NL2014136B1

NL2014136B1 - Annexin A2 SNP and von Willebrand Disease.

Info

Publication number: NL2014136B1
Application number: NL2014136A
Authority: NL
Inventors: Laurens Van Heerde Waander
Original assignee: Stichting Katholieke Univ
Priority date: 2015-01-14
Filing date: 2015-01-14
Publication date: 2017-01-27
Also published as: NL2014136A; WO2016114662A3; WO2016114662A2

Abstract

The present disclosure relates to an in vitro method for determining Von Willebrand Disease or an increased risk of developing Von Willebrand Disease. The method involves determining whether a point mutation at a defined position is present or absent in the ANXA2 gene sequence. Also disclosed is a kit for determining Von Willebrand Disease or an increased risk of developing Von Willebrand Disease comprising means for determining the point mutation.

Description

Title: Annexin A2 SNP and von Willebrand Disease Technical field

The present disclosure relates to an in vitro method for determining Von Willebrand Disease or an increased risk of developing Von Willebrand Disease. The method involves determining whether a point mutation at a defined position is present or absent in a specific gene sequence. Also disclosed is a kit for determining Von Willebrand Disease or an increased risk of developing Von Willebrand Disease comprising means for determining the point mutation.

Background of the invention

Platelet adhesion to the damaged vessel wall and platelet plug formation in the circulatory system are crucial aspects of the hemostatic process. Many different factors and pathways are involved in hemostasis. One of these factors is the multimeric plasma protein ‘Von Willebrand Factor’, (VWF).

Circulating soluble VWF circulates as multimers in blood. After vessel wall rupture VWF multimers becomes immobilized due to binding with its A3 domain to collagen fibers. Collagen-bound VWF then binds platelets via the receptor glycoprotein 1b, factor V, factor IX complex. The bound platelets become activated resulting in the exposure of other platelet receptors, paracrine platelet signaling and more VWD binding, ultimately resulting in the formation of a platelet aggregate.

When a defect in the quality or quantity of VWF occurs, the patient is diagnosed with Von Willebrand Disease, (VWD). VWD is one of the most common bleeding disorders in the Netherlands: 1 in 10000 people in the Netherlands are diagnosed with a type of VWD. It is even thought that up to 1 in 100 individuals have symptoms of the disease, thus it can be classified as the most frequent bleeding disorder. VWD is divided into three different types based on pathophysiologic symptoms. Patients diagnosed with type 1 VWD suffer from a partial quantitative deficiency of the multimeric glycoprotein VWF, meaning that the concentration of multimeric VWF in the circulation is reduced. Patients with VWD type 2 have a qualitative defect of the VWF protein; the function of VWF is abnormal, resulting in a decreased activity in hemostasis. Type 3 VWD, or ‘severe’ VWD is characterized by a complete deficiency of VWF. The majority of the patients with VWD are diagnosed with type 1 VWD.

When a patient is suspected of having VWD, blood plasma is investigated for quantitative and qualitative deficiencies of VWF. This is generally performed by measuring the quantity of VWF with a VWF antigen assay and the functionality of VWF with a glycoprotein (GP)lb binding assay, a collagen binding assay, or a ristocetin cofactor activity (RiCof) or ristocetin induced platelet agglutination (RIPA) assay. Factor VIII levels are normally also measured because VWF protects factor VIII from rapid degradation within the blood.

However, testing for VWD can be influenced by numerous variables in the testing procedure, which may lead to a missed or erroneous diagnosis. Procedural errors most frequently occur during the pre-analytical phase (during collection, storage and transportation of the sample). Unfortunately, diagnostic errors are not uncommon either, and studies revealed error rates ranging from 7% to 22% in some studies to as high as 60% in cases of misclassification of VWD sub-type (Favaloro EJ, Bonar R, Kershaw G, et al. 2006 Semin. Thromb. Hemost. 32 (5): 505-13; and Chandler WL, Peerschke El, Castellone DD, Meijer P, June 2011. Am. J. Clin. Pathol. 135 (6): 862-9).

Therefore, there remains a need to develop new methods to diagnose Von Willebrand Disease or other causes that result in low VWF levels.

General definitions

Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Singleton et al., Dictionary of Microbiology and Molecular Biology 2nd ed., J. Wiley & Sons (New York, N.Y. 1994); March, Advanced Organic Chemistry Reactions,

Mechanisms and Structure 4th ed., J. Wiley & Sons (New York, N.Y. 1992); and Sambrook and Russel, Molecular Cloning: A Laboratory Manual 3rd ed., Cold Spring Harbor Laboratory Press (Cold Spring Harbor, N.Y. 2001) provide one skilled in the art with a general guide to many of the terms used in the present disclosure. One skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which could be used in the practice of the present disclosure. Indeed, the present disclosure is in no way limited to the methods and materials described. For purposes of the present disclosure, the following terms are defined below.

Methods of carrying out the conventional techniques used in methods of the disclosure will be evident to the skilled worker. The practice of conventional techniques in molecular biology, biochemistry, computational chemistry, cell culture, recombinant DNA, bioinformatics, genomics, sequencing and related fields are well-known to those of skill in the art and are discussed, for example, in the following literature references: Sambrook et al. ., Molecular Cloning. A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y., 1989; Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1987 and periodic updates; and the series Methods in Enzymology, Academic Press, San Diego.

As used herein, the singular forms "a," "an" and "the" include plural referents unless the context clearly dictates otherwise. For example, a method for isolating "a" DNA molecule, as used above, includes isolating a plurality of molecules (e.g. 10's, 100's, 1000's, 10's of thousands, 100's of thousands, millions, or more molecules). “Identity" is a measure of the identity of nucleotide sequences or amino acid sequences. In general, the sequences are aligned so that the highest order match is obtained. "Identity" per se has an art-recognized meaning and can be calculated using published techniques. See, e.g.: (COMPUTATIONAL MOLECULAR BIOLOGY, Lesk, A. M., ed„ Oxford University Press, New York, 1988; BIOCOMPUTING: INFORMATICS AND GENOME PROJECTS, Smith, D. W., ed., Academic Press, New York, 1993; COMPUTER ANALYSIS OF SEQUENCE DATA, PART I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; SEQUENCE ANALYSIS IN MOLECULAR BIOLOGY, von Heinje, G.,

Academic Press, 1987; and SEQUENCE ANALYSIS PRIMER; Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991). While there exist a number of methods to measure identity between two polynucleotide or polypeptide sequences, the term "identity" is well known to skilled artisans (Carillo, H., and Upton, D., SIAM J. Applied Math (1988) 48:1073). Methods commonly employed to determine identity or similarity between two sequences include, but are not limited to, those disclosed in GUIDE TO HUGE COMPUTERS, Martin J. Bishop, ed., Academic Press, San Diego, 1994, and Carillo, H., and Lipton, D., SIAM J. Applied Math (1988) 48:1073. Methods to determine identity and similarity are codified in computer programs. Preferred computer program methods to determine identity and similarity between two sequences include, but are not limited to, GCS program package (Devereux, J., et al., Nucleic Acids Research (1984) 12(1):387), BLASTP, BLASTN, FASTA (Atschul, S. F. et al., J. Molec. Biol. (1990) 215:403).

