ cocktail of 8 biotinylated oligos specific to the upstream regions of each of the 4 J segments on both strands: Depletion biotinylated oligonucleotides
- the primer extension reaction was denatured at 94 °C for 4 mins, annealed at 55 °C for 2 mins, and extended at 72 °C for lOmins, then chilled on ice.
- the 8 primer extension reactions were pooled and magnetically purified using 720 ⁇ of SPRI beads according to the manufacturers protocol, and eluted into 50 ⁇ of water.
- the biotinylated unrecombined DNA fragments were depleted using streptavidin coupled Dynabeads from the kilobaseBIN DER kit (Invitrogen). 10 ⁇ aliquots of Dynabeads were prepared according to the manufacturers protocol, to which the 50 ⁇ DNA samples were added and incubated overnight at 20 °C on a
- Thermomixer at 1200rpm .
- the samples were placed on a magnet for 5 mins and the supernatant was removed and placed in a fresh tube, the beads containing the unrecombined fragments were discarded.
- the depleted samples were magnetically purified using 108 ⁇ of SPRI beads according to the manufacturers protocol, and eluted into 50 ⁇ of water.
- Master mix 1 contained the following per reaction : 11 ⁇ of water, 1 ⁇ of lOmM dNTP mix, 1.5 ⁇ of 10 ⁇ Illumina paired end PCR forward primer, and 1.5 ⁇ of 10 ⁇
- Illumina paired end PCR reverse primer Illumina paired end PCR reverse primer.
- Master mix 2 contained the following per reaction : 19.25 ⁇ of water, 5 ⁇ of lOx Expand high fidelity buffer (Roche) and 0.75 ⁇ of Expand high fidelity Taq (Roche, 2.6U).
- V genes in the mouse Igh locus All detectable V genes are shown in locus order on the x-axis, which has been split into two due to space constraints.
- the DpnII and Nlalll datasets have been normalised by dividing the total number of reads per dataset by the number of V segments detectable with that restriction enzyme giving number of reads per segment expected if the reads were evenly distributed . Finally, the number of reads observed for each V segment was divided by that expected number giving fold difference between number of reads observed compared to number of reads expected. A value of 1 corresponds to the number of reads expected if reads were evenly distributed.
- Bone marrow taken from 15 mice generally yields approximately 5 x 10 6 fraction B/C VDJ recombined B cells following MACS depletion & FACS sorting .
- Approximately 16pg of DNA is typically isolated from this number of cells using the Qiagen DNeasy kit.
- splenic B cells deplete spleen of T cells, activated B cells and erythrocytes using CD43 biotin (1 : 1000) and Terl l9 (1 : 400) .
- CD43 biotin (1 : 1000)
- Terl l9 (1 : 400)
- One spleen typically gives 6-8 x 10 7 cells at greater than 90% purity from 1- 1.5 x 10 £ starting cells.
- 10 7 cells makes over 20pg DNA using the Qiagen DNeasy kit.
- Nanodrop is used to determine DNA concentration and yield.
- Fragmentation & Repair DNA is fragmented using the Covaris E220 system using the manufacturer's protocol to generate 500bp peak fragments.
- the machine requires at least 1 hour of pre-cooling and degassing before use.
- Adapter mix uses 2 oligos: "DpnII adapter F” & “Rev PE both adapter”, which anneal together to create an asymmetric PE1 adapter:
- DpnII adapter F ALAL 1 L 1 1 1 LLL 1 ALALbALbL 1 L 1 1 LLbA 1 L* 1 22 Rev PE both CGAGAAGGCTAG[Phos] 23 adapter
- Primer extension using biotinylated oligos annealing to upstream regions of each J segment Split sample into separate primer extension reactions not exceeding l g DNA per reaction. For example, 8x reactions use less than l g per reaction accounting for loss of DNA through cleanup.
- Thermal cycler conditions 95°C for 4 minutes, 55°C for 5 minutes, 72°C for 15 minutes, 4°C pause.
- a mixture of 8 biotinylated primers are used with Tms between 57.4°C to 59.4°C:
- 12. Prepare Dynabeads MyOne Streptavidin CI beads (Invitrogen). Vortex Dynabead stock, transfer 20 ⁇ to eppendorf, add 1ml lx B&W buffer(Binding & Washing), mix, place tube on magnet for 2 mins, discard supernatant.
