WO2013109144A1

WO2013109144A1 - Annexin a5 snp in atherosclerosis

Info

Publication number: WO2013109144A1
Application number: PCT/NL2013/050023
Authority: WO
Inventors: Waander Laurens Van Heerde; Maria Catharina Henrica DE VISSER- VAN SOEST; Larissa Filaretovna HIDDINK-EMELIANOVA
Original assignee: Stichting Katholieke Universiteit
Priority date: 2012-01-18
Filing date: 2013-01-17
Publication date: 2013-07-25

Abstract

Disclosed is an in vitro method for diagnosing atherosclerosis, determining a predisposition for atherosclerosis; and/or predicting progression of atherosclerosis. The method examines the presence (or absence) of one, or a combination of defined point mutation(s), at defined positions in nucleotide sequences of the Annexin A5 gene.

Description

ANNEXIN A5 SIMP IN ATHEROSCLEROSIS

TECHNICAL FIELD

The disclosure relates in general to diagnostic methods. Disclosed in particular are methods for diagnosis of atherosclerosis (development) and/or determining a predisposition for atherosclerosis and/or predicting progression of atherosclerosis of a subject.

BACKGROUND

Atherosclerosis is a cardiovascular condition as a result of the build-up of plaque inside the arteries. These plaques can consist of low-density lipoproteins, oxidized-LDL, muscle cells, fibrous tissue, clumps of platelets, cholesterol, and sometimes calcium. The number and thickness of plaques generally increases with age. This may cause loss of the smooth lining of the blood vessels and may promote the formation of blood clots. The major causes of atherosclerosis are hypercholesterolemia and hyperlipidemia.

Atherosclerosis is responsible for more deaths in West-European countries and the Unites States of America, than any other single disease. It is the most common single cause of death. Atherosclerosis may also cause illness by reducing the blood flow such as to the kidneys, the legs and the intestines.

Carotid Intima-media Thickness (CIMT) is closely associated with atherosclerosis and cardiovascular diseases. CIMT is shown to be predictive for angiographically defined coronary artery disease (CAD), intravascular ultrasound-defined CAD, myocardial infarction, and ischemic stroke. The use of carotid IMT as a surrogate marker for atherosclerosis and a strong predictor of future vascular events is justified by many studies (e.g. de Groot et al. 2004 Circulation 109(23 Suppl 1 ):III33; Lorenz et al. 2007 Circulation 1 15(4):459); or Cobble et al. 2010 Postgrad Med 122(1 ):10).

Also other studies provide compelling evidence that CIMT is associated with cardiovascular diseases and atherosclerosis as its main underlying process. Indeed, CIMT, as measured by e.g. B-mode ultrasound, can be used to detect atherosclerosis progress and subclinical atherosclerosis. CIMT is defined as the combined thickness of the intimal and medial layers of the carotid artery. Atherosclerotic plaques significantly increase arterial wall thickness. An atherosclerotic plaque is defined as an isolated CIMT of 1 .5 mm or < 50% of the surrounding IMT, but some physicians consider maximal thickness as little as 1 mm indicative of plaque. l Atherosclerosis risk prediction is nowadays based mainly on the assessment of conventional risk factors including obesity, hypertension, lipid disorders, smoking, and diabetes mellitus. To improve diagnosis, prognostics, and progression of atherosclerosis research has shifted to identification of new biomarkers of atherosclerosis, including markers for inflammation and oxidative stress, without much success.

There remains the need for alternative methodology for /or prognostics of atherosclerosis, particularly in people who are genetically predisposed to such conditions, to insure better health. The present invention may fulfill some of these and other needs.

DETAILED DESCRIPTION OF THE INVENTION Definitions

Throughout this application, various references are cited in parentheses to describe more fully the state of the art to which this invention pertains. The disclosure of these references are hereby incorporated by reference into the present disclosure in their entirety.

Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Singleton et al., Dictionary of Microbiology and Molecular Biology 2nd ed., J. Wiley & Sons (New York, N.Y. 1994); March, Advanced Organic Chemistry Reactions, Mechanisms and Structure 4th ed., J. Wiley & Sons (New York, N.Y. 1992); and Sambrook and Russel, Molecular Cloning: A Laboratory Manual 3rd ed., Cold Spring Harbor Laboratory Press (Cold Spring Harbor, N.Y. 2001 ) provide one skilled in the art with a general guide to many of the terms used in the present application. One skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which could be used in the practice of the present invention. Indeed, the present invention is in no way limited to the methods and materials described. For purposes of the present invention, the following terms are defined below.

Methods of carrying out the conventional techniques used in methods of the invention will be evident to the skilled worker. The practice of conventional techniques in molecular biology, biochemistry, computational chemistry, cell culture, recombinant DNA, bioinformatics, genomics, sequencing and related fields are well-known to those of skill in the art and are discussed, for example, in the following literature references: Sambrook et al. ., Molecular Cloning. A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y., 1989; Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1987 and periodic updates; and the series Methods in Enzymology, Academic Press, San Diego.

As used herein, the singular forms "a," "an" and "the" include plural referents unless the context clearly dictates otherwise. For example, a method for isolating "a" DNA molecule, as used above, includes isolating a plurality of molecules (e.g. 10's, 100's, 1000's, 10's of thousands, 100's of thousands, millions, or more molecules).

A "3' UTR" or "3' non-translated sequence" (also often referred to as 3' untranslated region, or 3'end) refers to the nucleic acid sequence found downstream of the coding sequence of a gene, which comprises for example a transcription termination site and (in most, but not all eukaryotic mRNAs) a polyadenylation signal (such as e.g. AAUAAA or variants thereof). After termination of transcription, the mRNA transcript may be cleaved downstream of the polyadenylation signal and a poly(A) tail may be added, which is involved in the transport of the mRNA to the cytoplasm (where translation takes place).

A "5' UTR" or "leader sequence" or "5' untranslated region" is a region of the mRNA transcript, and the corresponding DNA, between the +1 position where mRNA transcription begins and the translation start codon of the coding region (usually AUG on the mRNA or ATG on the DNA). The 5'UTR usually contains sites important for translation, mRNA stability and/or turnover, and other regulatory elements.

Aligning and alignment: With the term "aligning" and "alignment" is meant the comparison of two or more nucleotide sequence based on the presence of short or long stretches of identical or similar nucleotides. Several methods for alignment of nucleotide sequences are known in the art, as will be further explained below.

