WO2013111668A1 - Analyse fish pour la détection de la translocation entre le gène kif5b et le gène ret - Google Patents

Analyse fish pour la détection de la translocation entre le gène kif5b et le gène ret Download PDF

Info

Publication number
WO2013111668A1
WO2013111668A1 PCT/JP2013/050868 JP2013050868W WO2013111668A1 WO 2013111668 A1 WO2013111668 A1 WO 2013111668A1 JP 2013050868 W JP2013050868 W JP 2013050868W WO 2013111668 A1 WO2013111668 A1 WO 2013111668A1
Authority
WO
WIPO (PCT)
Prior art keywords
probe
gene
ret
region
kif5b
Prior art date
Application number
PCT/JP2013/050868
Other languages
English (en)
Japanese (ja)
Inventor
秀文 佐々木
Original Assignee
公立大学法人名古屋市立大学
株式会社Ｇｓｐ研究所
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 公立大学法人名古屋市立大学, 株式会社Ｇｓｐ研究所 filed Critical 公立大学法人名古屋市立大学
Publication of WO2013111668A1 publication Critical patent/WO2013111668A1/fr

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/02—Antineoplastic agents specific for leukemia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Definitions

  • the present invention relates to a fluorescence in situ hybridization (FISH) assay for detecting a translocation on chromosome 10. Specifically, the present invention relates to a FISH assay for detecting translocation of KIF5B gene and RET gene, its use, and the like.
  • the present invention is useful for detecting non-small cell lung cancer, for example, and provides useful information for diagnosis, treatment, etc. of non-small cell lung cancer.
  • This application is based on the priority based on Japanese Patent Application No. 2012-015939 filed on January 27, 2012 and the priority based on Japanese Patent Application No. 2012-104585 filed on May 1, 2012. The entire contents of these patent applications are incorporated by reference.
  • tyrosine kinase gene encodes an important enzyme that directly regulates cell growth, and leads to canceration by spontaneous activation of kinase activity detected as an increase in autophosphorylation due to amino acid sequence or deletion. It is known.
  • a fusion gene of PTC mainly 1-3
  • RET tyrosine kinase is found at a frequency of 20-60%, and activation of RET kinase is important for the growth of tumor cells by PTC / RET. It has been shown (Non-Patent Documents 1, 2, and 3).
  • Non-patent Document 4 discloses Japanese non-small cell lung cancer.
  • the frequency of EML4-ALK fusion gene is about 6% in Japanese non-small cell lung cancer.
  • FISH has been adopted as a method for searching for gene translocations that generate EML4-ALK fusion genes (Patent Document 1).
  • KIF5B-ALK Non-patent Document 5
  • KIF kinesin family member
  • GRIP1 Glutamate receptor-mediated protein 1
  • Information on the human KIF5B gene is registered in a public database (EntrezGene ID: 3799, SWISS-PROT ID: P33176).
  • the RET gene was named after rearranged during ⁇ transfection and was thought to have arisen during the transfection of a gene in which two human DNA sequences were recombined (NIH-3T3 (cultured cells isolated from NIH Swiss mouse embryo fibroblasts)). Isolated).
  • the RET gene (10q.11.21) expressed in the peripheral nervous system codes for c-Ret receptor, a receptor tyrosine kinase.
  • a mutation of the RET gene is observed in a family with multiple endocrine adenomatosis (MEN) (Non-patent Document 7). However, a point mutation of the RET gene in lung cancer has not been reported.
  • RET unitinib, vandetanib, sorafenib
  • RET inhibitors are already covered by insurance for kidney cancer, thyroid cancer, etc., and can be used for humans.
  • the present invention uses or utilizes the KIF5B-RET fusion gene, which is a new causative gene of cancer, in the treatment strategy, and detects a translocation between the KIF5B gene and the RET gene. It is an object of the present invention to provide a kit that can be used for the detection method, its use, and the detection method.
  • the present inventor found that a part of the 5 ′ side of the KIF5B gene and a part of the 3 ′ side of the RET gene are produced by chromosomal translocation from a sample obtained from a non-small cell lung cancer patient (Japanese sample).
  • a sample obtained from a non-small cell lung cancer patient Japanese sample.
  • We succeeded in isolating the fused KIF5B-RET fusion gene (FIG. 9).
  • we succeeded in isolating the cDNA of a variant from one specimen and one variant similar to that reported by the Korean group Non-patent Document 6).
  • KIF5B-RET translocation a translocation between the KIF5B gene and the RET gene (hereinafter referred to as “KIF5B-RET translocation” for convenience of explanation) was not observed in breast cancer, colon cancer or thyroid cancer, and lung cancer. It became clear to be specific. Furthermore, it was found that the KIF5B-RET fusion gene exists exclusively from known oncogenes such as the EGFR gene and the EML4-ALK fusion gene. That is, it was suggested that the KIF5B-RET fusion gene is a causative gene for cancer and exhibits tumorigenicity of non-small cell lung cancer. These facts mean that detecting the KIF5B-RET translocation is extremely important for the treatment strategy of lung cancer (particularly non-small cell lung cancer).
  • the present inventor conducted further studies and devised a detection method for KIF5B-RET translocation using an original fluorescent probe, and verified its usefulness. As a result, it was confirmed that the method was extremely effective for detecting the KIF5B-RET translocation.
  • the length of the first chromosome site is 0.5 Mb to 2.0 Mb
  • the length of the second chromosome site is 0.5 Mb to 2.0 Mb
  • the length of the third chromosome site is 0.5 Mb to 2.0 Mb.
  • the length of the fourth chromosome site is 0.5 Mb to 2.0 Mb.
  • the length of the probe 1A is 100 kb to 500 kb
  • the length of the probe 1B is 300 kb to 800 kb
  • the length of the probe 2A is 300 kb to 800 kb
  • the length of the probe 2B is 400 kb.
  • the probe 4A has a length of 800 kb to 1,500 kb
  • the probe 4B has a length of 900 kb to 1,700 kb.
  • At least one of the probe 1A, the probe 1B, the probe 2A, the probe 2B, and the probe 4A is composed of a plurality of DNA fragments labeled with the same fluorescent substance.
  • step (iv) Select two or more probe sets from the above (1) to (4), and individually perform the steps (i) to (iii) using each selected probe set,
  • step (iv) the method according to [5], wherein the presence or absence of a translocation between the KIF5B gene and the RET gene is determined by combining the fluorescence signal patterns obtained for each probe set.
  • the probe set of (1) and the probe set of (3) are selected.
  • the method according to [9], wherein the chromosome sample is derived from a lung cancer patient.
  • a kit for detecting a translocation between the KIF5B gene and the RET gene comprising one or more probe sets selected from the group consisting of the following (1) to (4): (1) A first probe set targeting a chromosome site (first chromosome site) containing a RET gene, A probe 1A labeled with a first fluorescent substance and a probe 1B labeled with a second fluorescent substance, The probe 1A is complementary to the first region which is the 5 ′ side region in the first chromosome site, The probe 1B is a 3′-side region in the first stained other site, and is complementary to a second region that exists at a distance from the first region, When the KIF5B-RET fusion gene is generated by translocation between the KIF5B gene and the RET gene, the breakpoint in the RET gene is the 3 ′ end of the first region, between the first region and the second region, Or a first probe set located at the 5 ′ end of the second region; (2) A second probe set targeting a chromosome site (
  • the probe set consists of a TexRed labeled probe 1A (about 200 kb) and a FITC labeled probe 1B (about 630 kb). Details of the first probe set of this example are shown in FIG.