- Thermal cycler conditions 95°C for 4 minutes, 59°C for 5 minutes, 72°C for 15 minutes, 4°C pause.
- Tms are between 62.7°C to 63.7°C: Biotinylated primers for enrichment of VDJ recombined fragments
- amplification for example 10, 12 or 15 cycles. It is considered to be best to do more cycles in the first round than the second (for example, 15x 1st round, 7x 2nd round). Ensure these primers are at least HPLC, ideally PAGE purified. Short PE1 primer Tm : 68.5°C; J primers Tm range: 68.7-69.8°C.
- Jk3 PE2 PCR GTGACTGGAGTTCAGACGTGTGCTCTTCCGA 64
- Jk4 PE2 PCR GTGACTGGAGTTCAGACGTGTGCTCTTCCGA 65
- SPRI/Seramag beads Purify and size select PCR reaction using lx volume SPRI/Seramag beads (will be approximately 120 ⁇ ). This removes primers/primer dimers and fragments less than 200bp. Binding capacity of SPRI beads is 3 ⁇ 9/ ⁇ and they are suspended in 20% PEG-8000, 2.5M NaCI (see, http://core- genomics.blogspot.co.uk/2012/04/how-do-spri-beads-work.html). Since the binding capacity is so great, it may be possible to dilute the beads down in this buffer to make them go further without affecting capture efficiency. Add beads, mix thoroughly by pipetting, incubate at room temp for 10 minutes or more, place on magnet for 5 minutes and discard supernatant.
- Tms of regions annealing to target are 58.2°C for PE1, and 61.9°C for PE2.
- Primers should be at least HPLC, preferably PAGE purified.
- Flowcell PE1 AATGATACGGCGACCACCGAGATCTACACTCTTTCCC 73
- IgH J region use J3-J4 new int.
- F-mu0r2 141bp (IgH J) - this region will be lost if depletion has successfully occured.
- B2M or actin can be used for non-Igh.
- V genes in the mouse Igh locus All V genes are shown in locus order on the x-axis, which has been split into four due to space constraints. Each V gene on the X axis is depicted by 3 bars representing the results from 3 biological replicates of mouse proB cells. The read count is normalized to the middle replicate to take into account that different sequencing libraries produce different numbers of sequences, such that the variation between the biological replicates reflects proportional differences in
- V genes in the locus that do not have reads are invariably V pseudogenes, that have a defect that precludes VDJ recombination, and thus they do not contribute to the repertoire.
- Example 3 may be performed in an analogous manner to Examples 1 and 2 except for the following :
- oligonucleotides or biotinylated RNA followed by separation using streptavidin magnetic beads.
- biotinylated RNA methodology for depletion regions just upstream of each J gene are amplified by PCR and cloned into a vector containing a T7 promoter sequence flanking the cloning site. These are then linearised at the opposite end of the insert to the 17 sequence and these are used as templates to produce biotinylated RNA using 17 polymerase. Large amounts of strand- specific biotinylated RNA can be made in this way as this enzyme is highly processive. This biotinylated RNA can then be used in a similar way to the oligonucleotides detailed above to hybridise to unrecombined regions in denatured genomic DNA and remove them using streptavidin magnetic beads.
- RNA can easily be digested and removed from DNA following hybridisation .
- the J genes and regions just 3' could be cloned, linearised, used to produce biotinylated RNA and this then hybridised in a similar way to above but in this case to enrich for V(D)J recombined DNA. It would be best to do this after having already depleted for unrecombined regions. Again it would be best to use antisense RNA to target the sense strand in both depletion and enrichment steps as this would just leave unrecombined depleted, V(D)J enriched sense-strand DNA that would then be the perfect template for the standard PCR-based VDJ- seq library production as detailed in Examples 1 and 2, above.
- B cells are isolated from bone marrow or spleen from mice, or from human peripheral blood. RNA isolated by RNeasy or Trizol and DNase digested. Between l-lOpg RNA is used per library preparation. (ii) Reverse transcription & RNA degradation
- [SpcC3] refers to a spacer with a 3' modification that prevents elongation.
- Primer sequences only include constant region primers of interest in the primer mix. These contain 8 random nucleotides to increase complexity at the start of the run. Short PE2 primer Tm : 61.87°C; Constant-J primers Tm range: 61 - 63°C.