"Identity" is a measure of the identity of nucleotide sequences or amino acid sequences. In general, the sequences are aligned so that the highest order match is obtained. "Identity" per se has an art-recognized meaning and can be calculated using published techniques. See, e.g.: (COMPUTATIONAL MOLECULAR BIOLOGY, Lesk, A. M., ed., Oxford University Press, New York, 1988; BIOCOMPUTING: INFORMATICS AND GENOME PROJECTS, Smith, D. W., ed., Academic Press, New York, 1993; COMPUTER ANALYSIS OF SEQUENCE DATA, PART I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; SEQUENCE ANALYSIS IN MOLECULAR BIOLOGY, von Heinje, G., Academic Press, 1987; and SEQUENCE ANALYSIS PRIMER; Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991 ). While there exist a number of methods to measure identity between two polynucleotide or polypeptide sequences, the term "identity" is well known to skilled artisans (Carillo, H., and Lipton, D., SIAM J. Applied Math (1988) 48:1073). Methods commonly employed to determine identity or similarity between two sequences include, but are not limited to, those disclosed in GUIDE TO HUGE COMPUTERS, Martin J. Bishop, ed., Academic Press, San Diego, 1994, and Carillo, H., and Lipton, D., SIAM J. Applied Math (1988) 48:1073. Methods to determine identity and similarity are codified in computer programs. Preferred computer program methods to determine identity and similarity between two sequences include, but are not limited to, GCS program package (Devereux, J., et al., Nucleic Acids Research (1984) 12(1 ):387), BLASTP, BLASTN, FASTA (Atschul, S. F. et al., J. Molec. Biol. (1990) 215:403).

As an illustration, by a polynucleotide having a nucleotide sequence having at least, for example, 95% "identity" to a reference nucleotide sequence encoding a polypeptide of a certain sequence it is intended that the nucleotide sequence of the polynucleotide is identical to the reference sequence except that the polynucleotide sequence may include up to five point mutations per each 100 nucleotides of the reference polypeptide sequence. In other words, to obtain a polynucleotide having a nucleotide sequence at least 95% identical to a reference nucleotide sequence, up to 5% of the nucleotides in the reference sequence may be deleted and/or substituted with another nucleotide, and/or a number of nucleotides up to 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence. These mutations of the reference sequence may occur at the 5' or 3' terminal positions of the reference nucleotide sequence, or anywhere between those terminal positions, interspersed either individually among nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence. DNA amplification: the term DNA amplification will be typically used to denote the in vitro synthesis of double-stranded DNA molecules using PCR. It is noted that other amplification methods exist and they may be used in the present invention without departing from the gist.

The term "gene" means a DNA sequence comprising a region (transcribed region), which is transcribed into an RNA molecule (e.g. an mRNA) in a cell, operably linked to suitable regulatory regions (e.g. a promoter). A gene may thus comprise several operably linked sequences, such as a promoter, a 5' leader sequence comprising e.g. sequences involved in translation initiation, a (protein) coding region (cDNA or genomic DNA) and a 3'non -translated sequence comprising e.g. transcription termination sites.

A nucleic acid according to the present invention may include any polymer or oligomer of pyrimidine and purine bases, preferably the nucleotides cytosine, thymine, and uracil, and adenine and guanine, respectively (See Albert L. Lehninger, Principles of Biochemistry, at 793-800 (Worth Pub. 1982) which is herein incorporated by reference in its entirety for all purposes).

In general, the term primers refer to DNA strands which can prime the synthesis of DNA. DNA polymerase cannot synthesize DNA de novo without primers: it can only extend an existing DNA strand in a reaction in which the complementary strand is used as a template to direct the order of nucleotides to be assembled. We will refer to the synthetic oligonucleotide molecules which are used in a polymerase chain reaction (PCR) as primers. As used herein, the term "promoter" refers to a nucleic acid fragment that functions to control the transcription of one or more genes, located upstream with respect to the direction of transcription of the transcription initiation site of the gene, and is structurally identified by the presence of a binding site for DNA-dependent RNA polymerase, transcription initiation sites and any other DNA sequences, including, but not limited to transcription factor binding sites, repressor and activator protein binding sites, and any other sequences of nucleotides known to one of skill in the art to act directly or indirectly to regulate the amount of transcription from the promoter. Optionally the term "promoter" includes herein also the 5'UTR region (e.g. the promoter may herein include one or more parts upstream (5') of the translation initiation codon of a gene, as this region may have a role in regulating transcription and/or translation.

The term sequencing refers to determining the order of nucleotides (base sequences) in a nucleic acid sample, e.g. DNA or RNA. Many techniques are available such as Sanger sequencing and high-throughput sequencing technologies (also known as next-generation sequencing technologies) such as the GS FLX platform offered by Roche Applied Science, and the Genome Analyzer from lllumina, both based on pyrosequencing.

Description

The present disclosure relates to a method for diagnosing atherosclerosis development, and/or determining a predisposition for atherosclerosis and/or predicting progression of atherosclerosis, the method comprising the following steps:

a. Examining the presence of at least one of the following point mutations:

i. a point mutation G to A at a position that corresponds to nucleotide 243 of SEQ ID NO:1 ;

ii. a point mutation G to A at a position that corresponds to nucleotide 337 of SEQ ID NO:1

iii. a point mutation C to T at a position that corresponds to nucleotide 709 of SEQ ID NO:1 ; or iv. a point mutation C to T at a position that corresponds to nucleotide 82 of SEQ ID NO:1 .

b. Determining whether any of the at least one of said point mutations is present. The presence of an "A" at a position that corresponds to nucleotide 243 of SEQ ID NO:1 , an A at a position that corresponds to nucleotide 337 of SEQ ID NO:1 and/or a "T" at a position that corresponds to nucleotide 709 of SEQ ID NO:1 is indicative for an increased risk for progression of atherosclerosis and/or premature cardiovascular disease. Analysis of the presence of the identified variations may provide for better understanding in disease development, and prediction of progression of atherosclerosis and cardiovascular disease.

In contrast the presence of a "T" at a position that corresponds to nucleotide 82 of SEQ ID NO:1 . is indicative of no increased risk for progression of atherosclerosis and/or premature cardiovascular disease.

It will be understood by the skilled person that the term point mutation within the context of the current invention denotes the presence of a nucleotide in the material under study that is different from the nucleotide that is shown in SEQ ID NO: 1 at the corresponding position. Based on the presence or absence of one or more of the point mutations described herein, a skilled person can determine whether the particular subject from which the material has been obtained may have e.g. an increased risk for progression of atherosclerosis and/or premature cardiovascular disease. The results may well be combined with other indications and/or measurements in the diagnosis of these conditions.