  • the probe set consists of TexRed labeled probe 2A (about 620 kb) and FITC labeled probe 2B (about 750 kb). Details of the second probe set are shown in FIG.
  • the figure which showed typically the structure of the 3rd probe set (KIF5B / RET, (SY) Translocation (Dual) Color (FISH) Probe).
  • the probe set consists of TexRed labeled probe 2A (about 620 kb) and FITC labeled probe 1B (about 630 kb).
  • the figure which showed typically the structure of the 4th probe set (KIF5B / RET, "DY" Translocation "Dual” Color "FISH” Probe).
  • the probe set consists of TexRed labeled probe 4A (about 1,180 kb) and FITC labeled probe 4B (about 1,370 kb).
  • TexRed labeled probe 1A (about 200 kb) and the FITC labeled probe 1B (about 630 kb) constituting the first probe set a.
  • Five types of DNA fragments are used in combination as the FITC-labeled probe 1B.
  • Details of TexRed labeled probe 2A (about 620 kb) and FITC labeled probe 2B (about 750 kb) constituting the second probe set.
  • Four types of DNA fragments are used in combination as the TexRed labeled probe 2A.
  • five types of DNA fragments are used in combination as the FITC-labeled probe 2B. Results of FISH analysis using specimens from non-small cell lung cancer patients.
  • the first probe set a (about 200 kb TexRed labeled probe 1A and about 630 kb FITC labeled probe 1B) was used. Fluorescence pattern showing KIF5B-RET translocation (observed with clear red and green dots apart) (circled). Results of FISH analysis using specimens from non-small cell lung cancer patients. A third probe set was used. A fluorescent pattern indicating a KIF5B-RET translocation (a yellow dot is observed by the combination of a red dot and a green dot) (circled) is observed. The figure which shows the structure of a variant 1 type KIF5B-RET fusion gene. The figure which shows the translocation of a new variant.
  • the probe set includes a TexRed labeled probe 1A (about 490 kb) and a FITC labeled probe 1B (about 630 kb). Details of the first probe set of this example are shown in FIG. Details of the TexRed labeled probe 1A (about 490 kb) and the FITC labeled probe 1B (about 630 kb) constituting the first probe set b. Three types of DNA fragments are used in combination as the TexRed labeled probe 1A. Five types of DNA fragments are used in combination as the FITC-labeled probe 1B.
  • the first probe set b (about 490 kb TexRed labeled probe 1A and about 630 kb FITC labeled probe 1B) was used.
  • a fluorescent pattern showing a KIF5B-RET translocation (observed with clear red and green dots separated) is observed.
  • a clearer split signal is obtained than when the first probe set a is used (FIG. 7).
  • Epitomics anti-RET rabbit monoclonal antibody 3454 antibody was used at a dilution of 1: 250. The method of dyeing was classified into G1 (granular) and G2 (and chronic), and if G2 and the staining range were 50% or more, there was a high possibility of RET translocation (it seems to have a correlation).
  • the first aspect of the present invention relates to a method for detecting a KIF5B-RET translocation.
  • a FISH assay using a specific probe set is performed.
  • the probe set one or more probe sets selected from the group consisting of the following (1) to (4) are used.
  • the positions and sequences on the chromosome referred to in this specification are based on the results of the human genome international project Build37.
  • (1) First probe set A probe set targeting a chromosomal site (first chromosomal site) containing the RET gene (43572475 to 43625799: build37).
  • Probe 1A is complementary to the first region, which is the 5 ′ region in the first chromosome site.
  • the probe 1B is a 3′-side region in the first stained other site and is complementary to a second region existing at a distance from the first region.
  • the breakpoint in the RET gene is the 3 ′ end of the first region, between the first region and the second region, or the second region. Located at the 5 'end of the region. The breakpoint in the RET gene is usually estimated around the positive strand 43611118 base of chromosome 10.
  • the length of the first chromosome site is preferably from 0.5 to Mb, more preferably from 1.0 to Mb.
  • the start position of the first chromosome site is between base positions 42,500,000 and 43,500,000 of chromosome 10
  • the end position is between base positions 44,000,000 and 45,000,000 of chromosome 10.
  • the length of the probe 1A is, for example, 100 kb to 500 kb, preferably 200 kb to 490 kb.
  • One specific example of the probe 1A is an insert of the BAC clone GSP1506F09 (in addition to this clone, all specific examples of the BAC clone mentioned below can be obtained from GPS Research Institute, Inc.) (Which consists of a sequence corresponding to base positions 43020444 to 43224507) is fluorescently labeled. The insert is approximately 200 kb long.
  • probe 1A examples include a fluorescently labeled insert of BAC clone GSP1506F09 (consisting of a sequence corresponding to base positions 43020444 to 43224507 of chromosome 10), and an insert of GSP3023D06 (base position 43276632 of chromosome 10).
  • a combination (mixture) of fluorescently labeled inserts of GSP3012B07 consististing of sequences corresponding to base positions 43342754 to 43512026 of chromosome 10). The insert is approximately 490 kb long.
  • the length of the probe 1B is, for example, 300 kb to 800 kb, preferably 500 kb to 700 kb.
  • Specific examples of probe 1B include a fluorescently labeled insert of BAC clone GSP1877H08 (consisting of a sequence corresponding to nucleotide positions 43563936 to 43735238 (NCBI: Build37.2) of chromosome 10), and an insert of BAC clone GSP1018G02 (number 10).
  • Chromosome labeled with a sequence corresponding to base positions 43670474 to 43814797 of the chromosome Chromosome labeled with a sequence corresponding to base positions 43670474 to 43814797 of the chromosome
  • BAC clone GSP1070C12 insert (comprised with a sequence corresponding to base positions 43809245 to 44003042 of chromosome 10)
  • BAC clone Fluorescently labeled GSP0369G08 insert consisting of a sequence corresponding to nucleotide positions 43893593 to 44100865 of chromosome 10
  • BAC clone GSP0075D03 insert comprising a sequence corresponding to nucleotide positions 44076856 to 44195623 of chromosome 10.
  • a combination (mixture) of labels are all fluorescently labeled with the same fluorescent material.
  • Second probe set A probe set targeting a chromosomal site (second chromosomal site) containing the KIF5B gene (32297938 to 32345359: buid37).
  • the probe 2A is labeled with a first fluorescent substance and the probe 2B is labeled with a second fluorescent substance.
  • the probe 2A is complementary to the first region which is the 5 ′ region in the second chromosome site.
  • Probe 2B is a 3 ′ region in the second chromosome site, and is KIF5B-RET by translocation between the KIF5B gene and the RET gene that are complementary to the second region that is located at a distance from the first region.
  • the breakpoint in the KIF5B gene when the fusion gene is generated is located at the 3 ′ end of the first region, between the first region and the second region, or at the 5 ′ end of the second region.
  • the KIF5B-RET fusion gene has at least four types of variants (three types reported in Non-Patent Document 6 and one new variant), and the breakpoints in the KIF5B gene are different among them (Non-Patent Document 6). ).
  • the breakpoint in the KIF5B gene is located after the 32316377 base of the minus strand of chromosome 10.
  • the KIF5B gene breakpoint shifts behind exon 22.