As an illustration, by a polynucleotide having a nucleotide sequence having at least, for example, 95% "identity" to a reference nucleotide sequence encoding a polypeptide of a certain sequence it is meant that the nucleotide sequence of the polynucleotide is identical to the reference sequence except that the polynucleotide sequence may include up to five point mutations per each 100 nucleotides of the reference polypeptide sequence. In other words, to obtain a polynucleotide having a nucleotide sequence at least 95% identical to a reference nucleotide sequence, up to 5% of the nucleotides in the reference sequence may be deleted and/or substituted with another nucleotide, and/or a number of nucleotides up to 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence. These mutations of the reference sequence may occur at the 5' or 3' terminal positions of the reference nucleotide sequence, or anywhere between those terminal positions, interspersed either individually among nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence. Preferably, identity is determined relative to the reference sequence over its entire length. DNA amplification: the term DNA amplification will be typically used to denote the in vitro synthesis of double-stranded DNA molecules using PCR. It is noted that other amplification methods exist and they may be used in the present invention without departing from the gist.

The term “gene” means a DNA sequence comprising a region (transcribed region), which is transcribed into an RNA molecule (e.g. an mRNA) in a cell, operably linked to suitable regulatory regions (e.g. a promoter). A gene may thus comprise several operably linked sequences, such as a promoter, a 5’ leader sequence comprising e.g. sequences involved in translation initiation, a (protein) coding region (cDNA or genomic DNA) and a 3’non-translated sequence comprising e.g. transcription termination sites. A nucleic acid according to the present disclosure may include any polymer or oligomer of pyrimidine and purine bases, preferably the nucleotides cytosine, thymine, and uracil, and adenine and guanine, respectively (See Albert L. Lehninger, Principles of Biochemistry, at 793-800 (Worth Pub. 1982) which is herein incorporated by reference in its entirety for all purposes).

In general, the term primers refer to DNA strands which can prime the synthesis of DNA. DNA polymerase cannot synthesize DNA de novo without primers: it can only extend an existing DNA strand in a reaction in which the complementary strand is used as a template to direct the order of nucleotides to be assembled. We will refer to the synthetic oligonucleotide molecules which are used in a polymerase chain reaction (PCR) as primers.

The term sequencing refers to determining the order of nucleotides (base sequences) in a nucleic acid sample, e.g. DNA or RNA. Many techniques are available such as Sanger sequencing and high-throughput sequencing technologies (also known as next-generation sequencing technologies) such as the GS FLX platform offered by Roche Applied Science, and the Genome Analyzer from lllumina, both based on pyrosequencing.

Description of the disclosure

The present disclosure fulfills the need in the art and relates to a method for determining Von Willebrand Disease or an increased risk of developing Von Willebrand Disease. The method can at the same time or alternatively be used for predicting a decreased plasma level of Von Willebrand Factor. The method comprises the following step: - determining, in a nucleic acid molecule comprising an Annexin A2 (ANXA2) nucleotide sequence of at least 15 nucleotides that is derived from a subject, the presence or absence of a point mutation G to T at a position which corresponds to nucleotide 299 of SEQ ID NO:1.

The nucleic acid molecule according to the present disclosure can be derived from a sample obtained from the subject, for example body fluid, blood, serum, plasma, urine, amniotic fluid, or peripheral leukocytes. Of course, the sample may be obtained, after which nucleic acid may be isolated from said sample, processed (e.g. PCR amplified) and/or stored before it is examined. Commonly, the subject is a mammal, preferably a human, more preferably human having or suspected of having (or developing) a bleeding disorder, preferably Von Willebrand Disease, more preferably Von Willebrand Disease Type 1.

The presence of a T at the particular position indicates that the subject has Von Willebrand Disease, e.g. type 1, 2, and/or 3 (diagnosis) or has an increased risk of developing Von Willebrand Disease (type 1), i.e. as compared to a subject not having the point mutation.

In the art, reference may also be made to Type Nijmegen von Willebrand Disease. Accordingly, Type 1 von Willebrand Disease caused the point mutation according to the present disclosure may also be referred to as Type Nijmegen von Willebrand Disease.

The point mutation can also indicate at the same time or alternatively that the subject has a decreased plasma level of Von Willebrand Factor, for example as compared to a reference (value) associated with healthy subjects, i.e. subjects not having Von Willebrand Disease.

The presence or absence of a point mutation G to T at a position which corresponds to nucleotide 299 of SEQ ID NO:1 thus means presence or absence of a T at the said position. Since having blood group O is also associated with low levels of Von Willebrand Factor, the present disclosure may very well be combined with determining blood group of the subject, in particular determining if the subject has blood group 0.

In the context of the present disclosure, an Annexin A2 (ANXA2) nucleotide sequence is a (part) of an Annexin A2 (ANXA2) gene nucleotide sequence that comprises a position corresponding to nucleotide 299 of SEQ ID N0:1. In view of possible variant Annexin A2 (ANXA2) genes (e.g. of different organisms/species), the Annexin A2 (ANXA2) nucleotide sequence can have 100% identity with SEQ ID NO: 1, but may also have e.g. at least 90%, or at least 95%, 99%, or 99.5% identity with SEQ ID NO:1 over the entire length of the Annexin A2 (ANXA2) nucleotide sequence. For example, the (isolated) nucleic acid molecule, and comprising the point mutation G to T at a position which corresponds to nucleotide 299 of SEQ ID NO:1, may have a length of, e.g. 51 nucleotides, with the nucleotide that corresponds to the point mutation in the middle. Consequently, the nucleic acid according to the disclosure may have 25 nucleotides on the 3’end and 25 nucleotides on the 5’end of said nucleotide. Identity can now be determined relative to the corresponding positions in SEQ ID N0.1. In a preferred embodiment, the Annexin A2 (ANXA2) nucleotide sequence is a sequence of consecutive nucleotides of SEQ ID NO:1.

For example, the nucleic acid molecule may comprise an Annexin A2 (ANXA2) nucleotide sequence of at least 16, 17, 18, 19, 20, 25, 25, 30, 40, 50, 75, 100, 150, 200, 1000 nucleotides and/or preferably is between, and including, 15 - 10000 nucleotides, 20 - 8000 nucleotides, 50 -1000 nucleotides, or 100 - 250 nucleotides.