Although, according to the invention, in principal, the analysis of at least one of the above mentioned point mutations may suffice, in a preferred embodiment in step a the presence of at least two, three or all of said point mutations is studied. The person skilled in the art he may test for any possible combination of said point mutations.

For example, and in a further preferred embodiment at least the presence of a point mutation G to A at a position that corresponds to nucleotide 243 and the presence of a point mutation C to T at a position that correspond to nucleotide 709 of SEQ ID NO:1 is examined, or at least the presence of a point mutation G to A at a position that corresponds to nucleotide 243 and the presence of a point mutation G to A at a position that correspond to nucleotide 337 of SEQ ID NO:1 is examined, or the presence of a point mutation G to A at a position that corresponds to nucleotide 337 and the presence of a point mutation C to T at a position that correspond to nucleotide 709 of SEQ ID NO:1 is examined, or at least the presence of a point mutation G to A at a position that corresponds to nucleotide 243 and the presence of a point mutation G to A at a position that correspond to nucleotide 337, and the presence of a point mutation C to T at a position that correspond to nucleotide 709 of SEQ ID NO: 1 is examined. By determining more than one of the point mutations the chance of mistakes or misdiagnosis may reduce in comparison to determining the presence of one of the point mutations.

In another embodiment the step a in the method of the invention comprises:

Examining the presence of at least one of the following point mutations:

ii. a point mutation C to T at a position that corresponds to nucleotide 709 of SEQ ID NO:1 ;

iii. a point mutation G to A at a position that corresponds to nucleotide 337 of SEQ ID NO:1 ; and examining at least one of the following mutations: iv. a point mutation A to C at a position that corresponds to nucleotide 262 of SEQ ID NO:1 ;

v. a point mutation T to C at a position that corresponds to nucleotide 288 of SEQ ID NO:1 ;or

vi. a point mutation T to G at a position that corresponds to nucleotide 408 of SEQ ID NO:1 .

In this embodiment, in addition to examining at least one of the point mutations mentioned that corresponds to nucleotide 243, 709 and/or 337 of SEQ ID NO:1 , in addition at least one of the point mutations mentioned that corresponds to nucleotide 262, 288 and/or 408 of SEQ ID NO:1 .

It will be understood by the skilled person that also comprised is a method according to the invention, wherein the nucleic acid is examined for the presence of at least one, two, three, four, five, six or seven of the following point mutations

ii. a point mutation C to T at a position that corresponds to nucleotide 709 of SEQ ID NO:1 ; iii. a point mutation G to A at a position that corresponds to nucleotide 337 of SEQ ID NO:1 ;

iv. a point mutation A to C at a position that corresponds to nucleotide 262 of SEQ ID NO:1 ;

v. a point mutation T to C at a position that corresponds to nucleotide 288 of SEQ ID NO:1 ;

vi. a point mutation T to G at a position that corresponds to nucleotide 408 of SEQ ID NO:1 ;or

vii. a point mutation C to T at a position that corresponds to nucleotide 82 of SEQ ID NO:1 , and preferably wherein preferably at least one of point mutation at a position that corresponds to nucleotide 243, 337 and/or 709 of SEQ ID NO:1 is determined.

In particular it is preferred that the presence of all of the point mutations are determined, i.e. the method comprises a step a:

Examining the presence of the following point mutations:

iii. a point mutation G to A at a position that corresponds to nucleotide 337 of SEQ ID NO:1 ;

v. a point mutation T to C at a position that corresponds to nucleotide 288 of SEQ ID NO:1 ; and

vi. a point mutation T to G at a position that corresponds to nucleotide 408 of SEQ ID NO:1 . The inventors have surprisingly found a genetic variance in the Annexin A5 gene in human individuals associated with increased advance in the carotid IMT thickness, as will be shown in the Examples.

Sequence analysis of a 496-bp fragment within the 5'-UTR of the Annexin A5 gene showed the presence of six common SNPs: SNP1 (g.-628C>T, rs62319820); SNP2 (g.-467G>A, rs1 12782763); SNP3 (g.-448A>C, rs28717001 ) and SNP4 (g.-422T>C, rs28651243); SNP5 (g.-373G>A, rs1 13588187); and SNP6 (g.-302T>G, rs1050606). SNP7 (g.-1 C>T, rs1 1575945) located in the Kozak sequence in exon 2 was also evaluated in all participants Nucleotide numbering is from the ATG codon in accordance with current HGVS practice ((http://www.hgvs.org/mutnomen/); there is no nucleotide 0, nucleotide 1 is the A of the ATG-translation initiation codon, the nucleotide 5' of the ATG-translation initiation codon is -1 , the previous -2, etc). A schematic overview of the promoter and sequences is given in Figure 1 .

SNP1 corresponds with a point mutation C to T at a position that corresponds to nucleotide 82 of SEQ ID NO: 1 ;

SNP2 corresponds with a point mutation G to A at a position that corresponds to nucleotide 243 of SEQ ID NO: 1 ;

SNP3 corresponds with a point mutation A to C at a position that corresponds to nucleotide 262 of SEQ ID NO: 1 ;

SNP4 corresponds with a point mutation T to C at a position that corresponds to nucleotide 288 of SEQ ID NO: 1 ;

SNP5 corresponds with a point mutation G to A at a position that corresponds to nucleotide 337 of SEQ ID NO: 1 ;

SNP6 corresponds with a point mutation T to G at a position that corresponds to nucleotide 408 of SEQ ID NO: 1 ;

SNP7 corresponds with a point mutation C to T at a position that corresponds to nucleotide 709 of SEQ ID NO: 1 .

Within the context of the current disclosure reference may be made to SNP1 , SNP2, SNP3, SNP4, SNP5, SNP6 and/or SNP7. This will be understood to reference to the corresponding positions, and depending on the context, corresponding single nucleotide polymorphism, as indicated herein, and/or either as shown in SEQ ID NO: 1 , or in Figure 1 , or within any stretch of (genomic) DNA comprising the corresponding nucleotide position, e.g. comprising the nucleotide that corresponds to rs62319820, rs1 12782763, rs28717001 , rs28651243, rs1 13588187, rs1050606, and/or rs1 1575945 (SNP ID's according to www.ncbi.nlm.nih.gov/projects/SNP/). The skilled person thus understand that, for example also comprised is a method according to the invention, wherein the nucleic acid is examined for the presence of at least one, two, three, four, five, six or seven of the following point mutations

vi. a point mutation T to G at a position that corresponds to nucleotide 408 of SEQ ID NO:1 ; or

vii. a point mutation C to T at a position that corresponds to nucleotide 82 of SEQ ID NO:1 , and wherein the nucleic acid molecules comprises one, two, three, four, five or six or seven additional nucleotide changes in comparison to SEQ ID NO:1 . In the art, different sequences corresponding to the Annexin A5 gene, and in particular to the promoter region, have been published. Figure 1 shows a comparison between those different sequences. S1 corresponds with SEQ ID NO:4, S2 correspond with SEQ ID NO:5; S3 corresponds with SEQ ID NO:6, S4 corresponds with SEQ ID NO:7, S5 corresponds with SEQ ID NO:8, and S6 corresponds to SEQ ID NO 1 . SED ID NO:4- SEQ ID NO:8 were disclosed in EP1819833.