  • a probe is designed by paying attention to a specific cutting point. Alternatively, considering two or more cutting points, for example, both of them are located at the 3 ′ end of the first region, between the first region and the second region, or at the 5 ′ end of the second region. Design the probe.
  • the length of the second chromosome site is preferably from 0.5 to Mb, more preferably from 1.0 to 1.5 Mb.
  • the start position of the second chromosome site is set between the base positions 31,000,000 and 32,000,000 of chromosome 10
  • the end position is set between the base positions 32,500,000 and 33,500,000 of chromosome 10.
  • the length of the probe 2A is, for example, 300 kb to 800 kb, preferably 500 kb to 700 kb.
  • Specific examples of the probe 2A include a BAC clone GSP1528C10 insert (consisting of a sequence corresponding to base positions 32417786 to 32584317 of chromosome 10) and a BAC clone GSP3158B05 insert (base position 32572458 to 32735258 of chromosome 10). And a BAC clone GSP1107C12 insert (consisting of a sequence corresponding to nucleotide positions 32715505 to 32844442 of chromosome 10), and a BAC clone GSP1094C12 insert (chromosome 10).
  • the length of the probe 2B is, for example, 400 kb to 900 kb, preferably 600 kb to 800 kb.
  • Specific examples of probe 2B include a fluorescently labeled insert of BAC clone GSP1544E09 (consisting of a sequence corresponding to base positions 31658954 to 31808161 of chromosome 10), and an insert of BAC clone GSP1541C10 (base position 31800804 to 31960808 of chromosome 10).
  • BAC clone GSP1023E07 insert (consisting of a sequence corresponding to nucleotide positions 31903114 to 32124185 of chromosome 10), and an insert of BAC clone GSP1581D09 (chromosome 10) Fluorescently labeled with a BAC clone GSP3119B09 insert (consisting of a sequence corresponding to nucleotide positions 32233254 to 32404265 (NCBI: Build37.2) of chromosome 10). A combination (mixture) of labels. These inserts are all fluorescently labeled with the same fluorescent material.
  • a probe related to the KIF5B gene Complementary to the chromosomal site containing the RET gene (3rd chromosomal site), complementary to the probe 4A labeled with the first fluorescent substance and the chromosomal site containing the KIF5B gene (4th chromosomal site), The probe 4B is labeled with a fluorescent substance.
  • Probe 4A covers the full length of the RET gene, and probe 4B covers the full length of the KIF5B gene.
  • the length of the third chromosome site is preferably from 0.5 to 2.0 Mb, more preferably from 1.0 to 1.5 Mb.
  • the start position of the third chromosome site is between base positions 42,500,000 and 43,500,000 of chromosome 10, and the end position is between base positions 44,000,000 and 45,000,000 of chromosome 10.
  • the length of the fourth chromosome site is preferably 0.5 to Mb to 2.0 to Mb, more preferably 1.0 to Mb to 1.5 to Mb.
  • the start position of the fourth chromosome site is between base positions 31,000,000 and 32,000,000 of chromosome 10, and the end position is between base positions 32,500,000 and 33,500,000 of chromosome 10.
  • the length of the probe 4A is, for example, 800 kb to 1,500 kb, preferably 1,000 kb to 1,300 kb.
  • Specific examples of probe 4A include a fluorescently labeled insert of BAC clone GSP1506F09 (consisting of a sequence corresponding to base positions 43020444 to 43224507 of chromosome 10), and an insert of BAC clone GSP1877H08 (base positions of chromosome 1043563936 to 43335238).
  • BAC clone GSP1018G02 insert consisting of sequences corresponding to nucleotide positions 43670474 to 43814797 of chromosome 10
  • BAC clone GSP1070C12 insert chromosome 10
  • BAC clone GSP0369G08 comprising a sequence corresponding to base positions 43893593 to 44100865 of chromosome 10
  • BAC clone GSP0075D03 Fluorescent insert (consisting of a sequence corresponding to base positions 44076856 to 44195623 of chromosome 10) Despite his identification is a combination (mixture).
  • These inserts are all fluorescently labeled with the same fluorescent material.
  • the length of the probe 4B is, for example, 900 kb to 1,700 kb, preferably 1,200 kb to 1,500 kb.
  • Specific examples of the probe 4B include a fluorescently labeled insert of BAC clone GSP1544E09 (consisting of a sequence corresponding to base positions 31658954 to 31808161 of chromosome 10), and an insert of BAC clone GSP1541C10 (base position 31800804 to 31960808 of chromosome 10).
  • BAC clone GSP1023E07 insert (consisting of a sequence corresponding to nucleotide positions 31903114 to 32124185 of chromosome 10), and an insert of BAC clone GSP1581D09 (chromosome 10) Of BAC clone GSP3119B09 (consisting of a sequence corresponding to base positions 32233254 to 32404265 of chromosome 10), BAC clone GSP1528C10 Fluorescent insert (consisting of a sequence corresponding to base positions 32417786-32584317 of chromosome 10) Fluorescence-labeled insert of BAC clone GSP3158B05 (consisting of the sequence corresponding to base positions 32572458 to 32735258 of chromosome 10), insert of BAC clone GSP1107C12 (corresponds to base positions 32715505 to 32884442 of chromosome 10) A combination (mixture) of fluorescently labeled
  • a relatively long probe in the above specific example, about 200 kb (probe 1A) to about 1370 kb (probe 4B)
  • the complementarity between the probe and the target sequence may not be highly stringent as long as the specific hybridization intended in the present invention is achieved.
  • the sequence identity with the target sequence is, for example, 90% or more, preferably 95% or more, more preferably 98% or more.
  • Each probe can be designed based on the information provided in this specification regarding the translocation breakpoint and the sequence data of the KIF5B-RET translocation, and the descriptions in the literature cited herein.
  • the KIF5B-RET translocation the existence of several variants (variants) is known, but the possibility of the existence of another variant cannot be ruled out.
  • a probe designed to recognize a particular variant may recognize one or more other variants.
  • the probe used in the present invention can be prepared using a BAC (bacterial artificial chromosome) clone of GSP Laboratory.
  • BAC is a vector used to clone relatively long DNA fragments in E. coli cells.
  • a plurality of BAC clones are used to obtain a probe with a wide range of coverage (consisting of a plurality of DNA fragments labeled with the same fluorescent substance). .
  • the first probe set and the second probe set used in the present invention correspond to so-called “break-apart” probes.
  • the fluorescence signal of each probe constituting the probe set is detected adjacent to or overlapping with the sample in which the KIF5B-RET translocation has not occurred, and the KIF5B-RET translocation is detected.
  • loci occur, they are detected at remote locations for chromosome segregation.
  • the first probe set is a probe set related to the RET gene.
  • KIF5B-RET translocation does not occur (that is, in the case of a non-translocation type sample)
  • the probe 1A and probe 1B hybridize to the chromosome in close proximity, and the KIF5B-RET translocation occurs. If so (ie, in the case of a translocation sample), the probe 1A and the probe 1B are hybridized to the chromosome in a state of being separated. Therefore, it is possible to determine the presence or absence of the KIF5B-RET translocation based on the positional relationship between the fluorescent signal of the probe 1A and the fluorescent signal of the probe 1B.
  • the second probe set is a probe set related to KIF5B.
  • the probe set is used, if the KIF5B-RET translocation does not occur (that is, in the case of a non-translocated sample), the probe 2A and the probe 2B will hybridize in close proximity, and the KIF5B-RET translocation has occurred.