As will be understood, and depending on the context, the corresponding single nucleotide polymorphism (SNP), as indicated herein, and/or either as shown in SEQ ID NO:1, or within the nucleotide sequence disclosed before the Example, corresponds to rs17845226 (SNP ID’s according to www.ncbi.nlm.nih.gov/projects/SNP/). (rs17845226: c. 346 G>T; P. Val 116 > Leu).

The presence of a “T” at a position that corresponds to nucleotide 299 of SEQ ID NO:1 is indicative for a decreased level of Von Willebrand Factor in the circulation, in comparison the absence of a “T” at that position (having a G at the position). The presence of a “T” at a position that corresponds to nucleotide 299 of SEQ ID NO:1 is therefore corresponding to having (an increased risk for) Von Willebrand Disease.

It will be understood by the skilled person that the term point mutation within the context of the current disclosure denotes the presence of a nucleotide in the material under study that is different from the nucleotide that is shown in SEQ ID NO:1 at the corresponding position.

Based on the presence or absence of one or more of the point mutations described herein, a skilled person can determine whether the particular subject from which the material has been obtained may have e.g. an increased or decreased plasma level of Von Willebrand Factor and/or a increased tendency for developing Von Willebrand Disease (or already having VWD). The results may very well be combined with other indications and/or measurements in the diagnosis of these conditions.

The skilled person will be aware of the existence of different nucleotide sequences for the part of the Annexin A2 gene according to SEQ ID NO:1. He understands that the position of the point mutation, described in the context of SEQ ID NO:1, has a corresponding position in these alternative nucleotide sequences, and that the particular point mutation described herein can thus also be present in such alternative nucleotide sequences (and are encompassed by the present disclosure).

Based on the present disclosure and previous research on the rs17845226 mutation by Lagace and his research team, further possibilities for diagnostics were identified by the present inventors.

Therefore, the present disclosure also relates to a method for determining Von Willebrand Disease or an increased risk of developing Von Willebrand Disease and/or for predicting a decreased plasma level of Von Willebrand Factor (as compared to subjects not having the point mutation, or healthy subjects), wherein the method comprises the following step: - determining, in a sample derived from a subject, the level of PCSK9 and/or the level of LDL cholesterol, wherein a lower level of PCSK9 and/or a lower level of LDL cholesterol as compared to a reference (value) indicates that the subject carries the point mutation G to T at a position which corresponds to nucleotide 299 of SEQ ID NO:1 in Annexin A2 (ANXA2).

The reference may be a value derived from subjects not having the point mutation, or healthy subjects (i.e. subjects not having or suspected of developing VWD).

The sample can be body fluid, blood, serum, plasma, urine, amniotic fluid, or peripheral leukocytes. Of course, the sample may be processed or stored before it is provided. Commonly, the sample is obtained from a mammal, preferably a human, more preferably a human having or suspected of having (or developing) a bleeding disorder, preferably Von Willebrand Disease, more preferably Von Willebrand Disease Type 1. The determination can be performed as described in Lagace (2014 Curr Opin Lipidol).

Lagace showed a significant decrease of plasma PCSK9 concentration in both heterozygous and homozygous persons with the rs17845226 SNP. The one homozygous case of the study even shows a decreased LDL-cholesterol plasma concentration (Lagace, T. A. (2014). PCSK9 and LDLR degradation: regulatory mechanisms in circulation and in cells. Curr Opin Lipidol.). This subsequently suggests that circulating plasma PCSK9 and plasma LDL-cholesterol can be used as a possible indication marker for the rs17845226 SNP. This present disclosure therefore hypothesizes that persons with lower plasma PCSK9 levels might also have an increased risk for VWD type 1, as the rs17845226 SNP can cause type 1 VWD. PCSK9, referring to Proprotein convertase subtilisin/kexin type 9, is an enzyme that in humans is encoded by the PCSK9 gene (Seidah et al 2003 Proc. Natl. Acad. Sci. U.S.A. 100 (3): 928-33). Similar genes (orthologs) are found across many species.

Blood tests that can measure LDL-C are broadly available. They are usually based on calculation, using e.g. the Friedewald formula which includes total cholesterol, HDL-C and triglycerides. Direct LDL -C measurements are also available, but are less often done due to higher costs (Brunzell et al J Am Coll Cardiol, 2008; 51:1512-1524).

The methods according to the present disclosure are preferably for determining Type 1 Von Willebrand Disease (and/or Type 2B, 2N) or an increased risk of developing Type 1 Von Willebrand Disease (and/or Type 2B, 2N) while at the same time or alternatively the method can be used for predicting a decreased plasma level of Von Willebrand Factor, preferably as compared to a reference (value) associated with healthy subjects (known or thought to be non-VWD).

Von Willebrand Factor is synthesized in endothelial cells and stored within ‘Weibel Palade bodies’ (WPB), which are rod shaped organelles inside the endothelial cells. When the endothelial vessel wall gets damaged VWF will be released from the WPB and secreted into the circulation through exocytosis.

As described earlier herein, VWD can divided into three different types based on pathophysiologic symptoms. Patients diagnosed with type 1 VWD suffer from a partial quantitative deficiency of the multimeric glycoprotein VWF, meaning that the concentration of VWF in the circulation is reduced. The majority of the patients with VWD are diagnosed with type 1 VWD.

Patients with VWD type 2 have a qualitative defect of the VWF protein; the function of VWF is abnormal, resulting in a decreased activity of hemostasis. VWD types can be divided as follows:

Type 1: Partial quantitative deficiency of VWF. Multimers may be abnormal, but the proportion of large multimers is not significantly decreased. Typically autosomal dominant in inheritance although diagnosis is complicated by reduced penetrance and variable expressivity.

Type 2A: Qualitative VWF defect resulting in a reduction of VWF-dependent platelet adhesion. Associated with absence of the largest multimers. Generally autosomal dominant. Type 2B: Qualitative VWF defect resulting in increased VWF-dependent platelet adhesion. Associated with (usually) reduced high molecular weight multimers. Inheritance is autosomal dominant.

Type 2M: Qualitative VWF defect associated with specific defects in plateletA/WF interaction but with a normal range of multimers. Inheritance is autosomal dominant.

Type 2N: Qualitative VWF defect resulting from defective VWF binding to coagulation factor VIII (FVIII) and consequently low levels of circulating FVIII. Inheritance is autosomal recessive.

Type 3: Clinically severe quantitative disorder resulting from a markedly reduced or absent platelet and plasma VWF (less than 5 lU/dL). Consequently, FVIII activity is also reduced. Inheritance is autosomal recessive. (from: http://www.vwf.group.shef.ac.uk/vwd.html)

Type 3 VWD, or ‘severe’ VWD is thus characterized by a complete deficiency of VWF. The levels of VWF in the blood are below 5 lU/dL and are therefore undetectable. Even the most severe type 1 VWD patient will rarely reach values as low as 10 lU/dL and thus patients with type 3 VWD can be classified with a distinct type.