- step 15 Add 40 ⁇ of DNA sample (step 15) to beads, mix and incubate for 60 mins, or overnight, on rotator at room temperature.
- Tms of regions annealing to target are 58.2°C for PE1, and 61.9°C for PE2.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- Physics & Mathematics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Pathology (AREA)
- Cell Biology (AREA)
- Medicinal Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2014559299A JP6513949B2 (ja) | 2012-03-02 | 2013-03-01 | Vdj組み換え産物を特定する方法 |
| US14/382,142 US9797014B2 (en) | 2012-03-02 | 2013-03-01 | Method of identifying VDJ recombination products |
| EP13709986.7A EP2820153B1 (en) | 2012-03-02 | 2013-03-01 | Method of identifying vdj recombination products |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| GB1203720.6 | 2012-03-02 | ||
| GBGB1203720.6A GB201203720D0 (en) | 2012-03-02 | 2012-03-02 | Method of identifying VDJ recombination products |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2013128204A1 true WO2013128204A1 (en) | 2013-09-06 |
Family
ID=46003032
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/GB2013/050516 Ceased WO2013128204A1 (en) | 2012-03-02 | 2013-03-01 | Method of identifying vdj recombination products |
Country Status (5)
| Country | Link |
|---|---|
| US (1) | US9797014B2 (enExample) |
| EP (1) | EP2820153B1 (enExample) |
| JP (1) | JP6513949B2 (enExample) |
| GB (1) | GB201203720D0 (enExample) |
| WO (1) | WO2013128204A1 (enExample) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018144410A1 (en) * | 2017-01-31 | 2018-08-09 | Ludwig Institute For Cancer Research Ltd. | Enhanced immune cell receptor sequencing methods |
| US10227655B2 (en) | 2013-10-29 | 2019-03-12 | Region Syddanmark | Method for analyzing body fluid samples |
| WO2019074972A1 (en) * | 2017-10-10 | 2019-04-18 | Memorial Sloan Kettering Cancer Center | SYSTEM AND METHODS FOR PRIMER EXTRACTION AND CLONALITY DETECTION |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12043856B2 (en) | 2016-05-24 | 2024-07-23 | The Translational Genomics Research Institute | Molecular tagging methods and sequencing libraries |
| WO2017202389A1 (zh) * | 2016-05-27 | 2017-11-30 | 深圳市海普洛斯生物科技有限公司 | 一种适用于超微量dna测序的接头及其应用 |
| US20200131564A1 (en) * | 2017-07-07 | 2020-04-30 | Board Of Regents, The University Of Texas System | High-coverage and ultra-accurate immune repertoire sequencing using molecular identifiers |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1992012260A1 (fr) * | 1991-01-09 | 1992-07-23 | Institut National De La Sante Et De La Recherche Medicale (Inserm) | PROCEDE DE DESCRIPTION DES REPERTOIRES D'ANTICORPS (Ab) ET DES RECEPTEURS DES CELLULES T (TcR) DU SYSTEME IMMUNITAIRE D'UN INDIVIDU ll |
| WO2001027329A2 (en) * | 1999-10-08 | 2001-04-19 | Board Of Regents, The University Of Texas System | Combinatorial oligonucleotide pcr: a method for rapid, global expression analysis |
| WO2004033728A2 (en) * | 2002-10-11 | 2004-04-22 | Erasmus Universiteit Rotterdam | Nucleic acid amplification primers for pcr-based clonality studies |
| WO2008026927A2 (en) * | 2006-08-30 | 2008-03-06 | Academisch Medisch Centrum | Process for displaying t- and b-cell receptor repertoires |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007031550A2 (en) * | 2005-09-15 | 2007-03-22 | Crucell Holland B.V. | Method for preparing immunoglobulin libraries |
| CA2796822C (en) * | 2010-05-07 | 2021-10-05 | The Board Of Trustees Of The Leland Standford Junior University | Measurement and comparison of immune diversity by high-throughput sequencing |