  • the probe 2A and the probe 2B are hybridized to the chromosome in a state where they are separated. Therefore, it is possible to determine the presence or absence of the KIF5B-RET translocation based on the positional relationship between the fluorescent signal of the probe 2A and the fluorescent signal of the probe 2B.
  • the third probe set consists of the probe 2A targeting the 5 ′ end of the KIF5B gene (ie, the region constituting the KIF5B-RET fusion gene) and the 3 ′ end of the RET gene (ie, the KIF5B-RET fusion gene). This is a combination of the probe 1B targeting the region).
  • the probe 2A and probe 1B are hybridized to the chromosome in a separated state, and the KIF5B-RET translocation occurs. If so (that is, in the case of a translocation type sample), the probe 2A and the probe 1B are hybridized in close proximity.
  • both KIF5B cleavage and RET gene cleavage associated with translocation can be grasped. Therefore, it can be said that it is the most useful probe set for the purpose of the present invention. Further, it is considered to be a probe set that recognizes all variants reported to date (including those newly reported in the present specification).
  • the fourth probe set is a combination of a probe 4A related to the RET gene and a probe 4B related to the KIF5B gene.
  • the probe set is used, if the KIF5B-RET translocation does not occur (that is, in the case of a non-translocated sample), the probe 4A and the probe 4B can hybridize to the chromosome, and the KIF5B-RET translocation has occurred.
  • the probe 4A and the probe 4B cannot hybridize to the chromosome. Therefore, the presence or absence of the KIF5B-RET translocation can be determined depending on whether or not a fluorescent signal can be detected.
  • One of the probes constituting each probe set of the present invention is labeled with a first fluorescent substance, and the other is labeled with a second fluorescent substance (a fluorescent substance that generates a fluorescent signal different from that of the first fluorescent substance).
  • a second fluorescent substance a fluorescent substance that generates a fluorescent signal different from that of the first fluorescent substance.
  • fluorescent materials include Texas Red (registered trademark), FITC, 7-AAD, Alexa Fluor (registered trademark) 488, Alexa Fluor (registered trademark) 350, Alexa Fluor (registered trademark) 546, Alexa Fluor (registered trademark) 555.
  • the fluorescent labeling of the probe may be performed by a known method. For example, labeling can be performed by a random priming method or a nick translation method according to a standard protocol.
  • the first probe set or the third probe set is used.
  • the third probe set is used.
  • the third probe set is used.
  • the third probe set since it is possible to grasp both the KIF5B gene translocation and the RET gene translocation, the most reliable determination is possible.
  • the third probe set is used, a more reliable determination result can be obtained by using another probe set in combination. Examples of the combined use here include the combined use of the third probe set and the first probe set, and the combined use of all probe sets (first probe set to fourth probe set).
  • the following steps (i) to (iv) are performed.
  • the chromosome sample in step (i) is prepared by a conventional method from a sample (eg, blood, skin tissue, hair) collected from the subject.
  • a sample eg, blood, skin tissue, hair
  • the term “subject” refers to a human or a non-human mammal. Mammals other than humans include livestock animals, pets, laboratory animals, and non-human primates. Specific examples include chickens, horses, cows, pigs, goats, dogs, cats, guinea pigs, hamsters, minks and It is a rabbit.
  • a typical subject is a human.
  • a preferred subject is a patient with lung cancer. Among lung cancer patients, non-small cell lung cancer patients or lung cancer patients at risk of suffering from non-small cell lung cancer are particularly preferred subjects.
  • Steps (i) to (iii) are essential and basic steps in the FISH assay, and those skilled in the art can set appropriate conditions with reference to the examples described later.
  • Steps (i) to (iii) are essential and basic steps in the FISH assay, and those skilled in the art can set appropriate conditions with reference to the examples described later.
  • Steps (i) to (iii) are essential and basic steps in the FISH assay, and those skilled in the art can set appropriate conditions with reference to the examples described later.
  • Steps (i) to (iii) are essential and basic steps in the FISH assay, and those skilled in the art can set appropriate conditions with reference to the examples described later.
  • In implementing this refer to Leitch at al. In situ Hybridization: a practical guide, Oxford BIOS Scientific Publishers, Microscopy handbooks v 2 (1994) describing the general conditions of in situ hybridization. it can.
  • hybridization refers to a process of binding two DNAs or a DNA and an RNA complementary strand for the formation of a double-stranded molecule, or a formed double-stranded molecule.
  • the hybridization conditions in the present invention may vary depending on the chromosome sample and the probe set employed, but those skilled in the art can easily set them through preliminary experiments. Moreover, high stringency conditions or low stringency conditions can be employed as hybridization conditions. Appropriate hybridization conditions can be set by adjusting parameters such as temperature, salt concentration, and formamide concentration.
  • hybridization conditions are changed in the hybridization step (ie, step (i)) or the subsequent washing step (ie, step (ii)). Also good.
  • high stringency conditions are employed, the background signal can be reduced, but at the same time the sensitivity is reduced.
  • An example of high stringency conditions is a reaction at 0.1 xPESSPE, 0.1% SDS, 65 ° C
  • an example of medium stringency conditions is a reaction at 0.2 x SSOE, 0.1% SDS, 50 ° C
  • low stringency An example of a jenci condition is a reaction at 1 x SSPE, 0.1% SDS, 50 ° C.
  • step (iii) following step (ii) a fluorescent signal is detected.
  • the hybridization signal in the FISH assay is detected by visualizing the fluorescent label of the nucleic acid probe through a fluorescence microscope or the like.
  • the presence or absence of translocation between the KIF5B gene and the RET gene is determined based on the fluorescence signal pattern (fluorescence image) obtained in step (iii) (step (iv)).
  • the determination here can be automatically / mechanically performed without depending on the determination of a person having specialized knowledge such as a doctor or a laboratory technician, as is apparent from the determination criteria.
  • one probe is labeled with a specific fluorescent substance, and the other probe is labeled with another fluorescent substance that generates a fluorescent signal different from the fluorescent substance.
  • a chromosome sample in which a translocation occurs between the KIF5B gene and the RET gene typically has two fluorescent lights. A merged signal (yellow) is detected.
  • two fluorescent signals red signal and green signal
  • two fluorescent signals are detected separately.
  • the determination in step (iv) is preferably made based on comparison with a control (test sample).
  • the control here is, for example, a chromosomal sample derived from a non-small cell lung cancer patient or a chromosomal sample derived from a patient exhibiting a precancerous lesion.
  • a chromosomal sample of a patient without a precancerous lesion, a sample derived from a patient not suffering from cancer, a chromosomal sample derived from a healthy person, and the like can also be used as controls.