Determining the presence or absence of the point mutations in the Annexin A2 (ANXA2) gene sequence, or fragment thereof, may be performed by nucleic acid techniques based on size or sequence, preferably chosen from the group consisting of hybridization techniques, nucleic acid sequencing, PCR, restriction fragment determination, single nucleotide polymorphism (SNPs)-determination, LCR (ligation chain reaction) and restriction fragment length polymorphism (RFLP)-determination, more preferably by nucleic acid sequencing.

The examining of the point mutation as described herein can be carried out by standard methods known in the art. For example, the detection of said point mutation in said Annexin A2 gene, including gene regulatory elements like promoter regions, 5’UTR, 3’UTR, exons, introns, may be carried out or determined by nucleic acid techniques based on size or sequence. Techniques suitable include, but are not limited to, nucleic acid sequencing techniques, hybridization techniques (e.g. using specific probes), PCR, single nucleotide polymorphism (SNPs)-determination, or restriction fragment length polymorphism (RFLP)-determination. Corresponding or additional techniques have been described in numerous handbooks, including Sambrook, Russell "Molecular Cloning, A Laboratory Manual", Cold Spring Harbor Laboratory, N.Y. (2001)).

The methods according to the disclosure are preferably performed in vitro. The present disclosure preferably does not relate to a diagnostic method practiced on (i.e. necessitating the presence of) the human or animal body.

Although the method according to the disclosure can be performed with genetic material from any organism, the method is preferably performed on genetic material obtained from a mammal, preferably a human, more preferably a human suspected of having Von Willebrand Disease (type 1) or suspected to be at risk thereof.

The nucleotide sequence to be analyzed may be obtained from any part of the body, including a body fluid, preferably chosen from the group consisting of blood, serum, urine, amniotic fluid, or peripheral leukocytes.

The method disclosed herein can be performed on genomic DNA, preferably by amplifying a DNA-stretch of the Annexin A2 gene from genomic DNA by PCR and subsequent examination.

For example, the following primers may be used: forward 5’- CCTT AT GATT GCCT GTTAT C -3’ (SEQ ID NO:2); and reverse 5’- GTAGCAGCTGGTAACTGACT -3’ (SEQ ID NO:3).

However, a skilled person well understands that alternative techniques and/or primers may be employed in the analysis of one or more (different) DNA-stretch or stretches of the Annexin A2 gene, and either alone, or together comprise at the mutation as disclosed herein.

Preferably a stretch is at least about (± 5 nucleotides) 20, 40, 100, 200, 400, 1000, 1500 nucleotides long, depending on the technique for examining employed.

The present disclosure further relates to a method for determining if Von Willebrand Disease is caused by a defect (point mutation) in the Annexin A2 (ANXA2) gene or for example by a defect in the Von Willebrand gene, wherein the method comprises the following steps: - determining, in a nucleic acid molecule comprising an Annexin A2 (ANXA2) nucleotide sequence of at least 15 nucleotides that is derived from a subject, the presence or absence of a point mutation G to T at a position which corresponds to nucleotide 299 of SEQ ID NO:1.

The presence of a point mutation G to T at the particular position indicates that the subject has Von Willebrand Disease caused by a point mutation in the Annexin A2 (ANXA2) gene.

Comparably, the present disclosure also relates to a method for determining if (Type 1) Von Willebrand Disease is caused by a defect (point mutation) in the Annexin A2 (ANXA2) gene, the method comprising the following step: - determining, in a sample derived from a subject, the level of PCSK9 and/or the level of LDL cholesterol, wherein a lower level of PCSK9 and/or a lower level of LDL cholesterol as compared to a reference indicates that the subject carries the point mutation G to T at a position which corresponds to nucleotide 299 of SEQ ID NO:1 in Annexin A2 (ANXA2).

The present inventors considered that Annexin A2 is involved in the regulation of exocytosis of Weibel Palade bodies, which leads to VWF release into the circulation. Since VWD type 1 and type 3 are the only (partial) quantitative types of VWD with lower VWF plasma levels, effects of Annexin A2 mutations should, according to the present aims, be visible specifically in patients with VWD type 1 and/or type 3.

Since VWD type 1 is the only partial quantitative type of VWD with lower VWF plasma levels, deleterious mutations in the Annexin A2 gene may result in less secretion of VWF by WPB. The cause for type 2 VWD is expected to be primarily related to VWF itself and is not thought to be primarily related to the exocytosis or transport of VWF out of the cell.

However, less secretion of VWF and the VWF protein itself being less functional may also occur together within the same patient. Therefore, the present point mutation may occur in type 2 VWD as well, or e.g. in type 1/2N combination.

From a treatment perspective it is very useful that the above method can distinguish between VWD caused by a defective Annexin A2 due to mutation(s) in the Annexin A2 gene, and VWD caused by a defective (less functional) VWF gene due to mutation(s) in the VWF gene. In case of a defective Annexin A2 gene, treatment with Desmopressin (DDAVP) can be effective, because Desmopressin can increase secretion of VWF from endothelial cells. VWF is stored in Weibel Palade bodies and under influence of Desmopressin VWF may enter the circulation. However, in case of a defective Von Willebrand gene, Desmopressin will be much less effective and treatment with much more expensive VWF concentrate may be necessary.

Desmopressin is a synthetic peptidometic for vasopressin. Vasopressin and Desmopressin both act onto the V2 receptor also present on the endothelial cell surface. Desmopressin can thus promote the release of VWF to the blood circulation and as such can be used in patients with a partial quantitative defect. Patients with VWD type 3 typically do not respond to Desmopressin. It is anticipated that patients carrying the present point mutation in Annexin A2 do not respond adequately to DDAVP either and thus may need to be treated with VWF concentrate.

Further encompassed is the use of a nucleic acid molecule comprising an Annexin A2 (ANXA2) nucleotide sequence of at least 15 nucleotides comprising a point mutation G to T at a position which corresponds to nucleotide 299 of SEQ ID NO:1 for determining Von Willebrand Disease (preferably Type 1, 2B, or 2N) or an increased risk of developing Von Willebrand Disease (preferably Type 1, 2B, or 2N) and/or predicting a decreased plasma level of Von Willebrand Factor.

The nucleic acid molecule according to the present disclosure can be derived from a sample, which can be body fluid, blood, serum, plasma, urine, amniotic fluid, or peripheral leukocytes. Of course, the sample may be processed or stored before it is tested.

Commonly, the subject is a mammal, preferably a human, more preferably human having or suspected of having (or developing) a bleeding disorder, preferably Von Willebrand Disease, more preferably Von Willebrand Disease Type 1.