| GB2498163B (en) * | 2010-10-08 | 2015-07-01 | Harvard College | High-throughput immune sequencing |
-
2012
- 2012-03-02 GB GBGB1203720.6A patent/GB201203720D0/en not_active Ceased
-
2013
- 2013-03-01 JP JP2014559299A patent/JP6513949B2/ja not_active Expired - Fee Related
- 2013-03-01 EP EP13709986.7A patent/EP2820153B1/en not_active Not-in-force
- 2013-03-01 WO PCT/GB2013/050516 patent/WO2013128204A1/en not_active Ceased
- 2013-03-01 US US14/382,142 patent/US9797014B2/en not_active Expired - Fee Related
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1992012260A1 (fr) * | 1991-01-09 | 1992-07-23 | Institut National De La Sante Et De La Recherche Medicale (Inserm) | PROCEDE DE DESCRIPTION DES REPERTOIRES D'ANTICORPS (Ab) ET DES RECEPTEURS DES CELLULES T (TcR) DU SYSTEME IMMUNITAIRE D'UN INDIVIDU ll |
| WO2001027329A2 (en) * | 1999-10-08 | 2001-04-19 | Board Of Regents, The University Of Texas System | Combinatorial oligonucleotide pcr: a method for rapid, global expression analysis |
| WO2004033728A2 (en) * | 2002-10-11 | 2004-04-22 | Erasmus Universiteit Rotterdam | Nucleic acid amplification primers for pcr-based clonality studies |
| WO2008026927A2 (en) * | 2006-08-30 | 2008-03-06 | Academisch Medisch Centrum | Process for displaying t- and b-cell receptor repertoires |
Non-Patent Citations (9)
| Title |
|---|
| A.M COLLINS ET AL: "Immunoglobulin gene rearrangement, repertoire diversity, and the allergic response", PHARMACOLOGY & THERAPEUTICS, vol. 100, no. 2, 1 November 2003 (2003-11-01), pages 157 - 170, XP055063855, ISSN: 0163-7258, DOI: 10.1016/j.pharmthera.2003.07.002 * |
| HODGES E ET AL: "DIAGNOSTIC ROLE OF TESTS FOR T CELL RECEPTOR (TCR) GENES", JOURNAL OF CLINICAL PATHOLOGY, BMJ PUBLISHING GROUP, GB, vol. 56, no. 1, 1 January 2003 (2003-01-01), pages 1 - 11, XP001196998, ISSN: 0021-9746, DOI: 10.1136/JCP.56.1.1 * |
| I RAMASAMY ET AL: "Improved PCR method for detecting monoclonal immunoglobulin heavy chain rearrangement in B cell neoplasms", J CLIN PATHOL, 1 September 1992 (1992-09-01), pages 770 - 775, XP055064110, Retrieved from the Internet <URL:http//:www.jcp.bmj.com> [retrieved on 20130527] * |
| LANGERAK A W ET AL: "Molecular and flow cytometric analysis of the Vbeta repertoire for clonality assessment in mature TCRalphabeta T-cell proliferations", BLOOD, AMERICAN SOCIETY OF HEMATOLOGY, US, vol. 98, no. 1, 1 July 2001 (2001-07-01), pages 165 - 173, XP002287368, ISSN: 0006-4971, DOI: 10.1182/BLOOD.V98.1.165 * |
| MANCINI S J C ET AL: "TCRA gene rearrangement in immature thymocytes in absence of CD3, pre-TCR, and TCR signaling", THE JOURNAL OF IMMUNOLOGY, THE AMERICAN ASSOCIATION OF IMMUNOLOGISTS, US, vol. 167, no. 8, 15 October 2001 (2001-10-15), pages 4485 - 4493, XP002287367, ISSN: 0022-1767 * |
| PANZARA M A ET AL: "ANALYSIS OF THE T CELL REPERTOIRE USING THE PCR AND SPECIFIC OLIGONUCLEOTIDE PRIMERS", BIOTECHNIQUES, INFORMA HEALTHCARE, US, vol. 12, no. 5, 1 January 1992 (1992-01-01), pages 728 - 735, XP002028497, ISSN: 0736-6205 * |
| PASQUAL N ET AL: "Quantitative and qualitative changes in V-J alpha rearrangements during mouse thymocytes differentiation: implication for a limited T cell receptor alpha chain repertoire", THE JOURNAL OF EXPERIMENTAL MEDICINE, ROCKEFELLER UNIVERSITY PRESS, US, vol. 196, no. 9, 4 November 2002 (2002-11-04), pages 1163 - 1173, XP002322207, ISSN: 0022-1007, DOI: 10.1084/JEM.20021074 * |