The nucleic acid molecule defined herein as comprising (or consisting of) an Annexin A5 gene promoter nucleotide sequence is a promoter. Accordingly, most preferably, the nucleic acid molecule is capable of conferring the activity of the Annexin A5 gene, in particular in form of Annexin A5 gene expression. Said expression may be tested by methods known in the art, for example by operatively linking the nucleic acid molecule of the present invention to either a marker molecule to be expressed and/or to the coding sequence of annexin A5 and detecting whether said Annexin A5 or said marker molecule is expressed in, inter alia, an heterologous gene expression system.

Also comprised in the definition of an nucleic acid molecule defined herein as comprising (or consisting of) an Annexin A5 gene promoter nucleotide sequence are nucleic acid molecules which are 80%, more preferably 90%, even more preferably 95%, most preferably 99%, or 99.5% identical to the promoter sequences as shown in any one of SEQ ID NOS: 1 , 4-8, as discussed above.

The Annexin A5 gene promoter nucleotide sequence is accordingly, a promoter that is highly homologous to the promoter sequences as defined in any one of SEQ ID NOS: 1 , 4 to 8, or as shown in Figure 1 , and which is capable of driving Annexin A5 expression in cells.

It will be understood by the skilled person that these sequences are also encompassed by the current invention and that the corresponding point mutations at positions that correspond to those described in view of SEQ ID NO:1 are also part of the current disclosure and invention. In other words, the skilled person is aware of the existence of different nucleotide sequences available for this part of the Annexin A5 gene. He understands that the position of the point mutations, in particular those referred to as SNP 2 - SNP7, described in the context of SEQ ID NO:1 , has a corresponding position in these alternative nucleotide sequences, and that the particular point mutations described herein may also be present or determined in such alternative nucleotide sequences.

Therefore, also encompassed is determining the presence of the mentioned point mutation or point mutations at positions corresponding to the said position or positions in SEQ ID NO:1 in those nucleic acid molecules having at least 80%, more preferably 90%, even more preferably 95%, most preferably 99%, or 99.5% identity with SEQ ID NO:1 , or a fragment of at least 50, 100, 150 adjacent nucleotides there from.

The variant identified by the inventor consists of six nucleotide substitutions, which appear to be inherited as a haplotype identified herein as haplotype H3. As defined herein below, of particular relevance in this respect are the point mutations characterized as SNP2, SNP3, SNP4, SNP5, SNP6 and SNP7 above, whereby "G" denotes guanine, "C" denotes cytosine, "A" denotes adenine and "T" thymine. Also SNP1 , as described above, is of particular relevance, as will be explained herein..

The variant nucleotides SNP2, SNP3, SNP4, SNP5, SNP6, SNP7 are found in human individuals that show, over time, an increase in advance of carotid IMT thickness in comparison to non-carriers, and represent therewith a subpopulation of human individuals with increased risk for progression of atherosclerosis and/or premature cardiovascular disease. Analysis of the presence of the identified variations provides for better understanding in disease development, and prediction of progression of atherosclerosis and cardiovascular disease, and is therefore helpful. In contrast, person carrying SNP1 , as described in detail above, do not show, over time, an increase in advance of carotid IMT thickness. Since SNP1 (a point mutation C to T at a position that corresponds to nucleotide 82 of SEQ ID NO:1 ) is not found in subjects with the haplotype H3 and/or in which for example SNP2, SNP5 and/or SNP7 are found, said SNP1 may as well be used. The presence of SNP1 (a point mutation C to T at a position that corresponds to nucleotide 82 of SEQ ID NO: 1 ) is indicative of no increased risk for progression of atherosclerosis and/or premature cardiovascular disease.

As shown in the examples, a human individual at least carrying SNP2 (g.-467G>A) and/or SNP7 (g.-1 C>T) and/or SNP5 (g.-373G>A), e.g. an individual with haplotype H3 (see Table 2) has a higher risk of an age-related increase in carotid IMT, and therewith shows increased progression/onset of atherosclerosis, and therewith increased risk of cardiovascular disease.

Human individuals with any one of these single-nucleotide polymorphisms in the Annexin A5 should preferably be subjected to closer medical care and supervision. This supervision may be before or after diagnosis of atherosclerosis and/or cardiovascular disease. For example, early diagnosis of increased risk in carotid IMT thickness increase over time might help to prevent, or at least delay, onset of atherosclerosis and/or cardiovascular disease. Patients diagnosed with for example atherosclerosis, or with a condition closely related therewith, in which the presence of any of the disclosed point mutations is determined, should be followed even closer than other patients due to the increased risk of developing atherosclerosis and/or CVD over time, as reflected by the quicker increase of the carotid IMT thickness with age in these patients. As shown in the examples, SNP2 and SNP7 or SNP5 and SNP7 are not completely linked to each other, and each individual SNP is associated the higher increase of carotid IMT thickness over time. SNP2 and SNP5 are completely linked in the haplotype defined in the examples. The haplotype H3 disclosed herein comprises the following

iii. a point mutation G to A at a position that corresponds tp nucleotide 337 of SEQ ID NO:1 ;

iv. a point mutation A to C at a position that corresponds to nucleotide 262 of SEQ ID NO:1 ; v. a point mutation T to C at a position that corresponds to nucleotide 288 of SEQ ID NO:1 ;and

These are SNP 2, 3, 4,5, 6 and SNP7.

Also provide is a method for haplotyping an individual, comprising the step of determining the presence (or not) of at least one of the above-identified point-mutations, preferably all of the above-identified point mutations SNP2, SNP3, SNP4, SNP5, SNP6 and SNP7, even more preferably all of the above-mentioned point mutations SNP1 , SNP2, SNP3, SNP4, SNP5, SNP6 and SNP7.