In addition or alternatively, and in view of possible variant Annexin A2 (ANXA2) genes, the nucleic acid molecule comprising an Annexin A2 (ANXA2) nucleotide sequence can have 100% identity with SEQ ID NO:1, but may also have e.g. at least 90%, or at least 95%, 99%, or 99.5% identity with SEQ ID NO:1 over the entire length of the Annexin A2 (ANXA2) nucleotide sequence. For example, the isolated nucleic acid molecule, and comprising the point mutation G to T at a position which corresponds to nucleotide 299 of SEQ ID NO:1, may have a length of, e.g. 51 nucleotides, with the nucleotide that corresponds to the point mutation in the middle. Consequently, the nucleic acid according to the invention has 25 nucleotides on the 3’end and 25 nucleotides on the 5’end of said nucleotide. Identity can now be determined relative to the corresponding positions in SEQ ID NO.1. In a preferred embodiment, the Annexin A2 (ANXA2) nucleotide sequence is a sequence of consecutive nucleotides of SEQ ID NO:1.

Comparably, the present disclosure also relates to a use of PCSK9 and/or LDL cholesterol for determining Von Willebrand Disease or an increased risk of developing Von Willebrand Disease and/or for predicting a decreased plasma level of Von Willebrand Factor.

The present disclosure also relates to a kit for determining Von Willebrand Disease (preferably Type 1, 2B, or 2N) or an increased risk of developing Von Willebrand Disease (preferably Type 1, 2B, or2N) and/or for predicting a decreased plasma level of Von Willebrand Factor as compared to a reference (value) such as associated with healthy subjects, the kit comprising means for determining presence or absence, in a nucleic acid molecule comprising an Annexin A2 (ANXA2) nucleotide sequence of at least 15 nucleotides, of the point mutation G to T at a position which corresponds to nucleotide 299 of SEQ ID NO:1. In a preferred embodiment, the present disclosure relates to use of the kit for determining Von Willebrand Disease (preferably Type 1, 2B, or 2N) or an increased risk of developing Von Willebrand Disease (preferably Type 1, 2B, or 2N) and/or predicting a decreased plasma level of Von Willebrand Factor.

An Annexin A2 (ANXA2) nucleotide sequence is a sequence comprising consecutive nucleotides of a (variant) Annexin A2 (ANXA2) gene. For example, such nucleic acid molecule comprising an Annexin A2 (ANXA2) nucleotide sequence can have 100% identity with SEQ ID NO: 1, but may also have e.g. at least 90%, or at least 95%, 99%, or 99.5% identity with SEQ ID NO:1 over the entire length of the Annexin A2 (ANXA2) nucleotide sequence. The sequence may have a length of at least 16, 17, 18, 19, 20, 25, 25, 30, 40, 50, 75, 100, 150, 200, 1000 nucleotides and/or preferably is between, and including, 15 -10000 nucleotides, 20 - 8000 nucleotides, 50 -1000 nucleotides, or 100 - 250 nucleotides.

The kit according to the disclosure may comprise an oligonucleotide selectively hybridizing under stringent conditions (being complementary) with a nucleic acid molecule comprising an Annexin A2 (ANXA2) nucleotide sequence of at least 15 (or at least 16, 17, 18, 19, 20, 25, 30, 35) nucleotides comprising a point mutation G to T at a position which corresponds to nucleotide 299 of SEQ ID NO:1 and not selectively hybridizing (not being complementary) under stringent conditions with a nucleic acid molecule comprising an Annexin A2 (ANXA2) nucleotide sequence of at least 15 (or at least 16, 17, 18, 19, 20, 25, 30, 35) nucleotides comprising a G at a position which corresponds to nucleotide 299 of SEQ ID NO:1. Alternatively, vice versa.

The term “hybridizing” means that two nucleic acid fragments are capable of hybridization to one another under standard hybridization conditions described in Sambrook et al., Molecular Cloning: A Laboratory Manual (1989) Cold Spring Harbor Laboratory Press, New York, USA. More specifically, “stringent conditions” as used herein refer to hybridization at 65° C. in a hybridization buffer consisting of 250 mmol/l sodium phosphate buffer pH 7.2, 7% (w/v) SDS, 1% (w/v) BSA, 1 mmol/l EDTA and 0.1 mg/ml single-stranded salmon sperm DNA. A final wash is performed at 65° C. in 125 mmol/l sodium phosphate buffer pH 7.2, 1 mmol/l EDTA and 1% (w/v) SDS.

The kit may also comprise a primer pair capable of amplifying a nucleic acid molecule comprising an Annexin A2 (ANXA2) nucleotide sequence of at least 15 (or at least 16, 17, 18, 19, 20, 25, 30, 35) nucleotides comprising a point mutation G to T at a position which corresponds to nucleotide 299 of SEQ ID NO:1. Furthermore, a primer in the primer pair may be designed to selectively anneal to, and amplify, a nucleic acid molecule comprising an Annexin A2 (ANXA2) nucleotide sequence of at least 15 nucleotides comprising a point mutation G to T at a position which corresponds to nucleotide 299 of SEQ ID NO:1.

Finally, also encompassed is a kit for determining Von Willebrand Disease or an increased risk of developing Von Willebrand Disease and/or for predicting a decreased plasma level of Von Willebrand Factor, the kit comprising means for determining the level of PCSK9 and/or the level of LDL cholesterol in a sample.

Preferably, the kits according to the present disclosure can be combined with a sample of a subject, preferably being body fluid, blood, serum, plasma, urine, amniotic fluid, or peripheral leukocytes.

The method(s) and kits according to the present disclosure may further (comprise means to) determine in the sample that is derived from the subject: - blood group (0), - Von Willebrand Factor quantity (e.g. with VWF antigen assay), - Von Willebrand Factor activity (e.g. with a glycoprotein (GP)lb binding assay, a collagen binding assay, or a ristocetin cofactor activity (RiCof) or ristocetin induced platelet agglutination (RIPA) assay), - Annexin A2 quantity (e.g. with antigen assay, ELISA) and/or - Annexin A2 activity.

Also disclosed are a method and a kit that (comprise means to) determine in the sample that is derived from the subject: - blood group (0), - Von Willebrand Factor quantity (e.g. with VWF antigen assay), - Von Willebrand Factor activity (e.g. with a glycoprotein (GP)lb binding assay, a collagen binding assay, or a ristocetin cofactor activity (RiCof) or ristocetin induced platelet agglutination (RIPA) assay), - Annexin A2 quantity (e.g. with antigen assay, ELISA) and/or - Annexin A2 activity. Such method or kit is for determining von Willebrand Disease, preferably Type 1 or other Types.

Annexin A2 quantity/activity may be determined in a sample comprising (peripheral) leukocytes, platelets, endothelial cells or precursors thereof, derived from the subject.