| VAN DONGEN J ET AL: "Design and standardization of PCR primers and protocols for detection of clonal immunoglobuline and T-cell receptor gene recombinations is suspect lymphoproliferations: report of the BIOMED-2 concerted action BMH4-CT98-3936", LEUKEMIA, MACMILLAN PRESS LTD, US, vol. 17, no. 12, 1 December 2000 (2000-12-01), pages 2257 - 2317, XP008093070, ISSN: 0887-6924 * |
| XU JOHN L ET AL: "Diversity in the CDR3 region of VH is sufficient for most antibody specificities", IMMUNITY, CELL PRESS, US, vol. 13, no. 1, 1 July 2000 (2000-07-01), pages 37 - 45, XP009147376, ISSN: 1074-7613, [retrieved on 20000905], DOI: 10.1016/S1074-7613(00)00006-6 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10227655B2 (en) | 2013-10-29 | 2019-03-12 | Region Syddanmark | Method for analyzing body fluid samples |
| WO2018144410A1 (en) * | 2017-01-31 | 2018-08-09 | Ludwig Institute For Cancer Research Ltd. | Enhanced immune cell receptor sequencing methods |
| US11319590B2 (en) | 2017-01-31 | 2022-05-03 | Ludwig Institute For Cancer Research Ltd. | Enhanced immune cell receptor sequencing methods |
| WO2019074972A1 (en) * | 2017-10-10 | 2019-04-18 | Memorial Sloan Kettering Cancer Center | SYSTEM AND METHODS FOR PRIMER EXTRACTION AND CLONALITY DETECTION |
| CN112204155A (zh) * | 2017-10-10 | 2021-01-08 | 纪念斯隆-凯特林癌症中心 | 引物提取和克隆性检测的系统和方法 |
Also Published As
| Publication number | Publication date |
|---|---|
| US20150031042A1 (en) | 2015-01-29 |
| GB201203720D0 (en) | 2012-04-18 |
| JP6513949B2 (ja) | 2019-05-22 |
| EP2820153B1 (en) | 2018-12-05 |
| US9797014B2 (en) | 2017-10-24 |
| JP2015509724A (ja) | 2015-04-02 |
| EP2820153A1 (en) | 2015-01-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP7570651B2 (ja) | 混合物中の核酸を配列決定する方法およびそれに関する組成物 | |
| US11584959B2 (en) | Compositions and methods for selection of nucleic acids | |
| US6159713A (en) | Methods for producing probes capable of distinguishing DNA from related sources | |
| Head et al. | Library construction for next-generation sequencing: overviews and challenges | |
| US20120028814A1 (en) | Oligonucleotide ligation, barcoding and methods and compositions for improving data quality and throughput using massively parallel sequencing | |
| US20120015821A1 (en) | Methods of Generating Gene Specific Libraries | |
| CN102203273A (zh) | 生成基因特异性的文库的方法 | |
| JP2018503403A (ja) | 液相におけるライゲーションアッセイ | |
| JPH08308598A (ja) | 遺伝子発現分析方法 | |
| US9797014B2 (en) | Method of identifying VDJ recombination products | |
| JP2023513606A (ja) | 核酸を評価するための方法および材料 | |
| US20240384264A1 (en) | Guide Strand Library Construction and Methods of Use Thereof | |
| US20140336058A1 (en) | Method and kit for characterizing rna in a composition | |
| US20040197774A1 (en) | Representational approach to DNA analysis | |
| CN108103052A (zh) | 提高基因组覆盖度的单细胞全基因组扩增及文库构建方法 | |
| EP1723260A2 (en) | Nucleic acid representations utilizing type iib restriction endonuclease cleavage products | |
| JP2022548000A (ja) | シーケンシングライブラリーの多重製造方法 | |
| Head et al. | Practical Guide | |
| Cheng et al. | Dense sgRNA library construction using a Molecular Chipper approach | |
| WO2005010184A1 (ja) | 変異の検出方法 | |
| HK40013856B (en) | Compositions for sequencing nucleic acids in mixtures | |
| HK40013856A (en) | Compositions for sequencing nucleic acids in mixtures | |
| JP2005312442A (ja) | マイクロビーズの精製方法 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 13709986 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 14382142 Country of ref document: US |
|
| ENP | Entry into the national phase |
Ref document number: 2014559299 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2013709986 Country of ref document: EP |