As pointed out above, the in methods described herein are useful in the diagnosis of atherosclerosis development, in particular in predicting progression thereof, and/or in determining the predisposition of an individual to develop atherosclerosis, and/or in determining the predisposition of an individual to be at an elevated risk of developing atherosclerosis quicker over time. Preferably, in the method according to the invention, at least the presence of a point mutation at a position that corresponds to nucleotide 243 (SNP2) and at a position that corresponds to nucleotide 709 (SNP7) of SEQ ID NO:1 is examined.

From the Examples it is clear that both SNPs are associated with the heightened risks of increase of carotid IMT thickness, and therewith with (the progression of) atherosclerosis and/or cardiovascular disease over time.

In another embodiment, at least the presence of a point mutation at a position that corresponds to nucleotide 243 and of a point mutation at a position that correspond to nucleotide 709 and of a point mutation at a position that corresponds to nucleotide 337 of SEQ ID NO:1 is examined, for the reason already discussed above.

In an preferred embodiment of the method for diagnosing atherosclerosis and/or determining a predisposition for atherosclerosis and/or predicting progression of atherosclerosis, at least two, three, four or five, or six of the point mutations described (SNP2, SNP3, SNP4, SNP5, SNP6 or SNP7) is analysed for, with, preferably, at least SNP2 and/or SNP7 being analysed. In even another embodiment, all of the point mutations/SNPs described above are determined. The examining of at least one point mutation as described herein , or of a haplotype as described, herein, can be carried out by standard methods known in the art, e.g. those described in the Examples. For example, the detection of said at least one point mutation in said Annexin A5 gene, including gene regulatory elements like promoter regions, 5'UTR, 3'UTR, exons, introns, or the haplotyping may be carried out or determined by nucleic acid techniques based on size or sequence. Techniques suitable include, but are not limited to, nucleic acid sequencing techniques, hybridization techniques (e.g. using specific probes), PCR, single nucleotide polymorphism (SNPs)-determination, or restriction fragment length polymorphism (RFLP)-determination. Corresponding or additional techniques have been described in numerous handbooks, including Sambrook, Russell "Molecular Cloning, A Laboratory Manual", Cold Spring Harbor Laboratory, N.Y. (2001 )).

The method is preferably performed in vitro. Although the method according to the invention can be performed with genetic material from any organism, the method is preferably performed on genetic material obtained from a mammal, preferably a human, either women or men. As will be understood by the skilled person, the method according to the invention can advantageously be performed on genetic material of patients e.g. already suspected to have increased risk for the development of atherosclerosis and/or cardiovascular disease and/or familial hypercholesterolemia, for example due to life style or expected predisposition, or familial history.

Although not limited thereto, the method according to the invention can in particular be practised on genetic material from patients diagnosed or suffering from familial hypercholesterolaemia (FH). The method in such embodiment would thus pertain to a method for predicting progression of atherosclerosis in patients diagnosed with or suffering from familial hypercholesterolemia. However, as already mentioned above, it will be clear that in the practice of the invention is not limited to such patient group, but may be practiced on suitable material obtained from any (human) subject, with or without any (suspected) medical condition.

The nucleotide sequence to be analyzed in the method according to the invention may be obtained from any part of the body, including a body fluid, preferably chosen from the group consisting of blood, serum, and/or urine.

The method disclosed herein can be performed on genomic DNA, preferably by amplifying a DNA-stretch of the Annexin A5 gene from genomic DNA by PCR and subsequent examination. For example, the following primers may be used: forward 5' CCGAGCCCTGGACAGCTCCCCA-3' (SEQ ID NO:2)

and reverse 5'-GCCCCGCGACCACGCTCTCCTCT-3' (SEQ ID NO:3)

Exon 2 with flanking regions (130-bp fragment) may be amplified as previously described (de Laat B. et al., Ann.Rheum.Dis. 2006;65(1 1 ):1468-1472) .

However, a skilled person will understand that alternative techniques and/or primers may be employed in the analysis of one or more (different) DNA-stretch or stretches of the Annexin A5 gene, and either alone, or together comprise at least one position that may hold a point mutation as disclosed herein ((SNP1 , SNP2, SNP3, SNP4, SNP5, SNP6 or SNP7); preferably the stretch or stretches alone, or together comprises position that may hold a position that may comprise a point mutation SNP2 and/or SNP7. For example, a stretch may be provided comprising the nucleotide positions that corresponds with SNP2 (and may show the point mutation described herein) and SNP3 (and may show the point mutation described herein), whereas in addition a stretch may be provide that comprises the nucleotide that corresponds with SNP7 (and may show the point mutation described herein). Preferably a stretch is at least about (± 5nucleotides) 20, 40, 100, 200, 400, 1000, 1500 nucleotides long, depending on the technique for examining employed.

In another aspect of the invention, there is provided a method for screening for molecules, preferably a method for screening for molecules useful in the treatment and/or prevention of atherosclerosis, which molecules are capable of interacting with a nucleic acid molecule comprising a fragment of the Annexin A5 gene, preferably comprising a promoter region and/or an untranslated exon 1 of the Annexin A5 gene, and wherein the nucleic acid molecule comprises the following point mutations:

i. a point mutation G to A at a position that corresponds to nucleotide 243 of SEQ ID NO:1 ; or

ii. a point mutation G to A at a position that corresponds to nucleotide 337 of SEQ ID NO:1 ; or

iii. a point mutation C to T at a position that corresponds to nucleotide 709 of SEQ ID NO:1 ; or

iv. a point mutation G to A at a position that corresponds to nucleotide 243 of SEQ ID NO:1 and a point mutation G to A at a position that corresponds to nucleotide 337 of SEQ ID NO:1 ; or v. a point mutation G to A at a position that corresponds to nucleotide 243 of SEQ ID NO:1 and a point mutation C to T at a position that corresponds to nucleotide 709 of SEQ ID NO:1 ; or vi. a point mutation G to A at a position that corresponds to nucleotide 337 of SEQ ID NO:1 and a point mutation C to T at a position that corresponds to nucleotide 709 of SEQ ID NO:1 ; or vii. a point mutation G to A at a position that corresponds to nucleotide 243 of SEQ ID NO:1 and a point mutation G to A at a position that corresponds to nucleotide 337 of SEQ ID NO:1 , and a point mutation C to T at a position that corresponds to nucleotide 709 of SEQ ID NO: 1 , the method comprising the following steps: a. contacting said nucleic acid molecule comprising a fragment of the Annexin A5 gene, preferably comprising a promoter of the Annexin A5 gene, with a candidate molecule;

b. measuring and/or detecting a response to said contacting;

c. comparing said response with a standard response as measured in the absence of the candidate molecule. The skilled person knows how to perform such experiments. For example, the nucleic acid molecule may be in a vector operably linked to a gene encoding for a marker protein, a signal protein, a reporter gene, or a tag and modification in expression of e.g. the marker protein may be determined in the presence or absence of the candidate molecule. Non-limiting examples include fluorescent proteins, e.g. green fluorescent protein. A vector is a circular or linear nucleic acid molecule which can autonomously replicate in host cells into which they are introduced ./pet

Alternatively, interacting of a compound, e.g. binding can be determined and compared to binding to a corresponding or identical nucleic acid but not comprising the point mutations.