Sequence listing

Annexin A2, exon 5, c.346G>T p.Val116 Leu, rs17845226 (NM 001002858) TTTTATTGACCGGGGAAGACGGCAAAATTAACTTGGATTTTAAGGAATTTCGTTGAAGCA AAGCCT GAT GTTTAT GTTTCT GAGAT GTGGGT CT GTT GAAGGGAAT GCAGTT GAGGGCG TTT GACCCAAGACTCCGGAGT GGT CAAAGACT CACAACCTGCTT CACAAAAAGAT CCCT CTT ACTTTT GTTTT ACT CACT AGTTTT A AAGT A A A AT A A AT ATTTT CCTT AT GATT GCCTGT TATCTTGAAGGAACTTGCATCAGCACTGAAGTCAGCCTTATCTGGCCACCTGGAGACGi TGATTTTGGGCCTATTGAAGACACCTGCTCAGTATGACGCTTCTGAGCTAAAAGCTTCCA T GAAGGTAAATGCAT GT GAGAT GTCAT CT CT GT CAAAT CT GCTATTAATTTT GT GAATTAC AGCTTTCT GAGT GTAATTTGGT GATTTTCAGTTTT GTT GAATT CTCATTTGGAACCATTTT TTA AAAAT G AACT G AAGTTATATGT CT C AGG ATTT GT ACCAAAAATATTT C AATT ACTT GT TTT AAGACT GT AAAGAAATTTCAT GATGCT GAGAAGTCAGTTACC AGCTGCTACTACT CA GCACCTGGGCAA (SEQ ID NO:1)

Grey: primers sites (SEQ ID NO:2 and 3 respectively)

Underlined: exon 5

Bold, grey and underlined: rs17845226 Legend to the figures

Figure 1 - Blood characteristics of healthy subjects (median (25-75% IQR)) and their associated genotype regarding polymorphism rs17845226 (wild type or heterozygous). The bold bar represents the median level whereas the small bars represent the 25-75% IQR)

CLAUSES 1. A method for determining Von Willebrand Disease or an increased risk of developing Von Willebrand Disease and/or for predicting a decreased plasma level of Von Willebrand Factor comprising the following step: - determining, in a nucleic acid molecule comprising an Annexin A2 (ANXA2) nucleotide sequence of at least 15 nucleotides that is derived from a subject, the presence or absence of a point mutation G to T at a position which corresponds to nucleotide 299 of SEQ ID NO:1. 2. A method for determining Von Willebrand Disease or an increased risk of developing Von Willebrand Disease and/or predicting a decreased plasma level of Von Willebrand Factor comprising the following step: - determining, in a sample derived from a subject, the level of PCSK9 and/or the level of LDL cholesterol, wherein a lower level of PCSK9 and/or a lower level of LDL cholesterol as compared to a reference indicates that the subject carries the point mutation G to T at a position which corresponds to nucleotide 299 of SEQ ID NO:1 in Annexin A2 (ANXA2). 3. Method according to any one of clauses 1-2, wherein the method is for determining Type 1 Von Willebrand Disease or an increased risk of developing Type 1 Von Willebrand Disease and/or for predicting a decreased plasma level of Von Willebrand Factor as compared to a reference. 4. Method for determining if Type 1 Von Willebrand Disease is caused by a defect in the Annexin A2 (ANXA2) gene, the method comprising the following step: - determining, in a nucleic acid molecule comprising an Annexin A2 (ANXA2) nucleotide sequence of at least 15 nucleotides that is derived from a subject, the presence or absence of a point mutation G to T at a position which corresponds to nucleotide 299 of SEQ ID NO:1. 5. Method for determining if Type 1 Von Willebrand Disease is caused by a defect in the Annexin A2 (ANXA2) gene, the method comprising the following step: - determining, in a sample derived from a subject, the level of PCSK9 and/or the level of LDL cholesterol, wherein a lower level of PCSK9 and/or a lower level of LDL cholesterol as compared to a reference indicates that the subject carries the point mutation G to T at a position which corresponds to nucleotide 299 of SEQ ID NO:1 in Annexin A2 (ANXA2). 6. Method according to any one of clauses 1-5, wherein the subject is a mammal, preferably a human, more preferably a human having or suspected of having a bleeding disorder, preferably Von Willebrand Disease, more preferably Von Willebrand Disease Type 1. 7. Method according to any one of clauses 1-6, wherein the method further determines in the sample that is derived from the subject: blood group, Von Willebrand Factor quantity, Von Willebrand Factor activity, Annexin A2 quantity and/or Annexin A2 activity. 8. The method according to any one of clauses 1-7, wherein a sample derived from the subject is used which is body fluid, blood, serum, plasma, urine, amniotic fluid, or peripheral leukocytes. 9. Use of a nucleic acid molecule comprising an Annexin A2 (ANXA2) nucleotide sequence of at least 15 nucleotides comprising a point mutation G to T at a position which corresponds to nucleotide 299 of SEQ ID NO:1 for determining Von Willebrand Disease or an increased risk of developing Von Willebrand Disease and/or for predicting a decreased plasma level of Von Willebrand Factor. 10. Use of PCSK9 and/or LDL cholesterol for determining Von Willebrand Disease or an increased risk of developing Von Willebrand Disease and/or for predicting a decreased plasma level of Von Willebrand Factor. 11. Kit for determining Von Willebrand Disease or an increased risk of developing Von Willebrand Disease and/or for predicting a decreased plasma level of Von Willebrand Factor, the kit comprising means for determining presence or absence, in a nucleic acid molecule comprising an Annexin A2 (ANXA2) nucleotide sequence of at least 15 nucleotides, of the point mutation G to T at a position which corresponds to nucleotide 299 of SEQ ID NO:1. 12. Kit according to clause 11 comprising an oligonucleotide that selectively hybridizes with a nucleic acid molecule comprising an Annexin A2 (ANXA2) nucleotide sequence of at least 15 nucleotides comprising a point mutation G to T at a position which corresponds to nucleotide 299 of SEQ ID NO:1, wherein said oligonucleotide does not selectively hybridize with a nucleic acid molecule comprising an Annexin A2 (ANXA2) nucleotide sequence of at least 15 nucleotides comprising a G at a position which corresponds to nucleotide 299 of SEQ ID NO:1. 13. Kit according to any one of clauses 11-12 comprising a primer pair capable of amplifying a nucleic acid molecule comprising an Annexin A2 (ANXA2) nucleotide sequence of at least 15 nucleotides comprising a point mutation G to T at a position which corresponds to nucleotide 299 of SEQ ID NO:1. 14. Kit according to clause 13, wherein a primer in the primer pair is designed to selectively anneal to, and amplify, a nucleic acid molecule comprising an Annexin A2 (ANXA2) nucleotide sequence of at least 15 nucleotides comprising a point mutation G to T at a position which corresponds to nucleotide 299 of SEQ ID NO:1. 15. Kit for determining Von Willebrand Disease or an increased risk of developing Von Willebrand Disease and/or for predicting a decreased plasma level of Von Willebrand Factor, the kit comprising means for determining the level of PCSK9 and/or the level of LDL cholesterol in a sample.