  • a chromosome sample derived from a cell line can also be used as a control.
  • two or more probe sets are selected, and steps (i) to (iii) are individually performed using each selected probe set. Then, in step (iv), the presence or absence of translocation between the KIF5B gene and the RET gene is determined by combining the fluorescence signal patterns obtained for each probe set.
  • the probe set selected in this aspect includes the first probe set and the third probe set.
  • the second aspect of the present invention relates to application and use of the detection method of the present invention.
  • One embodiment of this aspect relates to a method for detecting non-small cell lung cancer, and a subject (patient) from which a chromosomal sample is derived when it is determined by the detection method of the present invention that there is a translocation between the KIF5B gene and the RET gene.
  • the determination here can be made automatically / mechanically without depending on the judgment of a person having specialized knowledge, such as a doctor or laboratory technician, as is apparent from the judgment criteria. Identifying whether a subject has non-small cell lung cancer is important in determining an appropriate treatment strategy.
  • the detection method of the present invention When it is determined by the detection method of the present invention that there is a translocation between the KIF5B gene and the RET gene, it may be determined that the subject from which the chromosomal sample is derived has adenocarcinoma. Moreover, you may decide to determine prognosis based on the result of the detection method of this invention. For example, it can be determined whether the prognosis is poor, intermediate, or good.
  • Another embodiment relates to a method for determining a therapeutic strategy, and when the detection method of the present invention determines that there is a translocation between the KIF5B gene and the RET gene, the subject (patient) from which the chromosomal sample is derived is treated as a RET kinase. Determine that the inhibitor should be treated. In other words, the subject is identified as a candidate to be treated with a RET kinase inhibitor.
  • a treatment policy can be determined based on the determination. For example, treatment with one or more RET kinase inhibitors will be recommended or prescribed. Moreover, treatment / treatment or the like may be performed on the subject based on the determination. Note that the same determination may be made for a patient from which a chromosomal sample whose RET gene translocation is proved by using the first probe set or the third probe set is derived.
  • treatment is intended to prevent, ameliorate, prevent or cure a disease (eg, non-small cell lung cancer) or condition.
  • Treatment after symptoms appear is aimed at reducing, ameliorating or eliminating the symptoms and / or related symptoms, or preventing exacerbations.
  • Treatment before symptoms appear is typically aimed at reducing the risk of symptoms appearing or reducing the severity if symptoms appear.
  • RET kinase inhibitors examples include sunitinib (SUNITINIB), sorafenib (SORATINIB) and vandetanib (VANDETANIB).
  • a RET kinase inhibitor a compound that knocks down the expression of RET can also be used. Examples of such compounds are antibodies, small molecules, peptides, aptamers. In general, any molecule that can inhibit the expression of RET can knock down the expression of RET. For example, RNAi, antisense RNA, ribozyme, miRNA and the like can be used. Various gene knockdown strategies known in the art can be employed.
  • the RET kinase inhibitor may inhibit the expression (for example, transcription, translation and / or stability) of RET and / or RET kinase activity.
  • Inhibitors may be RET-specific or non-specific (eg, non-specific kinase inhibitors, multi-target inhibitors).
  • RET kinase inhibitors have been developed and their clinical application is being investigated. Downstream of RET kinase activity are phosphatidylinositol 3 kinase (PI3K), extracellular signal kinase 1/2 (ERK) (Wixted JH et al. J Biol Chem 2011), STAT3 (Hwang JH et al. Mol Endocrinol 2003; 17 : 1155-1166). Agents that inhibit such downstream signaling pathways can also be used as an alternative or supplement to RET kinase inhibitors.
  • PI3K phosphatidylinositol 3 kinase
  • ERK extracellular
  • Sunitinib is an anticancer agent for gastrointestinal stromal tumor (GIST) and kidney cancer that was approved in April 2008 and launched in June 2008, and is involved in angiogenesis VEGF (vascular endothelial growth factor) It targets multiple receptors such as the receptor, PDGF (platelet-derived growth factor) receptor involved in tumor growth, and RET. Sorafenib is an inhibitor targeting multiple receptors targeting Braf, RET, etc., which has been expanded for kidney cancer and unresectable hepatocellular carcinoma. Vandetanib has an anti-angiogenic action because it targets EGFR and VEGF, but it also inhibits RET, so the US FDA has approved it for medullary thyroid cancer.
  • GIST gastrointestinal stromal tumor
  • RET vascular endothelial growth factor
  • a subject determined to have a KIF5B-RET translocation is also determined to have a RET mutation at a site after the translocation site.
  • the RET mutation is, for example, an activation mutation.
  • An activating mutation of RET is any mutation that results in increased activity compared to the wild type mutation.
  • activating mutations in RET may result in constitutive activation of RET. It may also be a secondary RET activation variant associated with or resulting from the use of a RET inhibitor. Mutations that cause an increase in RET signal activity are caused, for example, by point mutations, deletions, insertions, replications, inversions, or combinations of two or more thereof in the kinase domain that cause an increase in RET signal.
  • a subject determined to have both a KIF5B-RET translocation and other RET mutations should be treated with a RET kinase inhibitor.
  • treatment / treatment or the like may be performed on the subject based on the determination.
  • a further aspect of the present invention relates to a method for determining a therapeutic strategy, and a subject (patient) from which a chromosomal sample is derived when it is determined by the detection method of the present invention that there is a translocation between the KIF5B gene and the RET gene. Should be treated with an EGFR inhibitor and / or an ALK inhibitor.
  • a subject determined to have a KIF5B-RET translocation has an EGFR mutation
  • (2) a subject determined to have a KIF5B-RET translocation has an ALK translocation mutation
  • a subject determined to have the KIF5B-RET translocation will be determined to have an EGFR mutation and an ALK translocation mutation.
  • the EGFR mutation is, for example, an activation mutation.
  • An activating mutation of EGFR is any EGFR mutation that results in increased activity compared to the wild type mutation. Activating mutations in EGFR may result in constitutive activation of EGFR.
  • a cancer associated with increased EGFR signal may express a variant of EGFR with a deletion in the extracellular domain.
  • the variant EGFR is EGFRvIII. Mutations that cause an increase in EGFR signal activity are caused, for example, by point mutations, deletions, insertions, replications, inversions, or combinations of two or more thereof in the kinase domain that cause an increase in EGFR signal.
  • a subject determined to have both a KIF5B-RET translocation and an EGFR mutation should be treated with an inhibitor of RET kinase activity and / or EGFR activity.
  • treatment / treatment or the like may be performed on the subject based on the determination.
  • EGFR inhibitors are gefitinib, erlotinib, lavatinib, TAK-285, EKB-569 and vandetanib.