In a last aspect, there is provided for the use of point mutations as defined herein, a primer pair capable of amplifying stretches of the Annexin A5 gene sequence comprising the described point mutations of the invention, an Annexin A5 nucleotide molecule, or fragment thereof, e.g. of at least 5, 10, 100 nucleotides, comprising the point mutations as defined herein, for diagnosing and/or determining a predisposition for atherosclerosis and/or predicting progression of atherosclerosis of a subject. The skilled person understand how to provide for e.g. the said primer pair, and/or fragments, and use thereof.

LEGEND TO THE FIGURES

Figure 1 shows a comparison between different nucleotide sequence in the art for part of the Annexin A5 gene, including the promoter region of the Annexin A5. S1 corresponds with SEQ ID NO: 4, S2 correspond with SEQ ID NO: 5; S3 corresponds with SEQ ID NO: 6, S4 corresponds with SEQ ID NO 7, S5 corresponds with SEQ ID NO 8, and S6 corresponds to SEQ ID NO 1 .

EXAMPLES Methods

1. Subject

ANXA5 SNPs were evaluated in FH patients who participated in the Atorvastatin versus Simvastatin on Atherosclerosis Progression (ASAP) trial (Smilde et al., 2001 Lancet 357(9256):577). ASAP was a randomized, double-blind, two-center study as described in detail elsewhere. The ASAP population included 325 subjects aged 30-70 years who had elevated LDL-cholesterol levels (>5.5 mmol/L), but no significant clinical, hematological and biochemical abnormalities. Coronary heart disease within previous 3 months, hypertension, diabetes and other endocrine diseases, secondary hyperlipidemia were exclusion criteria as previously described. In the present study, we used only data collected after an 8-week placebo run-in period before any intervention with statins. Of the 325 participants, genomic DNA of 299 patients was available for sequencing. Plasma ANXA5 levels were measured in 150 participants from the Nijmegen center. The Ethics Committees of both trial centers approved the study. 2. Assessment of atherosclerosis

The methods to determine carotid IMT are described in detail elsewhere (Smilde TJ et al, 2001 Lancet 357(9256):577) . Briefly, ultrasound examinations were performed using a Biosound Phase-2 real time scanner (BiosoundEsaote, USA) equipped with a 10 MHz transducer. Three 10 mm segments were scanned bilaterally: the distal portion of the CCA, the BUL and the proximal portion of the internal carotid artery (ICA). Both near and far walls were evaluated. Mean carotid IMT was calculated as averaged over anterior and posterior walls in the CCA, BUL and the posterior wall of the ICA, bilaterally. 3. Genetic analysis

Genomic DNA of 299 patients was available for genotyping. A 496-bp fragment within the 5'- untranslated region (5'-UTR) of the ANNEXIN A5 gene was amplified by polymerase chain reaction (PCR) using two oligonucleotide primers: forward 5'

CCGAGCCCTGGACAGCTCCCCA-3' (SEQ ID NO:2) and reverse 5'-

GCCCCGCGACCACGCTCTCCTCT-3' (SEQ ID NO:3)(Bogdanova et al. 2007 Hum Mol Genet 16(5):573). PCR reactions were carried out in a final volume of 50 μΙ reaction mixture containing 5 μΙ 10x PCR Buffer (Invitrogen), 1 .5 mM MgCI2, 5% DMSO (v/v), 1 M GC-RICH resolution solution (Roche Applied Science), 20 pM of each primer (forward and reverse), 0.2 mM of deoxynucleotide triphosphates, 100 - 150 ng genomic DNA and 1 .25 U Taq DNA polymerase (Invitrogen). PCRs were performed in a GeneAmp PCR System 9700 Thermal Cycler (Applied Biosystems). Cycling conditions were: an initial denaturation step at 95°C for 3 minutes followed by denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds and elongation at 72°C for 30 seconds (30 cycles in total).

Exon 2 with flanking regions (130-bp fragment) was amplified as previously described using two primers: forward 5'-CGCTAAGCCCGAGGTTTCT- 3' (SEQ ID NO:9) and reverse 5'- CGCAGCATACAAAGTTGTGG -3'. (SEQ ID NO:10) (de Laat B. et al., Ann.Rheum.Dis.

2006;65(1 1 ):1468-1472).

PCR products were purified using Multiscreen PCR plates (Millipore). Purified amplicons were sequenced using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied

Biosystems) and analyzed on the ABI 3730 PRISM DNA Analyzer (Applied Biosystems).

Successful sequencing of the 5'-UTR and exon 2 was possible in 284 (95.0%) and 298 (99.7%) patients, respectively. Sequences of 284 patients with complete genotypes were used for haplotype analysis.

4. Statistical analyses

Differences between two or three groups were determined by unpaired f-test or one-way ANOVA, respectively, for normally distributed continuous variables. Skewed distributed continuous variables were compared by Mann-Whitney test. The Fisher exact test was used for categorical variables. Hardy-Weinberg equilibrium for each SNP was evaluated by a χ² test. Haploview software was used to estimate the degree of linkage disequilibrium (LD; r² values) between all SNP pairs and to determine haplotypes (Barett et al., 2005 Bioinformatics 21 (2):263). Haplotypes were assigned manually to all individuals. Only common haplotypes (frequency >1 %) were used for further analyses. Three rare haplotypes present in nine patients were excluded from further analysis. The age-related IMT progression in different ANXA5 haplotype groups was estimated by a linear regression analysis. The interaction term IMT-age was entered in all regression models. The independent variables included in the multiple regression model were gender, body mass index, smoking habit, the history of cardiovascular disease (CVD), HDL-C, LDL-C and mean arterial blood pressure (SAS version 6.12 software), which are all known risk factors for vascular changes and atherosclerosis. The regression coefficient β represents IMT increase with age (millimeters per year, mm/y). Comparison of the regression slopes between groups was performed by analysis of variance. In the first model, the slopes of carriers were compared with those of non-carriers. In the second model, the regression slope of the homozygous wild-type H1 patients was used as the reference. In the single SNP analyses, the slopes of the wild-type individuals were taken as the reference.