Example 1

The results of this Example show that the rs17845226 mutation in the Annexin A2 gene, which is positioned in exon 5 (which is in the literature sometimes also referred to as exon 6), has an influence on Von Willebrand Factor antigen levels and the Von Willebrand Factor activity in circulation (Figure 1). The results of this example further show that the rs17845226 mutation in the Annexin A2 gene occurs more frequently in the Von Willebrand Disease Type 1 patient population, as compared to the control group population (Table 1).

METHODS

Participants 80 healthy controls (cohort 1) and 94 presumed VWF patients from the Radboud VWD patient population (cohort 2) were analyzed for the rs17845226 single nucleotide polymorphism in exon 5. Additionally, SNP data from the ‘Nijmegen Biomedische Studie’ was obtained and provided a further control group with 1502 controls (cohort 3). Of all controls and patients informed written consent was obtained.

Genetic analysis of cohort 1 and cohort 2

Genomic DNA was isolated from peripheral leukocytes. An exon 5 region of the ANXA2 gene was amplified by polymerase chain reaction (PCR) using two oligonucleotide primers: forward 5’- CCTT AT GATT GCCTGTTATC -3’ (SEQ ID NO:2) and reverse 5’-GTAGCAGCTGGTAACTGACT -3’ (SEQ ID NO:3). PCR reactions were carried out in a final volume of 50 μΙ reaction mixture containing 5 μΙ 10x PCR Buffer (Invitrogen), 5 μΙ dNTP, 1.5 mM MgCI2, 1 μΙ of each primer (forward and reverse), 2 μΙ DNA sample (-100-150 ng), 0.25 μΙ Taq DNA polymerase (Invitrogen), and purified water. Cycling conditions were: an initial denaturation step at 95°C for 5 minutes followed by denaturation at 94°C for 30 seconds, annealing at 54°C for 30 seconds and elongation at 72°C for 30 seconds (36 cycles in total). PCRs were performed in a GeneAmp® PCR System 9700 Thermal Cycler (Applied Biosystems). PCR products were purified using a 96 well PCR filter clean-up plate (Millipore). Purified amplicons were sequenced using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems).

Sequence analysis and data conversion of cohort 1 and cohort 2 Analysis of the DNA sequences and the determined nucleotides was performed by comparing the nucleotides of the amplicon sequences with a reference sequence from the national center for biotechnology information. The reference sequence which was used for exon 5 was: NM_001002858.2. With help of the program, the exon 5 SNP was detected in the amplicons. The presence or absence of rs17845226 was referred to as Wild type (GG), heterozygous (GT) or homozygous (TT).

Genetic analysis of cohort 3

The control group included population controls from the Nijmegen Biomedical study (NBS). For this study, we used data of a subset of 1502 individuals who served as controls in a genome-wide association study (GWAS) [20], DNA of NBS participants were genotyped using the lllumina HumanHap CNV370-Duo BeadChip. For this study, we extracted the ANXA2 SNP from genome-wide imputed SNP data using the “Genome of the Netherlands” (GoNL) data as reference.

Determination of plasma von Willebrand factor levels

Plasma Von Willebrand factor activity levels were measured using the ristocetin-induced platelet agglutionation assay and the Collagen Binding Assay. A standard Von Willebrand factor Antigen ELISA was used to measure the von Willebrand factor antigen levels.

Statistical analyses

The Mann Witney U test was performed to determine statistical differences in plasma Von Willebrand factor parameters between heterozygous carriers of rs17845226 and non carriers in a cohort of healthy controls. This analysis was done to exclude any effect of VWF gene mutations on von willebrand factor parameters. Odds ratios were calculated based on the data obtained from patient (cohort 2) and control (cohort 3) data. The odds ratio is often used in epidemiologic research and is thought to approximate the risk ratio for a person to have a particular disease. The odds ratio is a parameter that measures association between two independent binomial trials, in this case, the persons exposed to the polymorphism and the persons unexposed to the polymorphism. In the exposed groups both homozygous and heterozygous persons were included, whereas the unexposed groups were only confined of persons with Wild type SNPs. The ultimate formula to calculate the odds ratio (OR) is: OR=((Control (AA))*(Patient (Aa+aa)))/((Patient (AA))*(Control (Aa+aa))) AA (here GG) means Wild type, Aa (here GT) means heterozygous and aa (here TT) represents homozygous for this particular SNP. The odds ratios for all VWD subtypes are expressed together with their 95% confidence lower and upper limits.

If the odds ratio >1, the chance to develop the disease is greater than the chance not to develop the disease. If the odds ratio <1 the chance to develop the disease is not elevated when the SNP is present in any form. The odds ratio can be regarded as significant if the value 1 is not within the 95% confidence interval, which is the interval between the lower and upper mid P value. ANOVA was performed to calculate significant differences between groups. In this study the difference between three groups; wild type, heterozygous and homozygous patients was calculated with the use of a one-way between groups ANOVA in excel. If the p value between the groups reaches below 0,05% there is proof of a significant difference between the groups. It means that the chance that the observation is due to coincidence is smaller than 5%.

Results and discussion

Figure 1 (and table 2) show the effect of rs17845226 on plasma VWF parameters in a cohort of healthy controls (cohort 1). Despite the small population, heterozygous carriers of rs17845226 have significantly lower plasma Von Willebrand Factor antigen levels ((VWF:Ag; p=0.029) and a trend to lower levels for both Von Willebrand Factor activity levels (VWF:Act and VWF:CB; both p=0.096).

Table 1 shows the frequencies and odds ratios for the different VWD patients (cohort 2) and NBS control (cohort 3). Odd ratios for each patient population were calculated using the NBS control cohort as a reference. rs17845226 is significantly more present in patients with Von Willebrand disease type 1 and type 2N. It is anticipated that the significant increased odd ratio in type 2N is due to a compound heterozygous effect of type 1/2N.

In conclusion, rs17845226, a polymorphism in the Annexin A2 gene which causes an amino acid change from a valine to a leucine at amino acid position 116, is related to Von Willebrand disease. Persons with this exon 5 SNP have an increased risk for developing VWD type 1 and type 2N. For the total group of patients significant odds ratios are reached as well, which shows that the polymorphism is significantly more often present in the patient population, compared to the control population.

Table 1 - rs17845226 characteristics for the Radboud patient population (cohort 2) and NBS control cohort 3. Odds ratios and a 95% confidence interval are displayed using the NBS cohort as control group. VWD classification by type, with n representing the quantity of patients per subtype. Quantity and percentage of patients with Wild type (GG),

Heterozygous (GT), and Homozygous (TT) SNP are shown.