  • the ALK translocation mutation is, for example, EML4-ALK.
  • An ALK translocation mutation is, for example, an activation mutation.
  • An activating mutation of ALK is any ALK mutation that results in increased activity compared to the wild type mutation.
  • a further aspect of the present invention relates to a method for determining a therapeutic strategy, wherein the detection method of the present invention determines that there is no translocation between the KIF5B gene and the RET gene, and a chromosomal sample is derived from the method.
  • the subject is a patient with non-small cell lung cancer, the subject is determined to have other genetic abnormalities specific to lung cancer.
  • the present application also provides a therapeutic method including the step of treating a subject according to the therapeutic policy determined by the method of the present invention.
  • the disease to be treated by the treatment method of the present invention is typically non-small cell lung cancer (NSCLC).
  • NSCLC non-small cell lung cancer
  • cancer is interpreted broadly. In the present invention, the term “cancer” is used interchangeably with “tumor”. It may also include benign tumors, benign malignant border lesions, and malignant tumors before the pathological diagnosis is confirmed, that is, before any benign or malignant tumor is confirmed. possible. Cancer is called the name of the organ that developed it, or the name of the mother tissue.
  • the main cancers are: tongue cancer, gingival cancer, pharyngeal cancer, maxillary cancer, laryngeal cancer, salivary gland cancer, esophageal cancer.
  • the occurrence of cancer can be prevented, the symptoms of cancer can be reduced, and / or the growth of cancer can be inhibited.
  • one or more compounds selected from the group consisting of a RET inhibitor, an ALK inhibitor, and an EGFR inhibitor are administered. These compounds may be administered before or after surgery and / or radiation therapy intended for the treatment of cancer. Surgery and radiation therapy are common methods for treating cancer. Surgery can also be employed as a preventive measure to reduce the risk of developing cancer.
  • a subject at risk of developing colorectal cancer eg, a patient with familial colorectal polyposis
  • Patients with precancerous lesions of lung cancer AAH may also undergo lung resection.
  • these patients are also administered a RET inhibitor before or after surgery.
  • one or more cancer drugs are used together with one or more compounds selected from the group consisting of a RET inhibitor, an ALK inhibitor, and an EGFR inhibitor.
  • a chemotherapeutic agent and / or an immunotherapeutic agent is administered together with a RET inhibitor.
  • a cancer drug is a drug used for the purpose of treating a patient suffering from cancer or a subject at risk of developing cancer.
  • the cancer medicament contains one or more components selected from the group consisting of, for example, an immunotherapeutic agent, a chemotherapeutic agent, and a cancer vaccine.
  • a chemotherapeutic agent is a chemical or biological agent that directly targets cancer cells. Some chemotherapeutic agents function to inhibit the cellular activity of cancer cells that depend on sustained survival. Examples of chemotherapeutic agents are alkylating agents / alkaloids, antimetabolites, hormones or hormone analogs, antineoplastic agents.
  • chemotherapeutic agents include, but are not limited to, aminoglycosides, asparakinase, busulfan, carboplatin, chlorambucil, cytarabine HCL, cisplatin, dactinomycin, daunorubicin HCL, estramustine phosphate sodium, etoposide (VP-16-2139), Floxuridine, Fluorouracil (5-FU), Flutamide, Hydroxyurea (Hydroxycarbamide), Ifosfamide, Interferon alfa 2a, Leuprolide acetate (LHRH releasing factor analog), Lomustine (CCNU), Mechlorethamine HCL (nitrogen mustard), mercaptopurine, mesna, mitotane (op'-DDD), mitoxantrone HCL, octreotide, bricamycin, procarbazine HCL, streptozocin, tamoxifen citrate, pe Metrexate
  • hormone therapy may be used in combination.
  • hormones or hormone substitutes or hormone derivatives are administered to a subject who has cancer or is at risk of having cancer.
  • Specific examples include estrogen therapy (eg, use of diethylstilbestrol and ethinyl estradiol (eg, breast and prostate cancer)), anti-estrogen therapy (eg, use of tamoxifen (eg, breast cancer)), progesterone therapy (eg, medroxyprogesterone and methoxyprogesterone acetate).
  • Guest rolls eg use of breast cancer and endometrial cancer
  • androgen blockade eg use of antiandrogens such as flutamide, eg prostate cancer).
  • KIF5B-RET translocation detection kit A further aspect of the present invention relates to a kit for detecting the KIF5B-RET translocation.
  • the kit of the present invention makes it possible to perform the detection method of the present invention simply and efficiently.
  • the kit of the present invention includes the first probe set, the second probe set, the third probe set, or the fourth probe set as an essential element (essential component). Two or more types of probe sets may be included.
  • a kit including a first probe set and a third probe set is provided. Since the details of each probe set are as described above, description thereof is omitted here.
  • the kit of the present invention may contain other elements.
  • other elements include instructions for probe usage, DNA counterstains such as DAPI, hybridization buffers, wash buffers, solvents, mounting media, control slides, reaction vessels, and other It is an instrument. It may further include instructions for diagnostic purposes.
  • the detection (positive identification) of the KIF5B-RET translocation in a chromosome sample derived from a cancer patient may further include an instruction or the like indicating that the patient should be treated with a RET kinase inhibitor. Further, it may include guidelines and explanations for determining a treatment policy.
  • RT-PCR and mutation analysis Primer sets of the following sequences were used for RT-PCR analysis of KIF5B-RET.
  • the forward primer (AAATGAGCTCAACAGATGGCGTAA: SEQ ID NO: 1) corresponds to exon 12 of the KIF5B gene.
  • the reverse primer (AGAACCAAGTTCTTCCGAGGGAAT: SEQ ID NO: 2) corresponds to exon 12 of the RET gene.
  • Amplification by PCR was performed using Takara EXTaq (Takara Bio Inc. Shiga Japan) based on the manufacturer's guidelines using the prepared cDNA. Forty cycles of amplification were performed.
  • the obtained PCR product (681 bp for variant type 1 and 1395 bp for variant type 3) was analyzed by agarose gel electrophoresis, and direct sequencing was also performed.
  • FISH Fluorescence in situ hybridization
  • BAC clones around the RET locus (GSP1506F09, GSP3023D06, GSP3012B07, GSP1877H08, GSP1018G02, GSP1070C12, GSP0369G08, GSP0075D03) and 9 types of BAC clones around the KIF5B locus (GSP1544E09, GSP1541C15GSP, GSP1541C10GSP GSP3158B05, GSP1107C12, GSP1094C12) were selected. BAC clones were streaked on LB agar plates containing chloramphenicol and grown overnight at 37 ° C.
  • BAC DNA Single colonies from each BAC clone were selected and grown overnight at 37 ° C., and BAC DNA was extracted using established techniques. These BAC DNAs are labeled with Fluorescein12-dUTP (FITC) (PerkinElmer, Massachusetts, USA) or TexRed-5-dUTP (PerkinElmer, Massachusetts, USA) using NickTranslation Kit (GSP Laboratories, Inc.) Four types of FISH probe sets were prepared (see FIGS. 1 to 6, 11, and 12).
  • FITC Fluorescein12-dUTP
  • TexRed-5-dUTP PerkinElmer, Massachusetts, USA
  • Probe 1A GSP1506F09 insert labeled with TexRed
  • Probe 1B GSP1877H08, GSP1018G02, GSP1070C12, GSP0369G08 and GSP0075D03 inserts FITC-labeled (mixture of 5 types of DNA fragments)