For all statistical analyses, two-sided P-values <.05 were considered statistically significant. Results

1. Patient characteristics

Clinical characteristics are shown in Table 1 . Baseline characteristics of the study group were comparable to those of the total ASAP population. The population consisted of 97.2% Caucasian individuals with mean age of 48.4 years. Sixty percent of the subjects were female. Every fourth patient (28.9%) had history of CVD, and 60.6% individuals were smokers (former or current). Plasma levels of LDL-cholesterol and carotid IMT were markedly increased at baseline.

Table 1. Baseline characteristics of the patients with familial hypercholesterolemia.

Age (years) 48.4 ± 10.4

Gender (male/female), n (%) 1 14 (40.1 )/170 (59.9)

Caucasian, n (%) 276 (97.2)

Body mass index (kg/m2) 25.7 ± 3.5

History of CVD, n (%) 82 (28.9)

Smoking,* n (%) 172 (60.6)

Total cholesterol (mmol/liter) 10.13 ± 1.99

HDL-cholesterol (mmol/liter) 1.16 ± 0.31

LDL-cholesterol (mmol/liter) 8.17 ± 1 .96

Triglycerides (mmol/liter) 1.64 (1.12-2.28)

Hs-CRP (mg/liter) 2.2 (0.8-4.6)

Carotid IMT (mm) 0.93 ± 0.22 Values are presented as means ± SD for continuous variables. Triglycerides and hsCRP are given as median and interquartile range. *Previous and current smokers

CVD, cardiovascular disease; HDL, high-density lipoprotein; LDL, low-density lipoprotein; hsCRP, high-sensitivity C-reactive protein; IMT, intima-media thickness;

2. Annexin A5 gene promoter polymorphisms and haplotypes

Sequence analysis of a 496-bp fragment within the 5'-UTR of the Annexin A5 gene showed the presence of six common SNPs (with rs ID's according to NCBI dbSNP (http://www.ncbi.nlm.nih.gov/projects/SNP/index.html)

SNP1 (g.-628C>T, rs62319820),

SNP2 (g.-467G>A, rs1 12782763),

SNP3 (g.-448A>C, rs28717001 ) and

SNP4 (g.-422T>C, rs28651243),

SNP5 (g.-373G>A, rs1 13588187),

SNP6 (g. -302T>G, rs1050606)

The genomic g.-1 C>T SNP (SNP7, rs11575945) located in the Kozak sequence in exon 2 was also evaluated in all participants. All seven SNPs were in Hardy-Weinberg equilibrium. A high degree of linkage disequilibrium was observed between all SNPs except for SNP1 and SNP6. SNP3 and SNP4 as well as SNP2 and SNP5 were completely linked (1^=1 ). SNP7 was tightly linked to SNP2 and SNP5 (r²=0.85).

Four common haplotypes (H) were inferred on the basis of seven SNPs (Table 2). Haplotype H1 , the most frequent haplotype (51 %), composed of the wild-type alleles of all seven polymorphisms. Haplotype H2 was discriminated from haplotype H1 by SNP6. Haplotypes H1 and H2 included Bogdanova's haplotype N (ie, 467G/ 448A/-422T/-373G; Bogdanova et al. 2007 Hum Mol Genet 16(5):573). Haplotype H3, the third major haplotype, consisted of the major allele of SNP1 and the minor alleles of the other polymorphisms. Haplotype H3 is an extension of the M2 haplotype (ie, 467A/ 448C/ 422C/-373A). Haplotype H4, an extension of the M1 haplotype (ie, -467G/-448C/-422C/-373G), also included the minor allele -628T.

Table 2. Polymorphisms and haplotypes of the ANXA5 gene in 284 patients with familial hypercholesterolemia

SNP1 SNP2 SNP3 SNP4 SNP5 SNP6 SNP7

-6280T -467G>A -448A>C -422T>C -373G>A -302T>G -1 C>T rs rs623198 rs112782 rs287170 rs286512 rs113588 rs1050606 rs115759

MAF* 0.09 0.11 0.19 0.19 0.11 0.49 0.10

Haplo

Haplo type type fre- quen

H1 C G A T G T C 0.51

H2 C G A T G G c 0.29

H3 C A C c A G T 0.099

H4 T G C c G G c 0.09 ^"Nucleotide numbering from the ATG codon; According to http://www.ncbi.nlm.nih.gov/snp; *MAF, minor allele frequency; SNP, single nucleotide polymorphism; minor alleles in bold and underlined.

3. Annexin A5 haplotypes and progression of atherosclerosis

Multiple linear regression analysis, including age, gender, body mass index, smoking habit, history of CVD, HDL-, LDL-cholesterol, mean arterial blood pressure and study center as independent variables, was performed to study the impact of Annexin A5 haplotypes and individual SNPs on carotid IMT. Age and gender were the most important predictors of IMT values at baseline (together: r² ranges 0.19 to 0.20).

After adjustment for the above mentioned variables, only Annexin A5 haplotype H3 was associated with increase in age-related carotid IMT (β=0.01396; P=0.0374) (Table 3). Table 3. Association of Annexin A5 promoter haplotypes with baseline carotid IMT.

Results of the linear regression analysis are shown, β indicates regression coefficient; β represents IMT increase with age (mm/year).

*Adjusted for gender, smoking habit, the history of CVD, body mass index, HDL-C, LDL-C and mean arterial blood pressure.

Hx means all haplotypes except for the one given; IMT, intima-media thickness; SE, standard error; Ref., reference; N, number of subjects.

P-values illustrate differences between carriers and non-carriers; significant P-value is in bold. No linear relationship was found between IMT and age (P=0.21 ) in H4H4 subjects (N=4).

Hence, an increase of 0.01396 mm/y in carotid IMT could be predicted in H3 carriers. Non-H3 carriers showed, on the contrary, an increase of 0.0072 mm/y (β=0.0072) in carotid IMT.

With regard to other clinical characteristics, lipid or lipoprotein levels, heterozygotes for H3 did not differ from non-H3 carriers (data not shown).

Individual SNP analysis showed that SNP2 (g.^67G>A), SNP5 (g.-373G>A) and/or SNP7 (g.-1 C>T) were associated with age-related carotid IMT. Heterozygous -467GA carriers had larger IMT increase with age than -467GG (wild-type) carriers (β=0.01394 versus β=0.00835, P=0.0466). Carriers of -1 T allele showed more rapid IMT increase with age than -1 CC (wild- type) carriers (β=0.01379 versus β=0.00824, P=0.0435). SNP2 was completely linked to SNP5 (g.-373G>A) (1^=1 ). SNP7, on the other hand, was tightly but not completely linked to SNP2 and SNP5 (r²=0.85). Hence, the -467A and -373A alleles as well as -1 T allele, which were unique for haplotype H3, seemed to be major contributors to larger carotid IMT increase with age.