The rs17845226 mutation causes an amino acid change from a valine to a leucine on position 346 (amino acid position 116).

Figure 1 shows the mean blood characteristic levels from cohort 1 with heterozygous or wild type genotype.

Table 2

Conclusion

With an odds ratio of 3,0285 (Table 1) it is proven that the rs17845226 mutation which changes a guanine into a thymine, occurs more frequently in the VWD type 1 patient population compared to the control population.

Carriers of rs17845226 have lower VWF antigen levels and VWF activity levels (figure 1). This means that VWF plasma levels in VWD type 1 patients with a homozygous or heterozygous mutation for rs17845226 can be expected to be significantly lower than VWD type 1 patients with a Wild type on the position of rs17845226.

These results suggest that the rs17845226 polymorphism plays a role in developing a quantitative form of VWD with lowered VWF concentration, leading to lowered VWF antigen in the plasma and lowered VWF activity in the plasma.

Previous research on the rs17845226 SNP by Lagace and his research team shows potential for future diagnostics. Lagace shows a significant decrease of plasma PCSK9 concentration in both heterozygous and homozygous persons with the rs17845226 SNP. The one homozygous case of the study even shows a decreased LDL-cholesterol plasma concentration (Lagace, T. A. 2014. Curr Opin Lipidol). This subsequently suggest that circulating plasma PCSK9 and plasma LDL-cholesterol can be used as a possible indication marker for the rs17845226 SNP and thus as a marker for the mRNA decay of Annexin A2. This study therefore hypothesizes that persons with lower plasma PCSK9 levels might also have an increased risk for VWD type 1, as the rs17845226 SNP proves to cause type 1 VWD.

Significant odds ratios were also found for the VWD type 2N patient group, and even for the entire VWD patient group as a whole. These results suggest a role for Annexin A2 in the Von Willebrand Disease group as a whole, /mjo

Claims

Method for determining Von Willebrand disease or an increased risk of Von Willebrand disease and / or predicting a reduced plasma level of Von Willebrand Factor comprising the following step: - determining, in a nucleic acid molecule comprising an annexin A2 (ANXA2 nucleotide sequence of at least 15 nucleotides from or derived from an individual, the presence or absence of a point mutation G to T at a position corresponding to nucleotide 299 of SEQ ID NO: 1.

Method for determining Von Willebrand disease or an increased risk of Von Willebrand disease and / or predicting a reduced plasma level of Von Willebrand Factor comprising the following step: - determining, in a sample derived or derived from an individual, from the level of PCSK9 and / or LDL cholesterol, where a lower PCSK9 level and / or a lower LDL cholesterol level compared to a reference is an indication that the individual carries the point mutation G to T at a position corresponding to nucleotide 299 of SEQ ID NO: 1 in Annexin A2 (ANXA2).

A method according to any of claims 1-2, wherein the method is for determining Type 1 von Willebrand disease or an increased risk of Type 1 von Willebrand disease and / or for predicting a reduced plasma level of Von Willebrand Factor compared to a reference.

Method for determining whether Type 1 von Willebrand disease is caused by a defect in the annexin A2 (ANXA2) gene, the method comprising the following steps: - determining, in a nucleic acid molecule comprising an annexin A2 (ANXA2) nucleotide sequence of at least 15 nucleotides from or derived from an individual, the presence or absence of a point mutation G to T at a position corresponding to nucleotide 299 of SEQ ID NO: 1.

5. Method for determining whether Type 1 von Willebrand disease is caused by a defect in the annexin A2 (ANXA2) gene, the method comprising the following step: - determining, in a sample originating from or derived from an individual, the level of PCSK9 and / or LDL cholesterol, where a lower PCSK9 level and / or a lower LDL cholesterol level compared to a reference is an indication that the individual carries the point mutation G to T at a position corresponding to nucleotide 299 of SEQ ID NO : 1 in Annexin A2 (ANXA2).

The method of any one of claims 1-5, wherein the individual is a mammal, preferably a human, more preferably a human with, or presumably with, a bleeding disorder, preferably Von Willebrand Disease, more preferably Von Willebrand Disease Type 1 .

A method according to any one of claims 1-6, wherein the method further determines in the sample derived or derived from the individual: blood type, Von Willebrand Factor quantity, Von Willebrand Factor activity, Annexin A2 quantity and / or Annexin A2 activity .

The method of any one of claims 1-7, wherein a sample derived or derived from the individual is used that is body fluid, blood, serum, plasma, urine, amniotic fluid, or peripheral leukocytes.

Use of a nucleic acid molecule comprising an annexin A2 (ANXA2) nucleotide sequence of at least 15 nucleotides comprising a point mutation G to T at a position corresponding to nucleotide 299 of SEQ ID NO: 1 for the determination of Von Willebrand Disease or increased risk of Von Willebrand disease and / or for predicting a reduced plasma level of Von Willebrand Factor.

10. Use of PCSK9 and / or LDL cholesterol to determine Von Willebrand disease or an increased risk of Von Willebrand disease and / or to predict a reduced plasma level of Von Willebrand Factor.

11. Use of a kit for determining Von Willebrand disease or an increased risk of Von Willebrand disease and / or for predicting a reduced plasma level of Von Willebrand Factor, the kit comprising means for determining the presence or absence, in a nucleic acid molecule comprising an Annexin A2 (ANXA2) nucleotide sequence of at least 15 nucleotides, from the point mutation G to T at a position corresponding to nucleotide 299 of SEQ ID NO: 1.

The use of claim 11, the kit comprising an oligonucleotide that selectively hybridizes to a nucleic acid molecule comprising an annexin A2 (ANXA2) nucleotide sequence of at least 15 nucleotides comprising a point mutation G to T at a position corresponding to nucleotide 299 of SEQ ID NO: 1 wherein said oligonucleotide does not selectively hybridize to a nucleic acid molecule comprising an annexin A2 (ANXA2) nucleotide sequence of at least 15 nucleotides comprising a G at a position corresponding to nucleotide 299 of SEQ ID NO: 1.

Use according to any of claims 11-12, the kit comprising a primer pair capable of amplifying a nucleic acid molecule comprising an annexin A2 (ANXA2) nucleotide sequence of at least 15 nucleotides comprising a point mutation G to T at a position corresponding with nucleotide 299 of SEQ ID NO: 1.

The use of claim 13, wherein a primer of the primer pair is designed to selectively select a nucleic acid molecule comprising an annexin A2 (ANXA2) nucleotide sequence of at least 15 nucleotides comprising a point mutation G to T at a position corresponding to nucleotide 299 of SEQ ID NO: 1 to hybridize and amplify.

Use of a kit for determining Von Willebrand disease or an increased risk of Von Willebrand disease and / or for predicting a lowered plasma level of Von Willebrand Factor, the kit comprising means for determining PCSK9 and / or LDL -cholesterol in a sample.