  • Probe 1A GSP1506F09, GSP3023D06 and GSP3012B07 inserts labeled with TexRed (mixture of three DNA fragments)
  • Probe 1B FISP-labeled inserts of GSP1877H08, GSP1018G02, GSP1070C12, GSP0369G08 and GSP0075D03 (mixture of 5 types of DNA fragments)
  • Probe 2A GSP1528C10, GSP3158B05, GSP1107C12 and GSP1094C12 inserts labeled with TexRed (mixture of four DNA fragments)
  • Probe 2B FISP-labeled GSP1544E09, GSP1541C10, GSP1023E07, GSP1581D09 and GSP3119B09 (mixture of 5 DNA fragments)
  • KIF5B / RET SY translocation dual color FISH probe consisting of probe 1B and probe 2A (KIF5B / RET, SY Translocation Dual Color FISH Probe)
  • Probe 4A GSP1506F09, GSP1877H08, GSP1018G02, GSP1070C12, GSP0369G08 and GSP0075D03 inserts labeled with TexRed (mixture of 6 DNA fragments)
  • Probe 4B FISP-labeled inserts of GSP1544E09, GSP1541C10, GSP1023E07, GSP1581D09, GSP3119B09, GSP1528C10, GSP3158B05, GSP1107C12 and GSP1094C12 (mixture of nine types of DNA fragments)
  • FISH slides were prepared using standard cytogenetic techniques. The paraffin-embedded specimen was sliced to 5 ⁇ m with a microtome, attached to an aminosilane-coated slide glass, and thoroughly dried overnight in a constant temperature bath at 40 ⁇ 3 ° C.
  • (3-5) FISH detection method (a) Pretreatment The pretreatment reagent is placed in a staining doze and warmed in advance in a warm bath until the pretreatment reagent reaches 95-99 ° C. Immerse the specimen tissue slide in the warmed pretreatment reagent, and let it react for 10 minutes while keeping the temperature of the pretreatment reagent at 95-99 ° C in a warm bath. Remove the stained doze from the hot tub and leave it for 15 minutes at room temperature with the specimen tissue slide immersed. Remove the specimen tissue slide from the pretreatment reagent, immerse it in purified water and lightly rinse. Furthermore, the purified water is replaced with a new one, and the same operation is performed twice. Immerse the specimen tissue slide in the washing solution for 5 minutes. Replace the cleaning solution with a new one and immerse for 5 minutes.
  • probe reagent (10 ⁇ L) is dropped onto a sample tissue, and the sample tissue is covered with a cover glass, and the cover glass is sealed with a cover glass sealer. Place the specimen tissue slide on the Hybridizer (S2450) to denature the probe and target DNA for 5 minutes at 82 ° C. After denaturation, the reaction is continued at 37 ° C. for 16 to 72 hours. After washing the excess FISH probe (see below), the specimen was counterstained with 4 ′, 6-diamidino-2-phenylindole (DAPI).
  • DAPI 6-diamidino-2-phenylindole
  • Fluorescent labels were visualized with alkaline phosphatase-labeled anti-Tex RED antibody (colored in red) and peroxidase-labeled anti-FITC antibody (colored in blue) using Dako's Double staining chromogenic in situ hybridization kit (Dako DuoCISH SK108) Observation with an optical microscope was possible, and comparison with immunohistochemical staining was performed.
  • results RT-PCR and long-distance genomic PCR are methods applicable to the detection of KIF5B-RET fusion genes from cell lines or fresh tumor specimens.
  • FFPE formalin-fixed paraffin-embedded
  • the inventor newly designed a probe set for detecting the KIF5B-RET translocation and developed a FISH method using the probe set. In order to evaluate the performance of the probe set, examination was performed using clinical specimens (specimens that recognized the KIF5B-RET fusion gene and NSCLC specimens that did not recognize the KIF5B-RET fusion gene).
  • the first probe set consists of a TexRed labeled probe (probe 1A) that hybridizes to the 5 ′ region of the RET gene, and a FITC labeled probe (probe 1B) that hybridizes to the RET gene and its 3 ′ region. If the KIF5B-RET translocation is present, the two probes hybridize to the chromosome at distant positions, and as a result, the red and green dots are observed at distant positions. If the KIF5B-RET translocation does not exist, the two probes hybridize to the chromosome in close proximity, resulting in the combination of red and green dots and the observation of yellow dots.
  • FIG. 7 shows the result (fluorescence detection image) of FISH (using the first probe set a) for the specimen in which the KIF5B-RET fusion gene is observed. A clear red dot and a green dot are detected (circled). When another first probe set (first probe set b) was used, a clearer split signal was observed (FIG. 13).
  • the third probe set consists of a TexRed labeled probe (probe 2A) that hybridizes to the 5 ′ region of the KIF5B gene, a RET gene and a FITC labeled probe (probe 1B) that hybridizes to the 3 ′ region thereof. If the KIF5B-RET translocation is present, the two probes will hybridize to the chromosome in close proximity, resulting in the combination of red and green dots and the observation of yellow dots. If the KIF5B-RET translocation does not exist, the two probes are separated and hybridize to the chromosome, and as a result, red dots and green dots are observed at separate positions.
  • FIG. 8 shows the FISH result (fluorescence detection image) for a sample in which the KIF5B-RET fusion gene is observed.
  • a yellow dot in which a red dot and a green dot are merged is recognized (circled). As described above, it was shown that each probe set was effective in detecting the KIF5B-RET translocation.
  • Non-patent Document 6 Korean non-small cell lung cancer
  • Our research group uses RE-PCR to determine the frequency of KIF5B-RET fusion genes in non-small cell lung cancer (277 cases) derived from patients of Japanese specimens (176 adenocarcinomas and 101 squamous cell carcinomas). investigated. As a result, the same two types of mutants as in the previous report were detected in 3 persons.
  • FIG. 9 shows a variant 1 type translocation, in which exon 15 of the KIF5B gene and exon 12 of the RET gene are fused and translocated.
  • the new variant was a fusion of exon 22 of KIF5B and exon 12 of the RET gene (FIG. 10). All tumors with a KIF5B-RET fusion gene were adenocarcinoma and non-small cell lung cancer patients who were non-tobacco smokers and occurred more frequently than smokers. As controls, breast cancer (60 cases), colon cancer (10 cases), and papillary adenocarcinoma (1 case) were also examined, but no mutants were observed. The mutant was not detected from the normal lung tissues of 3 persons who had the mutant.
  • KIF5B-RET translocation was observed in adenocarcinomas (148 cases) with known lung cancer development-related gene abnormalities such as EGFR, Kras, Braf, ErbB2, and EML4-ALK translocation. There was no translocation from squamous cell carcinoma. These results suggest that the KIF5B-RET fusion gene is a cancer development-related gene.
  • RET inhibitors are effective treatments because RET is activated when the KIF5B-RET translocation occurs.
  • immunohistochemical examination was performed to the case where the variation
  • the method of dyeing was classified into G1 (granular) and G2 (and chronic), and if G2 and the staining range were 50% or more, there was a high possibility of RET translocation (it seems to have a correlation). No significant correlation with translocation cases was observed with the antibody manufactured by Vector TM Laboratories.
  • the presence or absence of KIF5B-RET translocation can be determined. Confirming the presence of the KIF5B-RET translocation is important and beneficial in determining the therapeutic strategy for lung cancer (particularly non-small cell lung cancer).
  • the present invention is expected to contribute to the realization of tailor-made medicine.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Oncology (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Hospice & Palliative Care (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Hematology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