3. Discussion

In the present study, we evaluated seven known ANXA5 SNPs, reconstructed haplotypes and determined the association of common haplotypes/individual SNPs with progression of atherosclerosis Haplotype H3 appeared to be associated with increase in age-related carotid IMT, a surrogate marker of atherosclerosis. Individually SNP2/SNP5 and SNP7 were responsible for atherosclerosis progression. SNP1 , on the contrary is indicative of no risk of enhanced progression. Heterozygous H3 patients showed a nearly two times more rapid increase in carotid IMT (14 μιη/y versus 7.2 μιη/y, P=0.0374) than non-H3 carriers. When we used the regression slope of the homozygous wild-type H1 subjects as the reference, the same trend was observed. Interestingly, individual SNP analysis revealed that SNP2/SNP5 and SNP7 were responsible for more rapid increase in carotid IMT with age.

Even a 0.1 mm thicker CCA-IMT increases the future risk of myocardial infarction and stroke by 10%-15% and 13%-18% respectively, as concluded from the meta-analysis of eight clinical studies (Lorenz et al. 2007 Circulation 1 15(4):459. With regard to our observations, heterozygous H3 patients should have a 0.14 mm thicker carotid IMT in 10 years and hence, a higher risk for cardiovascular events as compared with non-H3 carriers (a 0.072 mm thicker carotid IMT in 10 years). Haplotype H3 is an extension of the M2 haplotype (Bogdanova et al. 2007 Hum Mol Genet 16(5):573; -467A 48C/-422C/-373A). The possession of the -467A and/or -373A alleles and/or -1T allele, which were unique for haplotype H3, appeared to be associated with atherosclerosis progression.

Claims

1 . An in vitro method for diagnosing atherosclerosis development, and/or predicting progression of atherosclerosis, the method comprising the following steps:

a. Examining the presence of at least one of the following point mutations:

iv. a point mutation C to T at a position that corresponds to nucleotide 82 of SEQ ID NO:1 ,

b. Determining whether any of the at least one of said point mutations is present.

2. Method according to claim 1 wherein in step a the presence of at least two, three or all of said point mutations is studied.

3. Method according to any one of the previous claims wherein at least the presence of a point mutation at a position that corresponds to nucleotide 243 and the presence of a point mutation at a position that corresponds to nucleotide 709 of SEQ ID NO:1 is examined, or wherein at least the presence of a point mutation at a position that corresponds to nucleotide 243 and the presence of a point mutation at a position that corresponds to nucleotide 337 of SEQ ID NO: 1 is examined, or wherein the presence of a point mutation at a position that corresponds to nucleotide 337 and the presence of a point mutation at a position that corresponds to nucleotide 709 of SEQ ID NO:1 is examined, or wherein at least the presence of a point mutation at a position that corresponds to nucleotide 243 and the presence of a point mutation at a position that corresponds to nucleotide 337, and the presence of a point mutation at a position that corresponds to nucleotide 709 of SEQ ID NO: 1 is examined.

4. Method according to any of the previous claims wherein step a is:

a. Examining the presence of at least one of the following point mutations:

ii. a point mutation C to T at a position that corresponds to nucleotide 709 of SEQ ID NO:1 ; a point mutation G to A at a position that corresponds tp nucleotide 337 of SEQ ID NO:1 ;

and at least one of the following mutations:

a point mutation A to C at a position that corresponds to nucleotide 262 of SEQ ID NO:1 ;

a point mutation T to C at a position that corresponds to nucleotide 288 of SEQ ID NO:1 ;or

a point mutation T to G at a position that corresponds to nucleotide 408 of SEQ ID NO:1 .

Method according to any of the previous claims wherein step a is:

a. Examining the presence of the following point mutations:

Method according to anyone of the previous claims wherein the nucleotide sequence to be examined has been obtained from a human subject, preferably a human subject that has been diagnosed, or is expected to have an increased risk of developing atherosclerosis .

Method according to anyone of the previous claims wherein the nucleotide sequence to be examined is obtained from a body fluid, preferably chosen from the group consisting of blood, serum, and/ or urine.

Method according to any of the previous claims, which is carried out on genomic DNA, preferably by amplifying a DNA-stretch of the Annexin A5 gene from genomic DNA by PCR and subsequent examination.

9. A method for screening for molecules useful in the treatment and/or prevention of atherosclerosis, which molecules are capable of interacting with a nucleic acid molecule comprising a fragment of the Annexin A5 gene, preferably comprising a promoter of the Annexin A5 gene, and wherein the nucleic acid molecule comprises the following point mutations:

iv. a point mutation G to A at a position that corresponds to nucleotide 243 of SEQ ID NO:1 and a point mutation G to A at a position that corresponds to nucleotide 337 of SEQ ID NO:1 ; or

v. a point mutation G to A at a position that corresponds to nucleotide 243 of SEQ ID NO:1 and a point mutation C to T at a position that corresponds to nucleotide 709 of SEQ ID NO:1 ; or

vi. a point mutation G to A at a position that corresponds to nucleotide 337 of SEQ ID NO:1 and a point mutation C to T at a position that corresponds to nucleotide 709 of SEQ ID NO: 1 ; or

vii. a point mutation G to A at a position that corresponds to nucleotide 243 of SEQ ID NO:1 and a point mutation G to A at a position that corresponds to nucleotide 337 of SEQ ID NO:1 , and a point mutation C to T at a position that corresponds to nucleotide 709 of SEQ ID NO:1 , the method comprising the following steps:

a. contacting said nucleic acid molecule comprising a fragment of the Annexin A5 gene, preferably comprising a promoter of the Annexin A5 gene, with a candidate molecule;

b. measuring and/or detecting a response to said contacting;

c. comparing said response with a standard response as measured in the absence of the candidate molecule.

10. Use of point mutations, and combination thereof as defined in any one of claims 1 -6, a primer pair capable of amplifying stretches of the Annexin A5 gene sequence comprising the point mutations as defined in any of claims 1 - 6, or an Annexin A5 nucleotide molecule, or fragment thereof, comprising the point mutations as defined in any one of claim 1 - 6, for diagnosing and/or determining a predisposition for atherosclerosis and/or predicting progression of atherosclerosis of a subject.