La présente invention concerne un procédé permettant de détecter la translocation entre le gène KIF5B et le gène RET. Une analyse par hybridation in situ en fluorescence est effectuée en utilisant une série de sondes conçues pour créer un motif fluorescent reflétant l'apparition de la translocation entre le gène KIF5B et le gène RET.
PCT/JP2013/050868 2012-01-27 2013-01-18 Analyse fish pour la détection de la translocation entre le gène kif5b et le gène ret WO2013111668A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
JP2012-015939 2012-01-27
JP2012015939 2012-01-27
JP2012-104585 2012-05-01
JP2012104585A JP2013172706A (ja) 2012-01-27 2012-05-01 Ｋｉｆ５ｂ遺伝子とｒｅｔ遺伝子との間の転座を検出するｆｉｓｈアッセイ

Publications (1)

Publication Number Publication Date
WO2013111668A1 true WO2013111668A1 (fr) 2013-08-01

Family

ID=48873389

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2013/050868 WO2013111668A1 (fr) 2012-01-27 2013-01-18 Analyse fish pour la détection de la translocation entre le gène kif5b et le gène ret

Country Status (2)

Country Link
JP (1) JP2013172706A (fr)
WO (1) WO2013111668A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9297011B2 (en) 2011-08-23 2016-03-29 Foundation Medicine, Inc. KIF5B-RET fusion molecules and uses thereof
US10668075B2 (en) 2012-09-25 2020-06-02 Chugai Seiyaku Kabushiki Kaisha RET inhibitor

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP6231709B1 (ja) * 2016-05-31 2017-11-15 シスメックス株式会社 蛍光画像分析装置および分析方法

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
HENDERSON Y. C. ET AL.: "Sorafenib Potently Inhibits Papillary Thyroid Carcinomas Harboring RET/PTC1 Rearrangement", CLINICAL CANCER RESEARCH, vol. 14, no. 15, 2008, pages 4908 - 4914, XP055081498 *
JU Y. S. ET AL.: "A transforming KIF5B and RET gene fusion in lung adenocarcinoma revealed from whole-genome and transcriptome sequencing", GENOME RESEARCH, vol. 22, 22 December 2011 (2011-12-22), pages 436 - 445, XP003031534 *
KIM D. W. ET AL.: "An Orally Administered Multitarget Tyrosine Kinase Inhibitor, SU11248, Is a Novel Potent Inhibitor of Thyroid Oncogenic RET/Papillary Thyroid Cancer Kinases", THE JOURNAL OF CLINICAL ENDOCRINOLOGY & METABOLISM, vol. 91, 2006, pages 4070 - 4076, XP003019456 *
KWAK E. L. ET AL.: "Anaplastic Lymphoma Kinase Inhibition in Non-Small-Cell Lung Cancer", THE NEW ENGLAND JOURNAL OF MEDICINE, vol. 363, 2010, pages 1693 - 1703, XP055081495 *
SAKAIRI Y. ET AL.: "EML4-ALK Fusion Gene Assessment Using Metastatic Lymph Node Samples Obtained by Endobronchial Ultrasound-Guided Transbronchial Needle Aspiration", CLINICAL CANCER RESEARCH, vol. 16, no. 20, 2010, pages 4938 - 4945, XP055081497 *
SASAKI H. ET AL.: "RET expression and detection of KIF5B/RET gene rearrangements in Japanese lung cancer", CANCER MEDICINE, vol. 1, no. 1, 12 July 2012 (2012-07-12), pages 68 - 75, XP055081499 *
SUEHARA Y. ET AL.: "Identification of KIF5B-RET and GOPC-ROS1 Fusions in Lung Adenocarcinomas through a Comprehensive mRNA-Based Screen for Tyrosine Kinase Fusions", CLINICAL CANCER RESEARCH, vol. 18, no. 24, 10 October 2012 (2012-10-10), pages 6599 - 6608, XP055081500 *
TAKEUCHI K. ET AL.: "KIF5B-ALK, a Novel Fusion Oncokinase Identified by an Immunohistochemistry-based Diagnostic System for ALK-positive Lung Cancer", CLINICAL CANCER RESEARCH, vol. 15, no. 9, 2009, pages 3143 - 3149, XP055069999 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9297011B2 (en) 2011-08-23 2016-03-29 Foundation Medicine, Inc. KIF5B-RET fusion molecules and uses thereof
US9884060B2 (en) 2011-08-23 2018-02-06 Foundation Medicine, Inc. KIF5B-RET fusion molecules and uses thereof
US10668075B2 (en) 2012-09-25 2020-06-02 Chugai Seiyaku Kabushiki Kaisha RET inhibitor
US11633402B2 (en) 2012-09-25 2023-04-25 Chugai Seiyaku Kabushiki Kaisha RET inhibitor

Also Published As

Publication number Publication date
JP2013172706A (ja) 2013-09-05

Similar Documents

Publication Publication Date Title
JP6032616B2 (ja) Ｋｉｆ５ｂ遺伝子とｒｅｔ遺伝子との融合遺伝子、並びに該融合遺伝子を標的としたがん治療の有効性を判定する方法
Trost et al. Premature senescence is a primary fail-safe mechanism of ERBB2-driven tumorigenesis in breast carcinoma cells
US20110110923A1 (en) Fish assay for eml4 and alk fusion in lung cancer
WO2014017491A1 (fr) Gène de fusion formé par le gène cep55 et le gène ret
TW201542825A (zh) 在肺癌辨識出的新穎融合基因
JP2007506425A (ja) 肝細胞癌を診断する方法
WO2017122815A1 (fr) Nouveau fusant et son procédé de détection
WO2013141266A1 (fr) Procédé pour détecter un nouveau corps fusionné ret
EP3020828A1 (fr) Procédé de prédiction de réponse d'un cancer à un traitement
US20070253954A1 (en) Epha4 As Therapeutic Target Of Prc And Pdaca
CA2991846A1 (fr) Expression de fgfr et sensibilite a un inhibiteur du fgfr
JP6566933B2 (ja) ガンを治療するための療法のための標的として使用するためのｆａｌｚ
WO2013111668A1 (fr) Analyse fish pour la détection de la translocation entre le gène kif5b et le gène ret
Gromova et al. ENDOGLIN/CD105 is expressed in KIT positive cells in the gut and in gastrointestinal stromal tumours
US10563265B2 (en) Use of RHOA in cancer diagnosis and inhibitor screening
ES2873377T3 (es) Procedimientos y composiciones farmacéuticas para el tratamiento de cáncer de pulmón
JP2014507629A (ja) 癌の診断および予後ならびに治療応答予測の新規方法
US10865415B2 (en) Prevention, diagnosis and treatment of cancer overexpressing GPR160
US20130237590A1 (en) Assessing thyroid neoplasms
JP6806440B2 (ja) 新規融合体及びその検出法
WO2017122816A1 (fr) Nouveau corps de fusion et procédé de détection de celui-ci
US11459567B2 (en) Specific siRNA molecules, composition and use thereof for the treatment of triple negative breast cancer
US20190062846A1 (en) Compositions and methods for screening pediatric gliomas and methods of treatment thereof
JP2007522791A (ja) 結腸直腸癌を診断する方法
WO2022229846A1 (fr) Traitement du cancer à l'aide d'un inhibiteur du récepteur du facteur de croissance transformant bêta de type 1

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13740829

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13740829

Country of ref document: EP

Kind code of ref document: A1